- Email: [email protected]
graphene paste modified carbon paste electrode
Bioelectrochemistry 130 (2019) 107322
Contents lists available at ScienceDirect
Bioelectrochemistry journal homepage: www.elsevier.com/locate/bioelechem
Electrochemical aptasensor for activated protein C using a gold nanoparticle – Chitosan/graphene paste modified carbon paste electrode Maryam Hosseini Ghalehno a,b, Mohammad Mirzaei a, Masoud Torkzadeh-Mahani c,⁎ a b c
Department of Chemistry, University of Shahid Bahonar Kerman, Kerman, Iran Young Research Society, Shahid Bahonar University of Kerman, Kerman, Iran Department of Biotechnology, Institute of Science, High Technology and Environmental Sciences, Graduate University of Advanced Technology, Kerman, Iran
a r t i c l e
i n f o
Article history: Received 18 September 2018 Received in revised form 21 June 2019 Accepted 21 June 2019 Available online 25 June 2019 Keywords: Activated protein C Sensor Aptasensor Electrochemical Gold nanoparticle – Chitosan nanocomposite
a b s t r a c t In this work, a selective and simple electrochemical aptasensor was developed for the detection of activated protein C by employing methylene blue (MB) as a redox indicator. An activated protein C aptamer (APC-apt) was covalently immobilized on the surface of a carbon paste electrode modified with gold nanoparticle – chitosan / graphene paste (AuNPs-Chi/Gr). The AuNPs-Chi/Gr paste increased electrochemical peak current and immobilized the aptamer on the electrode surface. The process of aptasensor construction and successful immobilization of the aptamer on the electrode surface was confirmed by electrochemical cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). Differential pulse voltammetry (DPV) was used to determine the methylene blue peak current. By replacing APC instead of MB at the electrode surface, the cathodic current of the MB decreases, and this decrease corresponds to the APC concentration. Under optimum conditions, the APC concentration was detected in the range from of 0.1 ng·mL−1 to 40 μg·mL−1 with a relatively low detection limit of 0.073 ng·mL−1. This method was then applied to the determination of APC in human serum samples. The results revealed that this strategy can be used to measure other proteins in biological samples. © 2019 Elsevier B.V. All rights reserved.
1. Introduction Activated protein C (APC) is a serine protease and the key enzyme of protein C (PC) [1,2]. APC plays cytoprotective, anti-inflammatory, and antiapoptotic roles for the protection of endothelial barrier function [2,3]. Moreover, the recombinant APC has been used as a prospective therapeutic intervention to treat sepsis [4–6]. Thus, the development of sensitive and selective detection platforms has become an urgent need for the recognition of APC and its monitoring by a fast, costeffective, and reliable approach. A variety of analytical methods have been developed in order to determine APC levels in different sample matrices including ELISA [7], fluorometry [8], surface plasmon resonance aptasensor [9], voltammetric aptasensor [10]. Although ELISA is the most well-known method for APC detection, the use of mono- and polyclonal antibodies in the production of related kits creates certain restrictions, mainly owing to the instability and high cost of these proteins [11–15]. In recent years, electrochemical biosensors have attracted much attention because of their high sensitivity, rapid response time, and good selectivity as well as their capacity for instrument miniaturization [16–20]. So far, various types of electrochemical biosensors using a broad range of nanomaterials such as carbon ⁎ Corresponding author. E-mail address: [email protected] (M. Torkzadeh-Mahani).
https://doi.org/10.1016/j.bioelechem.2019.06.007 1567-5394/© 2019 Elsevier B.V. All rights reserved.
nanotubes, silica nanowires, quantum dots (QDs), magnetic nanoparticles, and AuNPs have been employed to improve the sensitivity and stability of biosensors [21,22]. As an immobilizing matrix for biomolecules, gold nanoparticles (AuNPs) have remarkable features and properties such as a large surface area, favorable microenvironment for retaining the biological activity of biomolecules, and high electrical conductivity [23]. While the electrodes of most biosensors are constructed by simply dropping nanoparticles on the electrodes' surface, some of the active sites may be blocked by nanoparticles, thereby reducing the number of biomolecules that bind to nanoparticles [24,25]. Thus, there is an immediate need for an ordered array of nanoparticles and more active sites in the specific area of the electrode to perform a highly sensitive detection of the biomarker. Chitosan, an attractive natural biopolymer, containing reactive amino and hydroxyl functional groups, has been widely utilized as an immobilization matrix. Chitosan was usually combined with carbon nanotubes, redox mediators, and metal nanoparticles for electrochemical biosensing platforms. Therefore, a combination of AuNPs with the mentioned advantages and proper immobilizing capability of chitosan matrix may provide a synergistic augmentation of electrochemical performance [26–28]. Graphene (Gr) is a monolayer of sp2 hybridized carbon atoms packed into a dense honeycomb crystal structure [29], superior electronic conductivity [30,31], remarkable structural flexibility [32,33],
2
M. Hosseini Ghalehno et al. / Bioelectrochemistry 130 (2019) 107322
high specific surface area [34], and widespread potential applications [35] in nanoscience and nanotechnology. Aptamers are single strands of DNA or RNA molecules that bind to a specific target such as drugs, proteins, whole cells and ionic species by strong affinities and forming unique three dimensional structures by wrapping around the target [25,26]. In comparison to the anti-body system, several characteristic of aptamers make them fascinating as a recognition layer for construction and development of biosensors including low cost of preparation and ease of labeling for attachment to the surface by specific orientations, small size for micro and nano platform and stability for longer times. Consequently, there have been numerous aptamer-based biosensors (aptasensors) developed in combination with various analytical techniques [1,9,27]. In the present study, an APC electrochemical aptasensor was designed based on AuNPs-Chi/Gr paste-modified carbon paste electrode as the supporting interface and AuNPs-chitosan for the covalent attachment of aptamer and methylene blue (MB) as a redox indicator. Differential pulse voltammetry was utilized as the analytical method for APC measurement. The preparation process, characterization, stability, and reproducibility of the APC aptasensor were investigated. Furthermore, different experimental conditions for APC detection were optimized, and the applicability of the aptasensor to detect the APC in serum samples was evaluated and compared with the obtained results of ELISA method. The design concept of the sensing system is displayed in Scheme 1. 2. Experimental procedure 2.1. Chemicals and apparatus The 5′-thiol-linked single-stranded DNA Aptamer (DNA-Apt), which was specific for APC [36] was purchased from Bio Basik Inc. (Canada). The sequence of the selected aptamer for APC was as follows: 5′-SH-(CH2)6 CCTAACTGTACTCGACTTATCCCGGATGGGGCTCTT AGG-3′. Human activated protein C (APC) was purchased from Aldrich (St. Louis, MO, USA; www.sigmaaldrich.com). Human serum samples (three women, age 42–56) were obtained from University-Medical Hospital of Kerman Medical University (Kerman, Iran). HAuCl4, 1hexanethiol (1-HT), human serum albumin (HSA), myoglobin (Myb),
immunoglobulin G (IgG) and hemoglobin (Hb) were purchased from Aldrich (St. Louis, MO, USA; www. sigmaaldrich.com). Graphene, graphite, chitosan, methylene blue (Mb) and all the other commercially available substances were purchased from Merck (Darmstadt, Germany; www.merckchemicals.com) and used without further purification. All voltammograms were obtained using an EmStat DropSens potentiostat/galvanostat from Drop Instrument (Technological Park of Asturias, Spain; www.dropsens.com) interfaced with a personal computer for data acquisition and potential control. A three-electrode assembly was employed: a glass cell containing an Ag/AgCl reference electrode, a platinum wire counter electrode, and a carbon paste electrode (CPE) as the working electrode. A Metrohm 827 pH meter (Herisau, Switzerland; www.metrohm.com) supplied with a combination glass electrode was used for pH measurements. Scanning electron microscope (SEM) and energy dispersive X-ray (EDAX) were obtained from a FESEM model Sigma VP (ZEISS, Germany) equipped with EDS detector (Oxford Instruments, England). Transmission electron microscopy (TEM) images were obtained from a Hitachi H-800 microscope (Japan). The results of SEM, EDAX and TEM were obtained by the analytical lab services (Daypetronic company, Tehran, Iran, www.daypetronic. com).The cyclic voltammetry (CV) was performed in the presence of 1 mM K3 [Fe (CN) 6]/K4 [Fe (CN)] (1:1) as the redox couple in 0.1 M KCl. The differential pulse voltammetry (DPV) measurements were performed by scanning the potential from 0.1 to −0.5 V with the pulse amplitude of 50 mV and pulse width of 50 ms. A 2 μM stock solution of aptamer was prepared by deionized water and ethanol (1:1) and stored at −20 °C. Moreover, a 100 μg.mL−1 stock solution of APC was prepared by dissolving an appropriate amount of the APC in phosphate buffer (pH = 7); the solution was then stored at 4 °C.
2.2. Synthesis of gold nanoparticle- chitosan nanocomposite For the synthesis of the AuNPs-Chi nanocomposite, tetrachloro auric acid (1.0 mM, HAuCl4) and trisodium citrate aqueous solutions (1% w/ w) were first prepared. To 25 mL of HAuCl4 solution, 0.15 g of chitosan was added and the mixture was heated at 100 ͦ C with stirring. The prepared trisodium citrate solution (6 mL) was added to the boiling HAuCl4 solution and the mixture was boiled for 15 min. Afterwards, the
Scheme 1. Schematic diagram of the construction of aptasensor for the detection of activated protein C.
M. Hosseini Ghalehno et al. / Bioelectrochemistry 130 (2019) 107322
homogenous solution was left to cool at room temperature and then dried at 50° C for 24 h. Finally, the AuNPs-Chi nanocomposite was collected. 2.3. Preparation of the AuNPs-Chi /Gr/CPE electrode The AuNPs-Chi /Gr paste was prepared by direct mixing of AuNPschitosan nanocomposite, graphene nanosheet and graphite powder (9:1:90), followed by grounding in an agate mortar until a homogeneous paste obtained. The AuNPs-Chi /Gr modified CPE electrode was fabricated by rubbing some of this paste on the carbon paste (CPE) electrode surface to form a homogeneous layer. The effective surface areas of CPE and modified electrodes were obtained by cyclic voltammetry with 1 mM K3Fe (CN) 6 as a probe at different scan rates. For a reversible process, the following equation applies [37]: 1=2 Ip ¼ 0:4463 F3 =RT An3=2 D12 cν1=2 where Ip refers to the peak current and A is the electrode area (cm2). In this work, for 1 mM K3 Fe (CN) 6, T = 298 K (25 °C), n = 1, D = 7.6 × 10−6 cm2 s−1 (0.1 M KCl), c is the concentration of K3Fe (CN) 6, and υ is the scan rate. Thus, Ip = 2.687 × 105An3/2D1/2cν1/2. The surface areas of the bare CPE and AuNPs-Chi/Gr/CPE were calculated from the slope of the Ip versus ν1/2 plot to be 0.03 cm2 and 0.217 cm2, respectively. 2.4. Preparation of the aptasensor In order to fabricate the proposed aptasensor, the surface of the AuNPs-Chi/Gr/CPE electrode was modified with APC-Apt. For this propose, 10 μL of 2 μM aptamer solution was dropped on the modified electrode and then held upside down in a humid chamber for self-assembly overnight. After rinsing with buffer (0.1 M PBS, pH = 7.4), the modified electrode was immersed in 1 mM 1-HT solution for 1 h to block the nonspecific sites and arrange the aptamer strands in a straight orientation. After this, the 1-HT/APC-Apt/AuNPs-Chi/Gr/CPE was dipped into 2 mL phosphate buffer (0.10 M, pH 4.0) containing methylene blue solution (30 μM), and the solution was stirred at an open circuit system for 30 min (accumulation step). The electrode was washed successively with a PBS solution (0.1 M, pH = 7.4) after each step. 2.5. Electrochemical measurement The blank current (I0) was obtained by immersing the 1-HT/APCApt/AuNPs-Chi/Gr/CPE electrode into 2.0 mL phosphate buffer containing 30 μL MB (1 mM), and the solution was stirred at an open circuit system for 20 min. The electrode was then rinsed with distilled water and placed in 10 mL of 0.20 M phosphate buffer solution (pH = 7.00). The electrochemical responses of the accumulated MB were recorded by scanning the potential range from −0.5 V to 0.0 V using the differential pulse voltammetry (stripping step). Then, 10 μL of different concentrations of APC solution was placed on the working electrode for 30 min. After rinsing the electrode with buffer (0.1 M PBS, pH = 7.4), current (I) was recorded by DPV. By replacing MB with APC at the electrode surface, the current decrease, ΔI (=I0 – I, where I0 and I denote the peak currents before and after APC recognition, respectively), which was proportional to the APC concentration, was used for the determination of APC. The design concept of the assay system is displayed in Scheme 1. 3. Results and discussion In this study, AuNPs-Chi nanocomposite was applied as a support material with Gr as signal amplification molecules for modifying the surface of the CPE electrode. The AuNPs-Chi/Gr paste increased
3
electrochemical peak current and immobilized the aptamer on the electrode surface. Modification of the electrode surface with the AuNPs-Chi/ Gr paste was not only fast and comfortable but also had a good repeatability for immobilization the aptamer on the electrode surface. Chitosan with abundant amino groups has many action sites with AuNPs, and could be a suitable supporting interface for AuNPs. Combination of AuNPs with the specific ability of chitosan as the supporting interface provided a remarkable synergistic augmentation of electrochemical performance. 3.1. Electrode surface and nanocomposite characterization The FESEM was employed to characterize the surface morphology of CPE, and AuNPs - Chi/ Gr/CPE. Fig. 1a, illustrates the characteristic morphology of the bare carbon paste electrode, while Fig. 1b, shows that AuNPs - Chi/Gr paste has been homogeneously modified on CPE surface. As a result, the SEM image exhibits presence of the nanoparticle on the polymeric network of the chitosan. The elemental analysis of the modified electrode was obtained using EDAX analysis (Fig. 2c). This analysis shows that only carbon, oxygen, gold and nitrogen elements were presented at the surface of AuNPsChi/Gr/CPE. The morphology of AuNPs-Chi was characterized by TEM. As can be seen in Fig. 2, gold nanoparticle has a spherical morphology, and also the TEM image indicates the synthesis gold nanoparticles did not assemble into clusters. Furthermore, TEM image shows the AuNPs was accumulated on the surface of chitosan as a supporting interface. The results obtained from TEM were consistent with the SEM data that confirmed the success formation of the nanostructures. 3.2. Principle of the electrochemical detection of APC The stepwise procedure of aptasensor development is illustrated in Scheme 1. In a typical experiment, the surface of the carbon paste electrode was modified for the amplification of signal (a) and, after APC-apt self-assembled on the modified CPE electrode (b), free sites were blocked with blocking agent solution (c), followed by the reaction with methylene blue (d), reaction with the APC (e), and finally recording DPV measurements. The modification of the aptasensor blocks the electron transfer between the solution species and the electrode to a certain extent, which can be easily characterized by CV and EIS using K3 [Fe (CN) 6]/ K4 [Fe (CN) 6] as a probe. The redox-label K3 [Fe (CN) 6]/K4 [Fe (CN) 6] revealed a reversible CV at the bare CPE with an ΔEP of 0.108 V (Fig. 3, Curve a). After the pretreated CPE was modified with the AuNPs-Chi/Gr paste, the shape of the CV changed with the ΔEP of 0.152 V. Although ΔEP was as much as that of the bare CPE, the peak current (Ia = 113.0 μA) markedly surpassed that of the bare CPE (Ia = 52.0 μA) (Fig. 3, Curve b). The increase in the peak current suggests that the introduction of the AuNPs-Chi/Gr paste played a role in increasing the electroactive surface area. After the immobilization of the aptamer on the AuNPs-Chi/Gr paste-modified surface and 1-hexanethiol, peak currents significantly decreased (Fig. 3, Curves c and d), indicating that the aptamer and 1-hexanethiol reduced the effective area for electron transfer. Electrochemical impedance spectroscopy is a powerful technique for studying the interface properties of electrode surfaces. Fig. 4 illustrates the impedance spectra in the form of Nyquist plots of the interfaces recorded after each modification step. Due to the good electronic transferability, the AuNPs-Chi/Gr paste-modified CPE (Curve b) displayed an almost straight line in the Nyquist plot, exhibiting a lower Ret than the bare CPE (Curve a). It was clear that the diameter of the semicircles successively increased with the sequential assembly of the aptamer probe (Curve c) and 1-HT as a blocking agent for blocking the nonspecific sites on the electrode (Curve d), indicating a step-by-step
4
M. Hosseini Ghalehno et al. / Bioelectrochemistry 130 (2019) 107322
Fig. 1. SEM Images from surface of (a) bare CPE (b) AuNPs - Chi/ Gr/CPE, (c) EDAX patterns of the elemental composition of the AuNPs - Chi/ Gr/CPE.
Fig. 2. TEM images of AuNPs-Chi morphology. The AuNPs was dispersed in chitosan solution without aggregation.
M. Hosseini Ghalehno et al. / Bioelectrochemistry 130 (2019) 107322
Fig. 3. Cyclic voltammetry responses of the modified electrode for each steps; (a) CPE, (b) AuNPs-Chi/ Gr /CPE, (c) APC-apt/ AuNPs-Chi/ Gr/CPE, (d) 1-HT /APC-apt/ AuNPsChi/ Gr/CPE, in 1 mM K3 Fe(CN)6 and 1 mM K4 Fe(CN)6 and 0.1 M KCl.
enhancement in Ret. These results were well consistent with the phenomena in CVs, confirming the successful preparation.
3.3. Optimization of detection conditions In order to provide an aptasensor with an acceptable performance, different parameters such as the effect of accumulation pH between MB and aptamer, incubation time between MB and aptamer, the concentration of accumulation MB on the aptamer, and incubation time between aptamer and APC should be optimized. Since the redox response of MB is pH-dependent, the aptasensor response in the 0.1 M phosphate buffer solutions with different pH values was investigated by recording DPV. As shown in Fig. S1a, the peak currents increase with increasing the pH value from 2 to 4, then start to decrease at pH N 4. Therefore, pH equal to 4 was chosen as the optimum value for MB. In another experiment, the effect of accumulation MB concentration on the aptasensor response was examined using the DPV method. Based on Fig. S1b, with increasing the MB concentration, the aptasensor response increased from 5.0 to 30.0 μM. When MB concentration was N30 μM, the reduction peak current trended to a constant value. Therefore, the optimal MB concentration was 30 μM. For the optimization of incubation time between MB and the aptamer, the aptasensor response in different incubation times was also examined. Based on Fig. S1c the aptasensor response increased rapidly with increasing the incubation time from 10 to 60 min, then reached
Fig. 4. EIS responses of the modified electrode for each steps; (a), CPE (b), AuNPs-Chi/ Gr / CPE (c), APC-apt/ AuNPs-Chi/ Gr/CPE and(d), 1-HT /APC-apt/ AuNPs-Chi/ Gr/CPE, in the solution containing 1 mM K3Fe(CN)6/ K4Fe(CN)6 as a electrolyte solution.
5
Fig. 5. (a) DPV responses for the developed aptasensor at different APC concentration, from 0.0, 0.1, 0.3, 0.5, 3.0, 10.0, 1.0 × 102, 1.0 × 103, and 40.0 × 103 ng·mL−1 and (b) shows the linear relationship between the anodic peak current (I) by DPV and the APC concentrations over the range from 0.1 ng·mL−1–40.0 μg·mL−1. The linear regression equation obtained ΔI (μA) = 2.31 Log [APC] (μg·mL−1) + 16.02.
equilibrium after 30 min. Thus, 30 min was obtained as the optimum incubation time between MB and the aptamer. The incubation time between the aptamer and APC was another important factor to affect the sensitivity of the assay. To this end, the MB/1HT/APC-apt/AuNPs-Chi/Gr/CPE aptasensor was incubated for various times (10–40 min) in the presence of APC. As illustrated in Fig. S1d, the aptasensor response increased with increasing the incubation time between 10 and 20 min and then reached level-off after 20 min. Therefore, 20 min was sufficient incubation time for measuring APC in the proposed assay. The effect of stripping pH on the APC aptasensor response was explored in different types of buffers (Tris-HCl buffer, phosphate buffer, and Britton–Robinson buffer) with different concentrations of buffer (0.05–0.4 M) and pH values ranging from 2.00 to 9.00. This result indicates that using the phosphate buffer solution at pH = 7.0 and 0.2 M concentration, ΔIpa was maximum (Fig. S2a, b, c). Therefore, in subsequent experiments, the stripping was performed in the 0.2 M phosphate buffer with pH = 7.0.
3.4. Performance of the aptasensor 3.4.1. Electrochemical detection of APC The sensitivity and dynamic range of the electrochemical aptasensor were first assessed using MB as a redox indicator in an aptasensor under optimal conditions. Fig. 5 demonstrates the typical DPV curves obtained in response to varying APC concentrations. The DPV peak currents increased with the increase of the APC concentration. As shown in Fig. 5b, the increase of DPV peak currents was linear in the range of 0. 1 ng·mL−1 to 40.0 μg·mL−1 and the linear regression equation was
Fig. 6. Specificity of the aptasensor to 10 μg·mL−1 APC by comparing it to the interfering agents, including Human serum albumin (HSA), tumor necrosis factor α (TNF-α), myoglobin (Myb), immunoglobulin G (IgG) and hemoglobin (Hb). Error bars show the standard deviations of measurements taken from three independent experiments.
6
M. Hosseini Ghalehno et al. / Bioelectrochemistry 130 (2019) 107322
Table 1 APC concentration [ng·mL−1] obtained from three repeated analyses by proposed biosensor and ELISA kit for three samples of human serum. Samples
Aptasensor (ng·mL−1)
ELISA (ng·mL-1)
t calculated
t(0.05,2) tabulated
1 2 3
12.5 ± 1.5 18.6 ± 0.3 8.7 ± 0.8
11.6 ± 0.8 18.2 ± 0.1 9.1 ± 0.4
0.9 2 0.8
4.3 4.3 4.3
3.4.5. Comparison with other methods Table 2 compares some response characteristics of the proposed aptasensor with some of the analytical characteristics of the previously reported APC voltammetric sensors. As one can see, our proposed aptasensor not only shows a reasonably low LOD (0.073 ng·mL−1) and wider linear range comparable or superior to the other methods, but also is simple, relatively fast, and flexible. 4. Conclusion
adjusted to ΔI (μA) = 2.31 Log [APC] (μg·mL−1) + 16.02 with a detection limit (LOD) of 0.073 ng·mL−1. 3.4.2. Stability, reproducibility and regeneration of the aptasensor The stability of the aptasensor in a 14-day period was examined. After keeping it in the refrigerator (4° C) for two weeks, the aptasensor was employed to detect the same APC concentration (10 μg·mL−1), and approximately 96.4% of the initial anodic current was retained. These results reveal that the aptasensor has an acceptable stability. The reproducibility of the aptasensor was evaluated by analyzing 10 μg·mL−1 of APC with five aptasensors prepared independently. The relative standard deviation was 5.08%. Furthermore, the precision of the aptasensor was assessed by assaying 10 μg·mL−1 of APC 6 times. The observed CVs was 3.25%. These results demonstrate the acceptable reproducibility and precision of the proposed aptasensor. The regeneration of the aptasensor (to 2 times) was estimated by urea solution (3 M) is enough for Half hour [38], and the regenerated interface can be re-used. As shown as in Fig. S.3. the result of first and second detection is almost the same as the first detection of APC. 3.4.3. The specificity of the aptasensor The specificity of the aptasensor plays an important role in analyzing complex samples. To demonstrate the specificity of the electrochemical aptasensor, samples containing different types of proteins were used as controls. As shown in Fig. 6, compared with the target, the changes in peak current are negligible in the presence of 10 μg·mL−1 of other proteins (human serum albumin (HSA), tumor necrosis factor α (TNF-α), myoglobin (Myb), immunoglobulin G (IgG) and hemoglobin (Hb)). Therefore, the method is highly specific for APC, which can be attributed to the high-specificity interaction between aptamer and APC. 3.4.4. Application of the aptasensor to detect APC in human serum In order to evaluate the feasibility, this aptasensor was used to detect of APC in the three samples of human serum (obtained from UniversityMedical Hospital of Kerman Medical University, three female, age 42–56) and compared with ELISA kit (Table 1). The biological samples were prepared (based on acetone precipitation method) according to the literature [39]. After the treatment, these samples were analyzed by this electrochemical aptasensor. Statistical comparison of the experimental results from this proposed sensor with those from ELISA was performed using a t-test. Student's t-test (P = .05) showed that there was no significant difference between the results obtained by the two methods. Therefore, the electrochemical aptasensor had a satisfactory accuracy to detect APC in real samples (Table 1).
Table 2 Comparison of the presented method with some methods currently reported for the determination of APC. Electrochemical methods
LOD (μg·mL−1)
Linear range(μg·mL−1)
Ref
Aptasensor Aptasensor Aptasensor This work
1.50 2.03 0.2 0.73 × 10−5
2.50–7.50 0.01–15.0 1.0–2.50 1.0 × 10−4 −4.0 × 101
[40] [6] [41] –
The sensitive and specific biosensor are based on AuNPs-Chi/Gr paste and aptamer probes for APC detection was established. The AuNPs-Chi/Gr paste provided a high electron transferability, good surface area, and numerous binding sites for the assembly of the thiolderived aptamer. The detection was performed by employing the MB as the signal label. This designed aptasensor displayed an extremely low LOD, a wide detection range, good selectivity, acceptable reproducibility, and stability, and can be used for detection in human serum samples. The aptasensor proposed here will not only expand the application of the new nanocomposite but also provide an attractive way to detect other targets in clinical settings as well as environmental and food safety monitoring applications. Acknowledgment The authors wish to thank the Shahid Bahonar University of Kerman and Graduate University of Advanced Technology of Kerman. Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi. org/10.1016/j.bioelechem.2019.06.007. References [1] C.T. Esmon, The protein C pathway, Chest 124 (2003) 26S–32S, https://doi.org/10. 1378/chest.124.3_suppl.26S. [2] J. Griffin, J. Fernandez, A. Gale, L. Mosnier, Activated protein C, J. Thromb. Haemost. 5 (2007) 73–80, https://doi.org/10.1111/j.1538-7836.2007.02491.x. [3] R.A. Davenport, M. Guerreiro, D. Frith, C. Rourke, S. Platton, M. Cohen, R. Pearse, C. Thiemermann, K. Brohi, Activated protein C drives the hyperfibrinolysis of acute traumatic coagulopathy, ASA 126 (2017) 115–127, https://doi.org/10.1097/ALN. 0000000000001428. [4] F. Sadaka, J. O'Brien, M. Migneron, J. Stortz, A. Vanston, R.W. Taylor, Activated protein C in septic shock: a propensity-matched analysis, Crit. Care 15 (2011) R89, https://doi.org/10.1186/cc10089. [5] N. Alshaikh, J. Rosing, M. Thomassen, E. Castoldi, P. Simioni, T. Hackeng, New functional assays to selectively quantify the activated protein C-and tissue factor pathway inhibitor-cofactor activities of protein S in plasma, JTH 15 (2017) 950–960, https://doi.org/10.1111/jth.13657. [6] A. Erdem, G. Congur, Dendrimer enriched single-use aptasensor for impedimetric detection of activated protein C, Colloids Surf B Biointerfaces 117 (2014) 338–345, https://doi.org/10.1016/j.colsurfb.2014.03.003. [7] J.A. Fernández, S.R. Lentz, D.M. Dwyre, J.H. Griffin, A novel ELISA for mouse activated protein C in plasma, J. Immunol. Methods 314 (2006) 174–181, https://doi.org/10. 1016/j.jim.2006.05.004. [8] Q. Zhao, J. Gao, Fluorogenic assays for activated protein C using aptamer modified magnetic beads, Microchim. Acta 180 (2013) 813–819, https://doi.org/10.1007/ s00604-013-1004-9. [9] S. Koyun, S. Akgönüllü, H. Yavuz, A. Erdem, A. Denizli, Surface plasmon resonance aptasensor for detection of human activated protein C, Talanta 194 (2019) 528–533, https://doi.org/10.1016/j.talanta.2018.10.007. [10] A. Erdem, G. Congur, E. Eksin, Voltammetric Aptasensor Based on Magnetic Beads Assay for Detection of Human Activated Protein C, Nucleic Acid Aptamers, Springer, 2016 163–170, https://doi.org/10.1007/978-1-4939-3197-2. [11] Y. Liu, Q. Zhou, A. Revzin, An aptasensor for electrochemical detection of tumor necrosis factor in human blood, Anal 138 (2013) 4321–4326, https://doi.org/10.1039/ C3AN00818E. [12] T. Li, Z. Si, L. Hu, H. Qi, M. Yang, Prussian blue-functionalized ceria nanoparticles as label for ultrasensitive detection of tumor necrosis factor-α, Sens Actuators B Chem 171 (2012) 1060–1065, https://doi.org/10.1016/j.snb.2012.06.034. [13] L. Yuan, X. Hua, Y. Wu, X. Pan, S. Liu, Polymer-functionalized silica nanosphere labels for ultrasensitive detection of tumor necrosis factor-alpha, Anal. Chem. 83 (2011) 6800–6809, https://doi.org/10.1021/ac201558w.
M. Hosseini Ghalehno et al. / Bioelectrochemistry 130 (2019) 107322 [14] L. Yuan, W. Wei, S. Liu, Label-free electrochemical immunosensors based on surfaceinitiated atom radical polymerization, Biosens. Bioelectron. 38 (2012) 79–85, https://doi.org/10.1016/j.bios.2012.05.007. [15] Z. Yin, Y. Liu, L.-P. Jiang, J.-J. Zhu, Electrochemical immunosensor of tumor necrosis factor α based on alkaline phosphatase functionalized nanospheres, Biosens. Bioelectron. 26 (2011) 1890–1894, https://doi.org/10.1016/j.bios.2010.03.025. [16] Y. Ding, Q. Wang, F. Gao, F. Gao, Highly sensitive and selective DNA biosensor using a dumbbell-shaped bis-groove binder of bi-acetylferrocene ethylenediamine complex as electrochemical indicator, Electrochim. Acta 106 (2013) 35–42, https://doi.org/ 10.1016/j.electacta.2013.05.066. [17] K.-J. Huang, Y.-J. Liu, H.-B. Wang, Y.-Y. Wang, A sensitive electrochemical DNA biosensor based on silver nanoparticles-polydopamine@ graphene composite, Electrochim. Acta 118 (2014) 130–137, https://doi.org/10.1016/j.electacta.2013.12. 019. [18] M.H. Ghalehno, M. Mirzaei, M. Torkzadeh-Mahani, Aptamer-based determination of tumor necrosis factor α using a screen-printed graphite electrode modified with gold hexacyanoferrate, Microchim. Acta 185 (2018), 165. https://doi.org/10.1007/ s00604-018-2704-y. [19] L.-H. Pan, S.-H. Kuo, T.-Y. Lin, C.-W. Lin, P.-Y. Fang, H.-W. Yang, An electrochemical biosensor to simultaneously detect VEGF and PSA for early prostate cancer diagnosis based on graphene oxide/ss DNA/PLLA nanoparticles, Biosens. Bioelectron. 89 (2017) 598–605, https://doi.org/10.1016/j.bios.2016.01.077. [20] M.H. Ghalehno, M. Mirzaei, M. Torkzadeh-Mahani, Electrochemical aptasensor for tumor necrosis factor α using aptamer–antibody sandwich structure and cobalt hexacyanoferrate for signal amplification, JICS (2019) 1–9, https://doi.org/10. 1007/s13738-019-01650-1. [21] B. Li, F. Liu, Y. Peng, Y. Zhou, W. Fan, H. Yin, S. Ai, X. Zhang, Two-stage cyclic enzymatic amplification method for ultrasensitive electrochemical assay of microRNA21 in the blood serum of gastric cancer patients, Biosens. Bioelectron. 79 (2016) 307–312, https://doi.org/10.1016/j.bios.2015.12.051. [22] T. Hu, L. Zhang, W. Wen, X. Zhang, S. Wang, Enzyme catalytic amplification of miRNA-155 detection with graphene quantum dot-based electrochemical biosensor, Biosens. Bioelectron. 77 (2016) 451–456, https://doi.org/10.1016/j.bios.2015. 09.068. [23] J.M. Pingarrón, P. Yáñez-Sedeño, A. González-Cortés, Gold nanoparticle-based electrochemical biosensors, Electrochim. Acta 53 (2008) 5848–5866, https://doi.org/ 10.1016/j.electacta.2008.03.005. [24] X. Ye, C. Zhu, P. Ercius, S.N. Raja, B. He, M.R. Jones, M.R. Hauwiller, Y. Liu, T. Xu, A.P. Alivisatos, Structural diversity in binary superlattices self-assembled from polymergrafted nanocrystals, Nat. Commun. 6 (2015), 10052. https://doi.org/10.1038/ ncomms10052. [25] D. Pan, Y. Gu, H. Lan, Y. Sun, H. Gao, Functional graphene-gold nano-composite fabricated electrochemical biosensor for direct and rapid detection of bisphenol A, Anal. Chim. Acta 853 (2015) 297–302, https://doi.org/10.1016/j.aca.2014.11.004. [26] S. Dehdashtian, M.B. Gholivand, M. Shamsipur, Construction of a sensitive and selective sensor for morphine using chitosan coated Fe3O4 magnetic nanoparticle as a modifier, Mater. Sci. Eng. C. 58 (2016) 53–59, https://doi.org/10.1016/j.msec.2015. 07.049.
7
[27] M. Figiela, M. Wysokowski, M. Galinski, T. Jesionowski, I. Stepniak, Synthesis and characterization of novel copper oxide-chitosan nanocomposites for nonenzymatic glucose sensing, Sens Actuators B Chem 272 (2018) 296–307, https:// doi.org/10.1016/j.snb.2018.05.173. [28] G. Sargazi, D. Afzali, A. Mostafavi, S.Y. Ebrahimipour, Synthesis of CS/PVA biodegradable composite nanofibers as a microporous material with well controllable procedure through electrospinning, J. Polym. Environ. 26 (2018) 1804–1817, https:// doi.org/10.1007/s10924-017-1080-8. [29] A.A. Balandin, S. Ghosh, W. Bao, I. Calizo, D. Teweldebrhan, F. Miao, C.N. Lau, Superior thermal conductivity of single-layer graphene, Nano Lett. 8 (2008) 902–907, https://doi.org/10.1021/nl0731872. [30] K.S. Novoselov, Z. Jiang, Y. Zhang, S. Morozov, H.L. Stormer, U. Zeitler, J. Maan, G. Boebinger, P. Kim, A.K. Geim, Room-temperature quantum hall effect in graphene, Sci 315 (2007) 1379, https://doi.org/10.1126/science.1137201. [31] G. Sargazi, D. Afzali, A. Mostafavi, A novel synthesis of a new thorium (IV) metal organic framework nanostructure with well controllable procedure through ultrasound assisted reverse micelle method, Ultrason. Sonochem. 41 (2018) 234–251, https://doi.org/10.1016/j.ultsonch.2017.09.046. [32] D.A. Dikin, S. Stankovich, E.J. Zimney, R.D. Piner, G.H. Dommett, G. Evmenenko, S.T. Nguyen, R.S. Ruoff, Preparation and characterization of graphene oxide paper, Nat 448 (2007) 457–460, https://doi.org/10.1038/nature06016. [33] C. Lee, X. Wei, J.W. Kysar, J. Hone, Measurement of the elastic properties and intrinsic strength of monolayer graphene, Sci 321 (2008) 385–388, https://doi.org/10. 1126/science.1157996. [34] A. Peigney, C. Laurent, E. Flahaut, R. Bacsa, A. Rousset, Specific surface area of carbon nanotubes and bundles of carbon nanotubes, Carbon 39 (2001) 507–514, https:// doi.org/10.1016/S0008-6223(00)00155-X. [35] C. Rao, K. Biswas, K. Subrahmanyam, A. Govindaraj, Graphene, the new nanocarbon, J. Mater. Chem. 19 (2009) 2457–2469, https://doi.org/10.1039/B815239J. [36] J. Müller, B. Isermann, C. Dücker, M. Salehi, M. Meyer, M. Friedrich, T. Madhusudhan, J. Oldenburg, G. Mayer, B. Pötzsch, An exosite-specific ssDNA aptamer inhibits the anticoagulant functions of activated protein C and enhances inhibition by protein C inhibitor, Chem. Biol. 16 (2009) 442–451. [37] A.J. Bard, L.R. Faulkner, J. Leddy, C.G. Zoski, Electrochemical Methods: Fundamentals and Applications, Wiley, New York, 1980. [38] J. Saeed, M. Mirzaei, M. Torkzadeh-Mahani, A selective and regenerable voltammetric aptasensor for determination of homocysteine, Microchim. Acta 183 (2016) 2205–2210, https://doi.org/10.1007/s00604-016-1852-1. [39] L. Jiang, L. He, M. Fountoulakis, Comparison of protein precipitation methods for sample preparation prior to proteomic analysis, J. Chromatogr. A 1023 (2004) 317–320, https://doi.org/10.1016/j.chroma.2003.10.029. [40] A. Erdem, G. Congur, F. Mese, Electrochemical detection of activated protein C using an aptasensor based on PAMAM dendrimer modified pencil graphite electrodes, Electroanalysis 26 (2014) 2580–2590, https://doi.org/10.1002/elan.201400354. [41] A. Erdem, G. Congur, Dendrimer modified 8-channel screen-printed electrochemical array system for impedimetric detection of activated protein C, Sensors Actuators B Chem. 196 (2014) 168–174, https://doi.org/10.1016/j.snb.2014.01.103.
Contents lists available at ScienceDirect
Bioelectrochemistry journal homepage: www.elsevier.com/locate/bioelechem
Electrochemical aptasensor for activated protein C using a gold nanoparticle – Chitosan/graphene paste modified carbon paste electrode Maryam Hosseini Ghalehno a,b, Mohammad Mirzaei a, Masoud Torkzadeh-Mahani c,⁎ a b c
Department of Chemistry, University of Shahid Bahonar Kerman, Kerman, Iran Young Research Society, Shahid Bahonar University of Kerman, Kerman, Iran Department of Biotechnology, Institute of Science, High Technology and Environmental Sciences, Graduate University of Advanced Technology, Kerman, Iran
a r t i c l e
i n f o
Article history: Received 18 September 2018 Received in revised form 21 June 2019 Accepted 21 June 2019 Available online 25 June 2019 Keywords: Activated protein C Sensor Aptasensor Electrochemical Gold nanoparticle – Chitosan nanocomposite
a b s t r a c t In this work, a selective and simple electrochemical aptasensor was developed for the detection of activated protein C by employing methylene blue (MB) as a redox indicator. An activated protein C aptamer (APC-apt) was covalently immobilized on the surface of a carbon paste electrode modified with gold nanoparticle – chitosan / graphene paste (AuNPs-Chi/Gr). The AuNPs-Chi/Gr paste increased electrochemical peak current and immobilized the aptamer on the electrode surface. The process of aptasensor construction and successful immobilization of the aptamer on the electrode surface was confirmed by electrochemical cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). Differential pulse voltammetry (DPV) was used to determine the methylene blue peak current. By replacing APC instead of MB at the electrode surface, the cathodic current of the MB decreases, and this decrease corresponds to the APC concentration. Under optimum conditions, the APC concentration was detected in the range from of 0.1 ng·mL−1 to 40 μg·mL−1 with a relatively low detection limit of 0.073 ng·mL−1. This method was then applied to the determination of APC in human serum samples. The results revealed that this strategy can be used to measure other proteins in biological samples. © 2019 Elsevier B.V. All rights reserved.
1. Introduction Activated protein C (APC) is a serine protease and the key enzyme of protein C (PC) [1,2]. APC plays cytoprotective, anti-inflammatory, and antiapoptotic roles for the protection of endothelial barrier function [2,3]. Moreover, the recombinant APC has been used as a prospective therapeutic intervention to treat sepsis [4–6]. Thus, the development of sensitive and selective detection platforms has become an urgent need for the recognition of APC and its monitoring by a fast, costeffective, and reliable approach. A variety of analytical methods have been developed in order to determine APC levels in different sample matrices including ELISA [7], fluorometry [8], surface plasmon resonance aptasensor [9], voltammetric aptasensor [10]. Although ELISA is the most well-known method for APC detection, the use of mono- and polyclonal antibodies in the production of related kits creates certain restrictions, mainly owing to the instability and high cost of these proteins [11–15]. In recent years, electrochemical biosensors have attracted much attention because of their high sensitivity, rapid response time, and good selectivity as well as their capacity for instrument miniaturization [16–20]. So far, various types of electrochemical biosensors using a broad range of nanomaterials such as carbon ⁎ Corresponding author. E-mail address: [email protected] (M. Torkzadeh-Mahani).
https://doi.org/10.1016/j.bioelechem.2019.06.007 1567-5394/© 2019 Elsevier B.V. All rights reserved.
nanotubes, silica nanowires, quantum dots (QDs), magnetic nanoparticles, and AuNPs have been employed to improve the sensitivity and stability of biosensors [21,22]. As an immobilizing matrix for biomolecules, gold nanoparticles (AuNPs) have remarkable features and properties such as a large surface area, favorable microenvironment for retaining the biological activity of biomolecules, and high electrical conductivity [23]. While the electrodes of most biosensors are constructed by simply dropping nanoparticles on the electrodes' surface, some of the active sites may be blocked by nanoparticles, thereby reducing the number of biomolecules that bind to nanoparticles [24,25]. Thus, there is an immediate need for an ordered array of nanoparticles and more active sites in the specific area of the electrode to perform a highly sensitive detection of the biomarker. Chitosan, an attractive natural biopolymer, containing reactive amino and hydroxyl functional groups, has been widely utilized as an immobilization matrix. Chitosan was usually combined with carbon nanotubes, redox mediators, and metal nanoparticles for electrochemical biosensing platforms. Therefore, a combination of AuNPs with the mentioned advantages and proper immobilizing capability of chitosan matrix may provide a synergistic augmentation of electrochemical performance [26–28]. Graphene (Gr) is a monolayer of sp2 hybridized carbon atoms packed into a dense honeycomb crystal structure [29], superior electronic conductivity [30,31], remarkable structural flexibility [32,33],
2
M. Hosseini Ghalehno et al. / Bioelectrochemistry 130 (2019) 107322
high specific surface area [34], and widespread potential applications [35] in nanoscience and nanotechnology. Aptamers are single strands of DNA or RNA molecules that bind to a specific target such as drugs, proteins, whole cells and ionic species by strong affinities and forming unique three dimensional structures by wrapping around the target [25,26]. In comparison to the anti-body system, several characteristic of aptamers make them fascinating as a recognition layer for construction and development of biosensors including low cost of preparation and ease of labeling for attachment to the surface by specific orientations, small size for micro and nano platform and stability for longer times. Consequently, there have been numerous aptamer-based biosensors (aptasensors) developed in combination with various analytical techniques [1,9,27]. In the present study, an APC electrochemical aptasensor was designed based on AuNPs-Chi/Gr paste-modified carbon paste electrode as the supporting interface and AuNPs-chitosan for the covalent attachment of aptamer and methylene blue (MB) as a redox indicator. Differential pulse voltammetry was utilized as the analytical method for APC measurement. The preparation process, characterization, stability, and reproducibility of the APC aptasensor were investigated. Furthermore, different experimental conditions for APC detection were optimized, and the applicability of the aptasensor to detect the APC in serum samples was evaluated and compared with the obtained results of ELISA method. The design concept of the sensing system is displayed in Scheme 1. 2. Experimental procedure 2.1. Chemicals and apparatus The 5′-thiol-linked single-stranded DNA Aptamer (DNA-Apt), which was specific for APC [36] was purchased from Bio Basik Inc. (Canada). The sequence of the selected aptamer for APC was as follows: 5′-SH-(CH2)6 CCTAACTGTACTCGACTTATCCCGGATGGGGCTCTT AGG-3′. Human activated protein C (APC) was purchased from Aldrich (St. Louis, MO, USA; www.sigmaaldrich.com). Human serum samples (three women, age 42–56) were obtained from University-Medical Hospital of Kerman Medical University (Kerman, Iran). HAuCl4, 1hexanethiol (1-HT), human serum albumin (HSA), myoglobin (Myb),
immunoglobulin G (IgG) and hemoglobin (Hb) were purchased from Aldrich (St. Louis, MO, USA; www. sigmaaldrich.com). Graphene, graphite, chitosan, methylene blue (Mb) and all the other commercially available substances were purchased from Merck (Darmstadt, Germany; www.merckchemicals.com) and used without further purification. All voltammograms were obtained using an EmStat DropSens potentiostat/galvanostat from Drop Instrument (Technological Park of Asturias, Spain; www.dropsens.com) interfaced with a personal computer for data acquisition and potential control. A three-electrode assembly was employed: a glass cell containing an Ag/AgCl reference electrode, a platinum wire counter electrode, and a carbon paste electrode (CPE) as the working electrode. A Metrohm 827 pH meter (Herisau, Switzerland; www.metrohm.com) supplied with a combination glass electrode was used for pH measurements. Scanning electron microscope (SEM) and energy dispersive X-ray (EDAX) were obtained from a FESEM model Sigma VP (ZEISS, Germany) equipped with EDS detector (Oxford Instruments, England). Transmission electron microscopy (TEM) images were obtained from a Hitachi H-800 microscope (Japan). The results of SEM, EDAX and TEM were obtained by the analytical lab services (Daypetronic company, Tehran, Iran, www.daypetronic. com).The cyclic voltammetry (CV) was performed in the presence of 1 mM K3 [Fe (CN) 6]/K4 [Fe (CN)] (1:1) as the redox couple in 0.1 M KCl. The differential pulse voltammetry (DPV) measurements were performed by scanning the potential from 0.1 to −0.5 V with the pulse amplitude of 50 mV and pulse width of 50 ms. A 2 μM stock solution of aptamer was prepared by deionized water and ethanol (1:1) and stored at −20 °C. Moreover, a 100 μg.mL−1 stock solution of APC was prepared by dissolving an appropriate amount of the APC in phosphate buffer (pH = 7); the solution was then stored at 4 °C.
2.2. Synthesis of gold nanoparticle- chitosan nanocomposite For the synthesis of the AuNPs-Chi nanocomposite, tetrachloro auric acid (1.0 mM, HAuCl4) and trisodium citrate aqueous solutions (1% w/ w) were first prepared. To 25 mL of HAuCl4 solution, 0.15 g of chitosan was added and the mixture was heated at 100 ͦ C with stirring. The prepared trisodium citrate solution (6 mL) was added to the boiling HAuCl4 solution and the mixture was boiled for 15 min. Afterwards, the
Scheme 1. Schematic diagram of the construction of aptasensor for the detection of activated protein C.
M. Hosseini Ghalehno et al. / Bioelectrochemistry 130 (2019) 107322
homogenous solution was left to cool at room temperature and then dried at 50° C for 24 h. Finally, the AuNPs-Chi nanocomposite was collected. 2.3. Preparation of the AuNPs-Chi /Gr/CPE electrode The AuNPs-Chi /Gr paste was prepared by direct mixing of AuNPschitosan nanocomposite, graphene nanosheet and graphite powder (9:1:90), followed by grounding in an agate mortar until a homogeneous paste obtained. The AuNPs-Chi /Gr modified CPE electrode was fabricated by rubbing some of this paste on the carbon paste (CPE) electrode surface to form a homogeneous layer. The effective surface areas of CPE and modified electrodes were obtained by cyclic voltammetry with 1 mM K3Fe (CN) 6 as a probe at different scan rates. For a reversible process, the following equation applies [37]: 1=2 Ip ¼ 0:4463 F3 =RT An3=2 D12 cν1=2 where Ip refers to the peak current and A is the electrode area (cm2). In this work, for 1 mM K3 Fe (CN) 6, T = 298 K (25 °C), n = 1, D = 7.6 × 10−6 cm2 s−1 (0.1 M KCl), c is the concentration of K3Fe (CN) 6, and υ is the scan rate. Thus, Ip = 2.687 × 105An3/2D1/2cν1/2. The surface areas of the bare CPE and AuNPs-Chi/Gr/CPE were calculated from the slope of the Ip versus ν1/2 plot to be 0.03 cm2 and 0.217 cm2, respectively. 2.4. Preparation of the aptasensor In order to fabricate the proposed aptasensor, the surface of the AuNPs-Chi/Gr/CPE electrode was modified with APC-Apt. For this propose, 10 μL of 2 μM aptamer solution was dropped on the modified electrode and then held upside down in a humid chamber for self-assembly overnight. After rinsing with buffer (0.1 M PBS, pH = 7.4), the modified electrode was immersed in 1 mM 1-HT solution for 1 h to block the nonspecific sites and arrange the aptamer strands in a straight orientation. After this, the 1-HT/APC-Apt/AuNPs-Chi/Gr/CPE was dipped into 2 mL phosphate buffer (0.10 M, pH 4.0) containing methylene blue solution (30 μM), and the solution was stirred at an open circuit system for 30 min (accumulation step). The electrode was washed successively with a PBS solution (0.1 M, pH = 7.4) after each step. 2.5. Electrochemical measurement The blank current (I0) was obtained by immersing the 1-HT/APCApt/AuNPs-Chi/Gr/CPE electrode into 2.0 mL phosphate buffer containing 30 μL MB (1 mM), and the solution was stirred at an open circuit system for 20 min. The electrode was then rinsed with distilled water and placed in 10 mL of 0.20 M phosphate buffer solution (pH = 7.00). The electrochemical responses of the accumulated MB were recorded by scanning the potential range from −0.5 V to 0.0 V using the differential pulse voltammetry (stripping step). Then, 10 μL of different concentrations of APC solution was placed on the working electrode for 30 min. After rinsing the electrode with buffer (0.1 M PBS, pH = 7.4), current (I) was recorded by DPV. By replacing MB with APC at the electrode surface, the current decrease, ΔI (=I0 – I, where I0 and I denote the peak currents before and after APC recognition, respectively), which was proportional to the APC concentration, was used for the determination of APC. The design concept of the assay system is displayed in Scheme 1. 3. Results and discussion In this study, AuNPs-Chi nanocomposite was applied as a support material with Gr as signal amplification molecules for modifying the surface of the CPE electrode. The AuNPs-Chi/Gr paste increased
3
electrochemical peak current and immobilized the aptamer on the electrode surface. Modification of the electrode surface with the AuNPs-Chi/ Gr paste was not only fast and comfortable but also had a good repeatability for immobilization the aptamer on the electrode surface. Chitosan with abundant amino groups has many action sites with AuNPs, and could be a suitable supporting interface for AuNPs. Combination of AuNPs with the specific ability of chitosan as the supporting interface provided a remarkable synergistic augmentation of electrochemical performance. 3.1. Electrode surface and nanocomposite characterization The FESEM was employed to characterize the surface morphology of CPE, and AuNPs - Chi/ Gr/CPE. Fig. 1a, illustrates the characteristic morphology of the bare carbon paste electrode, while Fig. 1b, shows that AuNPs - Chi/Gr paste has been homogeneously modified on CPE surface. As a result, the SEM image exhibits presence of the nanoparticle on the polymeric network of the chitosan. The elemental analysis of the modified electrode was obtained using EDAX analysis (Fig. 2c). This analysis shows that only carbon, oxygen, gold and nitrogen elements were presented at the surface of AuNPsChi/Gr/CPE. The morphology of AuNPs-Chi was characterized by TEM. As can be seen in Fig. 2, gold nanoparticle has a spherical morphology, and also the TEM image indicates the synthesis gold nanoparticles did not assemble into clusters. Furthermore, TEM image shows the AuNPs was accumulated on the surface of chitosan as a supporting interface. The results obtained from TEM were consistent with the SEM data that confirmed the success formation of the nanostructures. 3.2. Principle of the electrochemical detection of APC The stepwise procedure of aptasensor development is illustrated in Scheme 1. In a typical experiment, the surface of the carbon paste electrode was modified for the amplification of signal (a) and, after APC-apt self-assembled on the modified CPE electrode (b), free sites were blocked with blocking agent solution (c), followed by the reaction with methylene blue (d), reaction with the APC (e), and finally recording DPV measurements. The modification of the aptasensor blocks the electron transfer between the solution species and the electrode to a certain extent, which can be easily characterized by CV and EIS using K3 [Fe (CN) 6]/ K4 [Fe (CN) 6] as a probe. The redox-label K3 [Fe (CN) 6]/K4 [Fe (CN) 6] revealed a reversible CV at the bare CPE with an ΔEP of 0.108 V (Fig. 3, Curve a). After the pretreated CPE was modified with the AuNPs-Chi/Gr paste, the shape of the CV changed with the ΔEP of 0.152 V. Although ΔEP was as much as that of the bare CPE, the peak current (Ia = 113.0 μA) markedly surpassed that of the bare CPE (Ia = 52.0 μA) (Fig. 3, Curve b). The increase in the peak current suggests that the introduction of the AuNPs-Chi/Gr paste played a role in increasing the electroactive surface area. After the immobilization of the aptamer on the AuNPs-Chi/Gr paste-modified surface and 1-hexanethiol, peak currents significantly decreased (Fig. 3, Curves c and d), indicating that the aptamer and 1-hexanethiol reduced the effective area for electron transfer. Electrochemical impedance spectroscopy is a powerful technique for studying the interface properties of electrode surfaces. Fig. 4 illustrates the impedance spectra in the form of Nyquist plots of the interfaces recorded after each modification step. Due to the good electronic transferability, the AuNPs-Chi/Gr paste-modified CPE (Curve b) displayed an almost straight line in the Nyquist plot, exhibiting a lower Ret than the bare CPE (Curve a). It was clear that the diameter of the semicircles successively increased with the sequential assembly of the aptamer probe (Curve c) and 1-HT as a blocking agent for blocking the nonspecific sites on the electrode (Curve d), indicating a step-by-step
4
M. Hosseini Ghalehno et al. / Bioelectrochemistry 130 (2019) 107322
Fig. 1. SEM Images from surface of (a) bare CPE (b) AuNPs - Chi/ Gr/CPE, (c) EDAX patterns of the elemental composition of the AuNPs - Chi/ Gr/CPE.
Fig. 2. TEM images of AuNPs-Chi morphology. The AuNPs was dispersed in chitosan solution without aggregation.
M. Hosseini Ghalehno et al. / Bioelectrochemistry 130 (2019) 107322
Fig. 3. Cyclic voltammetry responses of the modified electrode for each steps; (a) CPE, (b) AuNPs-Chi/ Gr /CPE, (c) APC-apt/ AuNPs-Chi/ Gr/CPE, (d) 1-HT /APC-apt/ AuNPsChi/ Gr/CPE, in 1 mM K3 Fe(CN)6 and 1 mM K4 Fe(CN)6 and 0.1 M KCl.
enhancement in Ret. These results were well consistent with the phenomena in CVs, confirming the successful preparation.
3.3. Optimization of detection conditions In order to provide an aptasensor with an acceptable performance, different parameters such as the effect of accumulation pH between MB and aptamer, incubation time between MB and aptamer, the concentration of accumulation MB on the aptamer, and incubation time between aptamer and APC should be optimized. Since the redox response of MB is pH-dependent, the aptasensor response in the 0.1 M phosphate buffer solutions with different pH values was investigated by recording DPV. As shown in Fig. S1a, the peak currents increase with increasing the pH value from 2 to 4, then start to decrease at pH N 4. Therefore, pH equal to 4 was chosen as the optimum value for MB. In another experiment, the effect of accumulation MB concentration on the aptasensor response was examined using the DPV method. Based on Fig. S1b, with increasing the MB concentration, the aptasensor response increased from 5.0 to 30.0 μM. When MB concentration was N30 μM, the reduction peak current trended to a constant value. Therefore, the optimal MB concentration was 30 μM. For the optimization of incubation time between MB and the aptamer, the aptasensor response in different incubation times was also examined. Based on Fig. S1c the aptasensor response increased rapidly with increasing the incubation time from 10 to 60 min, then reached
Fig. 4. EIS responses of the modified electrode for each steps; (a), CPE (b), AuNPs-Chi/ Gr / CPE (c), APC-apt/ AuNPs-Chi/ Gr/CPE and(d), 1-HT /APC-apt/ AuNPs-Chi/ Gr/CPE, in the solution containing 1 mM K3Fe(CN)6/ K4Fe(CN)6 as a electrolyte solution.
5
Fig. 5. (a) DPV responses for the developed aptasensor at different APC concentration, from 0.0, 0.1, 0.3, 0.5, 3.0, 10.0, 1.0 × 102, 1.0 × 103, and 40.0 × 103 ng·mL−1 and (b) shows the linear relationship between the anodic peak current (I) by DPV and the APC concentrations over the range from 0.1 ng·mL−1–40.0 μg·mL−1. The linear regression equation obtained ΔI (μA) = 2.31 Log [APC] (μg·mL−1) + 16.02.
equilibrium after 30 min. Thus, 30 min was obtained as the optimum incubation time between MB and the aptamer. The incubation time between the aptamer and APC was another important factor to affect the sensitivity of the assay. To this end, the MB/1HT/APC-apt/AuNPs-Chi/Gr/CPE aptasensor was incubated for various times (10–40 min) in the presence of APC. As illustrated in Fig. S1d, the aptasensor response increased with increasing the incubation time between 10 and 20 min and then reached level-off after 20 min. Therefore, 20 min was sufficient incubation time for measuring APC in the proposed assay. The effect of stripping pH on the APC aptasensor response was explored in different types of buffers (Tris-HCl buffer, phosphate buffer, and Britton–Robinson buffer) with different concentrations of buffer (0.05–0.4 M) and pH values ranging from 2.00 to 9.00. This result indicates that using the phosphate buffer solution at pH = 7.0 and 0.2 M concentration, ΔIpa was maximum (Fig. S2a, b, c). Therefore, in subsequent experiments, the stripping was performed in the 0.2 M phosphate buffer with pH = 7.0.
3.4. Performance of the aptasensor 3.4.1. Electrochemical detection of APC The sensitivity and dynamic range of the electrochemical aptasensor were first assessed using MB as a redox indicator in an aptasensor under optimal conditions. Fig. 5 demonstrates the typical DPV curves obtained in response to varying APC concentrations. The DPV peak currents increased with the increase of the APC concentration. As shown in Fig. 5b, the increase of DPV peak currents was linear in the range of 0. 1 ng·mL−1 to 40.0 μg·mL−1 and the linear regression equation was
Fig. 6. Specificity of the aptasensor to 10 μg·mL−1 APC by comparing it to the interfering agents, including Human serum albumin (HSA), tumor necrosis factor α (TNF-α), myoglobin (Myb), immunoglobulin G (IgG) and hemoglobin (Hb). Error bars show the standard deviations of measurements taken from three independent experiments.
6
M. Hosseini Ghalehno et al. / Bioelectrochemistry 130 (2019) 107322
Table 1 APC concentration [ng·mL−1] obtained from three repeated analyses by proposed biosensor and ELISA kit for three samples of human serum. Samples
Aptasensor (ng·mL−1)
ELISA (ng·mL-1)
t calculated
t(0.05,2) tabulated
1 2 3
12.5 ± 1.5 18.6 ± 0.3 8.7 ± 0.8
11.6 ± 0.8 18.2 ± 0.1 9.1 ± 0.4
0.9 2 0.8
4.3 4.3 4.3
3.4.5. Comparison with other methods Table 2 compares some response characteristics of the proposed aptasensor with some of the analytical characteristics of the previously reported APC voltammetric sensors. As one can see, our proposed aptasensor not only shows a reasonably low LOD (0.073 ng·mL−1) and wider linear range comparable or superior to the other methods, but also is simple, relatively fast, and flexible. 4. Conclusion
adjusted to ΔI (μA) = 2.31 Log [APC] (μg·mL−1) + 16.02 with a detection limit (LOD) of 0.073 ng·mL−1. 3.4.2. Stability, reproducibility and regeneration of the aptasensor The stability of the aptasensor in a 14-day period was examined. After keeping it in the refrigerator (4° C) for two weeks, the aptasensor was employed to detect the same APC concentration (10 μg·mL−1), and approximately 96.4% of the initial anodic current was retained. These results reveal that the aptasensor has an acceptable stability. The reproducibility of the aptasensor was evaluated by analyzing 10 μg·mL−1 of APC with five aptasensors prepared independently. The relative standard deviation was 5.08%. Furthermore, the precision of the aptasensor was assessed by assaying 10 μg·mL−1 of APC 6 times. The observed CVs was 3.25%. These results demonstrate the acceptable reproducibility and precision of the proposed aptasensor. The regeneration of the aptasensor (to 2 times) was estimated by urea solution (3 M) is enough for Half hour [38], and the regenerated interface can be re-used. As shown as in Fig. S.3. the result of first and second detection is almost the same as the first detection of APC. 3.4.3. The specificity of the aptasensor The specificity of the aptasensor plays an important role in analyzing complex samples. To demonstrate the specificity of the electrochemical aptasensor, samples containing different types of proteins were used as controls. As shown in Fig. 6, compared with the target, the changes in peak current are negligible in the presence of 10 μg·mL−1 of other proteins (human serum albumin (HSA), tumor necrosis factor α (TNF-α), myoglobin (Myb), immunoglobulin G (IgG) and hemoglobin (Hb)). Therefore, the method is highly specific for APC, which can be attributed to the high-specificity interaction between aptamer and APC. 3.4.4. Application of the aptasensor to detect APC in human serum In order to evaluate the feasibility, this aptasensor was used to detect of APC in the three samples of human serum (obtained from UniversityMedical Hospital of Kerman Medical University, three female, age 42–56) and compared with ELISA kit (Table 1). The biological samples were prepared (based on acetone precipitation method) according to the literature [39]. After the treatment, these samples were analyzed by this electrochemical aptasensor. Statistical comparison of the experimental results from this proposed sensor with those from ELISA was performed using a t-test. Student's t-test (P = .05) showed that there was no significant difference between the results obtained by the two methods. Therefore, the electrochemical aptasensor had a satisfactory accuracy to detect APC in real samples (Table 1).
Table 2 Comparison of the presented method with some methods currently reported for the determination of APC. Electrochemical methods
LOD (μg·mL−1)
Linear range(μg·mL−1)
Ref
Aptasensor Aptasensor Aptasensor This work
1.50 2.03 0.2 0.73 × 10−5
2.50–7.50 0.01–15.0 1.0–2.50 1.0 × 10−4 −4.0 × 101
[40] [6] [41] –
The sensitive and specific biosensor are based on AuNPs-Chi/Gr paste and aptamer probes for APC detection was established. The AuNPs-Chi/Gr paste provided a high electron transferability, good surface area, and numerous binding sites for the assembly of the thiolderived aptamer. The detection was performed by employing the MB as the signal label. This designed aptasensor displayed an extremely low LOD, a wide detection range, good selectivity, acceptable reproducibility, and stability, and can be used for detection in human serum samples. The aptasensor proposed here will not only expand the application of the new nanocomposite but also provide an attractive way to detect other targets in clinical settings as well as environmental and food safety monitoring applications. Acknowledgment The authors wish to thank the Shahid Bahonar University of Kerman and Graduate University of Advanced Technology of Kerman. Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi. org/10.1016/j.bioelechem.2019.06.007. References [1] C.T. Esmon, The protein C pathway, Chest 124 (2003) 26S–32S, https://doi.org/10. 1378/chest.124.3_suppl.26S. [2] J. Griffin, J. Fernandez, A. Gale, L. Mosnier, Activated protein C, J. Thromb. Haemost. 5 (2007) 73–80, https://doi.org/10.1111/j.1538-7836.2007.02491.x. [3] R.A. Davenport, M. Guerreiro, D. Frith, C. Rourke, S. Platton, M. Cohen, R. Pearse, C. Thiemermann, K. Brohi, Activated protein C drives the hyperfibrinolysis of acute traumatic coagulopathy, ASA 126 (2017) 115–127, https://doi.org/10.1097/ALN. 0000000000001428. [4] F. Sadaka, J. O'Brien, M. Migneron, J. Stortz, A. Vanston, R.W. Taylor, Activated protein C in septic shock: a propensity-matched analysis, Crit. Care 15 (2011) R89, https://doi.org/10.1186/cc10089. [5] N. Alshaikh, J. Rosing, M. Thomassen, E. Castoldi, P. Simioni, T. Hackeng, New functional assays to selectively quantify the activated protein C-and tissue factor pathway inhibitor-cofactor activities of protein S in plasma, JTH 15 (2017) 950–960, https://doi.org/10.1111/jth.13657. [6] A. Erdem, G. Congur, Dendrimer enriched single-use aptasensor for impedimetric detection of activated protein C, Colloids Surf B Biointerfaces 117 (2014) 338–345, https://doi.org/10.1016/j.colsurfb.2014.03.003. [7] J.A. Fernández, S.R. Lentz, D.M. Dwyre, J.H. Griffin, A novel ELISA for mouse activated protein C in plasma, J. Immunol. Methods 314 (2006) 174–181, https://doi.org/10. 1016/j.jim.2006.05.004. [8] Q. Zhao, J. Gao, Fluorogenic assays for activated protein C using aptamer modified magnetic beads, Microchim. Acta 180 (2013) 813–819, https://doi.org/10.1007/ s00604-013-1004-9. [9] S. Koyun, S. Akgönüllü, H. Yavuz, A. Erdem, A. Denizli, Surface plasmon resonance aptasensor for detection of human activated protein C, Talanta 194 (2019) 528–533, https://doi.org/10.1016/j.talanta.2018.10.007. [10] A. Erdem, G. Congur, E. Eksin, Voltammetric Aptasensor Based on Magnetic Beads Assay for Detection of Human Activated Protein C, Nucleic Acid Aptamers, Springer, 2016 163–170, https://doi.org/10.1007/978-1-4939-3197-2. [11] Y. Liu, Q. Zhou, A. Revzin, An aptasensor for electrochemical detection of tumor necrosis factor in human blood, Anal 138 (2013) 4321–4326, https://doi.org/10.1039/ C3AN00818E. [12] T. Li, Z. Si, L. Hu, H. Qi, M. Yang, Prussian blue-functionalized ceria nanoparticles as label for ultrasensitive detection of tumor necrosis factor-α, Sens Actuators B Chem 171 (2012) 1060–1065, https://doi.org/10.1016/j.snb.2012.06.034. [13] L. Yuan, X. Hua, Y. Wu, X. Pan, S. Liu, Polymer-functionalized silica nanosphere labels for ultrasensitive detection of tumor necrosis factor-alpha, Anal. Chem. 83 (2011) 6800–6809, https://doi.org/10.1021/ac201558w.
M. Hosseini Ghalehno et al. / Bioelectrochemistry 130 (2019) 107322 [14] L. Yuan, W. Wei, S. Liu, Label-free electrochemical immunosensors based on surfaceinitiated atom radical polymerization, Biosens. Bioelectron. 38 (2012) 79–85, https://doi.org/10.1016/j.bios.2012.05.007. [15] Z. Yin, Y. Liu, L.-P. Jiang, J.-J. Zhu, Electrochemical immunosensor of tumor necrosis factor α based on alkaline phosphatase functionalized nanospheres, Biosens. Bioelectron. 26 (2011) 1890–1894, https://doi.org/10.1016/j.bios.2010.03.025. [16] Y. Ding, Q. Wang, F. Gao, F. Gao, Highly sensitive and selective DNA biosensor using a dumbbell-shaped bis-groove binder of bi-acetylferrocene ethylenediamine complex as electrochemical indicator, Electrochim. Acta 106 (2013) 35–42, https://doi.org/ 10.1016/j.electacta.2013.05.066. [17] K.-J. Huang, Y.-J. Liu, H.-B. Wang, Y.-Y. Wang, A sensitive electrochemical DNA biosensor based on silver nanoparticles-polydopamine@ graphene composite, Electrochim. Acta 118 (2014) 130–137, https://doi.org/10.1016/j.electacta.2013.12. 019. [18] M.H. Ghalehno, M. Mirzaei, M. Torkzadeh-Mahani, Aptamer-based determination of tumor necrosis factor α using a screen-printed graphite electrode modified with gold hexacyanoferrate, Microchim. Acta 185 (2018), 165. https://doi.org/10.1007/ s00604-018-2704-y. [19] L.-H. Pan, S.-H. Kuo, T.-Y. Lin, C.-W. Lin, P.-Y. Fang, H.-W. Yang, An electrochemical biosensor to simultaneously detect VEGF and PSA for early prostate cancer diagnosis based on graphene oxide/ss DNA/PLLA nanoparticles, Biosens. Bioelectron. 89 (2017) 598–605, https://doi.org/10.1016/j.bios.2016.01.077. [20] M.H. Ghalehno, M. Mirzaei, M. Torkzadeh-Mahani, Electrochemical aptasensor for tumor necrosis factor α using aptamer–antibody sandwich structure and cobalt hexacyanoferrate for signal amplification, JICS (2019) 1–9, https://doi.org/10. 1007/s13738-019-01650-1. [21] B. Li, F. Liu, Y. Peng, Y. Zhou, W. Fan, H. Yin, S. Ai, X. Zhang, Two-stage cyclic enzymatic amplification method for ultrasensitive electrochemical assay of microRNA21 in the blood serum of gastric cancer patients, Biosens. Bioelectron. 79 (2016) 307–312, https://doi.org/10.1016/j.bios.2015.12.051. [22] T. Hu, L. Zhang, W. Wen, X. Zhang, S. Wang, Enzyme catalytic amplification of miRNA-155 detection with graphene quantum dot-based electrochemical biosensor, Biosens. Bioelectron. 77 (2016) 451–456, https://doi.org/10.1016/j.bios.2015. 09.068. [23] J.M. Pingarrón, P. Yáñez-Sedeño, A. González-Cortés, Gold nanoparticle-based electrochemical biosensors, Electrochim. Acta 53 (2008) 5848–5866, https://doi.org/ 10.1016/j.electacta.2008.03.005. [24] X. Ye, C. Zhu, P. Ercius, S.N. Raja, B. He, M.R. Jones, M.R. Hauwiller, Y. Liu, T. Xu, A.P. Alivisatos, Structural diversity in binary superlattices self-assembled from polymergrafted nanocrystals, Nat. Commun. 6 (2015), 10052. https://doi.org/10.1038/ ncomms10052. [25] D. Pan, Y. Gu, H. Lan, Y. Sun, H. Gao, Functional graphene-gold nano-composite fabricated electrochemical biosensor for direct and rapid detection of bisphenol A, Anal. Chim. Acta 853 (2015) 297–302, https://doi.org/10.1016/j.aca.2014.11.004. [26] S. Dehdashtian, M.B. Gholivand, M. Shamsipur, Construction of a sensitive and selective sensor for morphine using chitosan coated Fe3O4 magnetic nanoparticle as a modifier, Mater. Sci. Eng. C. 58 (2016) 53–59, https://doi.org/10.1016/j.msec.2015. 07.049.
7
[27] M. Figiela, M. Wysokowski, M. Galinski, T. Jesionowski, I. Stepniak, Synthesis and characterization of novel copper oxide-chitosan nanocomposites for nonenzymatic glucose sensing, Sens Actuators B Chem 272 (2018) 296–307, https:// doi.org/10.1016/j.snb.2018.05.173. [28] G. Sargazi, D. Afzali, A. Mostafavi, S.Y. Ebrahimipour, Synthesis of CS/PVA biodegradable composite nanofibers as a microporous material with well controllable procedure through electrospinning, J. Polym. Environ. 26 (2018) 1804–1817, https:// doi.org/10.1007/s10924-017-1080-8. [29] A.A. Balandin, S. Ghosh, W. Bao, I. Calizo, D. Teweldebrhan, F. Miao, C.N. Lau, Superior thermal conductivity of single-layer graphene, Nano Lett. 8 (2008) 902–907, https://doi.org/10.1021/nl0731872. [30] K.S. Novoselov, Z. Jiang, Y. Zhang, S. Morozov, H.L. Stormer, U. Zeitler, J. Maan, G. Boebinger, P. Kim, A.K. Geim, Room-temperature quantum hall effect in graphene, Sci 315 (2007) 1379, https://doi.org/10.1126/science.1137201. [31] G. Sargazi, D. Afzali, A. Mostafavi, A novel synthesis of a new thorium (IV) metal organic framework nanostructure with well controllable procedure through ultrasound assisted reverse micelle method, Ultrason. Sonochem. 41 (2018) 234–251, https://doi.org/10.1016/j.ultsonch.2017.09.046. [32] D.A. Dikin, S. Stankovich, E.J. Zimney, R.D. Piner, G.H. Dommett, G. Evmenenko, S.T. Nguyen, R.S. Ruoff, Preparation and characterization of graphene oxide paper, Nat 448 (2007) 457–460, https://doi.org/10.1038/nature06016. [33] C. Lee, X. Wei, J.W. Kysar, J. Hone, Measurement of the elastic properties and intrinsic strength of monolayer graphene, Sci 321 (2008) 385–388, https://doi.org/10. 1126/science.1157996. [34] A. Peigney, C. Laurent, E. Flahaut, R. Bacsa, A. Rousset, Specific surface area of carbon nanotubes and bundles of carbon nanotubes, Carbon 39 (2001) 507–514, https:// doi.org/10.1016/S0008-6223(00)00155-X. [35] C. Rao, K. Biswas, K. Subrahmanyam, A. Govindaraj, Graphene, the new nanocarbon, J. Mater. Chem. 19 (2009) 2457–2469, https://doi.org/10.1039/B815239J. [36] J. Müller, B. Isermann, C. Dücker, M. Salehi, M. Meyer, M. Friedrich, T. Madhusudhan, J. Oldenburg, G. Mayer, B. Pötzsch, An exosite-specific ssDNA aptamer inhibits the anticoagulant functions of activated protein C and enhances inhibition by protein C inhibitor, Chem. Biol. 16 (2009) 442–451. [37] A.J. Bard, L.R. Faulkner, J. Leddy, C.G. Zoski, Electrochemical Methods: Fundamentals and Applications, Wiley, New York, 1980. [38] J. Saeed, M. Mirzaei, M. Torkzadeh-Mahani, A selective and regenerable voltammetric aptasensor for determination of homocysteine, Microchim. Acta 183 (2016) 2205–2210, https://doi.org/10.1007/s00604-016-1852-1. [39] L. Jiang, L. He, M. Fountoulakis, Comparison of protein precipitation methods for sample preparation prior to proteomic analysis, J. Chromatogr. A 1023 (2004) 317–320, https://doi.org/10.1016/j.chroma.2003.10.029. [40] A. Erdem, G. Congur, F. Mese, Electrochemical detection of activated protein C using an aptasensor based on PAMAM dendrimer modified pencil graphite electrodes, Electroanalysis 26 (2014) 2580–2590, https://doi.org/10.1002/elan.201400354. [41] A. Erdem, G. Congur, Dendrimer modified 8-channel screen-printed electrochemical array system for impedimetric detection of activated protein C, Sensors Actuators B Chem. 196 (2014) 168–174, https://doi.org/10.1016/j.snb.2014.01.103.