Electrochemical detection of DNA mismatches using a branch-shaped hierarchical SWNT-DNA nano-hybrid bioelectrode

Materials Science & Engineering C 104 (2019) 109886

Contents lists available at ScienceDirect

Materials Science & Engineering C journal homepage: www.elsevier.com/locate/msec

Electrochemical detection of DNA mismatches using a branch-shaped hierarchical SWNT-DNA nano-hybrid bioelectrode Aboulfazl Mirzapoora, Anthony P.F. Turnerb, Ashutosh Tiwaric,d, Bijan Ranjbara,e,

T

⁎

a

Department of Nanobiotechnology, Faculty of Biological Sciences, Tarbiat Modares University, P.O. Box 14115-175, Tehran, Iran Biosensors and Bioelectronics Centre, Department of Physics, Chemistry and Biology (IFM), Linköping University, 58183 Linköping, Sweden c Institute of Advanced Materials, VBRI, Teknikringen 4A, Mjärdevi Science Park, 583 30 Linköping, Sweden d Innovation Centre, Vinoba Bhave Research Institute (VBRI), New Delhi 110019, India e Department of Biophysics, Faculty of Biological Sciences, Tarbiat Modares University, P.O. Box 14115-175, Tehran, Iran b

A R T I C LE I N FO

A B S T R A C T

Keywords: Hierarchical self-assembly SWNT-DNA nano-hybrid Bioelectrode DNA mismatch detection Electrochemical detection

Common approaches for DNA mutation detection are high cost and have difficult or complex procedure. We propose a fast quantitative method for recognition of DNA mutation based on SWNT/DNA self-assembled nanostructure. Covalent SWNT/DNA hybrid nanostructures are widely used in the fabrication of electrochemical biosensors. Interfacing carbon nanotubes with DNA in particular, is used as a detection method for the analysis of genetic disorders or the detection of mismatches in DNA hybridisation. We have designed a self-assembled, branch-shaped hybrid nanostructure by hybridisation of two sticky oligos that are attached to the ends of SWNTs via a linker oligo. These hybrid nanostructures showed a good conductivity that was greater than free SWNTs. Impedance spectroscopy studies illustrated that the conductivity of these hybrid nanostructures depended on the conformation and structure of the hybridised DNA. We demonstrated that the strategy of using SWNT/DNA selfassembled hybrid nanostructure fabrication yields sensitive and selective tools to discriminate mismatches in DNA. Cyclic voltammetry (CV) and impedance spectroscopy clearly revealed that the conductivity of the branchshaped and hierarchical hybridised SWNT/DNA nanostructure is higher when matched, than when mismatched in a 1 and 1′ hybridised SWNT/DNA nanostructure. Rapid biosensing of match and mismatch nanostructure based on carbon printed electrode showed similar results which can be used for rapid and fast detection of DNA mismatch.

1. Introduction Deoxyribonucleic acid (DNA) sequence mismatch and mutation as important biomarkers are closely connected to genetic based diseases such as various types of cancer [1–4]. This genetic defect detection relies on specific complementarity DNA hybridisation [5]. Conventional methods for DNA hybridisation assay can be divided into two distinct groups: a) DNA sequencing based methods that are usually very expensive and time-consuming and also need large amounts of highly purified DNA [6]. b) Nonsequencing methods based on DNA hybridisation that are categorized into three approaches: 1) Enzyme based methods that use enzyme for DNA ligation procedure or as label. The major drawbacks of using enzymes are high-cost and some issues in stabilisation procedure. 2) Label and mediator free methods based on oxidation/reduction activity of oligonucleotide bases. Due to the role of electrocatalytic activity of free guanine/adenine in label free

approaches, these electrochemical DNA detection approaches restrictively depend on availability of free guanine/adenine after hybridisation. Also, major disadvantage of using these approaches is high background signal in results [7], and 3) Label and mediator based methods. The main limitation of these methods is using nearly toxic and expensive labels and indicators and also complexity of DNA probe immobilisation and hybridisation procedure [8–10]. DNA hybridisation assays are combined with optical [11] or electrochemical transducers [7]. However, the most common strategy for mismatch detection is electrochemical hybridisation-based detection that relies on nucleotide hybridisation during the detection process, which involves specific electrostatic charge distributions and strong hydrogen bonding [12–15]. Charge distribution DNA sequence sensing and label-free homogeneous electrochemical immunosensors (genosensors) [16–18] with direct, fast, simple and inexpensive electrochemical analysis of nucleic acid samples have been fabricated based on electrochemical

⁎ Corresponding author at: Departments of Nanobiotechnology and Biophysics, Faculty of Biological Sciences, Tarbiat Modares University, P.O. Box 14115-175, Tehran, Iran. E-mail address: [email protected] (B. Ranjbar).

https://doi.org/10.1016/j.msec.2019.109886 Received 2 July 2018; Received in revised form 9 June 2019; Accepted 11 June 2019 Available online 28 June 2019 0928-4931/ © 2019 Elsevier B.V. All rights reserved.

Materials Science & Engineering C 104 (2019) 109886

A. Mirzapoor, et al.

functionalised with sticky oligo (P1 and P1′), can be assembled in favored patterns, such as branch-shaped, after addition of linker oligo “P2” (Scheme 1). Electrochemical studies of these branch-shaped nanostructures showed a significant improvement in the conductivity of the self-assembled hybrid nanostructures compared to SWNTs alone. The results indicated that such SWNT/DNA hybrid nanostructures offer a straightforward approach to the highly sensitive and selective detection of mismatches in oligonucleotides. The electrochemical properties of matched SWNT/DNA self-assembled hybrid nanostructures, such as charge transfer resistance, anodic and cathodic peak potentials and impedance spectra, were all clearly distinguishable from those obtained with mismatched hybrid nanostructures.

detection of the DNA hybridisation by hybrid nanostructures [19–22]. Due to unique electronic and structural properties of single-walled nanotubes (SWNTs), SWNT/DNA nanostructure widely is utilized in bottom-up fabrication of optical, mechanical and electrochemical biosensors and functional nanodevices [23–30]. Furthermore, SWNT/DNA hybrid nanostructures have been widely used for the rapid detection of unusual genes and reading the human genome [31]. SWNT/DNA hybrid nanostructures can be fabricated by combination of different oligomers such as aptamers, DNA and DNA origami nanostructures with SWNTs, by covalent conjugation of DNA to SWNT or noncovalent interaction (ππstacking) of DNA and SWNTs [32–34]. Such hybrid nanostructures have been extensively used for the fabrication of different nanodevices and especially electrochemical aptasensors, where the biophysical and electrochemical properties of these nanostructures have been studied [35–38]. In this manuscript, we have introduced a new qualitative and inexpensive approach for DNA hybridisation rapid biosensing based on capability of self-assembly in branch-shaped hierarchical SWNT-DNA nano-hybrid bioelectrode. Here, we report the fabrication of a self-assembled nanobranch, using the SWNT as a building block together with three complementary single-strand oligo as a smart glue. This procedure might be used to assay various genes or DNA sequences at the same time. The study demonstrated a conductivity-based DNA mismatch detection method utilizing a self-assembled, hierarchical and branch-shaped carbon nanotube-DNA network device (Fig. 1). The new electrochemical biosensor can be used for detection of mismatches in hybridised DNA. This research shows that SWNTs, after being

2. Materials & methods 2.1. Materials and reagents SWNT (diameter = 1.1 nm, purity > 95%) was obtained from Neutrino (China). 2-(N-morpholino) ethane sulfonic acid (MES) and polyethylene glycol (PEG) with average 10,000 molecular weight, were analytical grade and from Santa Cruz Biotechnology (St. Bergheimer, Heidelberg Germany). Potassium ferrocyanide (K4[Fe(CN)6]) and potassium ferricyanide (K3[Fe(CN)6]) were from Sigma Aldrich (St. Louis, MO, USA). Triton X-100 and other chemicals for buffer preparation were purchased from Merck (Darmstadt, Germany). Double distilled water was used in all experiments. DNA oligomers (match linker oligo (probe 2), mismatch 1 linker oligo, mismatch 1′ linker oligo and two

Fig. 1. (a) Depicts the FT-IR spectra (b) UV–vis spectra of SWNT, SWNT-P1 and SWNT-P1′ and photograph of the supernatant fraction obtained from the coupling steps with sticky oligo (p1&p1′) after one day. (c) UV–vis spectra of branch-shaped, self-assembled and hierarchical SWNT/DNA hybrid nanostructures fabricated with different concentration of linker oligo. (d) TEM image of SWNT and SWNT/DNA biointerface, top-left insets represente TEM images of free SWNT, top-right and bottom insets represent TEM images of hierarchically self-assembled SWNT/DNA branch-shaped nanostructures. 2

Materials Science & Engineering C 104 (2019) 109886

A. Mirzapoor, et al.

Scheme 1. Schematic model illustration of strategy for DNA hybridisation and SWNT/DNA nanofabrication.

product was SWNT-probe 1.probe 2.probe 1′-SWNT conjugate.

Table 1 Sticky oligo and match and mismatch linker oligo. DNA types

DNA sequences

Probe Probe Probe Probe Probe

NH2AAGAAGAAGAAGAAGAAGA AGAAGAAGAAGAAGAAGAANH2 TTCTTCTTCTTCTTCTTCTGGTCTTCTTCTTCTTCTTCTT TTCATCATCTTCGTCTTCTGGTCTTCTGCTTCTACTACTT TTGATCTTTATCTTCTACTGGTCATCTTCTATTTCTGATT

1 1′ 2 match 2 miss match 1 2 miss match 1′

2.4. Immobilisation of bioconjugates on the electrode For immobilisation of the hierarchical self-assembled 2D SWNT/ DNA hybrid nanostructures and other modification layers on the surface of the electrode, glassy carbon electrodes (GCE) were carefully polished with 1, 0.05 and 0.03 μm α-alumina and washed with deionised water. The bioconjugation solution (5 μl), which contained selfassembled 2D SWNT/DNA hybrid nanostructures was sonicated for 15 min to achieve a homogeneous dispersed suspension. This suspension (5 μl) was then drop-cast onto the GCE surface and dried for one day at 4 °C. The other electrodes (SWNT, SWNT conjugate with sticky DNA and SWNT/DNA hybrid nanostructures with mismatched hybridisation 1&1′) were prepared by the procedure described above.

amino end-functionalised sticky DNAs (probe 1 & probe 1′)) samples of HPLC grade were procured from Eurofins genomics (St. Anzinger Ebersberg Germany) which are listed in Table 1. 2.2. Preparation of SWNT-sticky DNA conjugates SWNTs were purified by heating in a 3:1 V/V solution of concentrated sulfuric acid (98%) and nitric acid (70%) for 16 h at 40–50 °C, and then washed with water. The sidewall and open end of the SWNTs were then functionalised with a carboxyl group [29, 32]. A 0.5 mg aliquot of oxidised, shortened SWNTs was suspended in 10 ml 0.5% Triton X-100 (V/V) and 0.5% (W/V) of PEG and sonicated (probe sonication, Up 450, Hielscher) for 10 min at 80 kHz; this solution was then centrifuged at 25,200g for 30 min. The supernatant consisting of dispersed and functionalised SWNT was collected and used for the next step. Generally, 50 μl of 20 mM EDC and 20 mM sulfo NHS was added to 100 μl of suspended SWNTs and sonicated for 10 min. Following this step, the carboxylic group was ready to bind the amine group on the end of the sticky DNA (probe 1 & probe 1′). After the activation step, one of the functionalised DNAs was added to a final concentration of 5 nM and diluted to final volume of 200 μl with 100 mM MES Buffer. The samples were placed in an ultrasonic bath for 30 min and stirred for 12 h in an incubator at 23 °C. SWNTs functionalised with probe 1 and probe 1′ (SWNT-probe 1 & SWNT-probe 1′) were prepared by mixing two groups of dispersed SWNTs with the two sticky DNAs (probe 1 & probe 1′) for 12 h. After this procedure, the reaction mixture consisted of SWNTs that bind to the sticky DNA covalently and other free SWNTs and free ss-DNA, therefore for purification of the covalent SWNT/sticky DNA hybrid nanostructures, the reaction mixture was centrifuged twice at 21,952g for 1 h and recovered in the supernatant. The sediment consisted of SWNTs covalently functionalised with probe 1 and probe 1′ and was washed twice with buffer containing 2.5 mM Ethylenediaminetetraacetic acid (EDTA), 20 mM sodium hydrogen phosphate and 300 mM sodium chloride to further purify samples. These structures were dispersed in 0.5 ml of 100 mM MES buffer with 1 h ultrasonication.

For characterisation of the SWNT-sticky DNA conjugation and selfassembled 2D SWNT/DNA hybrid nanostructures, UV–vis absorbance experiments were carried out on a Cary 100 UV–vis double beam spectrophotometer Agilent (Santa Clara, California, USA). All the spectra were measured over a 1.0 cm path-length cell with the different concentrations of linker DNA in aqueous solution. SEM images of SWNT/DNA hybrid nanostructures were obtained using a Hitachi S4160 (Cold Field Emission) (Chiyoda-ku, Tokyo, Japan) and a transmission electron microscope (TEM) was used to image SWNT/DNA hybrid nanostructures. For characterisation of the SWNT-sticky DNA conjugation self-assembled nanostructures, FT-IR measurements were carried out using a PE 100 FT-IR spectrometer PerkinElmer (Waltham, MA, USA). Circular dichroism (CD) is one of the best techniques to examine any conformational changes that might be induced in the structure of the macromolecules [39,40]. CD spectra were obtained using a Chirascan circular spectropolarimeter (Beverly, MA, USA) at room temperature. The optical chamber of the CD instrument was deoxygenated with nitrogen for 10 min at a speed of 5 l/min before use and the nitrogen atmosphere was maintained during the experiments.

2.3. Fabrication of hierarchical SWNT-DNA nano-hybrid nanostructures

2.7. Electrochemical study

Self-assembled SWNT/DNA hybrid nanostructures were fabricated by hybridisation of linker DNA (probe 2) with SWNT-probe 1 and SWNT-probe 1′ in MES buffer in pH = 6 and with DNA annealing process. 2 μl of 50 μM of probe 2 was added to a solution of SWNTprobe 1 and SWNT-probe 1′ in MES buffer and sonicated for 30 min then heated to 80 °C and gradually cooled down to 4 °C. The hybridised

Electrochemical studies were carried out in a conventional threeelectrode cell powered by an Ivium Stat XR electrochemical analyser (Eindhoven, Netherlands). Impedance measurement was carried out with an Autolab potentiostat–galvanostat (Kanaalweg, Utrecht, Netherlands). The three-electrode cell contained a glassy carbon (GC) working electrode (0.07 cm2 surface area), platinum branch auxiliary

2.5. Immobilisation of bioconjugate on the carbon printed electrodes For immobilisation of the 2D SWNT/DNA hybrid nanostructures and other layers on the surface of carbon printed electrodes, a 5 μl aliquot of the suspension was drop-cast on the electrode surface and dried for one day at 4 °C. For electrochemical measurement, ferro/ferri electrolyte was drop-cast on the surface the electrode until it covered all of the printed electrode prior to connection to the potentiostat. 2.6. Characterisation of electrodes

3

Materials Science & Engineering C 104 (2019) 109886

A. Mirzapoor, et al.

Scheme 2. Model for the preparation of branch- shaped, self-assembled and hierarchical SWNT/DNA hybrid nanostructures

carbamide group characteristic peak is apparent at 1200 cm−1. Due to the interaction between SWNT-COOH and sticky DNA, amine groups of DNA bind to carboxyl groups of SWNT covalently and carbamide groups were formed. The FT-IR spectra of SWNT-sticky oligo showed the characteristic peak of carbamide groups at 1200 cm−1. Raman spectra of dispersed SWNTs with carboxyl groups and functionalised SWNTs with sticky oligo (P1 and P1′) dispersed in solution are presented in Fig. S1. Fig. 2b shows the absorption spectra of SWNTs dispersed with PEG and Triton X-100, and SWNTs functionalised with sticky oligo P1 & P1′. Optical absorption spectra were taken over the wavelength range of 200–800 nm. The free SWNTs absorption spectrum appeared at 270 nm because of inter-band transitions. Murakami et al. have shown that there are two SWNT absorption peaks in the UV region (center at ~275 and ~236 nm) for graphite structures [46]. Furthermore, wide and small peaks at 230–330 nm in free SWNT solution absorption spectrum correspond to plasmon resonances of the free electron cloud of the nanotube p electrons [47]. Covalent interaction between DNA and SWNT occurs as a strong interaction between amine groups of sticky DNA and carboxyl groups of the nanotube that bind together with a carbamide bond [48]. Because of the hyperchromicity effect, after covalent interaction of sticky DNA with SWNTs, we expected a substantial increase in the UV–vis absorption of the hybrid nanostructure. Obviously, because SWNTs and sticky DNA show UV–vis absorption in 260–270 nm, probably because of increase of disposing chromophores, the absorption peak of SWNT-sticky DNA hybrid nanostructures increased. This intense UV–vis absorption was associated with electronic transitions of both the nanotubes and the DNA bases. Photographs of the supernatant fraction of free SWNT and functionalised SWNT/sticky oligo (SWNT-P1 and SWNT-P1′) obtained from the coupling steps are shown in Fig. 1b, which shows that after one day, functionalised SWNT with sticky oligo (P1 and P1′) self-collected spontaneously. Fig. S2(a) shows the CD spectra of SWNTs dispersed with PEG and Triton X-100, and SWNTs functionalised with two sticky oligos P1 and P1′. This experiment proves that the observed CD signal is due to nanotube-DNA hybrid nanostructures formation. SWNT–P1 and SWNT–P1′ were hybridised with different concentrations of their complementary strands, linker oligo (P2), to form duplex oligos in MES buffer at 33 °C and pH= 6. After separation and purification, the SWNT–P1&P1′·P2 conjugates were characterised by

and Ag/AgCl (3 M KCl) reference electrode. The GC disk electrode was polished with 1, 0.05 and 0.03 μm alumina powder on a polishing micro cloth and rinsed thoroughly with double-distilled water prior to modification. 3. Results and discussion A primary aim of this research was the fabrication of covalent SWNT/DNA conjugates prepared through covalent binding between carboxylic groups, localised on the CNT sidewall and the two ends of the dispersed SWNT, and the amine group on the end of two groups of symmetric functionalised sticky oligonucleotides, (P1 and P1′). Scheme 2 shows a schematic model of the SWNT/DNA conjugation and the SWNT/DNA self-assembled hybrid nanostructures that were fabricated in branch-shaped form. In the former, two groups of sticky oligo (P1 & P1′) were conjugated with SWNTs separately. Finally, linker DNA was added to the solution of mixed SWNT/sticky oligo (P1) and SWNTsticky oligo (P1′) and after hybridisation of the complementary DNA, self-assembled SWNT/DNA hybrid nanostructures were formed. 3.1. Fabrication of hierarchical SWNT-DNA nano-hybrid nanostructures Because of the naturally hydrophobic properties of SWNTs [41,42], these carbon-based nanoparticles in hydrophilic medium were aggregated together irreversibly. In order to prevent such an aggregation and sustain their unique chemical and physical properties, different organic solvents or non-covalent surface modifications such as polymer and surfactant must be used [43,44]. To obtain a stable and homogenous solution of SWNTs for bioconjugation with sticky DNA, SWNT was dispersed in poly ethylene glycol and Triton X-100. Poly ethylene glycol (PEG) contains long linear chains of ethylene oxide, which is a super water active polymer [45]. Triton X-100 is a nonionic surfactant that has a hydrophilic polyethylene oxide chain (on average it has 9.5 ethylene oxide units) and an aromatic hydrophobic group. Firstly, partially SWNT-COOH powder (20 μg) was dispersed in a 1 ml of 5 mg/ ml aqueous solution of PEG and 0.5 mM of Triton X-100 and sonicated to produce a well-dispersed state. Fig. 1a depicts the FT-IR spectra of dispersed SWNTs with carboxyl groups and functionalised SWNTs with sticky oligos (P1 and P1′). The 4

Materials Science & Engineering C 104 (2019) 109886

A. Mirzapoor, et al.

Fig. 2. (a), Temperature effects on CD spectra of match hybridised DNA at different temperatures 5–85 °C. (b) & (c) Dependency of Δε intensity at wavelength of positive and negative peaks in different temperatures 5–85 °C.

sidewall of SWNT. The nano-network of SWNTs generated a flexible nanoscaffold with some porosity that could be used for different applications.

UV–vis and CD spectroscopy (Figs. 1c and S2(b)). Fig. 1c shows the UV–vis spectra of self-assembled SWNT/DNA hybrid nanostructures that formed with different concentrations of linker oligo P2 (0.2 nmol, 0.4 nmol, 0.6 nmol). Optical absorption spectra were recorded over the wavelength range 200–800 nm. In contrast, UV–vis spectra of self-assembled SWNT/DNA hybrid nanostructures showed specific peaks of SWNT/DNA hybrid nanostructures at 260–270 nm. While, with increasing concentration of linker oligo, the intensity of the peaks increased. This means that in the presence of linker oligo, coupling DNA (P1, P1′ and P2) hybridised together and a nanonetwork of SWNTs was formed. Furthermore, with increasing concentration of linker oligo, more self-assembled SWNT/DNA hybrid nanostructures formed, as indicated by the increasing UV–vis absorption peak at 260 nm. CD spectra of SWNTs and self-assembled SWNT/ DNA hybrid nanostructures formed with different concentrations of linker oligo are shown in Fig. S2(b). However, the CD spectra of SWNT–P1&P1′·P2 showed positive and negative signals indicating that the hybridisation process was complicated. Although B-DNA has a conservative CD spectrum above 220 nm with approximately equal positive 275 nm and negative 245 nm components centered around 260 nm [49,50], CD spectrum of the SWNT–P1&P1′·P2 sample could be considered as a B-DNA-like form. Fig. 1d shows TEM images of dispersed and functionalised SWNT with sticky oligo before addition of linker oligo in up-left insets and selfassembled SWNT/DNA hybrid nanostructures at different magnifications (other insets). The samples were prepared by dropping 50 μl of each solution and casting them on a TEM grid. TEM images of the SWNTs revealed the two dimensional and tubular structure of these nanostructures. TEM images of dispersed SWNTs indicated clearly that after the conjugation process, polymer with the help of the surfactant covered the surface of these tubular nanostructures. It was clear that SWNTs modified with polymer and surfactant were well-separated. TEM images of self-assembled SWNT/DNA hybrid nanostructures illustrates a super nanonetwork of SWNTs with several cross links that were formed by hybridisation of linker oligo and the two groups of SWNT-sticky oligo. The typical TEM images of self-assembled SWNT/ DNA hybrid nanostructures showed homogeneous assembly of SWNTs without any self-condensation and aggregation. It was observed that SWNTs bound together head to head, head to tail and head to the

3.2. Match and mismatch coupling and hybridised DNA Double-stranded sequence, consisting of three complementary ssDNAs, were prepared in hybridisation buffer (100 mM MES, pH =6.0) and hybridised by using Thermoblock [51]. Matched double-stranded DNA and two types of mismatched double-stranded DNA (mismatch 1 and mismatch 1′) were generated by hybridisation of two types of sticky oligo with complementary linker oligo, or two types of mismatch linker oligo. These double DNA strands showed different physical structures. CD spectra of three different double DNA strands at 5 °C are illustrated in Fig. S3 (Supporting information). These spectra indicated that the conformational structure of the three types is different. The CD spectra of self-complementary and matched double strands had a maximum at 280 nm and minimum near 250 nm. The mismatched 1 hybridised DNA has a maximum near 275 nm and minimum near 250 nm. Whereas, the mismatched 1′ hybridised DNA had a maximum near 275 nm and minimum near 245 nm. Considering B-DNA conservative CD spectra [45,46], the three hybridised DNAs had a conformation approximating to B-DNA. Obviously, the exact shapes and magnitudes of the CD spectra will depend on the base sequences, but the overall patterns will remain constant [52]. Comparative assessment of three spectra shows that the conformational structure of matched hybridised DNA is approximately similar to mismatched 1′ hybridised DNA, but the positive and negative signal of the matched hybridised DNA illustrated a red shift and different magnitudes that could be considered as a different conformational structure. In fact, the mismatched 1 hybridised DNA maximum and minimum was less than one-half the magnitude of the positive and negative signal of the matched and mismatched 1′ hybridised DNA. Therefore, we can say this type of ds-DNA has some defect and mismatching in its structure. 3.3. CD of match and mismatch coupling and hybridised DNA in various temperatures The thermal stability of three different conformations of double 5

Materials Science & Engineering C 104 (2019) 109886

A. Mirzapoor, et al.

From this figure, we can see that the oxidation peak currents increased with increasing linker oligo concentration. Square-wave voltammograms (SQV) of a self-assembled modification layer that was synthesised at different concentrations of linker oligo are illustrated in Fig. 3b. These experiments were executed in 10 mM Fe (CN)63−/4− and 0.1 KCl solution with f = 2 Hz, ΔES = 10 mV and potential sweep rate of 50 mVs−1. The results indicated that the current peak increased with increasing linker oligo concentration. The peak current in both LSV and SQV spectra increased with increasing concentration of linker oligo “P2”, which suggests that with addition of more linker oligo, more completed and condensed self-assembled nanostructures were formed. As a result, a more accessible surface for electrochemical reaction was available and the current peak intensity increased. The electrochemical properties of all modified electrodes were characterised by measuring voltammetric and electrochemical impedance (EIS) responses in solutions containing 10 mM Fe(CN)63−/4− and 0.1 KCl. The results were shown in Figs. 4a & b, 5a & b and Figs. S6, S7, S8 and S9 (Supporting information). The CV analysis of the redox reaction of Fe (CN)63− and Fe (CN)64− is a well-known method to characterise the electrochemical behavior of modified and bare electrodes and the simplest way to determine electron transfer rate [53]. The CV responses of all modified electrodes displayed a classical sigmoidal shape with different peak-to-peak potential separations. The larger peak separation indicated slow electron transfer kinetics [54–56]. Cyclic voltammograms of branch-shaped and self-assembled SWNT/DNA modifications compared to nonhybridised layers is shown in Fig. S6 (Supporting information). However, the anodic and cathodic peak separation with GCE/SWNT/DNA is narrower than the others, and it could be considered that electron transfer in the SWNT/DNA nanonetwork modification layer was faster than with other modification layers. Modification of the electrode surface with SWNT/DNA branchshaped and self-assembled hybrid nanostructures resulted in a peak current increase in the presence of Fe (CN)63−/4− in comparison with modification by SWNT and SWNT–P1&P1′. This difference could be attributed to the layer-by-layer and branch-shaped structure of SWNT–P1&P1′·P2, permitting more electro catalysis. Also, due to the network structure of the nanobiostructures, the diffusion of Fe (CN)63−/ 4− from solution to electrode surface was facilitated. In addition, the conductivity of the SWNT/DNA self-assembled nanostructures increased. Cyclic voltammograms of a GCE/SWNT/matched DNA hybridised branch-shaped nanostructure electrode in 10 mM Fe (CN)63−/4− and 0.1 KCl solution at various potential sweep rates of 10–1000 mV s−1 is shown in Fig. S7a (Supporting information). The peak currents were proportional to sweep rates in the range of 10–1000 mV s−1 (Fig. S7b, Supporting information), which indicates

DNA strands was studied by temperature effects on CD spectra method. Circular dichroism of matched double-stranded hybridised DNA at different temperatures, from 5 °C to 85 °C, are displayed in Fig. 2a. The conformation of the hybridised DNA changed with increasing temperature and transformed from double stranded to single stranded. Due to this conformation change, the magnitude of the positive and negative CD signals decreased [39]. The positive and negative peaks intensity in the CD spectra with different temperatures, is illustrated in Fig. 2b and c. These spectra indicated that following the melting process of matched hybridised DNA, the intensity of signals is changed in a sigmoidal fashion with a midpoint Tm (about 45 °C). When the temperature increased, the double stranded DNA unfolded and transformed to single stranded DNA. Circular dichroism of mismatched 1′ double-stranded hybridised DNA at different temperatures, from 5 °C to 85 °C, are shown in Fig. S4a. The thermal unfolding of mismatched 1′ hybridised DNA (Fig. S4b, c) indicated that the ssDNA transition was sigmoidal with a midpoint Tm (about 35 °C). However, in comparison, the unfolding behavior in matched hybridised DNA to mismatched 1′ illustrated that thermal stability of match hybridised DNA is more than mismatch 1′ hybridised DNA. Fig. S5a shows a CD spectrum of thermal denaturation of mismatched 1 hybridised DNA. In the corresponding CD spectrum, due to the defect in the conformational structure of DNA, the signal strength decreased with increasing temperature. However, in the melting process of mismatched 1 hybridised DNA, the thermal unfolding diagram was not sigmoidal (Fig. S5b, c). According to this, its thermal stability is less than the thermal stability of matched and mismatched 1′ hybridised DNA. 3.4. Electrochemical properties of matched and mismatched self-assembled SWNT/DNA hybrid nanostructures The electrochemical properties of all self-assembled SWNT/DNA hybrid nanostructures were studied by cyclic voltammetry (CV), linear sweep voltammetry, square wave voltammetry and impedance spectroscopy (EIS) in solutions containing 10 mM Fe (CN)63−/4− and 0.1 KCl. Self-assembled SWNT/DNA hybrid nanostructures formation was studied by linear sweep voltammetry and square wave voltammetry. These self-assembled and branch-shaped nanostructures were formed by addition of different amounts of linker oligo “P2” (0.1 nmol, 0.2 nmol, 0.4 nmol) to modified SWNTs by sticky oligo (p1 & p1′). Fig. 3a shows linear sweep voltammogram (LSV) of a glassy carbon electrode (GCE) modified by branch-shaped and self-assembled SWNT/ DNA hybrid nanostructures (GCE/SWNT/DNA) that were formed by different amounts of linker oligo (0.1 nmol, 0.2 nmol, 0.4 nmol) in 10 mM Fe (CN)63−/4− and 0.1 KCl solution at a potential sweep rate of 50 mVs−1.

Fig. 3. (a), Linear sweep voltammograms (b), square-wave voltammograms of self-assembled and hierarchical SWNT/DNA hybrid nanostructures fabricated with different concentrations of linker oligo, P2. 6

Materials Science & Engineering C 104 (2019) 109886

A. Mirzapoor, et al.

Fig. 4. (a) Cyclic voltammograms of GCE/SWNT-P1&P1′, GCE/SWNT-P1&P1′/match P2, GCE/SWNT-P1&P1′/mismatch 1 P2, GCE/SWNT-P1&P1′/mismatch 1′ P2 in 10 mM Fe (CN)63−/4− and 0.1 KCl solution at a potential sweep rate of 50 mVs−1. (b) Nyquist diagrams of GCE/SWNT-P1&P1′, GCE/SWNT-P1&P1′/match P2, GCE/ SWNT-P1&P1′/mismatch 1 P2, GCE/SWNT-P1&P1′/mismatch 1′ P2 electrode in 10 mM Fe (CN)63−/4− and 0.1 KCl at DC oxidation peak potential. (c) Equivalent circuits of Nyquist diagrams in panel b.

Fig. 5. (a) Cyclic voltammograms and (b) linear sweep voltammograms of SWNT and SWNT-P1&P1′/match P2 modification layer on carbon electro printed surface in 10 mM Fe (CN)63−/4− and 0.1 KCl, solution at a potential sweep rate of 50 mVs−1.

complementary hybridisation showed an exceedingly narrow oxidation and reduction peaks potential differentiation (ΔEp) value compared to mismatch 1 & 1′ hybridisation SWNT/DNA-modified electrodes, which indicates a faster electron transfer rate in the matched DNA hybridised/ SWNT branch-shaped nanostructure modification. In contrast, the ΔEp value of mismatched 1 hybridised self-assembled hybrid nanostructure/ GCE electrodes was larger than the former which means that this modification layer could not facilitate fast electron transfer due to incomplete coupling. The electron transfer properties of different electrodes were further characterised by electrochemical impedance spectroscopy (EIS). The EIS analyser software was chosen to fit the impedance outputs. Nyquist plots of a GCE, GCE/SWNT, SWNT (GCE/SWNT–P1&P1′) and GCE/ SWNT/DNA in 10 mM Fe (CN)63−/4− and 0.1 KCl solution at the oxidation peak and at the reduction peak (potential as dc) are illustrated in Fig. S8a & b. The Nyquist diagrams are semicircular at low frequency and linear at high frequency. The depressed semicircle in the low frequency region can be related to the charge transfer resistance and the linear portion indicates that diffusion processes are occurring at the same time. The charge transport resistance (RCT) at the electrode surface can be quantified based on the diameter of the semi-circular part of plot and described by the equation below [58]. It is clear that the semicircle in the impedance spectra of GCE electrodes modified by SWNT/DNA branch-shaped hybrid nanostructures at oxidation and reduction peaks potentials were smaller than for other modified electrodes. Conversely, GCE/SWNT electrode had the largest semicircles.

the electrochemical activity and stability of the surface. From the slope of these lines and using the following equation [57]:

n2F 2 ⎞ Ip = ⎛ vAΓ ∗ ⎝ 4RT ⎠ ⎜

⎟

where Γ* is the surface coverage of the catalyst species (mol cm−2), A (cm2) is the surface area, ν being the potential sweep rate, F (faradic constant) and R ( 8.314 J K−1 mol−1) and taking the average of both cathodic and anodic results, Γ* values of around 1.8 × 10−5 mol cm−2 were obtained. Dependency of the current peaks on the square root of the potential sweep rates was linear (Fig. S7c, Supporting information) indicating that the process was diffusion controlled. These results were repeated for the other modified electrodes. These results showed nanobiocatalyst layer was stable that cues to stability of biosensing layer. 3.5. Electrochemical detection of defect and mismatch coupling in DNA The electrochemical properties of three types of SWNT/DNA hybridised structures were studied for detection of defect and mismatches in double-stranded DNA and non-complete self-hybridisation of DNA. Fig. 5a shows CVs of GCE/SWNT–P1&P1′, GCE/SWNT/match DNA hybrid nanostructures, GCE/SWNT/mismatch 1 DNA hybrid nanostructures, and GCE/SWNT/mismatch 1′ DNA hybrid nanostructures electrodes in 10 mM Fe (CN)63−/4− and 0.1 KCl solution at a potential sweep rate of 50 mVs−1. The GCE modified by SWNT/DNA branchshaped and self-assembled hybrid nanostructures formed by match and 7

Materials Science & Engineering C 104 (2019) 109886

A. Mirzapoor, et al.

respectively, which is higher than other modified electrodes. Whereas, the RCT of SWNT-P1&P1′/match P2 branch-shaped and self-assembled hybrid nanostructures were less than other modified electrodes (922.99 Ω and 532.28 Ω). Due to the presence of SWNTs on the surface of the electrode, the electron transfer kinetics decreased and RCT and Warburg increased. However, when the electrodes were modified by SWNT–P1&P1′/match P2 branch-shaped and self-assembled hybrid nanostructures, the RCT values decreased. This shows that branch-shaped and self-assembled hybrid nanostructures improve the conductivity and the electron transfer process. Thus, the equivalent circuit parameters for the impedance spectra of matched and mismatched hybridised modification (Table S1 & S2, Supporting information) layers illustrate that RCT of mismatch 1 & 1′ hybrid nanostructures at potential of oxidation peak were found as (2650.9 Ω &1578.5 Ω) and reduction peak were (773.12 Ω & 587.79 Ω) consequently. Whereas charge transfer resistance of match hybrid nanostructures at potential of oxidation peak was (922.99 Ω) and at reduction peak was (532.28 Ω) that illustrated relative conductivity of match hybrid nanostructure is more than those one. As can be seen from Tables S2 & S3 the diameter of the semicircle for the SWNT–P1&P1′/mismatch 1 P2 hybrid nanostructures modification layer in the Nyquist spectra is more than SWNT–P1&P1′/mismatch 1′ P2 hybrid nanostructures electrode. Previous computational study showed that conductivity of DNA is extremely dependant on second structure of DNA. According to this study electro conductivity of DNA is crucially dependant on distribution of molecular orbitals [60]. The electrochemical properties of SWNT/matched DNA hybridised branch-shaped nanostructures were also studied on printed carbon electrodes. Fig. 5a and b show CVs and LSVs of printed carbon electrodes modified with SWNT/matched DNA hybridised branch-shaped nanostructures compared with electrodes modified with just SWNTs. Results showed that due to the branch-shaped, self-assembled and hierarchical pattern on hybridisation, the oxidation and reduction peak current increased, suggesting that the SWNT/DNA nanonetwork was more conductive compared to SWNTs.

These results indicated that the charge transfer resistance of SWNT/ DNA branch-shaped hybrid nanostructures layers is lower than for pure SWNTs. In addition, for detection of incomplete coupling and defects in hybridised DNA, electrochemical conductivity of these nanostructures was studied by EIS. Nyquist diagrams of GCE/SWNT–P1&P1′, GCE/ SWNT/match DNA hybrid nanostructures, GCE/SWNT/mismatch 1 DNA hybrid nanostructures, GCE/SWNT/mismatch 1′ DNA hybrid nanostructures electrode at the oxidation peak shows in Fig. 4b and at the reduction peak presented in Fig. S9. Results showed that the spectra of GCE/SWNT/match DNA hybrid nanostructures had the smallest semicircle indicating that this self-assembled structure had the lowest charge transfer resistance and most conductivity. The impedance spectra illustrated that, mismatch and defects in non-complementary hybridised SWNT/DNA hybrid nanostructures had different and further charge transfer resistance compared to GCE/SWNT/match DNA hybrid nanostructures. In contrast, the charge transfer resistance of mismatch 1 SWNT/DNA hybrid nanostructures is bigger than mismatch 1′ SWNT/ DNA hybrid nanostructures. The equivalent circuit compatible with the Nyquist diagram is presented in Fig. 4c. In this electrical equivalent circuit, Rs, Rct and W represent solution resistance, charge transfer resistance and the Warburg which is electrical elements related to the diffusion processes. Qdl is constant phase element (CPE), corresponding to the double layer capacitance. The charge transport resistance (RCT) at the electrode surface can be quantified based on the diameter of the semi-circular part of plot and described by the following equation [59]:

Z(ω) = Rs +

RCT + σω−1/2

(

1 Cd σω2

)

+1

2

+ ω2Cd2 (RCT + σω−1/2)2

−j

1

ωCd (RCT + σ −1/2)2 + σω− 2 (σω1/2Cd + 1)

(

1 2

(Cd σω1/2 + 1)2 + ω2Cd2 RCT + σω− 2

)

where Rs is the solution resistance, Cd is the double layer capacitance, ω is the 2πf, where f is the frequency, and σ is defined as

σ=

RT ⎛ 1 + 2F 2A ⎜⎝ DO CO∗

3.6. Novelty of biosensing method and capabilities of self-assembled branched shape nanostructure

1 ⎞ DR CR∗ ⎟⎠

According to properties of SWNT/DNA branch shaped nanostructures we designed and developed a low-cost and low time consuming DNA hybridisation biodetection method. This detection approach operates without any labels or mediators and can be used for discrimination of mismatches in hybridised DNA. Table 2 showes comparative survey between the present work and previous common detection aproaches. The comparison indicated that electrochemical detection of mismatch based on SWNT/DNA branch shaped nanostructure can be used for fabrication of rapid, label free and low cost detection kit. Also hierarchical and self-assembled structure of SWNT/ DNA nanostructures prepared excellent matrix for differentiation of neurons in cell culture. However, due to good conductivity of SWNT/ DNA nanostructures we can utilize these for fabrication of DNA based nanowire.

where A is the area of the electrode, and DO and DR are the diffusion coefficients of oxidant and reductant, respectively. Co and CR represent the bulk concentrations of oxidant and reductant, respectively. To corroborate the equivalent circuit, the experimental data are fitted to equivalent circuit and the circuit elements are obtained. Table S2 & S3 (Supporting information) illustrates the equivalent circuit parameters for the impedance spectra of glassy carbon electrode (GCE), GCE/SWNT, GCE/SWNT–P1&P1′, GCE/SWNT–P1&P1′/match P2 hybrid nanostructures, GCE/SWNT–P1&P1′/mismatch 1 P2 hybrid nanostructures GCE/SWNT–P1&P1′/mismatch 1′ P2 hybrid nanostructures electrode at potential of oxidation peak and reduction peak respectively. According to calculation, the RCT of the GCE/SWNT electrode at the oxidation and reduction peak potentials were 3174.2 Ω and 1644.7 Ω,

Table 2 The comparison between the present works with previous common detection methods. Method

Approach

Transducer

PCR

Label

Sample preparation

Light-activated electrochemistry Ligase detection reaction (LDR) Field-effect transistor (FET) SWNT/DNA self-assembled nanostructure

Quantitative Quantitative Qualitative Qualitative

Electrochemical Bioluminescence Electrochemical Electrochemical

No Yes No No

Label free Enzyme Label free Label free

8

NO Yes NO NO

Time consumtion Some hours Some hours Some minutes Some minutes

DNA immobilisation Yes No Yes No

LOD

References

0.01 nM 50 nM 10 nM 5 μM

[62] [61] [11] Present work

Materials Science & Engineering C 104 (2019) 109886

A. Mirzapoor, et al.

4. Conclusion

(2010) 6986–6988. [14] F. Gao, Z. Zhu, J. Lei, Y. Geng, H. Ju, Biosens. Bioelectron. 39 (2013) 199–203. [15] M.E. Minaei, M. Saadati, M. Najafi, H. Honari, Journal of Applied Biotechnology Reports 2 (2015) 175–185. [16] Y. Qian, T. Fan, P. Wang, X. Zhang, J. Luo, F. Zhou, Y. Yao, X. Liao, Y. Li, F. Gao, Sensors Actuators B 248 (2017) 187–194. [17] Ch. Wang, Y. Qian, Y. Zhang, S. Meng, S. Wang, Y. Li, F. Gao, Sensors Actuators B 238 (2017) 434–440. [18] D.M.N. Ngavouka, P. Capaldo, E. Ambrosetti, G. Scoles, L. Casalisand, P. Parisse, Beilstein J. Nanotechnol. 7 (2016) 220–227. [19] M.T. Castaneda, et al., Biosens. Bioelectron. 22 (2007) 1961–1967. [20] A. Benvidi, A. Dehghani Firouzabadi, M. Dehghan Tezerjani, S.M. Moshtaghiun, M. Mazloum-Ardakani, A. Ansarin, J. Electroanal. Chem. 750 (2015) 57–64. [21] J. Wang, et al., Langmuir 19 (2003) 989–991. [22] N.L. Rosi, C.A. Mirkin, 105 (2005) 1547–1562. [23] Q. Zhao, Z. Gan, Q. Zhuang, Electroanalysis 14 (2002) 1609. [24] M.S. Dresselhaus, G. Dresselhaus, P. Eklund, Science of Fullerenes and Carbon Nanotubes, Academic Press, New York, 1996. [25] L. Dai, Intelligent Macromolecules for Smart Devices: From Materials Synthesis to Device Applications, Springer-Verlag, London, 2004. [26] M. Valcarcel, S. Cardenas, B.M. Simonet, Anal. Chem. 79 (2007) 4788–4797. [27] J.M. Lobez, T.M. Swager, Angew Chem Int Ed Engl 49 (2010) 95–98. [28] F. Wang, H. Gu, T.M. Swager, J. Am. Chem. Soc. 130 (2008) 5392–5393. [29] Y. Weizmann, D.M. Chenoweth, T.M. Swager, J. Am. Chem. Soc. 132 (2010) 14009–14011. [30] J. Wang, Electroanalysis 17 (2005) 7–14. [31] E. Katz, I. Willner, ChemPhysChem 5 (2004) 1084–1104. [32] Y. Weizmann, D.M. Chenoweth, T.M. Swager, J. Am. Chem. Soc. 133 (2011) 3238–3241. [33] L. Sinan, H. Pingang, J. Dong, Z. Guo, L. Dai, J. Am. Chem. Soc. 127 (2005) 14–15. [34] Y. Lu, X. Yang, Y. Ma, F. Du, Z. Liu, Y. Chen, Chem. Phys. Lett. 419 (2006) 390–393. [35] D.M. Guldi, M. Nazario, Carbon Nanotubes and Related Structures: Synthesis, Characterization, Functionalization, and Applications, Wiley, 2010. [36] A. Mirzapoor, B. Ranjbar, Phys. E. 93 (2017) 208–215. [37] S.E. Baker, W. Cai, T.L. Lasseter, K.P. Weidkamp, R.J. Hamers, Nano Lett. 2 (2002) 1413–1417. [38] M. Hazani, F. Hennrich, M. Kappes, R. Naaman, D. Peled, V. Sidorov, D. Shvarts, Chem. Phys. Lett. 391 (2004) 389–392. [39] B. Ranjbar, P. Gill, Chem. Biol. Drug Des. 74 (2009) 101. [40] I. Protasevich, B. Ranjbar, V. Labachov, A. Makarov, R. Gilli, B. Claudette, D. Lafitte, J. Haiech, Biochem. 36 (1997) 2017. [41] C.N. Rao, B.C. Satishkumar, A. Govindaraj, M. Nath, Nanotubes, ChemPhysChem 2 (2001) 78–105. [42] R.H. Baughman, A.A. Zakhidov, W.A. De Heer, Science 297 (2002) 787. [43] R.J. Chen, S. Bangsaruntip, K.A. DrouvalakisKam, N.W.S. Shim, M. Li, Y. Kim, W. Utz, P.J. Dai, H. J, PNAS 100 (2003) 4984. [44] M.S. Strano, C.A. Dyke, M.L. Usrey, P.W. Barone, M.J. Allen, H.W. Shan, C. Kittrell, R.H. Hauge, J.M. Tour, R.E. Smalley, Science 301 (2003) 1519. [45] L. Ninni, M.S. Camargo, A.J.A. Meirelles, Thermochim. Acta 328 (1999) 169–176. [46] Y. Murakami, E. Einarsson, T. Edamura, S. Maruyama, Phys. Rev. Lett. 94 (2005) 7402. [47] A.G. Rance, H.D. Marsh, J.R. Nicholas, N.A. Khlobystov, Chem. Phys. Lett. 493 (2010) 19. [48] Ch. Zha, K. Qu, C. Xu, J. Ren, X. Qu, Nucleic Acids Res. 39 (2011) 9. [49] V.A. Bloomfield, D.M. Crothers, I. Jr Tinoco, J.E. Hearst, D.E. Wemmer, P.A. Kollman, D.H. Turner, with contribution from, Nucleic Acids: Structures, Properties, and Functions, University Science Books, Sausalito, California, USA, 2000. [50] C.A. Sprecher, W.A. Baase, W.C. Johnson Jr., Biopolymers 18 (1979) 1009. [51] A. Azizi, B. Ranjbar, T. Tohidi Moghadam, Z. Bagheri, S. Ranjbari Baglou, J. of Physics D: Applied Physics. 47 (2014) 315401. [52] J.H. Riazance, W.A. Baase, W.C. Johnson Jr., K. Hall, P.v. CNZ, I.Jr. Tinoco, Nucleic Acids Res. 13 (1985) 4983–4989. [53] B. Unnikrishnan, S. Palanisamy, S.M. Chen, Biosens. Bioelectron. 39 (2013) 70–75. [54] J.M. Nugent, K.S.V. Santhanam, A. Rubio, P.M. Ajayan, NanoLetters 1 (2001) 87–91. [55] I. Danaee, M. Jafarian, A. Mirzapoor, F. Gobal, M.G. Mahjani, Electrochim. Acta 55 (2010) 2093–2100. [56] M. Jafarian, A. Mirzapoor, I. Danaee, S.A.A. Shahnazi, F. Gobal, SCIENCE CHINA Chem. 55 (9) (2012) 1819–1824. [57] A.J. Bard, L.R. Faulkner, A.J. Bard (Ed.), Electrochemical Methods, Fundamentals and Applications, Wiley, 2001. [58] J.A. Harrison, Z.A. Khan, J. Electroanal. Chem. 28 (1970) 131. [59] B.Y. Chang, S.M. Park, Anal. Chem. 78 (2006) 1052–1060. [60] A.H. Taghavi, B. Ranjbar, Iranian Journal of Biology 26 (2013) 1. [61] Qinfeng Xu, Si-qiang Huang, Fei Ma, Bo Tang, Chun-yang Zhang, Anal. Chem. 88 (4) (2016) 2431–2439. [62] L. Zarei, R. Tavallaie, M.H. Choudhury, S.G. Parker, P. Bakthavathsalam, S. Ciampi, V.R. Gonçales, J.J. Gooding, Langmuir 34 (49) (2018) 14817–14824.

In this study, we used a self-assembly approach to fabricate hierarchical, self-assembled SWNT/DNA branch-shaped nanostructures. Spectroscopic and spectropolarimetric results showed that in three dimensional self-assembled and hybrid nanostructures, the UV–Vis specific absorption peak of DNA increased, and specific signals of DNA in CD spectra appeared. The self-assembled branched nanostructures of SWNT/DNA formed a three dimensional nanonetwork that transferred electrons faster than free SWNTs. Electrochemical experiments indicated that the oxidation and reduction peaks of Fe(CN)64−/Fe (CN)63−, on the surface of GCE/branch-shaped SWNT/match DNA hybrid nanostructure-modified electrodes were higher than GCE/ SWNT-modified electrodes. Also, the charge transfer resistance of the SWNT modification layer was higher than branch-shaped SWNT/DNA hybrid nanostructures, indicating that these hybrid nanostructures have excellent conductivity. In the light of these advantageous findings, hybrid nanostructures were employed as an improved DNA biosensor. The assembly of SWCNT networks linked by oligonucleotides could serve to detect DNA mismatches. We demonstrated that SWNT/DNA hybrid nanostructures formed by mismatch 1 and 1′ hybridised DNA have different charge transfer resistances depending on matched and complementary hybridised DNA which can be used for detection of mismatches in duplex oligonucleotides. We designed a rapid, low cost and label free detection of mismatches in hybridised DNA that can be used for detection of various mutations in one specific sequence of genome. Also, this self-assembled nanostructure can be used in fabrication of bioscaffold for neuron cell culture or bioprinting ink. However, this SWNT/DNA based bioelectrode can be used for fabrication of DNA micro array chip. Acknowledgments The authors would like to thank research council of Tarbiat Modares University and Linköping University for Financial support of this work. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.msec.2019.109886. References [1] P. Fleshner, G.D. Braunstein, G. Ovsepyan, T.R. Tonozzi, A. Kammesheidt, Cancer Med 7 (1) (2018) 167–174. [2] A. Kammesheidt, Th.R. Tonozzi, S.W. Lim, G.D. Braunstein, Int J Mol Epidemiol Genet 9 (1) (2018) 1–12. [3] A. Chen, G. Braunstein, M. Anselmo, J. Jaboni, F. Viloria, J. Neidich, X. Li, A. Kammesheidt, Cancer Translational Medicine 3 (2) (2017) 39–45. [4] I. Garcia-Murillas, G. Schiavon, B. Weigelt, C. Ng, S. Hrebien, R.J. Cutts, M. Cheang, P. Osin, A. Nerurkar, I. Kozarewa, J.A. Garrido, M. Dowsett, J.S. Reis-Filho, I.E. Smith, N.C. Turner, Sci. Transl. Med. 7 (30) (2015) 133. [5] H. Willems, A. Jacobs, W.W. Hadiwikarta, T. Venken, D. Valkenborg, N. Van Roy, et al., PLoS One 12 (5) (2017) e0177384. [6] V. Tjong, H. Yu, A. Hucknall, S. Rangarajan, A. Chilkoti, Anal. Chem. 83 (2011) 5153–5159. [7] J.I. AbdulRashid, N.A. Yusof, Sensing and Bio-Sensing Research 16 (2017) 19–31. [8] N.B. Muren, E.D. Olmon, J.K. Barton, Phys. Chem.Chem. Phys. 14 (2012) 13754–13771. [9] B. Xu, D. Zheng, W. Qiu, F. Gao, S. Jiang, Q. Wang, Biosens. Bioelectron. 72 (2015) 175–181. [10] Y.J. Kim, M.M. Rahman, J.J. Lee, Sens. Actuators B Chem. 177 (2013) 172–177. [11] M. Kaisti, A. Kerko, E. Aarikka, P. Saviranta, Z. Boeva, T. Soukka, A. Lehmusvuori, Sci. Rep. 7 (2017) 15734. [12] H. Ji, F. Yan, J. Lei, H. Ju, Anal. Chem. 84 (2012) 7166–7171. [13] J. Zhang, X. Wu, P. Chen, N. Lin, J. Chen, G. Chen, F. Fu, Chem. Commun. 46

9