- Email: [email protected]
Electrostatic interaction between NADH-cytochrome b5 reductase and cytochrome b5 studied by site-directed mutagenesis
Biochimica et Biophysica Acta 1384 Ž1998. 16–22
Electrostatic interaction between NADH-cytochrome b5 reductase and cytochrome b5 studied by site-directed mutagenesis Komei Shirabe ) , Takushi Nagai, Toshitsugu Yubisui 1, Masazumi Takeshita Department of Biochemistry, Oita Medical UniÕersity, Oita, Japan Received 23 June 1997; revised 18 August 1997; accepted 26 August 1997
Abstract Electrostatic interaction between NADH-cytochrome b5 reductase and cytochrome b5 was studied by site-directed mutagenesis. The target residues for mutagenesis were selected on the basis of the previously reported chemical cross-linking study of these two proteins, which implicated possible charge-pair interactions between Lys-41, Lys-125, Lys-162, and Lys-163 of the enzyme, and Glu-47, Glu-48, Glu-52, Glu-60, Asp-64 Žgroup A., and heme propionate of cytochrome b5 . Mutant reductases that lost one of the above-listed Lys residues showed higher K m values for cytochrome b5 and lower k cat values than those of the wild type, suggesting that all of the examined Lys residues participate in binding with cytochrome b5 as reported previously. In contrast, a removal of one of Žor even all of. the group A residues from cytochrome b5 by mutagenesis caused no significant effect on the catalytic properties of cytochrome b5 . Additional elimination of another set of negative residues ŽGlu-41, Glu-42, Asp-57, and Glu-63 Žgroup B.., which are also located close to heme, elevated the K m value by more than five folds. These results suggest that there should be other acidic residueŽs. than group A in cytochrome b5 which participate in binding with NADH-cytochrome b5 reductase. q 1998 Elsevier Science B.V. Keywords: NADH-cytochrome b5 reductase; Site-directed mutagenesis; Electron transfer; Protein–protein interaction
1. Introduction Abbreviations: b5 R, NADH-cytochrome b5 reductase; bp, base pairs; SDS, sodium dodecyl sulfate; E. coli, Escherichia coli; group A ™ Ala mutant, cytochrome b5 mutant whose Glu47, Glu-48, Glu-52, Glu-60, Asp-64 are all changed to Ala; group B™ Ala mutant, cytochrome b5 mutant of which Glu-41, Glu-42, Asp-57, and Glu-63 were replaced by Ala ) Corresponding author. Department of Biochemistry, Oita Medical University, Hasama-machi, Oita 879-55, Japan. Fax: q81-975-49-6302; E-mail: [email protected] 1 Present address: Department of Biology, Faculty of Science, Kochi University, Kochi 780, Japan.
Human NADH-cytochrome b5 reductase Ž b5 R: EC 1.6.2.2. is an FAD containing oxidoreductase. The function of the enzyme is to catalyze the transfer of two electrons from NADH to two molecules of cytochrome b5 in one catalytic cycle w1,2x. The electrons of cytochrome b5 are transferred to various acceptors, thereby participating in various metabolic pathways. Soluble and membrane bound forms, are known for both b5 R and cytochrome b5. The soluble
0167-4838r98r$19.00 q 1998 Elsevier Science B.V. All rights reserved. PII S 0 1 6 7 - 4 8 3 8 Ž 9 7 . 0 0 1 4 6 - 5
K. Shirabe et al.r Biochimica et Biophysica Acta 1384 (1998) 16–22
forms of b5 R and cytochrome b5 existing erythrocytes and participate in methemoglobin reduction w3x. The membrane bound form is localized in the endoplasmic reticulum of somatic cells and functions in the elongation and desaturation of fatty acids w4x, cholesterol biosynthesis w5x, and some of cytochrome P-450 mediated drug metabolism w6x. Electron transfer from cytochrome b5 to cytochrome c has been a model for the study of molecular basis of protein–protein interaction in the electron transfer mechanism w7–9x. This model system is, however, an artificial electron transfer that is not present in vivo. Physiological electron donor of cytochrome b5 is NADH-cytochrome b5 reductase and acceptors are methemoglobin, fatty acid desaturase, and cytochrome P-450. Since bacterial expression systems are now available for both b5 R and cytochrome b5 w10,11x, it is now feasible to analyze electrostatic interaction by site-directed mutagenesis on the basis of X-ray structure of the proteins w12–14x. Electrostatic interaction between cytochrome b5 and b5 R was first studied by means of chemical modification experiments by Dailey and Strittmatter w15x. Since then they have identified several carboxyl groups in cytochrome b5 and lysyl residues in b5 R that are involved in the interaction w16x. They later confirmed by site-directed mutagenesis that the lysyl residues Ž Lys-41, 125, 162, and 163. in b5 R indeed participates in the interaction w17x as also shown in the present study. The docking model of cytochrome b5 and b5 R based on the crystal structure of both proteins was recently reported w18x. We examined the role of carboxyl residues of cytochrome b5 in the interaction with b5 R by site-directed mutagenesis and propose a possibility that sites for interaction in cytochrome b5 with b5 R and cytochrome c may be different.
17
2. Materials and methods 2.1. Materials Restriction endonucleases and T4 polynucleotide kinase were purchased from Takara Shuzo ŽKyoto, Japan. . w a- 35 SxdCTP Ž) 1000 Cirmmol., Sequenase DNA sequencing kit, and an in vitro oligonucleotide-directed mutagenesis system were the products of Amersham ŽUK. . Oligonucleotides for mutagenesis were synthesized with a Model 8600 DNA synthesizer ŽBiosearch, San Rafael, CA, USA.. DEAEToyopearl used for enzyme purification was the product of Tosoh Ž Tokyo, Japan.. 5X-AMP-Sepharose 4B, Sephacryl S-200, and Sephadex G-25 were products of Pharmacia ŽUppsala, Sweden. . Bovine a-thrombin was a product of Sigma ŽSt. Louis, MO, USA.. All other chemicals were of reagent grade. 2.2. Construction of mutant expression plasmids for b5 R The HindIII–PstI fragment Ž503 bp., which includes the NH 2-terminal portion of b5 R cDNA, was excised from expression plasmid placZX-APR-b5 R w10x and cloned into HindIII–Pst I site of M13mp19. Site-directed mutagenesis utilized synthetic primers as shown in Table 1 and the strand selection method of Taylor et al. w19x, using the Amersham mutagenesis system. M13 phage single-strand DNA was prepared from four independent plaques and mutant clones were selected by dideoxy sequencing w20x. Nucleotide sequences of the HindIII–Pst I fragments were verified. The mutated HindIII–Pst I fragments were excised from the mutant M13 phage DNA and cloned into pUC-b5 RrB to construct the mutant expression plasmid w10,21x.
Table 1 Synthetic oligonucleotides used for construction of expression plasmids for human b5 R mutant enzymes Changed amino acid
Strand
Sequence
Codon change
Amino acid change
41 125 162 163 162r163
anti-sense anti-sense sense sense sense
AGCGGGTACGCGATGTCCGG TGAGACATCGCCCCTCCAGC CGACCTGACGCAAAGTCCAAC CCTGACAAAGCGTCCAACCC CGACCTGACGCAGCGTCCAACCC
AAG ™ GCG AAG ™ GCG AAA ™ GCA AAG ™ GCG AAA-AAG™ GCA-GCG
Lys ™ Ala Lys ™ Ala Lys ™ Ala Lys ™ Ala Lys ™ Ala
Base changes are shown by underlines.
18
K. Shirabe et al.r Biochimica et Biophysica Acta 1384 (1998) 16–22
2.3. Construction of mutant expression plasmids for human erythrocyte cytochrome b5 The expression vector for human erythrocyte cytochrome b5 was described previously w11x. The EcoRI–HindIII fragment Ž 686 bp., which includes cytochrome b5 cDNA was excised from the vector and cloned into EcoRI–HindIII site of M13mp19. Synthetic oligonucleotides were used to construct the mutant plasmids as shown in Table 1.
using potassium ferricyanide was calculated on the base of the difference in absorption coefficient of the oxidized and reduced compounds at 420 nm Ž 1 mMy1 cmy1 .. Apparent K m values for cytochrome b5 and k cat values were determined in the presence of an excess concentration Ž100 m M. of NADH with various concentrations of cytochrome b5 in 5 mM Tris– HCl buffer ŽpH 7.5..
3. Results 2.4. Purification of wild type and mutant NADH-cytochrome b5 reductase Mutant forms of b5 R were expressed in E. coli RB791 and purified as described previously w10x. The purity of the enzymes was judged by SDS-polyacrylamide gel Ž12.5%. electrophoresis w22x. The enzyme concentration was determined on the basis of the absorption coefficient of FAD at 450 nm Ž 11.3 mMy1 cmy1 . released from the enzyme by adding 0.1% of SDS w23x or by the method of Lowry et al. w24x with bovine serum albumin as a standard. Spectrophotometric determinations of the enzymes were performed with a Union spectrophotometer ŽSM401; Union Giken, Osaka, Japan. and a Hitachi spectrophotometer, Model 200. 2.5. Purification of wild type and cytochrome b5 mutant Mutant forms of human erythrocyte cytochrome b5 were expressed in E. coli RB791 and purified as described previously w11x. The concentration of cytochrome b5 was determined from the reduced minus oxidized absorbance difference at 424 nm using an extinction difference of 124 mMy1 cmy1 w25x.
3.1. Mutagenesis and preparation of b5 R mutants and cytochrome b5 s We have constructed 5 and 7 mutant expression plasmids, for b5 R and cytochrome b5 respectively, using the oligonucleotides listed in Tables 1 and 2 and the expression system described previously w10,11x. Each mutant enzyme was expressed at a level approximately equivalent to the wild type Ždata not shown.. All of the enzymes were purified using DEAE-Toyopearl chromatography and 5X-AMP-Sepharose 4B affinity chromatography as described previously w10x. Digestion with a-thrombin to release the authentic soluble form of mutant enzymes from the recombinant fusion protein w10x did not cause any detectable changes in the enzymatic activity. Yield of the mutant enzymes during purification was 22.5%, 6.5%, 21.9%, 22.3%, and 26.0% for K41A, K125A, K162A, K163A, and K162ArK163A, respectively. Each mutant protein gave a single band on SDS-polyacrylamide gel electrophoresis at the same mobility as the wild type Ž data not shown. . All cytochrome b5 mutants were expressed in E. coli and purified to apparently homogeneity as judged by SDS-polyacrylamide gel electrophoresis Ždata not shown. w11x with almost comparable yields as the wild type.
2.6. Assay of enzyme actiÕity 3.2. Catalytic properties of b5 R mutants Specific activities of b5 R mutants were determined in the presence of an excess concentration Ž 100 m M. of NADH using 4 m M cytochrome b5 mutants or 0.5 mM potassium ferricyanide as electron acceptors. The rate of reaction using cytochrome b5 was calculated on the base of the difference of the absorbance of the reduced and the oxidized forms of cytochrome b5 at 424 nm Ž124 mMy1 cmy1 .. The rate of reaction
To characterize the lysyl residues of b5 R implicated in charge-pairing with carboxyl residues of cytochrome b5 , specific activities of b5 R mutants using the wild type cytochrome b5 were determined as shown in Table 3. All mutants have much less activities than the wild type. The values of specific activities using the wild type cytochrome b5 as a
K. Shirabe et al.r Biochimica et Biophysica Acta 1384 (1998) 16–22
19
Table 2 Synthetic oligonucleotides used for construction of expression plasmids for human erythrocyte cytochrome b5 Amino acid position
Strand
Sequence
Codon change
Amino acid change
Group A mutants 47 48 47r48 52 60 64
sense sense sense sense sense sense
CTGGTGGGGCAGAAGTTTT GTGGGGAAGCAGTTTTAAG CTGGTGGGGCAGCAGTTTTAAG TTTTAAGGGCACAAGCTGG ACGCTACTGCGAACTTTGA AACTTTGAGGCTGTCGGGC
GAA™ GCA GAA™ GCA GAA-GAA™ GCA-GCA GAA™ GCA GAG™ GCG GAT ™ GCT
Glu ™ Ala Glu ™ Ala Glu ™ Ala Glu ™ Ala Glu ™ Ala Asp ™ Ala
Group A r B mutant 41r42 57 63r64
sense sense sense
AAATTTCTGGCAGCGCATCCTGGT AGCTGGAGGTGCCGCTACTG GAACTTTGCGGCTGTCGGG
GAA-GAG™ GCA-GCG GAC ™ GCC GAG-GAT™ GCG-GCT
Glu ™ Ala Asp ™ Ala Glu ™ Ala
Base changes are shown by underlines. An expression plasmid containing amino acid substitutions from E47, E48, E52, E60, and D64 to all Ala was constructed by two steps as follows. The first step of mutagenesis was performed using E52A and E60A oligonucleotides Ždouble primers. and M13 phage containing E47ArE48A mutations as a template. As a second step, mutagenesis was performed using D64A oligonucleotide and M13 phage containing E47ArE48ArE52ArE60A mutations as a template. Group ArB mutant was generated by synthesizing the complementary strand to group A mutant-single strand DNA with E41r42™ A, D57 ™ A, and E63r64™ A as primers.
substrate were 3.8%, 18.2%, 5.6%, 6.3%, and 0.5% of those of the wild type for K41A, K125A, K162A, K163A, and K162ArK163A, respectively. When we used ferricyanide as an artificial electron acceptor, the activity of every mutant b5 R was almost the same as that of the wild type, indicating that electron transfer activity of the mutants were not impaired, rather the deficiency is in the step of interaction of two proteins. Apparent k cat and K m values were determined using the b5 R mutants and the wild type cytochrome b5 ŽTable 4.. As shown in Table 4, the values of apparent k cat and K m using the wild type cyTable 3 Catalytic activities of b5 R mutants b5 R wild K41A K125A K162A K163A K162ArK163A
tochrome b5 were 864 sy1 and 6.8 m M, respectively as previously reported w21,26x. K m values were 6.2fold, 5.3-fold, 2.6-fold, 5.7-fold, and 8.3-fold increased for K41A, K125A, K162A, K163A, and K162r163A, respectively as compared with that of the wild type b5 R. The k cat values were 14%, 55%, 8.7%, 31%, and 1.6% of that of the wild type b5 R for K41A, K125A, K162A, K163A, and K162r163A, respectively. The decrease in k cat values together with the elevation of K m values indicated that the efficiency of electron transfer from b5 R to cytochrome b5 are also affected in the mutants. It is worth noting that the k cat value of K163A was
Table 4 Kinetic properties of b5 R mutants using wild-type cytochrome b5
Electron acceptors cytochrome b5
Ferricyanide
288"15.2 11.1"1.6 52.4"5.6 16.2"2.2 18.2"1.4 1.3"0.3
1234"86 1191"72 1215"94 1196"68 1254"74 1176"80
Specific activities Ž m molrminrmg. of b5 R mutants were measured using 4 m M cytochrome b5 and 0.5 mM potassium ferricyanide.
b5 R
Cytochrome b5 Žwild type. a k cat y1 .
wild K41A K125A K162A K163A K162ArK163A a
Žs 864"95 125"15 472"67 75"4.5 256"18 14"0.7
K ma Ž m M. 6.8"0.5 42.3"3.2 36.2"4.3 17.5"1.1 39.0"2.6 56.6"3.3
Apparent values were obtained as described under Section 2.
20
K. Shirabe et al.r Biochimica et Biophysica Acta 1384 (1998) 16–22
restored close to the level of the wild type when the activity was measured with group A ™ Ala cytochrome b5 mutant as an electron acceptor Ž data not shown.. This result may suggest that the negative residues of cytochrome b5 , that are normally neutralized by the positive charge of K163, interfere with complex formation between the wild type cytochrome b5 and K163A b5 R. Thus, the examined lysyl residues of b5 R may participate in complex formation with cytochrome b5. 3.3. Catalytic properties of cytochrome b5 mutants Any of the cytochrome b5 mutants of which one of Glu-47, Glu-48, Glu-52, Glu-60, or Asp-64 was replaced by Ala had no significant change in K m and k cat values Ž Table 5. . Moreover, the cytochrome b5 mutant in which all of group A residues were changed to Ala also showed almost the same catalytic properties as the wild type. These results suggest that none of these residues are involved in the electrostatic interaction with b5 R in contrast to the implication from the chemical modification experiments. To examine the role of other negative residues close to heme group, we generated cytochrome b5 mutant of which both of group A and group B residues were replaced by Ala. The mutant displayed a K m value about 5 fold higher than that of the wild type with no significant change in the k cat value. We used 5 mM Tris–HCl ŽpH 7.5. for the kinetic studies, since the enzyme has more than 80% activity at pH 7.5 of the highest activity at pH 6.6 w27x and is more stable at pH 7.5 than acidic pH. Since the k cat values of all the Table 5 Kinetic properties of wild-type b5 R using cytochrome b5 mutants Cytochrome b5 wild E47A E48A E47ArE48A E52A E60A D64A Group A ™ Ala Group ArB™ Ala a
b5 R Žwild type. k cat Žsy1 . a
K m Ž m M. a
864"95 1085"124 727"54 1084"142 1062"86 1134"112 873"74 790"67 754"78
6.8"0.5 11.3"2.1 4.1"0.6 7.8"0.5 7.9"1.1 9.8"0.8 10.4"0.9 9.7"0.7 41.3"3.7
Apparent values were obtained as described under Section 2.
mutants were not significantly changed, the mutations might not cause shift of the optimal pH. These results suggest that at least some of group B residues, but not group A residues, participate in the interaction with b5 R.
4. Discussion In the present study, we have generated b5 R mutants and cytochrome b5 s by means of bacterial expression system and site-directed mutagenesis in order to examined the role of the ionic side chains in the electrostatic interaction of these two proteins on the basis of chemical cross-linking study which suggested interaction between K41, K125, K162, and K163 of b5 R and E47, E48, E52, E60, D64 of cytochrome b5 w17x. Specific activities of b5 R mutants Ž K41, K125, K162, and K163. measured with potassium ferricyanide as an electron acceptor, were almost the same as that of the wild type ŽTable 2., suggesting that electron transfer from NADH to b5 R is intact in all mutant enzymes. Specific activities of all of b5 R mutants were much less than that of the wild type and the K m values were significantly elevated when the wild type cytochrome b5 was used as an electron acceptor ŽTable 4.. These data on the human proteins are consistent with the report on the steer enzyme by Strittmatter et al. w16x except that the K m and k cat values of K162 and K163 are somewhat different in these two reports probably due to the difference of species of the proteins examined. From these results we concluded that four Lys residues K41, K125, K162, and K163 may participate in the electrostatic interaction with cytochrome b5. K41 is the third residue of the first b-strand in N-terminal domain of the enzyme w13,14x and corresponds to K122 of Arabidopsis thaliana nitrate reductase flavopeptide which has about 45% sequence similarity to b5 R w21x. K125 is located in the N-terminus of short a-helix in the N-terminal domain of the enzyme w28x. K162 and K163 are located in the last part of the linker region that connects N-terminal and C-terminal domains of the enzyme and there exist one Lys residue in the corresponding location of nitrate reductase. Some of the features of the interaction between cytochrome
K. Shirabe et al.r Biochimica et Biophysica Acta 1384 (1998) 16–22
21
Fig. 1. Stereo view of bovine cytochrome b5. Side chains of negatively charged residues and heme prosphetic group of bovine cytochrome b5 are shown w12x. The numbering of the residues are based on that of human cytochrome b5. Group A negative residues are boxed. Circled residues are group B residues.
b-like heme protein and flavopeptide are, therefore, probably conserved among human b5 R-cytochrome b5 and higher plant nitrate reductase. It has been suggested from chemical cross-linking studies w16x that E47, E48, E52, E60, D64 of cytochrome b5 Žgroup A residues, see Fig. 1. are involved in the binding with b5 R. In our cytochrome b5 mutant in which one of or all of these residues were changed to Ala produced K m and k cat values that were not significantly changed, indicating that none of these residues participate in the interaction with b5 R; this in contrasts with the result of the chemical modification experiments which suggested the interaction of those residues with the positive residues of b5 R w15x. On the other hand, E47, E52, and D64 of group A residues have previously been shown by site-directed mutagenesis w9x to participate in interaction with cytochrome c. Thus we suggest that those residues of cytochrome b5 which participate in the interaction with cytochrome c Želectron acceptor. do not participate in the interaction with the native b5 R Želectron donor.. Examination of the role of other acidic residues located close to heme group of cytochrome b5 in the interaction with b5 R revealed that changing of E41, E42, D57, and E63 Žgroup B. to Ala Žin addition to group A residues. caused a five fold increase in the K m value with no significant change in k cat value. This indicates that some of the group B residues participate in the interaction of cytochrome b5 with b5 R. These results suggest that E47, E52, and D64 of
cytochrome b5 , which are clustered on one side of the molecule Župper side of cytochrome b5 in Fig. 1., interact with positive residues of cytochrome c Želectron acceptor., and that some of the group B residues, which are located on the other side of cytochrome b5 , are responsible for the interaction with b5 R Želectron donor.. We are now in the process of generating several cytochrome b5 mutants, of which one of group B and other candidate residues Žfor example D70. are replaced by Ala, to identify the responsible residueŽs. for the interaction with b5 R. These studies will lead us to modify the recently reported docking model for the complex of bovine cytochrome b5 and porcine NADH-cytochrome b5 reductase by Nishida and Miki w18x which include Glu-48 of cytochrome b5 ŽGlu-44 in bovine. as a candidate residue for the interaction. Acknowledgements We thank Dr. M. Tamura for discussion. This work was supported in part by a Grant-in-aid from the Ministry of Education, Science, and Culture of Japan Žto K.S... References w1x P. Strittmatter, J. Biol. Chem. 240 Ž1965. 4481–4487. w2x T. Iyanagi, Biochemistry 16 Ž1977. 2725–2730. w3x D.E. Hultquist, P.G. Passon, Nat. New Biol. 229 Ž1971. 252–254.
22
K. Shirabe et al.r Biochimica et Biophysica Acta 1384 (1998) 16–22
w4x N. Oshino, Y. Imai, R. Sato, J. Biochem. 69 Ž1971. 155–167. w5x S.R. Keyes, D.L. Cinti, J. Biol. Chem. 255 Ž1980. 11357– 11364. w6x V.V.R. Reddy, D. Kupfer, E. Capsi, J. Biol. Chem. 252 Ž1977. 2797–2801. w7x K.K. Rogers, T.C. Pochapsky, S.G. Sliger, Science 240 Ž1988. 1657–1659. w8x M.R. Mauk, A.G. Mauk, Biochemistry 25 Ž1986. 7085– 7091. w9x K.K. Rogers, S.G. Sliger, J. Mol. Biol. 221 Ž1991. 1453– 1460. w10x K. Shirabe, T. Yubisui, M. Takeshita, Biochim. Biophys. Acta 1008 Ž1989. 189–192. w11x T. Nagai, K. Shirabe, T. Yubisui, M. Takeshita, Blood 81 Ž1993. 808–814. w12x F.S. Mathew, M. Levine, P. Argos, J. Mol. Biol. 64 Ž1972. 449–464. w13x T. Takano, S. Bandoh, T. Horii, M. Higashiyama, M. Satoh, K. Ogawa, Y. Katsuya, M. Danno, T. Yubisui, K. Shirabe, M. Takeshita Ž1993. in Flavins and Flavoproteins, Walters de Gruyter, Berlin, pp. 409–412. w14x H. Nishida, K. Inaka, M. Yamanaka, S. Kaida, K. Kobayashi, K. Miki, Biochemistry 34 Ž1995. 2763–2767. w15x H.A. Dailey, P. Strittmatter, J. Biol. Chem. 254 Ž1979. 5388–5396.
w16x P. Strittmatter, C.S. Hackett, G. Korza, J. Ozols, J. Biol. Chem. 265 Ž1990. 21709–21713. w17x P. Strittmatter, J.M. Kittler, J.E. Coghill, J. Ozols, J. Biol. Chem. 267 Ž1992. 2519–2523. w18x H. Nishida, K. Miki, Proteins 26 Ž1996. 32–41. w19x J.W. Taylor, J. Ott, F. Eckstein, Nucl. Acids Res. 13 Ž1985. 8765–8785. w20x F. Sanger, S. Nicklen, A.R. Coulson, Proc. Natl. Acad. Sci. U.S.A. 76 Ž1977. 5463–5467. w21x K. Shirabe, T. Yubisui, N. Borgese, C. Tang, D.E. Hultquist, M. Takeshita, J. Biol. Chem. 267 Ž1992. 20416–20421. w22x U.K. Laemmli, Nature 227 Ž1970. 680–685. w23x K. Shirabe, Y. Fujimoto, T. Yubisui, M. Takeshita, J. Biol. Chem. 269 Ž1993. 5952–5957. w24x O.H. Lowry, N.J. Rosenbrough, A.L. Farr, R.J. Randall, J. Biol. Chem. 193 Ž1951. 265–275. w25x T. Yubisui, K. Murakami, M. Takeshita, T. Takano, Biochim. Biophys. Acta 936 Ž1988. 447–451. w26x K. Shirabe, T. Yubisui, T. Nishino, M. Takeshita, J. Biol. Chem. 266 Ž1991. 7531–7536. w27x T. Yubisui, M. Takeshita, J. Biochem. ŽTokyo. 91 Ž1982. 1467–1477. w28x G.E. Hyde, N.M. Crawford, W.H. Campbell, J. Biol. Chem. 266 Ž1991. 23542–23547.
Electrostatic interaction between NADH-cytochrome b5 reductase and cytochrome b5 studied by site-directed mutagenesis Komei Shirabe ) , Takushi Nagai, Toshitsugu Yubisui 1, Masazumi Takeshita Department of Biochemistry, Oita Medical UniÕersity, Oita, Japan Received 23 June 1997; revised 18 August 1997; accepted 26 August 1997
Abstract Electrostatic interaction between NADH-cytochrome b5 reductase and cytochrome b5 was studied by site-directed mutagenesis. The target residues for mutagenesis were selected on the basis of the previously reported chemical cross-linking study of these two proteins, which implicated possible charge-pair interactions between Lys-41, Lys-125, Lys-162, and Lys-163 of the enzyme, and Glu-47, Glu-48, Glu-52, Glu-60, Asp-64 Žgroup A., and heme propionate of cytochrome b5 . Mutant reductases that lost one of the above-listed Lys residues showed higher K m values for cytochrome b5 and lower k cat values than those of the wild type, suggesting that all of the examined Lys residues participate in binding with cytochrome b5 as reported previously. In contrast, a removal of one of Žor even all of. the group A residues from cytochrome b5 by mutagenesis caused no significant effect on the catalytic properties of cytochrome b5 . Additional elimination of another set of negative residues ŽGlu-41, Glu-42, Asp-57, and Glu-63 Žgroup B.., which are also located close to heme, elevated the K m value by more than five folds. These results suggest that there should be other acidic residueŽs. than group A in cytochrome b5 which participate in binding with NADH-cytochrome b5 reductase. q 1998 Elsevier Science B.V. Keywords: NADH-cytochrome b5 reductase; Site-directed mutagenesis; Electron transfer; Protein–protein interaction
1. Introduction Abbreviations: b5 R, NADH-cytochrome b5 reductase; bp, base pairs; SDS, sodium dodecyl sulfate; E. coli, Escherichia coli; group A ™ Ala mutant, cytochrome b5 mutant whose Glu47, Glu-48, Glu-52, Glu-60, Asp-64 are all changed to Ala; group B™ Ala mutant, cytochrome b5 mutant of which Glu-41, Glu-42, Asp-57, and Glu-63 were replaced by Ala ) Corresponding author. Department of Biochemistry, Oita Medical University, Hasama-machi, Oita 879-55, Japan. Fax: q81-975-49-6302; E-mail: [email protected] 1 Present address: Department of Biology, Faculty of Science, Kochi University, Kochi 780, Japan.
Human NADH-cytochrome b5 reductase Ž b5 R: EC 1.6.2.2. is an FAD containing oxidoreductase. The function of the enzyme is to catalyze the transfer of two electrons from NADH to two molecules of cytochrome b5 in one catalytic cycle w1,2x. The electrons of cytochrome b5 are transferred to various acceptors, thereby participating in various metabolic pathways. Soluble and membrane bound forms, are known for both b5 R and cytochrome b5. The soluble
0167-4838r98r$19.00 q 1998 Elsevier Science B.V. All rights reserved. PII S 0 1 6 7 - 4 8 3 8 Ž 9 7 . 0 0 1 4 6 - 5
K. Shirabe et al.r Biochimica et Biophysica Acta 1384 (1998) 16–22
forms of b5 R and cytochrome b5 existing erythrocytes and participate in methemoglobin reduction w3x. The membrane bound form is localized in the endoplasmic reticulum of somatic cells and functions in the elongation and desaturation of fatty acids w4x, cholesterol biosynthesis w5x, and some of cytochrome P-450 mediated drug metabolism w6x. Electron transfer from cytochrome b5 to cytochrome c has been a model for the study of molecular basis of protein–protein interaction in the electron transfer mechanism w7–9x. This model system is, however, an artificial electron transfer that is not present in vivo. Physiological electron donor of cytochrome b5 is NADH-cytochrome b5 reductase and acceptors are methemoglobin, fatty acid desaturase, and cytochrome P-450. Since bacterial expression systems are now available for both b5 R and cytochrome b5 w10,11x, it is now feasible to analyze electrostatic interaction by site-directed mutagenesis on the basis of X-ray structure of the proteins w12–14x. Electrostatic interaction between cytochrome b5 and b5 R was first studied by means of chemical modification experiments by Dailey and Strittmatter w15x. Since then they have identified several carboxyl groups in cytochrome b5 and lysyl residues in b5 R that are involved in the interaction w16x. They later confirmed by site-directed mutagenesis that the lysyl residues Ž Lys-41, 125, 162, and 163. in b5 R indeed participates in the interaction w17x as also shown in the present study. The docking model of cytochrome b5 and b5 R based on the crystal structure of both proteins was recently reported w18x. We examined the role of carboxyl residues of cytochrome b5 in the interaction with b5 R by site-directed mutagenesis and propose a possibility that sites for interaction in cytochrome b5 with b5 R and cytochrome c may be different.
17
2. Materials and methods 2.1. Materials Restriction endonucleases and T4 polynucleotide kinase were purchased from Takara Shuzo ŽKyoto, Japan. . w a- 35 SxdCTP Ž) 1000 Cirmmol., Sequenase DNA sequencing kit, and an in vitro oligonucleotide-directed mutagenesis system were the products of Amersham ŽUK. . Oligonucleotides for mutagenesis were synthesized with a Model 8600 DNA synthesizer ŽBiosearch, San Rafael, CA, USA.. DEAEToyopearl used for enzyme purification was the product of Tosoh Ž Tokyo, Japan.. 5X-AMP-Sepharose 4B, Sephacryl S-200, and Sephadex G-25 were products of Pharmacia ŽUppsala, Sweden. . Bovine a-thrombin was a product of Sigma ŽSt. Louis, MO, USA.. All other chemicals were of reagent grade. 2.2. Construction of mutant expression plasmids for b5 R The HindIII–PstI fragment Ž503 bp., which includes the NH 2-terminal portion of b5 R cDNA, was excised from expression plasmid placZX-APR-b5 R w10x and cloned into HindIII–Pst I site of M13mp19. Site-directed mutagenesis utilized synthetic primers as shown in Table 1 and the strand selection method of Taylor et al. w19x, using the Amersham mutagenesis system. M13 phage single-strand DNA was prepared from four independent plaques and mutant clones were selected by dideoxy sequencing w20x. Nucleotide sequences of the HindIII–Pst I fragments were verified. The mutated HindIII–Pst I fragments were excised from the mutant M13 phage DNA and cloned into pUC-b5 RrB to construct the mutant expression plasmid w10,21x.
Table 1 Synthetic oligonucleotides used for construction of expression plasmids for human b5 R mutant enzymes Changed amino acid
Strand
Sequence
Codon change
Amino acid change
41 125 162 163 162r163
anti-sense anti-sense sense sense sense
AGCGGGTACGCGATGTCCGG TGAGACATCGCCCCTCCAGC CGACCTGACGCAAAGTCCAAC CCTGACAAAGCGTCCAACCC CGACCTGACGCAGCGTCCAACCC
AAG ™ GCG AAG ™ GCG AAA ™ GCA AAG ™ GCG AAA-AAG™ GCA-GCG
Lys ™ Ala Lys ™ Ala Lys ™ Ala Lys ™ Ala Lys ™ Ala
Base changes are shown by underlines.
18
K. Shirabe et al.r Biochimica et Biophysica Acta 1384 (1998) 16–22
2.3. Construction of mutant expression plasmids for human erythrocyte cytochrome b5 The expression vector for human erythrocyte cytochrome b5 was described previously w11x. The EcoRI–HindIII fragment Ž 686 bp., which includes cytochrome b5 cDNA was excised from the vector and cloned into EcoRI–HindIII site of M13mp19. Synthetic oligonucleotides were used to construct the mutant plasmids as shown in Table 1.
using potassium ferricyanide was calculated on the base of the difference in absorption coefficient of the oxidized and reduced compounds at 420 nm Ž 1 mMy1 cmy1 .. Apparent K m values for cytochrome b5 and k cat values were determined in the presence of an excess concentration Ž100 m M. of NADH with various concentrations of cytochrome b5 in 5 mM Tris– HCl buffer ŽpH 7.5..
3. Results 2.4. Purification of wild type and mutant NADH-cytochrome b5 reductase Mutant forms of b5 R were expressed in E. coli RB791 and purified as described previously w10x. The purity of the enzymes was judged by SDS-polyacrylamide gel Ž12.5%. electrophoresis w22x. The enzyme concentration was determined on the basis of the absorption coefficient of FAD at 450 nm Ž 11.3 mMy1 cmy1 . released from the enzyme by adding 0.1% of SDS w23x or by the method of Lowry et al. w24x with bovine serum albumin as a standard. Spectrophotometric determinations of the enzymes were performed with a Union spectrophotometer ŽSM401; Union Giken, Osaka, Japan. and a Hitachi spectrophotometer, Model 200. 2.5. Purification of wild type and cytochrome b5 mutant Mutant forms of human erythrocyte cytochrome b5 were expressed in E. coli RB791 and purified as described previously w11x. The concentration of cytochrome b5 was determined from the reduced minus oxidized absorbance difference at 424 nm using an extinction difference of 124 mMy1 cmy1 w25x.
3.1. Mutagenesis and preparation of b5 R mutants and cytochrome b5 s We have constructed 5 and 7 mutant expression plasmids, for b5 R and cytochrome b5 respectively, using the oligonucleotides listed in Tables 1 and 2 and the expression system described previously w10,11x. Each mutant enzyme was expressed at a level approximately equivalent to the wild type Ždata not shown.. All of the enzymes were purified using DEAE-Toyopearl chromatography and 5X-AMP-Sepharose 4B affinity chromatography as described previously w10x. Digestion with a-thrombin to release the authentic soluble form of mutant enzymes from the recombinant fusion protein w10x did not cause any detectable changes in the enzymatic activity. Yield of the mutant enzymes during purification was 22.5%, 6.5%, 21.9%, 22.3%, and 26.0% for K41A, K125A, K162A, K163A, and K162ArK163A, respectively. Each mutant protein gave a single band on SDS-polyacrylamide gel electrophoresis at the same mobility as the wild type Ž data not shown. . All cytochrome b5 mutants were expressed in E. coli and purified to apparently homogeneity as judged by SDS-polyacrylamide gel electrophoresis Ždata not shown. w11x with almost comparable yields as the wild type.
2.6. Assay of enzyme actiÕity 3.2. Catalytic properties of b5 R mutants Specific activities of b5 R mutants were determined in the presence of an excess concentration Ž 100 m M. of NADH using 4 m M cytochrome b5 mutants or 0.5 mM potassium ferricyanide as electron acceptors. The rate of reaction using cytochrome b5 was calculated on the base of the difference of the absorbance of the reduced and the oxidized forms of cytochrome b5 at 424 nm Ž124 mMy1 cmy1 .. The rate of reaction
To characterize the lysyl residues of b5 R implicated in charge-pairing with carboxyl residues of cytochrome b5 , specific activities of b5 R mutants using the wild type cytochrome b5 were determined as shown in Table 3. All mutants have much less activities than the wild type. The values of specific activities using the wild type cytochrome b5 as a
K. Shirabe et al.r Biochimica et Biophysica Acta 1384 (1998) 16–22
19
Table 2 Synthetic oligonucleotides used for construction of expression plasmids for human erythrocyte cytochrome b5 Amino acid position
Strand
Sequence
Codon change
Amino acid change
Group A mutants 47 48 47r48 52 60 64
sense sense sense sense sense sense
CTGGTGGGGCAGAAGTTTT GTGGGGAAGCAGTTTTAAG CTGGTGGGGCAGCAGTTTTAAG TTTTAAGGGCACAAGCTGG ACGCTACTGCGAACTTTGA AACTTTGAGGCTGTCGGGC
GAA™ GCA GAA™ GCA GAA-GAA™ GCA-GCA GAA™ GCA GAG™ GCG GAT ™ GCT
Glu ™ Ala Glu ™ Ala Glu ™ Ala Glu ™ Ala Glu ™ Ala Asp ™ Ala
Group A r B mutant 41r42 57 63r64
sense sense sense
AAATTTCTGGCAGCGCATCCTGGT AGCTGGAGGTGCCGCTACTG GAACTTTGCGGCTGTCGGG
GAA-GAG™ GCA-GCG GAC ™ GCC GAG-GAT™ GCG-GCT
Glu ™ Ala Asp ™ Ala Glu ™ Ala
Base changes are shown by underlines. An expression plasmid containing amino acid substitutions from E47, E48, E52, E60, and D64 to all Ala was constructed by two steps as follows. The first step of mutagenesis was performed using E52A and E60A oligonucleotides Ždouble primers. and M13 phage containing E47ArE48A mutations as a template. As a second step, mutagenesis was performed using D64A oligonucleotide and M13 phage containing E47ArE48ArE52ArE60A mutations as a template. Group ArB mutant was generated by synthesizing the complementary strand to group A mutant-single strand DNA with E41r42™ A, D57 ™ A, and E63r64™ A as primers.
substrate were 3.8%, 18.2%, 5.6%, 6.3%, and 0.5% of those of the wild type for K41A, K125A, K162A, K163A, and K162ArK163A, respectively. When we used ferricyanide as an artificial electron acceptor, the activity of every mutant b5 R was almost the same as that of the wild type, indicating that electron transfer activity of the mutants were not impaired, rather the deficiency is in the step of interaction of two proteins. Apparent k cat and K m values were determined using the b5 R mutants and the wild type cytochrome b5 ŽTable 4.. As shown in Table 4, the values of apparent k cat and K m using the wild type cyTable 3 Catalytic activities of b5 R mutants b5 R wild K41A K125A K162A K163A K162ArK163A
tochrome b5 were 864 sy1 and 6.8 m M, respectively as previously reported w21,26x. K m values were 6.2fold, 5.3-fold, 2.6-fold, 5.7-fold, and 8.3-fold increased for K41A, K125A, K162A, K163A, and K162r163A, respectively as compared with that of the wild type b5 R. The k cat values were 14%, 55%, 8.7%, 31%, and 1.6% of that of the wild type b5 R for K41A, K125A, K162A, K163A, and K162r163A, respectively. The decrease in k cat values together with the elevation of K m values indicated that the efficiency of electron transfer from b5 R to cytochrome b5 are also affected in the mutants. It is worth noting that the k cat value of K163A was
Table 4 Kinetic properties of b5 R mutants using wild-type cytochrome b5
Electron acceptors cytochrome b5
Ferricyanide
288"15.2 11.1"1.6 52.4"5.6 16.2"2.2 18.2"1.4 1.3"0.3
1234"86 1191"72 1215"94 1196"68 1254"74 1176"80
Specific activities Ž m molrminrmg. of b5 R mutants were measured using 4 m M cytochrome b5 and 0.5 mM potassium ferricyanide.
b5 R
Cytochrome b5 Žwild type. a k cat y1 .
wild K41A K125A K162A K163A K162ArK163A a
Žs 864"95 125"15 472"67 75"4.5 256"18 14"0.7
K ma Ž m M. 6.8"0.5 42.3"3.2 36.2"4.3 17.5"1.1 39.0"2.6 56.6"3.3
Apparent values were obtained as described under Section 2.
20
K. Shirabe et al.r Biochimica et Biophysica Acta 1384 (1998) 16–22
restored close to the level of the wild type when the activity was measured with group A ™ Ala cytochrome b5 mutant as an electron acceptor Ž data not shown.. This result may suggest that the negative residues of cytochrome b5 , that are normally neutralized by the positive charge of K163, interfere with complex formation between the wild type cytochrome b5 and K163A b5 R. Thus, the examined lysyl residues of b5 R may participate in complex formation with cytochrome b5. 3.3. Catalytic properties of cytochrome b5 mutants Any of the cytochrome b5 mutants of which one of Glu-47, Glu-48, Glu-52, Glu-60, or Asp-64 was replaced by Ala had no significant change in K m and k cat values Ž Table 5. . Moreover, the cytochrome b5 mutant in which all of group A residues were changed to Ala also showed almost the same catalytic properties as the wild type. These results suggest that none of these residues are involved in the electrostatic interaction with b5 R in contrast to the implication from the chemical modification experiments. To examine the role of other negative residues close to heme group, we generated cytochrome b5 mutant of which both of group A and group B residues were replaced by Ala. The mutant displayed a K m value about 5 fold higher than that of the wild type with no significant change in the k cat value. We used 5 mM Tris–HCl ŽpH 7.5. for the kinetic studies, since the enzyme has more than 80% activity at pH 7.5 of the highest activity at pH 6.6 w27x and is more stable at pH 7.5 than acidic pH. Since the k cat values of all the Table 5 Kinetic properties of wild-type b5 R using cytochrome b5 mutants Cytochrome b5 wild E47A E48A E47ArE48A E52A E60A D64A Group A ™ Ala Group ArB™ Ala a
b5 R Žwild type. k cat Žsy1 . a
K m Ž m M. a
864"95 1085"124 727"54 1084"142 1062"86 1134"112 873"74 790"67 754"78
6.8"0.5 11.3"2.1 4.1"0.6 7.8"0.5 7.9"1.1 9.8"0.8 10.4"0.9 9.7"0.7 41.3"3.7
Apparent values were obtained as described under Section 2.
mutants were not significantly changed, the mutations might not cause shift of the optimal pH. These results suggest that at least some of group B residues, but not group A residues, participate in the interaction with b5 R.
4. Discussion In the present study, we have generated b5 R mutants and cytochrome b5 s by means of bacterial expression system and site-directed mutagenesis in order to examined the role of the ionic side chains in the electrostatic interaction of these two proteins on the basis of chemical cross-linking study which suggested interaction between K41, K125, K162, and K163 of b5 R and E47, E48, E52, E60, D64 of cytochrome b5 w17x. Specific activities of b5 R mutants Ž K41, K125, K162, and K163. measured with potassium ferricyanide as an electron acceptor, were almost the same as that of the wild type ŽTable 2., suggesting that electron transfer from NADH to b5 R is intact in all mutant enzymes. Specific activities of all of b5 R mutants were much less than that of the wild type and the K m values were significantly elevated when the wild type cytochrome b5 was used as an electron acceptor ŽTable 4.. These data on the human proteins are consistent with the report on the steer enzyme by Strittmatter et al. w16x except that the K m and k cat values of K162 and K163 are somewhat different in these two reports probably due to the difference of species of the proteins examined. From these results we concluded that four Lys residues K41, K125, K162, and K163 may participate in the electrostatic interaction with cytochrome b5. K41 is the third residue of the first b-strand in N-terminal domain of the enzyme w13,14x and corresponds to K122 of Arabidopsis thaliana nitrate reductase flavopeptide which has about 45% sequence similarity to b5 R w21x. K125 is located in the N-terminus of short a-helix in the N-terminal domain of the enzyme w28x. K162 and K163 are located in the last part of the linker region that connects N-terminal and C-terminal domains of the enzyme and there exist one Lys residue in the corresponding location of nitrate reductase. Some of the features of the interaction between cytochrome
K. Shirabe et al.r Biochimica et Biophysica Acta 1384 (1998) 16–22
21
Fig. 1. Stereo view of bovine cytochrome b5. Side chains of negatively charged residues and heme prosphetic group of bovine cytochrome b5 are shown w12x. The numbering of the residues are based on that of human cytochrome b5. Group A negative residues are boxed. Circled residues are group B residues.
b-like heme protein and flavopeptide are, therefore, probably conserved among human b5 R-cytochrome b5 and higher plant nitrate reductase. It has been suggested from chemical cross-linking studies w16x that E47, E48, E52, E60, D64 of cytochrome b5 Žgroup A residues, see Fig. 1. are involved in the binding with b5 R. In our cytochrome b5 mutant in which one of or all of these residues were changed to Ala produced K m and k cat values that were not significantly changed, indicating that none of these residues participate in the interaction with b5 R; this in contrasts with the result of the chemical modification experiments which suggested the interaction of those residues with the positive residues of b5 R w15x. On the other hand, E47, E52, and D64 of group A residues have previously been shown by site-directed mutagenesis w9x to participate in interaction with cytochrome c. Thus we suggest that those residues of cytochrome b5 which participate in the interaction with cytochrome c Želectron acceptor. do not participate in the interaction with the native b5 R Želectron donor.. Examination of the role of other acidic residues located close to heme group of cytochrome b5 in the interaction with b5 R revealed that changing of E41, E42, D57, and E63 Žgroup B. to Ala Žin addition to group A residues. caused a five fold increase in the K m value with no significant change in k cat value. This indicates that some of the group B residues participate in the interaction of cytochrome b5 with b5 R. These results suggest that E47, E52, and D64 of
cytochrome b5 , which are clustered on one side of the molecule Župper side of cytochrome b5 in Fig. 1., interact with positive residues of cytochrome c Želectron acceptor., and that some of the group B residues, which are located on the other side of cytochrome b5 , are responsible for the interaction with b5 R Želectron donor.. We are now in the process of generating several cytochrome b5 mutants, of which one of group B and other candidate residues Žfor example D70. are replaced by Ala, to identify the responsible residueŽs. for the interaction with b5 R. These studies will lead us to modify the recently reported docking model for the complex of bovine cytochrome b5 and porcine NADH-cytochrome b5 reductase by Nishida and Miki w18x which include Glu-48 of cytochrome b5 ŽGlu-44 in bovine. as a candidate residue for the interaction. Acknowledgements We thank Dr. M. Tamura for discussion. This work was supported in part by a Grant-in-aid from the Ministry of Education, Science, and Culture of Japan Žto K.S... References w1x P. Strittmatter, J. Biol. Chem. 240 Ž1965. 4481–4487. w2x T. Iyanagi, Biochemistry 16 Ž1977. 2725–2730. w3x D.E. Hultquist, P.G. Passon, Nat. New Biol. 229 Ž1971. 252–254.
22
K. Shirabe et al.r Biochimica et Biophysica Acta 1384 (1998) 16–22
w4x N. Oshino, Y. Imai, R. Sato, J. Biochem. 69 Ž1971. 155–167. w5x S.R. Keyes, D.L. Cinti, J. Biol. Chem. 255 Ž1980. 11357– 11364. w6x V.V.R. Reddy, D. Kupfer, E. Capsi, J. Biol. Chem. 252 Ž1977. 2797–2801. w7x K.K. Rogers, T.C. Pochapsky, S.G. Sliger, Science 240 Ž1988. 1657–1659. w8x M.R. Mauk, A.G. Mauk, Biochemistry 25 Ž1986. 7085– 7091. w9x K.K. Rogers, S.G. Sliger, J. Mol. Biol. 221 Ž1991. 1453– 1460. w10x K. Shirabe, T. Yubisui, M. Takeshita, Biochim. Biophys. Acta 1008 Ž1989. 189–192. w11x T. Nagai, K. Shirabe, T. Yubisui, M. Takeshita, Blood 81 Ž1993. 808–814. w12x F.S. Mathew, M. Levine, P. Argos, J. Mol. Biol. 64 Ž1972. 449–464. w13x T. Takano, S. Bandoh, T. Horii, M. Higashiyama, M. Satoh, K. Ogawa, Y. Katsuya, M. Danno, T. Yubisui, K. Shirabe, M. Takeshita Ž1993. in Flavins and Flavoproteins, Walters de Gruyter, Berlin, pp. 409–412. w14x H. Nishida, K. Inaka, M. Yamanaka, S. Kaida, K. Kobayashi, K. Miki, Biochemistry 34 Ž1995. 2763–2767. w15x H.A. Dailey, P. Strittmatter, J. Biol. Chem. 254 Ž1979. 5388–5396.
w16x P. Strittmatter, C.S. Hackett, G. Korza, J. Ozols, J. Biol. Chem. 265 Ž1990. 21709–21713. w17x P. Strittmatter, J.M. Kittler, J.E. Coghill, J. Ozols, J. Biol. Chem. 267 Ž1992. 2519–2523. w18x H. Nishida, K. Miki, Proteins 26 Ž1996. 32–41. w19x J.W. Taylor, J. Ott, F. Eckstein, Nucl. Acids Res. 13 Ž1985. 8765–8785. w20x F. Sanger, S. Nicklen, A.R. Coulson, Proc. Natl. Acad. Sci. U.S.A. 76 Ž1977. 5463–5467. w21x K. Shirabe, T. Yubisui, N. Borgese, C. Tang, D.E. Hultquist, M. Takeshita, J. Biol. Chem. 267 Ž1992. 20416–20421. w22x U.K. Laemmli, Nature 227 Ž1970. 680–685. w23x K. Shirabe, Y. Fujimoto, T. Yubisui, M. Takeshita, J. Biol. Chem. 269 Ž1993. 5952–5957. w24x O.H. Lowry, N.J. Rosenbrough, A.L. Farr, R.J. Randall, J. Biol. Chem. 193 Ž1951. 265–275. w25x T. Yubisui, K. Murakami, M. Takeshita, T. Takano, Biochim. Biophys. Acta 936 Ž1988. 447–451. w26x K. Shirabe, T. Yubisui, T. Nishino, M. Takeshita, J. Biol. Chem. 266 Ž1991. 7531–7536. w27x T. Yubisui, M. Takeshita, J. Biochem. ŽTokyo. 91 Ž1982. 1467–1477. w28x G.E. Hyde, N.M. Crawford, W.H. Campbell, J. Biol. Chem. 266 Ž1991. 23542–23547.