IGF axis genes in triploid crucian carp

General and Comparative Endocrinology 178 (2012) 291–300

Contents lists available at SciVerse ScienceDirect

General and Comparative Endocrinology journal homepage: www.elsevier.com/locate/ygcen

Elevated expressions of GH/IGF axis genes in triploid crucian carp Huan Zhong 1, Yi Zhou 1, Shaojun Liu ⇑, Min Tao, Yu Long, Zhen Liu, Chun Zhang, Wei Duan, Jie Hu, Can Song, Yun Liu Key Laboratory of Protein Chemistry and Fish Developmental Biology of the Education Ministry of China, College of Life Sciences, Hunan Normal University, Changsha 410081, China

a r t i c l e

i n f o

Article history: Received 31 January 2012 Revised 11 May 2012 Accepted 4 June 2012 Available online 17 June 2012 Keywords: GH GHR IGF-1 Triploids Tetraploids Fast growth

a b s t r a c t Growth hormone (GH), growth hormone receptor (GHR) and insulin-like growth factor 1 (IGF-1) are pivotal signaling factors of the GH/IGF axis, which plays a crucial role in regulating growth in vertebrates. In this study, GH, GHR and IGF-1 cDNAs were cloned from triploid and tetraploid crucian carp. In addition, mRNA expression levels were characterized in diploid red crucian carp, triploids and tetraploids. Reverse transcriptase PCR indicated that GH genes were only expressed in the pituitary, while GHR and IGF-1 were widely expressed in all tested tissues. Real-time PCR study of different seasonal profiles showed that triploids had significantly higher expression of the studied genes during both the prespawning and the spawning season. Although different temperatures (22, 26 and 30 °C) showed no significant effects on GH, GHR and IGF-1 mRNA expression in either diploids or triploids, triploids had higher expression levels than diploids at each temperature. After 1 week of fasting, the expression of all studied genes was reduced in both diploids and triploids, while the expressions levels were higher in triploids than in diploids. These results suggest that the elevated expression of GH/IGF axis genes in triploids plays a crucial role in the faster growth rate of triploids. Ó 2012 Elsevier Inc. All rights reserved.

1. Introduction In teleosts, somatic growth is regulated by the growth hormone/insulin-like growth factor (GH/IGF) axis, as in higher vertebrates [15,16]. GH is a pituitary hormone that participates in numerous physiological processes including somatic growth, energy mobilization, gonadal development, osmoregulation, social behavior and immunity [51]. These physiological actions are triggered by the high-affinity, high-specificity interaction between GH and the growth hormone receptor (GHR) in target tissues. This interaction activates a post-receptor signaling system that stimulates the transcription of target genes such as IGF-1 [29]. As a potent mitogenic hormone that induces growth and differentiation, IGF-1 mediates the growth-promoting capability of GH in a variety of target organs [3]. GH and IGF-1 are known to be key factors in the control of growth in teleosts. Devlin et al. reported that the GH transgenic coho salmon (Oncorhynchus kisutch) showed extraordinary growth rates [12]. Furthermore, both dietary GH supplementation and GH injection increase growth rates in fish [5,27,42]. These results indicate that GH is a potent growth promoter in fish. In addition, GH stimulates hepatic and circulating IGF-1 levels in teleosts [47,57]. And IGF-1 is positively correlated with growth rate of fish [50]. ⇑ Corresponding author. Fax: +86 731 88873074. 1

E-mail address: [email protected] (S. Liu). These authors contributed equally to this work.

0016-6480/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ygcen.2012.06.006

Elevated IGF-1 mRNA and circulating IGF-1 levels are related to fast growth in the Nile tilapia (Oreochromis niloticus) [8], coho salmon [41], Mozambique tilapia (Oreochromis mossambicus) [28] and mud carp (Cirrhinus molitorella) [59]. These results suggest that IGF-1 levels might serve as a growth index in fish. Furthermore, triploid sea bass (Dicentrarchus labrax) were shown to have higher IGF-1 immunoreactivity than diploids, suggesting a possible involvement for IGF-1 in their growth performance [48]. The GH/IGF axis is under regulation of neuroendocrine, endocrine and environmental factors including season, temperature, photoperiod, nutrition and salinity [2,50]. Deane [10] and Beckman [2] reviewed that both GH and IGF-1 are affected by temperature and seasonal variations. Figueroa et al. reported that in the common carp (Cyprinus carpio) pituitary GH mRNA and protein expression levels were higher in summer than in winter [20]. Another intensively researched factor affecting the GH/IGF is nutritional status. Several studies have found significant increases in pituitary GH mRNA and plasma GH concentration in teleosts after fasting [1,23,46], while food restriction decreased hepatic GHR and IGF-1 gene expression and circulating levels of IGF-1 [1,22,23,46,53]. However, information on the effects of temperature and nutritional status on the expression of GH and IGF-1 in cyprinid fishes is still limited. Partial F1 diploid hybrids from the red crucian carp (Carassius auratus red var.) ($)  common carp (#) were found to be fertile. Cytological analysis indicated that F2 hybrids derived from mating between males and females of the F1 generation were able to

292

H. Zhong et al. / General and Comparative Endocrinology 178 (2012) 291–300

Table 1 Primers used for GH, GHR and IGF-1 cloning, RT-PCR and quantitative real-time PCR. Gene

Primer name

Primer sequence (from 50 -30 )

Purpose

GH

GH-S GH-A GH-3-1 GH-3-2 GH-RT-S GH-RT-A

ATGGCTAGAGCGTTAGTGCTGTTG CTACAGGGTGCAGTTGGAATCCAG AGACAGCGCATGGTACACTTGAAGACA GAGTTCCCCAGCCAGACCCT CGCGTCTCTTTTCGCCTTATT TGCCTGGATGAGCACACTGA

CDS CDS 30 RACE 30 RACE RT-PCR and Real-time PCR RT-PCR and Real-time PCR

GHR

GHR-S1 GHR-A1 GHR-S2 GHR-A2 GHR-S3 GHR-A3 GHR-3-1 GHR-3-2 GHR-RT-S GHR-RT-A

ATGGCTTACTCTCTCTTGCTCAGTC TTCRCCAAAGTTGTCAAAGGCT CACAGCAGTCCATCTACGGTTTA CCTGAATCATCGTCGCTTTTG CTTGTCCCGCTCAGGCTCTTC ATGGTTGGCATTGCTGGGAG CTTTCGTCTGCTGGCTTGCT AATCCCGAGGACTTGGCTAC TGCATGTGGCACAGATACCA GCTCTGGGTCGATGCCTTTA

CDS CDS CDS CDS CDS CDS 30 RACE 30 RACE RT-PCR and Real-time PCR RT-PCR and Real-time PCR

IGF-1

I1-S I1-A I1-3-1 I1-3-2 I1-5-1 I1-5-2 I1-RT-S I1-RT-A

ATGACTTCAAACAAGTTCAT CTAAATGCGATAGTTGCTTCCC CCAAACATTTCCAACCCAAGC TGGAGACAGGGGGTTTTATTT TTTATTTCAGCAAACCAACAGG GCCCATATCCTGTTGGTTTGCTGAA TGTAGACACGCTGCAGTTTGTG GGAGTTTTGCCGGGCTTTAC

CDS CDS 30 RACE 30 RACE 50 RACE 50 RACE RT-PCR and Real-time PCR RT-PCR and Real-time PCR

b-Actin

b-Actin-S b-Actin-A

GCTCTTCCCCATGCAATCCT GGTTCCCATCTCCTGCTCAA

RT-PCR and Real-time PCR RT-PCR and Real-time PCR

produce diploid gametes [36]. Thus, tetraploid fish were produced in the F3 generation. From this, a bisexually fertile tetraploid population of F3–F21 was established [35]. By crossing tetraploid males from this population with diploid females of the Japanese crucian carp (C. auratus cuvieri), triploids were produced. The triploid fish showed several improved characteristics such as sterility, fast growth rate, good flesh quality and strong disease resistance [34]. We speculated that the sterile condition may contribute to the faster growth rate of triploids because little energy is consumed by the reproduction process during breeding season [33]. Similarly, it has been observed that triploid rainbow trout (Oncorhynchus mykiss) [24] and Asian catfish (Clarias batrachus) grow faster than diploid varieties [19]. In a previous histological study, we demonstrated that triploids showed the highest proportion of pituitary somatotropin (STH) cells among fishes of different ploidy [38]. As STH cells are the exclusive GH secreting cells in the pituitary gland, triploids may produce excess GH to promote

growth. However, the exact mechanism behind the rapid growth rate in triploids is still unknown. To investigate the regulation of the GH/IGF axis in crucian carp lines of different ploidy, we isolated cDNAs for GH, GHR and IGF-1 in triploids and tetraploids. Tissue distributions of the target genes were analyzed by RT-PCR. GH, GHR and IGF-1 mRNA expressions were evaluated in different seasons, at different temperatures and at different nutritional levels in fishes of different ploidy. The aim of present study was to provide molecular information on the rapid growth of triploids. 2. Materials and methods 2.1. Experimental fish For the cDNA cloning and tissues distribution study, diploid red crucian carp, triploids and tetraploids (1-year-old, March) were

Fig. 1. Phylogenetic tree based on the alignment of amino acid sequences of the known GH, GHR and IGF-1 in vertebrates. These sequences used for analysis and their GenBank Accession numbers were: goldfish (Carassius auratus, GH, AAC19389; GHR, AAK60495; IGF-1, AAC83444), common carp (Cyprinus carpio, GH, CAA36228; GHR, AAU43899; IGF-1, BAA11879), grass carp (Ctenopharyngodon idella, GH, AAA58724; GHR, AAP37033; IGF-1, ABU40947), zebrafish (Danio rerio, GH, CAI79040; GHR1, ACF60805; GHR2, ACF60806; IGF-1, AAI14263), Nile tilapia (Oreochromis niloticus, GH, AAA49437; GHR1, ABK41365; GHR2, ABK41366; IGF-1, ABY88872), Rainbow trout (Oncorhynchus mykiss, GH, AAA49553; GHR1, AFC87830; GHR2, NP_001118203; IGF-1, AAA49412), Japanese eel (Anguilla japonica, GH, AAA48535; GHR1, BAD20706; GHR2, BAD20707; IGF-1, BAF74504), African clawed frog (Xenopus laevis, GH, AAF05774; GHR, AAF05775; IGF-1, AAA70330), house mouse (Mus musculus, GH, CAA26650; GHR, AAH75720, IGF-1, AAL34535), chicken (Gallus gallus, GH, AAG01029; GHR, AAA48781; IGF-1, ACR83546) and human (Homo sapiens, GH, AAH62475; GHR, EAW56023; IGF-1, CAA40092). The number at each node indicates the percentage of bootstrap value after 1000 replication.

H. Zhong et al. / General and Comparative Endocrinology 178 (2012) 291–300

293

Fig. 2. Alignments of the deduced amino acid sequences of GH, GHR and IGF-1 in different cyprinid fishes. (A) Alignment of GH amino acid sequences; (B) Alignment of GHR amino acid sequences; (C) Alignment of IGF-1 amino acid sequences. ⁄ indicates that amino acids were the same in all species studied; - indicates that there was no corresponding amino acid. Conserved cysteine residues are shaded; potential N-glycosylation sites are boxed by open rectangles; FGEFS motifs are underlined with a solid line; Box 1 and Box 2 regions are underlined with two solid lines; tyrosine residues in the intracellular domain are boxed by shaded rectangles. The amino acid sequences from Genbank are the same as in Fig. 1.

294

H. Zhong et al. / General and Comparative Endocrinology 178 (2012) 291–300

2.3. Measurement of body weight for diploids and triploids In May of 2009, 200 triploid and 200 diploid carp were selected and reared in a 500-m2 pond. After feeding for 2 months, body weights (BWs) of triploids and diploids were measured monthly from July to December (n = 50 for each fish). 2.4. Quantitative real-time PCR

Fig. 3. Analysis of GH, GHR and IGF-1 mRNA expression in various tissues of triploids and tetraploids by RT-PCR. b-Actin was used as an internal control. (A) Tissue distribution in triploids; (B) Tissue distribution in tetraploids. O, ovary; T, testis; B, brain; P, pituitary; H, heart; L, liver; S, spleen; K, kidney; G, gill; M, muscle; NC, negative control.

Expression levels of GH, GHR and IGF-1 mRNA were determined by quantitative real-time PCR using the ABI Prism 7500 Sequence Detection System (Applied Biosystems, USA). After total RNA was extracted and measured, 1 lg RNA was digested by DNase I to eliminate DNA interference before cDNA was synthesized. Amplification conditions were: 50 °C for 5 min, 95 °C for 10 min followed by 40 cycles at 95 °C for 15 s and 60 °C for 45 s. Each test was performed three times to improve the accuracy of the results. Finally, melt curve analysis was performed to verify single product generation at the end of the assay. The relative expression of each gene was calibrated with b-Actin and the analysis of relative mRNA expression data was performed using the 2DDCt method [37]. 2.5. GH, GHR and IGF-1 expression in different seasons

obtained from the Engineering Center of Polyploidy Fish Breeding of National Education Ministry located at Hunan Normal University. After anesthetization with 2-phenoxyethanol, tissues were excised from the fish, frozen in liquid nitrogen, and stored at 80 °C until RNA extraction. 2.2. Cloning, phylogenetic analysis and tissue distribution of GH, GHR and IGF-1 Total RNA was extracted from pituitary glands and livers from fishes of different ploidy using Trizol (Omega, USA) according to the manufacturer’s instruction. The integrity of the total RNA was determined by agarose gel and the amount of isolated RNA was measured using spectrophotometer. First-strand cDNA was synthesized using AMV reverse transcriptase (Fermentas, Canada) with oligo(dT)12–18 primer at 42 °C for 60 min, and 70 °C for 5 min. The degenerate primers for GH, GHR and IGF-1 were designed based on the nucleotide sequences found in other teleosts (Table 1). The PCR products were cloned and sequenced to obtain the core partial cDNA of each of the three genes. Subsequently, RACE (rapid amplification of cDNA ends) was performed to obtain the cDNA of full-length genes using the SMART RACE cDNA Amplification Kit (Clontech, USA). Amino acid sequence alignments of GH, GHR and IGF-1 genes were carried out by ClustalW (2.1) software (http://www.ebi. ac.uk/Tools/msa/clustalw2/). Phylogenetic analysis was conducted using Neighbor-Joining method with 1000 bootstrap in MEGA 4.1 [30]. Distribution of GH, GHR, and IGF-1 in various tissues of fishes of different ploidy was determined by reverse transcription PCR (RTPCR). b-Actin was used as internal control. The PCR conditions were: 94 °C for 5 min followed by 40 cycles at 95 °C for 30 s, 60 °C for 30 s and 72 °C for 30 s and concluding with a single elongation step at 72 °C for 5 min.

Red crucian carp, triploids and tetraploids were obtained during the prespawning season (0.5-year-old, November. Diploid BWs = 65.3 ± 0.6 g; triploid BWs = 156.4 ± 1.3 g; tetraploid BWs = 46.4 ± 0.7 g; n = 8 for each group) and the spawning season (1-year-old, May; Diploid BWs = 198.5 ± 1.4 g, triploid BWs = 364.4 ± 1.3 g, tetraploid BWs = 186.4 ± 0.9 g, n = 8 for each group). Pituitaries, livers and muscles were obtained in different seasons. GH expression in the pituitary, GHR expression in the liver and IGF-1 expression in liver and muscle were examined by quantitative real-time PCR. 2.6. GH, GHR and IGF-1 expression at different temperatures To examine the effect of temperature on GH, GHR and IGF-1 expression, 0.5-year-old red crucian carp and triploids obtained during the prespawning season (November; Diploid BW = 69.5 ± 1.3 g, triploid BW = 116.3 ± 1.4 g) were both divided into three groups: low temperature (21.9 ± 0.3 °C), ambient temperature (25.9 ± 0.1 °C) and high temperature (30.1 ± 0.2 °C; n = 8 for each group, total n = 24 for each fish). Temperatures were maintained by submersible aquarium heaters throughout the experiment. During the acclimatization period, each group of fish was kept in the tank (0.7  0.4  0.5 m) for 1 week at the desired temperature and fed with a pellet diet at 1% BWs per day. Pituitaries, livers and muscles were collected from the fish of each group after the treatment and stored at 80 °C until analysis of GH, GHR and IGF-1 transcripts. 2.7. GH, GHR and IGF-1 expression during starvation and feeding To evaluate the expression levels of target genes during different nutritional conditions, red crucian carp (0.5-year-old, November; BW = 54.7 ± 0.9 g, n = 8) and triploids (0.5-year-old, November; BW = 100.3 ± 1.1 g, n = 8) were randomly divided into

Table 2 Comparison of the mean body weight of triploids and diploids.

Diploids Triploids

July

August

September

October

November

December

40.1 ± 1.3 47.6 ± 1.6⁄

100.3 ± 1.2 146.4 ± 1.4⁄

156.1 ± 0.9 230.6 ± 1.5⁄

230.3 ± 0.9 315.6 ± 0.8⁄

248.1 ± 1.9 390.4 ± 0.6⁄

265.4 ± 0.6 456.7 ± 1.8⁄

Values are mean ± SEM (g). ⁄represent statistically significant differences between diploids and triploids in the same month (P < 0.05).

H. Zhong et al. / General and Comparative Endocrinology 178 (2012) 291–300

295

Fig. 4. Quantification of the expression of the transcripts of GH, GHR and IGF-1 mRNA in the prespawning season. Different letters indicate significant differences between groups (P < 0.05). Data are presented as means ± SEM (n = 8) of triplicate measurements.

two groups (fasted and fed, n = 4 for each group). Each group was cultured in separate tank (0.7  0.4  0.5 m) at 25–26 °C. Following an acclimatization period of 1 week, fish in the fed group were fed with a pellet diet for 1 week at 1% BW per day, while the fasted group was withheld food for 1 week. After the treatment, pituitary, liver and muscle tissues were collected, snap frozen in liquid nitrogen and stored at 80 °C until RNA extraction. 2.8. Statistical analysis Data, expressed as means ± SEM, were analyzed by one-way analysis of variance. Differences among treatment means were determined by the Duncan’s multiple range test. The comparison of the mean body weight of triploids and diploids monthly were performed by t-test. All statistical analyses were performed using the SPSS 13.0 software. P values < 0.05 were taken to indicate statistical significance. 3. Results 3.1. Sequence and phylogenetic analysis The GH cDNA sequence of triploids was 1122 bp (GenBank accession No. HQ830012); that of tetraploids was 1145 bp (GenBank accession No. HQ830011). The sequences encode a 633-bp open reading frame with a 488-bp 30 -untranslated region (UTR) in the triploids and a 512-bp 30 -UTR in the tetraploids. The deduced proteins in triploids and tetraploids both contained five conserved cysteine residues and two N-glycosylation sites (Asn-X-Ser/Thr motif).

GHR cDNA of triploids (2076 bp; GenBank accession No. HQ830014) and tetraploids (2072 bp; GenBank accession No. HQ830013) both contained an 1809-bp coding region encoding a protein with 602 amino acids. The 30 -UTRs of GHR in triploids and tetraploids were 267 bp and 263 bp, respectively. The deduced protein sequences both contained characteristic conserved motifs of GHR, including seven cysteine residues, six potential N-glycosylation sites, an FGEFS motif, Box 1 and Box 2 regions and nine tyrosine residues. Full-length sequences of IGF-1 (GenBank accession No. HQ830016 for triploids and HQ830015 for tetraploids) were 849 bp in triploids and 889 bp in tetraploids. In both triploids and tetraploids, the protein coding region of 486 bp was preceded by a 224-bp 50 -UTR. The 30 -UTRs were 139 bp in triploids and 179 bp in tetraploids. The deduced protein with 161 amino acids contained six characteristic cysteine residues. Phylogenetic analysis (Fig. 1) revealed that triploids and tetraploids were evolutionarily more closely related to the Cypriniformes than to mammalian species. Besides, the phylogenetic tree of GHR was clustered within two clades: GHR1 and GHR2. The cloned GHR sequences belonged to GHR1 cluster. Among the cypriniform fishes, the cloned genes shared higher similarities with goldfish (C. auratus auratus) and common carp than with zebrafish (Danio rerio) and grass carp (Ctenopharyngodon idella) (Fig. 2), which was in agreement with the taxonomic relationship.

3.2. Tissue distribution of GH, GHR and IGF-1 Tissue distributions of GH, GHR and IGF-1 were studied in triploid and tetraploid fish (Fig. 3). GH mRNA expression was

296

H. Zhong et al. / General and Comparative Endocrinology 178 (2012) 291–300

Fig. 5. Quantification of the expression of the transcripts of GH, GHR and IGF-1 mRNA in the spawning season. Different letters indicate significant differences between groups (P < 0.05). Data are presented as means ± SEM (n = 8) of triplicate measurements.

restricted to the pituitary. No amplicons were detected in other studied tissues such as ovaries, testes, liver and brain. In contrast, GHR and IGF-1 were expressed in all of the examined tissues, with the highest levels in the liver. 3.3. Body weights of triploids and diploids in different months Mean BWs of triploids and diploids are shown in Table 2. From July to December, triploids had significantly higher BWs than diploids (P < 0.05). 3.4. Expression of GH, GHR, and IGF-1 transcripts in fishes of different ploidy in different seasons In both prespawning (November) and spawning seasons (May), GH transcripts in the pituitaries were significantly higher in triploids than in diploids and tetraploids (P < 0.05), while there was no significant difference between diploids and tetraploids (P > 0.05) (Figs. 4A and 5A). In contrast, expression of GHR in the prespawning season was significantly higher in the livers of diploids and triploids than in tetraploids (P < 0.05) (Fig. 4B). In the breeding season, hepatic GHR mRNA expression was higher in triploids than in diploids and tetraploids (P < 0.05), while no significant differences were observed between diploids and tetraploids (P > 0.05) (Fig. 5B). Triploids had the highest relative expression of IGF-1 in the liver during both prespawning and spawning seasons, while expression in tetraploids was the lowest (P < 0.05) (Figs. 4C and 5C). Expression of sarcous IGF-1 transcripts was highest in triploids during both the prespawning and spawning seasons. No significant

(P > 0.05) differences between diploids and tetraploids were detected during the prespawning season (Figs. 4D and 5D). 3.5. Expression of GH, GHR, and IGF-1 transcripts in fishes of different ploidy at different temperatures The expression of GH, GHR and IGF-1 transcripts was estimated in fishes of different ploidy at 22, 26 and 30 °C. Real-time PCR results showed no significant changes among the three different temperature groups in both triploids and diploids (P > 0.05). However, there were significant differences in expression levels of these genes between triploids and diploids in each temperature gradient (P < 0.05) (Fig. 6). 3.6. Expression of GH, GHR, and IGF-1 transcripts in fasted and fed fishes of different ploidy Starvation resulted in a significant decrease in pituitary GH expression in both diploids and triploids (P < 0.05). There was no significant difference between fasted diploids and triploids (P > 0.05), but pituitary GH expression was significantly higher in fed triploids than in fed diploids (P < 0.05) (Fig. 7A). Similarly, starvation significantly decreased the expression of GHR and IGF-1 in the liver in both diploids and triploids (P < 0.05) (Fig. 7B and C). Triploids showed higher expression of GHR and IGF-1 than diploids in both fasted and fed conditions. In muscle, starvation decreased IGF-1 expression in both diploids and triploids (P < 0.05). No significant changes were observed between fasted triploids and diploids (P > 0.05), whereas IGF-1

H. Zhong et al. / General and Comparative Endocrinology 178 (2012) 291–300

297

Fig. 6. Effects of temperature on the expression of GH, GHR and IGF-1 mRNA in fishes of different ploidy. Different letters indicate significant differences between groups (P < 0.05). Data are presented as means ± SEM (n = 8) of triplicate measurements.

mRNA expression was higher in fed triploids than fed diploids (P < 0.05) (Fig. 7D). 4. Discussion The present study provides an examination of key endocrine genes involved in growth in crucian carp lines of different ploidy. GH, GHR and IGF-1 cDNAs were cloned from triploid and tetraploid carp. The predicted primary amino acid sequences, domain structures, positions of cysteine residues and N-glycosylation sites of these genes are highly conserved among fish species [6,8,14,55], suggesting that the secondary and tertiary structures of GH, GHR and IGF-1 are also conserved among the species. Meanwhile, the cloned GHR cDNA sequences were clustered with GHR1. In certain fish species, two GHR genes were found, including, zebrafish [13], Nile tilapia [40], rainbow trout [56] and Japanese eel [44]. The two GHR genes may due to the whole genome duplication in teleosts. While in grass carp [25], goldfish [31] and common carp [54], only one GHR gene was found. Phylogenetic analysis of GH, GHR and IGF-1 showed that the deduced amino acid sequences of the carp shared high homology levels with cyprinid species, whereas low homology was found with mammals. In addition, alignment results of the amino acid sequences of the three genes in cyprinid species revealed that triploids and tetraploids had higher homology with their parents than with other teleosts. In Cottus kazika [26], GH mRNA was exclusively expressed in the pituitary gland. However, in the rainbow trout [58] and giant grouper (Epinephelus lanceolatus) [14], GH mRNA was also detected in extrapituitary tissues. The present results showed that in triploid and tetraploid, GH mRNAs expressed specifically in the

pituitary. This is in agreement with the C. kazika study which is indicated that pituitary gland is the site of GH secretion in these fish species. Expression patterns of GHR and IGF-1 in various tissues in triploids and tetraploids suggested that the two genes are universally expressed with the highest expression in liver, which is consistent with findings in other teleosts [21,26,31]. Extrahepatic IGF-1 production likely has an autocrine or paracrine function in proliferation, growth, and survival. In the spawning season, pituitary GH expression and hepatic GHR expression were significantly higher in triploids than in diploids or tetraploids. Similar results were found in the prespawning season, with the exception that hepatic GHR expression was significantly higher in both diploids and triploids than in tetraploids. Gene expression for IGF-1 in the liver and muscle in the spawning season was different among all three groups, with triploids showing the highest and tetraploids showing the lowest expression. Results from the prespawning season were similar, with the exception that there was no difference in muscle expression of IGF-1 between diploids and tetraploids. Long-term breeding studies have shown that growth rates are highest in triploids and lowest in tetraploids [38]. These results suggest that the growth rate is not simply correlated with ploidy but correlated with the expression levels of GH/IGF axis genes. In polyploid fish, the number of chromosomes is doubled with increased ploidy. However, gene expression levels in the present study were not doubled with ploidy. In particular, transcript expression levels in tetraploids were even lower than in diploids. The abnormal transcript expression in tetraploids could be due to dosage compensation by gene-copy silencing. Pala et al. reported that some alleles in the genome of a triploid hybrid fish were silenced, which suggests gene-copy

298

H. Zhong et al. / General and Comparative Endocrinology 178 (2012) 291–300

Fig. 7. Effects of fasting and feeding on the expression of GH, GHR and IGF-1 mRNA in fishes of different ploidy. Different letters indicate significant differences between groups (P < 0.05). Data are presented as means ± SEM (n = 8) of triplicate measurements.

silencing in triploid teleosts [45]. However, mechanisms behind genome silencing and the level of silencing in polyploid fish are still unknown. Thus, more information about the regulation of genome transcription needs to be obtained. The effects of temperature and nutrition on the expression of GH/IGF axis genes were considered in this study. Deane reviewed that both fasting and increased temperature resulted in an increase in GH in other teleosts [10]. Studies on seasonal variations in GH in carp [20] and gilthead sea bream [43] showed a GH peak of in spring or summer when water temperature is likely to be high. Similarly, GHR1 and GHR2 expression levels were found to be higher when rainbow trout were reared at 8 °C than when they were reared at 6 °C [32]. The effect of persistent temperature differences has been described in several species of fish. Silverstein et al. found significantly elevated IGF-1 levels in catfish reared at 26 °C compared with those reared at 21.7 °C [52]. In the southern flounder, mean plasma IGF-1 levels were significantly reduced at higher temperatures [39]. These results may be explained by the effects of changes in temperature on feed consumption. In the present study, temperature had no effect on gene expression in diploids and triploids. We presumed food consumption was optimal in the studied fish at temperatures of 20–32 °C. Thus, we subsequently studied the effects of food consumption on the expression of GH/IGF axis genes. GH expression levels in fasted diploids and triploids were not consistent with previous reports, suggesting that 1 week of treatment may not be sufficient to induce an increase in pituitary GH. Changes in expression of GHR and IGF-1 mRNA were consistent with other studies in teleosts in that expression levels decreased at lower temperatures and during fasting [8,53]. Interestingly, triploids had higher expression of all three genes than diploids under all conditions studied, suggesting that the elevated expression of GH/IGF axis genes in triploids was not caused by environmental factors but by their genetic background.

The results also showed that triploids had a faster growth rate than diploids based on BW measurements. Because of the rapid growth rate, triploids are used for commercial production. The growth rate of triploids was 21.78% and 70.83% higher than those of diploid Japanese crucian carp and Pengze crucian carp (C. auratus variety Pengze), respectively [34]. Long et al. reported that the proportion of STH cells in the meso-adenohypophysis was 25% in red crucian carp, 38% in triploids and 20% in tetraploids [38]. In vertebrates, STH cells are generally regarded as the site in which GH is produced and released. Triploid GH mRNA expression in the present study was higher than those of diploids and tetraploids. We presume that a higher percentage of STH cells results in higher production of GH transcripts, which in turn promotes somatic growth. The lower percentage of STH cells may contribute to the lower expression of GH in tetraploids, resulting in slower growth. Previous research has shown that GH levels in the pituitary are positively correlated with growth. In the European eel (Anguilla anguilla), females showed a faster growth rate and had significantly higher GH expression in the pituitary than males [11]. The growth rate of gilthead sea bream (Sparus aurata) was faster in June than in March, which coincided with higher plasma levels of GH in June [4]. Thus, the faster growth of triploids may be induced by the higher expression levels of GH. The growth-promoting effect of GH is mediated by IGF-1 through GHR [50]. In the present study we found that higher expression of GHR and IGF-1 was observed in triploids compared with diploids and tetraploids. This suggests that triploids have more GHR on the surfaces of target cells and can interact with GH sufficiently, so that the liver can produce enough IGF-1 to promote growth. Several studies have shown that GHR and IGF-1 levels were positively correlated with growth rate. A decrease in hepatic GHR gene expression was shown to reduce plasma IGF-I and growth during the period of food deprivation in tilapia [23]. Similarly, Calduch-Giner et al. reported that levels of liver GHR

H. Zhong et al. / General and Comparative Endocrinology 178 (2012) 291–300

mRNA were positively correlated with the growth rate in gilthead sea bream [4]. Studies in the Nile tilapia showed that hepatic IGF-1 mRNA levels were significantly correlated with the growth rate. Higher hepatic IGF-1 mRNA expression was observed in faster growing Nile tilapia reared at higher temperatures and longer photoperiods [7,8]. In addition, IGF-1 implants stimulated growth in the coho salmon and mud carp [41,59]. In GH-transgenic Nile tilapia [17], coho salmon [49] and zebrafish [9], IGF-1 mRNA was elevated in transgenic fish compared with the control fish, resulting in increased growth. Additionally, among the studied fishes, IGF-1 expression in muscle was highest in triploids. GH-transgenic Nile tilapia [17] and coho salmon [49] displayed higher expression of IGF-1 in muscle compared with the control. Eppler et al. suggested that the rapid growth rate of GH-overexpressing fish is likely caused by the action of IGF-1 on extrahepatic sites, in particular on skeletal muscle [18]. The present study showed that elevated expression of IGF-1 in the liver and muscle induced by GH resulted in rapid growth in triploids. In summary, we cloned cDNAs of GH, GHR and IGF-1 from triploid and tetraploid carp. The transcripts showed high homology with other vertebrate species with conservative domains and motifs. Tissue expression patterns showed that GH mRNA was exclusively expressed in the pituitary, while expression of GHR and IGF1 mRNA was observed in all the studied tissues, with the highest expression in liver. During both prespawning and spawning seasons, triploids had higher expression of target genes than diploids and tetraploids. Under different temperatures and nutritional conditions, triploids had higher transcripts levels than diploids. These results suggest that the higher expression of GH, GHR and IGF-1 genes in triploids was not caused by environmental factors but by the high percentage of STH cells in the pituitary, which resulted in increased growth. Acknowledgments This research was supported by The National Natural Science Foundation of China (Grant No. 30930071), The National Natural Science Foundation of China (Grant No. 30871915), The National Natural Science Foundation of China for Young Scholars (Grant No. 31001105), The Natural Science Fund for Innovative Research Team of Hunan Province (Grant No. 10JJ7004), The Natural Science Fund for Innovative Research Team of Hunan Province for Young Scholars (Grant No. 10JJ4018), The Hunan Provincial Natural Science Foundation of China (Grant No. 11JJ2016), The National Special Fund for Scientific Research in Public Benefits (Grant No. 200903046), the Doctoral Fund of Ministry of Education of China (Grant No. 20104306110004), and the Construction Project of Key Discipline of Hunan Province and China and Hunan Provincial Innovation Foundation for Postgraduate (Grant No. CX2010B224). References [1] F.G. Ayson, E.G. de Jesus-Ayson, A. Takemura, MRNA expression patterns for GH, PRL, SL, TGF-I and IGF-II during altered feeding status in rabbitfish Siganus guttatus, Gen. Comp. Endocrinol. 150 (2007) 196–204. [2] B.R. Beckman, Perspectives on concordant and discordant relations between insulin-like growth factor 1 (IGF1) and growth in fishes, Gen. Comp. Endocrinol. 170 (2011) 233–252. [3] A.A. Butler, D. LeRoith, Minireview: tissue-specific versus generalized gene targeting of the igf1 and igf1r genes and their roles in insulin-like growth factor physiology, Endocrinology 142 (2001) 1685–1688. [4] J.A. Calduch-Giner, M. Mingarro, S. Vega-Rubin de Celis, D. Boujard, J. PérezSánchez, Molecular cloning and characterization of gilthead sea bream (Sparus aurata) growth hormone receptor (GHR). Assessment of alternative splicing, Comp. Biochem. Physiol. B, Biochem. Mol. Biol. 136 (2003) 1–13. [5] B. Cavari, B. Funkenstein, T.T. Chen, L.I. Gonzalez-Villasenor, M. Schartl, Effect of growth hormone on the growth rate of the gilthead seabream (Sparus aurata), and use of different constructs for the production of transgenic fish, Aquaculture 111 (1993) 189–197.

299

[6] Y.S. Chang, C.S. Liu, F.L. Huang, T.B. Lo, The primary structures of growth hormones of three cyprinid species: bighead carp, silver carp, and grass carp, Gen. Comp. Endocrinol. 87 (1992) 385–393. [7] E.M. Cruz, C.L. Brown, Influence of the photoperiod on growth rate and insulinlike growth factor-I gene expression in Nile tilapia Oreochromis niloticus, J. Fish Biol. 75 (2009) 130–141. [8] E.M. Cruz, C.L. Brown, J.A. Luckenbach, M.E. Picha, R.B. Bolivar, R.J. Borski, Insulin-like growth factor-I cDNA cloning, gene expression and potential use as a growth rate indicator in Nile tilapia Oreochromis niloticus, Aquaculture 251 (2006) 585–595. [9] M. de Azevedo Figueiredo, C.F. Lanes, D.V. Almeida, M.C. Proietti, L.F. Marins, The effect of GH overexpression on GHR and IGF-I gene regulation in different genotypes of GH-transgenic zebrafish, Comp. Biochem. Physiol. Part D Genomics Proteomics 2 (2007) 228–233. [10] E.E. Deane, N.Y. Woo, Modulation of fish growth hormone levels by salinity, temperature, pollutants and aquaculture related stress: a review, Rev. Fish Biol. Fish. 19 (2009) 97–120. [11] G. Degani, I. Tzchori, S. Yom-Din, D. Goldberg, K. Jackson, Growth differences and growth hormone expression in male and female European eels [Anguilla anguilla (L.)], Gen. Comp. Endocrinol. 134 (2003) 88–93. [12] R.H. Devlin, T.Y. Yesaki, C.A. Biagi, E.M. Donaldson, P. Swanson, W.-K. Chan, Extraordinary salmon growth, Nature 371 (1994) 209–210. [13] C.M. Di Prinzio, P.E. Botta, E.H. Barriga, E.A. Ríos, A.E. Reyes, S.E. Arranz, Growth hormone receptors in zebrafish (Danio rerio): Adult and embryonic expression patterns, Gene Expr. Patterns 10 (2010) 214–225. [14] H. Dong, L. Zeng, D. Duan, H. Zhang, Y. Wang, W. Li, et al., Growth hormone and two forms of insulin-like growth factors I in the giant grouper (Epinephelus lanceolatus): molecular cloning and characterization of tissue distribution, Fish Physiol. Biochem. 36 (2010) 201–212. [15] C.M. Duan, The insulin-like growth factor system and its biological actions in fish, Am. Zool. 37 (1997) 491–503. [16] C.M. Duan, Nutritional and developmental regulation of insulin-like growth factors in fish, J. Nutr. 128 (1998) 306S–314S. [17] E. Eppler, G. Berishvili, P. Mazel, A. Caelers, G. Hwang, N. Maclean, et al., Distinct organ-specific up- and down-regulation of IGF-I and IGF-II mRNA in various organs of a GH-overexpressing transgenic Nile tilapia, Transgenic Res. 19 (2010) 231–240. [18] E. Eppler, A. Caelers, N. Shved, G. Hwang, A.M. Rahman, N. Maclean, et al., Insulinlike growth factor I (IGF-I) in a growth-enhanced transgenic (GH-overexpressing) bony fish, the tilapia (Oreochromis niloticus): indication for a higher impact of autocrine/paracrine than of endocrine IGF-I, Transgenic Res. 16 (2007) 479–489. [19] A.W. Fast, T. Pewnim, R. Keawtabtim, R. Saijit, F.T. Te, R. Vejaratpimol, Comparative growth of diploid and triploid Asian catfish clarias macrocephalus in thailand, J. World Aqua. Soc. 26 (1995) 390–395. [20] J. Figueroa, R.S. Martín, C. Flores, H. Grothusen, G. Kausel, Seasonal modulation of growth hormone mRNA and protein levels in carp pituitary: evidence for two expressed genes, J. Comp. Physiol. B, Biochem. Syst. Environ. Physiol. 175 (2005) 185–192. [21] A.L. Filby, C.R. Tyler, Cloning and characterization of cDNAs for hormones and/ or receptors of growth hormone, insulin-like growth factor-I, thyroid hormone, and corticosteroid and the gender-, tissue-, and developmentalspecific expression of their mRNA transcripts in fathead minnow (Pimephales promelas), Gen. Comp. Endocrinol. 150 (2007) 151–163. [22] B.K. Fox, J.P. Breves, T. Hirano, E.G. Grau, Effects of short- and long-term fasting on plasma and stomach ghrelin, and the growth hormone/insulin-like growth factor I axis in the tilapia Oreochromis mossambicus, Domest. Anim. Endocrinol. 37 (2009) 1–11. [23] B.K. Fox, L.G. Riley, T. Hirano, E.G. Grau, Effects of fasting on growth hormone, growth hormone receptor, and insulin-like growth factor-I axis in seawateracclimated tilapia Oreochromis mossambicus, Gen. Comp. Endocrinol. 148 (2006) 340–347. [24] X. Guo, W.K. Hershberger, J.M. Myers, Growth and Survival of Intrastrain and Interstrain Rainbow Trout (Oncorhynchus mykiss) Triploids, J. World Aqua. Soc. 21 (1990) 250–256. [25] W. Hu, X. Chen, G. Yu, Y. Chen, Y. Shen, Y. Zhang, et al., Molecular cloning of grass carp growth hormone receptor and its functional interaction with silver carp growth hormone, Protein Pept. Lett. 16 (2009) 320–323. [26] K. Inoue, H. Iwatani, Y. Takei, Growth hormone and insulin-like growth factor I of a Euryhaline fish Cottus kazika: cDNA cloning and expression after seawater acclimation, Gen. Comp. Endocrinol. 131 (2003) 77–84. [27] S. Jentoft, A.H. Aastveit, O. Andersen, Molecular cloning and expression of insulin-like growth factor-I (IGF-I) in Eurasian perch (Perca fluviatilis): lack of responsiveness to growth hormone treatment, Fish Physiol. Biochem. 30 (2004) 67–76. [28] S. Kajimura, K. Uchida, T. Yada, L.G. Riley, J.C. Byatt, R.J. Collier, et al., Stimulation of insulin-like growth factor-I production by recombinant bovine growth hormone in Mozambique tilapia Oreochromis mossambicus, Fish Physiol. Biochem. 25 (2001) 221–230. [29] J.J. Kopchick, J.M. Andry, Growth Hormone (GH), GH Receptor, and Signal Transduction, Mol. Genet. Metab. 71 (2000) 293–314. [30] S. Kumar, M. Nei, J. Dudley, K. Tamura, MEGA: A biologist-centric software for evolutionary analysis of DNA and protein sequences, Brief. Bioinform. 9 (2008) 299–306. [31] L.T.O. Lee, G. Nong, Y.H. Chan, D.L.Y. Tse, C.H.K. Cheng, Molecular cloning of a teleost growth hormone receptor and its functional interaction with human growth hormone, Gene 270 (2001) 121–129.

300

H. Zhong et al. / General and Comparative Endocrinology 178 (2012) 291–300

[32] M. Li, J. Greenaway, J. Raine, J. Petrik, A. Hahnel, J. Leatherland, Growth hormone and insulin-like growth factor gene expression prior to the development of the pituitary gland in rainbow trout (Oncorhynchus mykiss) embryos reared at two temperatures, Comp. Biochem. Physiol., Part A Mol. Integr. Physiol. 143 (2006) 514–522. [33] S.J. Liu, H. Feng, Y. Liu, G.J. Zhou, C. Luo, X.X. He, The measurement of DNA content of the tetraploid F3–F4 hybrids of red crucian carp ($)  common carp (#) and their triploid offspring and other related diploid fish (in Chinese), J. Nat. Sci. Hunan Normal Univ. 22 (1999) 61–68. [34] S.J. Liu, F. Hu, G.J. Zhou, X.J. Zhang, X.X. He, H. Feng, Y. Liu, Gonadal structure of triploid crucian carp produced by crossing allotetraploid hybrids of Carassius auratus red var.($)  Cyprinus carpio L.(#) with Japanese crucian carp (Carassius auratus cavieri T. ET S) (in Chinese)., Acta hydrobiol. Sin. 24 (2000) 301–306. [35] S.J. Liu, Y. Liu, G.J. Zhou, X.J. Zhang, C. Luo, H. Feng, et al., The formation of tetraploid stocks of red crucian carp  common carp hybrids as an effect of interspecific hybridization, Aquaculture 192 (2001) 171–186. [36] Y. Liu, G.J. Zhou, Cytological study on the gonadal development of F1 hybrids produced by crossing Carassius auratus L. ($) with Cyprinus carpio (#) (in Chinese), Acta hydrobiol. Sin. 10 (1986) 101–108. [37] K. Livak, Analysis of relative gene expression data using Real-Time quantitative PCR and the 2DDCT method, Methods 25 (2001) 402–408. [38] Y. Long, S.J. Liu, W.R. Huang, J. Zhang, Y.D. Sun, C. Zhang, S. Chen, J.H. Liu, Y. Liu, Comparative studies on histological and ultra-structure of the pituitary of different ploidy level fishes, Sci. China, C, Life Sci. 49 (2006) 446–453. [39] J.A. Luckenbach, R. Murashige, H.V. Daniels, J. Godwin, R.J. Borski, Temperature affects insulin-like growth factor I and growth of juvenile southern flounder, Paralichthys lethostigma, Comp. Biochem. Physiol., Part A: Mol. Integr. Physiol. 146 (2007) 95–104. [40] X.L. Ma, X.C. Liu, Y. Zhang, P. Zhu, W. Ye, H.R. Lin, Two growth hormone receptors in Nile tilapia (Oreochromis niloticus): molecular characterization, tissue distribution and expression profiles in the gonad during the reproductive cycle, Comp. Biochem. Physiol. B, Biochem. Mol. Biol. 147 (2007) 325–339. [41] S.D. McCormick, K.M. Kelley, G. Young, R.S. Nishioka, H.A. Bern, Stimulation of coho salmon growth by insulin-like growth factor I, Gen. Comp. Endocrinol. 86 (1992) 398–406. [42] E. McLean, E. Donaldson, E. Teskeredzic, L. Souza, Growth enhancement following dietary delivery of recombinant porcine somatotropin to diploid and triploid coho salmon (Oncorhynchus kisutch), Fish Physiol. Biochem. 11 (1993) 363–369. [43] M. Mingarro, S. Vega-Rubin de Celis, A. Astola, C. Pendón, M.M.n. Valdivia, J. Pérez-Sánchez, Endocrine mediators of seasonal growth in gilthead sea bream (Sparus aurata): the growth hormone and somatolactin paradigm, Gen. Comp. Endocrinol. 128 (2002) 102–111. [44] Y. Ozaki, H. Fukada, Y. Kazeto, S. Adachi, A. Hara, K. Yamauchi, Molecular cloning and characterization of growth hormone receptor and its homologue in the Japanese eel (Anguilla japonica), Comp. Biochem. Physiol. B, Biochem. Mol. Biol. 143 (2006) 422–431. [45] I. Pala, M. Coelho, M. Schartl, Dosage compensation by gene-copy silencing in a triploid hybrid fish, Curr. Biol. 18 (2008) 1344–1348.

[46] F.L. Pedroso, E.G.T. de Jesus-Ayson, H.H. Cortado, S. Hyodo, F.G. Ayson, Changes in mRNA expression of grouper (Epinephelus coioides) growth hormone and insulin-like growth factor I in response to nutritional status, Gen. Comp. Endocrinol. 145 (2006) 237–246. [47] A.L. Pierce, J.T. Dickey, D.A. Larsen, H. Fukada, P. Swanson, W.W. Dickhoff, A quantitative real-time RT-PCR assay for salmon IGF-I mRNA, and its application in the study of GH regulation of IGF-I gene expression in primary culture of salmon hepatocytes, Gen. Comp. Endocrinol. 135 (2004) 401–411. [48] G. Radaelli, C. Poltronieri, C. Simontacchi, E. Negrato, F. Pascoli, A. Libertini, et al., Immunohistochemical localization of IGF-I, IGF-II and MSTN proteins during development of triploid sea bass (Dicentrarchus labrax), Eur. J. Histochem. 54 (2010) e16. [49] P.A. Raven, M. Uh, D. Sakhrani, B.R. Beckman, K. Cooper, J. Pinter, et al., Endocrine effects of growth hormone overexpression in transgenic coho salmon, Gen. Comp. Endocrinol. 159 (2008) 26–37. [50] M. Reinecke, Influences of the environment on the endocrine and paracrine fish growth hormone-insulin-like growth factor-I system, J. Fish Biol. 76 (2010) 1233–1254. [51] M. Reinecke, B.T. Bjornsson, W.W. Dickhoff, S.D. McCormick, I. Navarro, D.M. Power, et al., Growth hormone and insulin-like growth factors in fish: where we are and where to go, Gen. Comp. Endocrinol. 142 (2005) 20–24. [52] J.T. Silverstein, W.R. Wolters, M. Shimizu, W.W. Dickhoff, Bovine growth hormone treatment of channel catfish: strain and temperature effects on growth, plasma IGF-I levels, feed intake and efficiency and body composition, Aquaculture 190 (2000) 77–88. [53] B. Small, C. Murdock, G. Waldbieser, B. Peterson, Reduction in channel catfish hepatic growth hormone receptor expression in response to food deprivation and exogenous cortisol, Domest. Anim. Endocrinol. 31 (2006) 340–356. [54] X.F. Sun, Q.L. Guo, W. Hu, Y.P. Wang, Z.Y. Zhu, Molecular cloning of growth hormone receptor (GHR) from common carp (Cyprinus carpio L.) and identification of its two forms of mRNA transcripts, Prog. Nat. Sci. 16 (2006) 1156–1163. [55] T. Venugopal, V. Anathy, T.J. Pandian, G.Z. Gong, S. Mathavan, Molecular cloning of growth hormone-encoding cDNA of an indian major carp, Labeo rohita, and its expression in Escherichia coli and zebrafish, Gen. Comp. Endocrinol. 125 (2002) 236–247. [56] N. Very, J. Kittilson, L. Norbeck, M. Sheridan, Isolation, characterization, and distribution of two cDNAs encoding for growth hormone receptor in rainbow trout (Oncorhynchus mykiss), Comp. Biochem. Physiol. B, Biochem. Mol. Biol. 140 (2005) 615–628. [57] Q.P. Vong, K.M. Chan, C.H.K. Cheng, Quantification of common carp (Cyprinus carpio) IGF-I and IGF-II mRNA by real-time PCR: differential regulation of expression by GH, J. Endocrinol. 178 (2003) 513–521. [58] B.Y. Yang, M. Greene, T.T. Chen, Early embryonic expression of the growth hormone family protein genes in the developing rainbow trout Oncorhynchus mykiss, Mol. Reprod. Dev. 53 (1999) 127–134. [59] D.C. Zhang, Y.Q. Huang, Y.Q. Shao, S.G. Jiang, Molecular cloning, recombinant expression, and growth-promoting effect of mud carp (Cirrhinus molitorella) insulin-like growth factor-I, Gen. Comp. Endocrinol. 148 (2006) 203–212.