- Email: [email protected]
Elevated microRNA-125b promotes inflammation in rheumatoid arthritis by activation of NF-κB pathway
Biomedicine & Pharmacotherapy 93 (2017) 1151–1157
Available online at
ScienceDirect www.sciencedirect.com
Original article
Elevated microRNA-125b promotes inflammation in rheumatoid arthritis by activation of NF-kB pathway Bo Zhanga , Li-Song Wangb , Yu-Hu Zhouc,* a b c
Weinan Central Hospital, Weinan 714000, Shaanxi Province, China The Second Department of Orthopedics, Shangluo Central Hospital, Shangluo 726300, Shaanxi Province, China Department of Orthopedics, Yanan University Affiliated Hospital, Yanan 716000, Shaanxi Province, China
A R T I C L E I N F O
Article history: Received 13 April 2017 Received in revised form 25 June 2017 Accepted 9 July 2017 Keywords: Rheumatoid arthritis MicroRNA-125b Pro-inflammatory cytokines Nuclear factor kappa B pathway
A B S T R A C T
microRNA-125b (miR-125b) has been reported to be increased in rheumatoid arthritis (RA). However, the role of miR-125b in RA remains to be fully elucidated. We aimed to explore the functional role of miR125b in RA, as well as the underlying mechanism. The expression of miR-125b in serum and synovial tissues of patients with RA and healthy controls was confirmed. In addition, the levels of miR-125b in lipopolysaccharide (LPS)-stimulated fibroblast-like synoviocytes (FLS) were also measured. FLS were transfected with miR-125b mimic, antisense oligonucleotides (ASO)-miR-125b, pcDNA-inhibitor of NFkB (IkB)-a or corresponding controls, and then stimulated with LPS or incubated with nuclear factor kappa B (NF-kB) inhibitors pyrrolidine dithiocarbamate (PDTC). The effects of miR-125b abnormal expression on pro-inflammatory cytokines including tumor necrosis factor (TNF)-a, interleukin (IL)-6 and IL-1b and NF-kB pathway key factors phospho-p65 (p-p65) and IkB-a were assessed. Pearson correlation analysis was performed to assess the relationship between miR-125b expression and proinflammatory cytokines expression. Result showed that, the levels of miR-125b were significantly increased in RA serum and synovial tissues, as well as in LPS-stimulated FLS (P < 0.01). miR-125b overexpression statistically increased the expression of TNF-a, IL-6, IL-1b and p-p65 (P < 0.05 or P < 0.01), but markedly decreased IkB-a (P < 0.05). Contrary results were obtained by miR-125b downregulation. Additionally, there were strong positive relationships between miR-125b and TNF-a (R2 = 0.7569, P < 0.000), IL-6 (R2 = 0.8479, P < 0.000), and IL-1b (R2 = 0.8037, P < 0.000). Moreover, the upregulated levels of pro-inflammatory cytokines were markedly decreased by PDTC (P < 0.01) and further downregulated by co-transfection with pcDNA-IkB-a (P < 0.01). In conclusion, our results suggest that elevated miR-125b promotes inflammation in RA by activation of NF-kB pathway. © 2017 Elsevier Masson SAS. All rights reserved.
1. Introduction Rheumatoid arthritis (RA) is a chronic, destructive, inflammatory, systemic disease, which eventually leads to severe functional deterioration, lifelong disability, and high morbidity and mortality [1,2]. It has been estimated that approximately 1% of the general population is affected by the disease, and the incidence rate seems to be increasing in recent years [3]. RA is an important public
Abbreviations: miR-125b, microRNA-125b; RA, Rheumatoid arthritis; FLS, Fibroblast-like synoviocytes; LPS, Lipopolysaccharide; ASO, antisense oligonucleotides; TNF, Tumor necrosis factor; IL, Interleukin; NF-kB, nuclear factor kappa B; IkB, Inhibitor of NF-kB; EDTA, Ethylenediaminetetraacetic acid; PDTC, Pyrrolidine dithiocarbamate; PBS, Phosphate buffer saline. * Corresponding author at: Department of Orthopedics, Yanan University Affiliated Hospital, No. 43, Beida Street, Yanan, 716000, Shaanxi Province, China. E-mail address: [email protected] (Y.-H. Zhou). http://dx.doi.org/10.1016/j.biopha.2017.07.042 0753-3322/© 2017 Elsevier Masson SAS. All rights reserved.
health issue due to the substantial social and economic burden [4]. Although significant advance has been made in understanding the pathogenesis of RA, the exact mechanism remains elusive. An increasing number of studies have confirmed that inflammatory response plays a significant role in RA [5]. It has been reported that tumor necrosis factor-a (TNF-a), interleukin (IL)-1 and IL-6 are three main pro-inflammatory cytokines that contribute to the proteoglycan metabolism and cartilage catabolism [6]. TNF-a has been considered as an important therapeutic target of RA [7]. Administration of an approved TNF-a blocking antibody could markedly reduce the levels of IL-6 and IL-1b [7]. Thus, reduction of inflammatory response could be benefit for treatment of RA. MicroRNAs (miRNAs) have been reported to play significant roles in the development and progress of autoimmunity diseases [8–10], including in RA [11–14]. miRNAs are a class of small and non-coding RNAs that control the gene expression at the posttranscriptional
1152
B. Zhang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1151–1157
level. Multiply miRNAs are deregulated in RA, which are considered as the most promising and potential non-invasive biomarkers for detection of RA [11]. Among the miRNAs, miR-125b, an evolutionary conserved miRNA, has been identified as an important modulator of inflammation [15], B cell differentiation [16], and apoptosis [17]. Several studies have implicated that miR-125b is involved in RA and plays a critical role in the pathogenesis of RA [18,19]. miR-125b is found to be increased in RA serum and is also associated with disease activity in response to the treatment. However, it is less clear whether and how aberrant expression of miR-125b activated lipopolysaccharide (LPS)-stimulated fibroblast-like synoviocytes (FLS), as well as the relationship between aberrant expression of miR-125b and pro-inflammatory cytokines expression. Therefore, in the present study, we aimed to explore the potential functional role of miR-125b in RA. The expressions of miR-125b in serum and synovial tissues of patients with RA were assessed, as well as in LPS-stimulated FLS. Thereafter, we overexpressed or down-regulated the expression of miR-125b and then analyzed the effects of miR-125b aberrant expression on proinflammatory cytokines expression, the correlation, and potential signaling pathway in LPS-stimulated FLS. Our results might provide an experimental basis for gaining insight into the pathogenesis of RA. 2. Materials and methods 2.1. Patients and healthy controls Between April 2015 and May 2016, a total of twenty patients (8 males and 12 females, mean age: 55.8 years, range: 53–65 years) with RA, 16 healthy controls (7 males and 9 females, mean age: 54.9 years, range: 53–69 years), and 5 emergency trauma amputation patients (3 males and 2 females, mean age: 45.8 years, range: 28–63 years) were recruited in the study. RA was diagnosed according to the American College of Rheumatology (1987 revised criteria). Fresh peripheral blood (5 mL) were collected from the antecubital vein of RA patients and healthy controls in the morning and placed into tubes containing ethylenediaminetetraacetic acid (EDTA) anticoagulant, and then were centrifuged at 1000 g for 10 min at 4 C. In addition, synovial tissues (20 pieces of synovial tissues) were obtained from patients with RA undergoing joint replacement surgery and also were taken from 5 emergency trauma amputation patients. Both the healthy controls and emergency trauma amputation patients had no history of autoimmune diseases and/or infectious diseases. Our study was approved by the medical Ethics Committees of Yanan University Affiliated Hospital, and written informed consent was obtained from all the participants.
IkB-a into pcDNA3.1 (Invitrogen) [21]. Vector expressing miR-125b was acquired after cloning miR-125b genomic sequences in pIRESneo2 expression vector (Clontech). The transfection efficiency in transfected cells was assessed by Quantitative real time polymerase chain reaction (qRT-PCR) analysis 24 h after transfection. Briefly, the cells (2 105 cells) were transfected with miR-125b mimic (a final concentration of 50 nM), ASO-miR-125b (a final concentration of 150 nM), IkB-a or corresponding NCs using Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer’s instruction. After transfection, the cells were stimulated with LPS (10 mg/mL; Sigma-Aldrich) or the nuclear factor kappa B (NF-kB) inhibitor pyrrolidine dithiocarbamate (PDTC; 20 mM; Sigma-Aldrich), for 24 h. The supernatants were collected for further analysis. 2.4. QRT-PCR analysis Total RNA, including miRNA, was isolated from serum, synovial tissues, or FLS using Qiagen miRNeasy mini kit (Valencia, CA, USA) according to the manufacturer's instructions. RNA was purified and quantitated by RNeasy MinElute Cleanup Kit (Qiagen, Hilden, Germany), and then were reversely transcribed into complementary DNA (cDNA) using a reverse transcriptase kit (TAKARA, Dalian, China). qRT-PCR was performed with an ABI Prism 7700 sequence detector (Applied Biosystems, Foster City, CA, USA) and Express SYBR Green ER qPCR Super Master Mix (Invitrogen). The specific primers of miRNA and mRNA were all synthesized by Genepharma (Shanghai, China). The primers were listed as following: miR-125b, 50 - TCCCGAGACCCTAACTTGTGA 30 ; Small nuclear RNA U6 (snU6) primer, F: 50 -CTCGCTTCGGCAGCACA-30 ; R: 50 -AACGCTTCACGAATTT GCGT-30 [22]; TNF-a, F: 50 - TCGAACCCCGAGTGACAAGC30 ; R: 50 - ACC ATCAGCCGGGCTTCAAT-30 ; IL-6, F: 50 - CCTCACCCTCCAACAAAGAT-30 ; R: 50 -GCCTCAGACATCTCCAGTCC-30 ; IL-1b, F: 50 GCTACCCTCAAGCTTTG CCC-30 ; R: 50 -CCAGACGAGTGCGGTCCTTT30 ; GAPDH, F: 50 -TCCTGCACC ACCAACTGCTTAG-30 , R: 50 -AGTGGCAGTGATGGCATGGACT-30 . GAPDH and U6 were respectively loading controls for mRNA and miRNA. 2.5. Enzyme-linked immunosorbent assay (ELISA) The concentrations of pro-inflammatory cytokines including TNF-a, IL-6 and IL-1b were determined by ELISA. Briefly, the cells were transfected with miR-125b mimic, ASO-miR-125b or corresponding NCs, and then the cells were or were not treated with LPS or PDTC. Thereafter, the culture supernatants were collected. The concentrations were then assayed with an ELISA kit (R&D Systems, Minneapolis, MN, USA) according to the manufacturer’s instructions. The absorbance at 450 nm was determined using a microplate reader (DTX 800, Beckman, CA, USA).
2.2. Cell culture 2.6. Western blot analysis FLS were isolated from the synovial tissues according to a previous study [20]. The isolated cells were cultured in Dulbecco's modified Eagle's medium (DMEM; Sigma-Aldrich, St. Louis, MO, USA) supplemented with 10% heat-inactivated fetal calf serum (FCS; Sigma-Aldrich), and 100 mg/mL streptomycin and 100 U/ml penicillin (Sigma-Aldrich) at 37 C in a humidified incubator 5% CO2. At passages 4–6, FLS were used for further experimental procedures. 2.3. Cell transfection and treatment miR-125b mimic, antisense oligonucleotides (ASO)-miR-125b and corresponding negative controls (NCs), i.e. mimic NC and ASONC, were all purchased from Genepharma (Shanghai, China). pcDNA-inhibitor of NF-kB (IkB-a) was constructed by subcloning
After transfection with miR-125b mimic or mimic NC, the cells were collected, washed with phosphate buffer saline (PBS), and then lysed with RIPA lysis buffer (Santa Cruz Biotechnology, CA, USA) supplemented with protease inhibitor cocktail (Santa Cruz Biotechnology). The protein concentration was measured by a BCA protein assay kit (Thermo Scientific, Waltham, MA, USA). Equal amounts of protein (20 mg per lane) were subjected to a 10–15% sodium dodecyl dulfonate (SDS)-polyacrylamide gel electrophoresis (PAGE) and transferred onto polyvinylidene fluoride (PVDF) membranes (Santa Cruz Biotechnology). The membranes were then blocked in 5% non-fat skimmed milk in Tris Buffered Saline with Tween (TBST) for 1 h. Subsequently, the membranes were incubated with anti-phospho-p65 (p-p65; ab28856, 1:1000; Abcam, Cambridge, UK) antibody or anti- IkB-a (#4812, 1:1000;
B. Zhang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1151–1157
Cell Signaling, Danvers, MA, USA) overnight at 4 C. GAPDH (#5174, 1:1000; Cell Signaling, Danvers) was used as the internal control. Thereafter, the membranes were incubated with the appropriate horseradish peroxidase (HRP)-conjugated secondary antibody (Abcam) for 2 h at room temperature. The membrane was finally visualized using enhanced chemiluminescence western blotting substrate reagent (Pierce Biotechnology, Rockford, IL, USA). 2.7. Statistical analysis Each experiment was repeated at least 3 times. All data were presented as the mean standard deviation (SD). Student's t-test or analysis of variance (ANOVA) was used to compare statistical differences. Pearson correlation analysis was performed to assess the relationships between levels of miR-125b and pro-inflammatory cytokines. All data were analyzed using SPSS 19.0 (SPSS Inc., Chicago, IL, USA). P < 0.05 was considered as significant difference between values. 3. Results 3.1. MiR-125b is increased in RA serum, synovial tissues, and LPSstimulated FLS To explore the potential functional role of miR-125b in RA, we determined its expression levels in both serum and synovial tissues of patients with RA, as well as in FLS in response to LPSstimulated by qRT-PCR. As shown in Fig. 1A and B, the results showed that the expression levels of miR-125b were significantly up-regulated in both serum and synovial tissues of patients with RA compared with normal controls (both P < 0.01). Normalization was performed to normalize the expression of miR-125b on its median among samples. LPS is a cell wall constituent of gramnegative bacteria and is released during bacterial growth and disintegration, which is also a well-known potent inducer of inflammation and inflammatory bone loss [23]. Therefore, in the present study, we used LPS to stimulate FLS, aiming to simulate RA. Similarly, we found that the expression levels of miR-125b were also statistically increased in LPS-stimulated human FLS compared to the non-treated cells (P < 0.01) (Fig. 1C). The results indicated that miR-125b might play a significant role in RA. 3.2. MiR-125b promotes the expression of pro-inflammatory cytokines The effects of miR-125b abnormal expression on the proinflammatory cytokines levels were investigated. The expression levels of TNF-a, IL-6, and IL-1b were assayed by ELISA. As indicated
1153
in Fig. 2A–C, the results showed that the expression levels of TNFa, IL-6, and IL-1b were all significantly increased by LPS stimulation (all P < 0.05). However, no significant difference was found in expression levels of TNF-a, IL-6, and IL-1b between mimic NC and miR-125b mimic or between ASO-NC and miR-125b inhibitor without LPS stimulation. When the cells were simultaneously stimulated by LPS and transfected with miR-125b mimic, it was noteworthy that the levels of TNF-a, IL-6, and IL-1b were all markedly increased compared to mimic NC group (P < 0.05 or P < 0.01). However, miR-125 suppression showed contrary results (P < 0.01). The results demonstrated that miR-125b overexpression promoted the expression of pro-inflammatory cytokines. 3.3. MiR-125b positively correlates with TNF-a, IL-6, and IL-1b We then studied the correlations between the expression levels of miR-125b and pro-inflammatory cytokines. The results showed that there were strong positive relationships between serum miR125b level and TNF-a level (R2 = 0.7569, P < 0.001) (Fig. 3A), between serum miR-125b level and IL-6 level (R2 = 0.8479, P < 0.001) (Fig. 3B), and between serum miR-125b level and IL1b level (R2 = 0.8037, P < 0.001) (Fig. 3C). The results indicated that miR-125b positively correlated with the expression of TNF-a, IL-6, and IL-1b. 3.4. MiR-125b activates NF-kB signaling pathway It has been well acknowledged that NF-kB signaling pathway is an important mediator in inflammation and immunity. To examine whether miR-125b is involved in NF-kB signaling pathway, we determined the expression of p-p65 and IkB-a after overexpression of miR-125b by western blot. The results demonstrated that, under condition of LPS stimulation, miR-125b overexpression prominently up-regulated the protein levels of p-p65 compared to the mimic NC group (P < 0.01), but down-regulated the levels of IkB-a (P < 0.05) (Fig. 4A and B). Furthermore, we observed that miR-125b knockdown significantly downregulated the protein levels of p-p65 (P < 0.01), but up-regulated the levels of IkB-a (P < 0.01) (Fig. 4C and D). These results suggested that miR-125b activated NF-kB signaling pathway. To further determine whether miR-125b regulates inflammatory response by modulating the NFkB signaling pathway, we administrated an inhibitor of NF-kB (PDTC) and upregulated the expression of IkB-a, and then analyzed the effects of PDTC on expression of TNF-a, IL-6, and IL-1b. As indicated in Fig. 4E, the data showed that the upregulated levels of TNF-a, IL-6, and IL-1b induced by miR-125b overexpression were all significantly decreased by PDTC and further
Fig. 1. Expression of miR-125b in patients with RA, health controls, trauma amputation patients, and FLS by qRT-PCR. The serum levels (A), synovial tissues levels (B), and the levels in FLS stimulated by LPS (C) were significantly increased compared to the controls. miR, microRNA; RA, rheumatoid arthritis; qRT-PCR, quantitative real time polymerase chain reaction; FLS, fibroblast-like synoviocytes; LPS, lipopolysaccharide. **P < 0.01.
1154
B. Zhang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1151–1157
Fig. 2. Effects of miR-125b aberrant expression on pro-inflammatory cytokines. FLS were transfected with miR-125b mimic, ASO-miR-125b or corresponding NCs and then were stimulated with LPS. Thereafter, the expression levels of TNF-a, IL-6, and IL-1b were assayed by ELISA. The expression of TNF-a (A), IL-6 (B), and IL-1b (C) was significantly increased by miR-125b overexpression but decreased by miR-125b suppression. However, no significant differences were found in the expression levels of proinflammatory cytokines between mimic NC/ASO-NC and miR-125b mimic/ASO-miR-125b without LPS stimulation. miR, microRNA; FLS, fibroblast-like synoviocytes; LPS, lipopolysaccharide; NC, negative controls; ASO, antisense oligonucleotides; ELISA, enzyme-linked immunosorbent assay; TNF, tumor necrosis factor; IL, interleukin; ns, no significance. *P < 0.05; **P < 0.01.
Fig. 3. Correlations between expressions of miR-125b and pro-inflammatory cytokines. To confirm the correlations between expressions of miR-125b and pro-inflammatory cytokines, we performed the correlation analysis. The results showed that miR-125b was positively correlated with expressions of TNF-a (A), IL-6 (B), and IL-1b (C). miR, microRNA; TNF, tumor necrosis factor; IL, interleukin.
downregulated by overexpression of IkB-a (all P < 0.01). Therefore, the results indicated that miR-125b exerted its proinflammatory role by activation of NF-kB signaling pathway. 4. Discussion In the present study, our data suggested that the expression levels of miR-125b were significantly increased in both serum and synovial tissues in patients with RA compared to the healthy controls, as well as in RA FLS in response to LPS. Overexpression of miR-125b statistically upregulated the expression of pro-inflammatory cytokines. In addition, we found that there were strong positive relationships between miR-125b levels and TNF-a, IL-6, and IL-1b expressions. Moreover, that the results showed that overexpression of miR-125b dramatically elevated the protein levels of p-p65 and IkB-a, while administration of an inhibitor of NF-kB (PDTC), the upregulated levels were reversed by PDTC. The results indicated that the miR-125b promoted inflammation in RA by activation of NF-kB pathway. Several miRNAs have been identified to be aberrantly expressed in patients with RA compared with the healthy controls [11,24–28]. Consistent with previous studies [18,19,29], we also observed that the expression patterns of miR-125b were all significantly elevated in both serum and synovial tissues in patients with RA and in FLS in response to LPS compared to controls. In addition to the above results, we analyzed the effects of aberrant expression of miR-125b on pro-inflammatory cytokines with or without LPS stimulation in FLS, along with the relationship between aberrant expression of miR-125b and pro-inflammatory cytokines expression. miR-125b was identified as a critical regulator of pro-inflammatory
cytokines, such as TNF-a, interferon (IFN) g, chemokine (CC motif) ligand (CCL) 4 and matrix metalloproteinase (MMP)-13 [30– 33]. Therefore, we assumed that miR-125b might contribute to the increased inflammatory response of RA. To further confirm the functional role of miR-125b in RA, we performed in vitro studies using cultured human FLS. FLS are a key component of rheumatoid synovium and produce some cytokines, chemokines, and transcription factors, which are responsible for the pathophysiological process of RA [34,35]. In addition, it has been reported that the prolonged life span of these cells plays a critical role in the ongoing of inflammation and destruction of joints [27]. The data demonstrated that overexpression of miR-125b dramatically increased the levels of TNF-a, IL-1b, and IL-6 and while downregulation of miR-125b, the expression of TNF-a, IL-1b, and IL-6 were all significantly decreased. Interestingly, our results found that the expression of TNF-a, IL-1b, and IL-6 were not markedly changed without LPS stimulation, indicating that the effects of miR-125b on expression of pro-inflammatory cytokines might be inflammatory-dependent. It has been well demonstrated that pro-inflammatory cytokines, such as TNF-a, IL-1b, and IL-6, are important mediators of inflammatory response in RA [36–38]. At present, substantial studies have suggested the effects of anti-cytokine therapies on RA. For example, anti-TNF-a and anti-IL-1 agents is established in the treatment of patients with refractory RA [39]. TNF-a is a major proinflammatory cytokine that necessarily stimulates synovial inflammation and joint destruction in the development of RA [40]. In addition, TNF-a could promote the synthesis of other proinflammatory cytokines and activate several intracellular signaling pathways [34]. IL-1b in vitro has also been shown the induction of
B. Zhang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1151–1157
1155
Fig. 4. Effects of miR-125b on NF-kB signaling pathway. To explore whether miR-125b is involved in NF-kB signaling pathway, we measured the expression of p-p65 and IkBa by western blot under the condition of overexpression or down-regulating the expression of miR-125b. Further, an inhibitor of NF-kB (PDTC) was performed and the expression of IkB-a was overexpressed, and then the expression of TNF-a, IL-6, and IL-1b was assayed again. The results showed that miR-125b overexpression significantly increased the protein expression of p-p65 but decreased IkB-a (A and B); and while miR-125b downregulation markedly downregulated the protein expression of p-p65 but increased IkB-a (C and D). The elevated mRNA expression of TNF-a, IL-6, and IL-1b induced by miR-125b overexpression was significantly decreased by PDTC and further downregulated by co-transfection of pcDNA-IkB-a (E). miR, microRNA; TNF, tumor necrosis factor; IL, interleukin; NF-kB, nuclear factor kappa B, PDTC, pyrrolidine dithiocarbamate; p-p65, phospho-p65; IkB, inhibitor of NF-kB; NC, negative controls. *P < 0.05; **P < 0.01.
pro-inflammatory cytokine during RA [41], and IL-6 appears to be the main driver of the acute phase response in RA [36]. Previous studies suggested that TNF-a mRNA was directly regulated by miR125b [30,32]. Similarly, our study also suggested that there was a strong positive relationship between miR-125b and TNF-a. In addition to TNF-a, our results also implied that IL-1b and IL-6 were both positively correlated with the expression of miR-125b. It was noteworthy that although the significant difference was found in the expression of pro-inflammatory cytokines regulated by miR125b in LPS-stimulated FLS, it is unclear whether this is biologically
relevant. Therefore, further animal studies should be performed to confirm the results. NF-kB pathway is responsible for regulation of numerous genes expression in the inflammatory response. An increasing number of in vitro and in vivo studies have confirmed that the NF-kB signaling pathway plays an important activated role in the development and progression of RA [42–44]. Activation of NF-kB mediates the inflammatory response and chondrocyte apoptosis, leading to progressive extracellular matrix damage and cartilage destruction. Inhibition of NF-kB has been shown good therapeutic effects [42].
1156
B. Zhang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1151–1157
Recently, several studies have illustrated the bidirectional interplays between the NF-kB pathway and miRNAs [45,46]. miR-125b has been reported to continuously regulate the NF-kB pathway [15,47,48]. In the present study, we analyzed the expression of pp65 and IkB-a after overexpression and downregulation of miR125b. P65 is one of the key subunits of NF-kB, and p-p65 is a marker for NF-kB activation [49]. IkB-a is a suppressive factor of NF-kB and degradation of IkB-a is a key event in activation of NFkB [50]. In our study, the findings showed that miR-125b overexpression significantly increased the protein levels of pp65 but decreased IkB-a, and while downregulation of miR-125b showed the contrary results, indicating that miR-125b overexpression activates the NF-kB pathway. Furthermore, it has been reported that NF-kB positively regulates genes encoding proinflammatory cytokines, such as TNF-a, IL-1b, IL-6 [42]. To verify whether miR-125b regulates the inflammatory response of RA by modulating NF-kB pathway, we administrated the inhibitor of NFkB pathway, PDTC, and co-transfected with pcDNA-IkB-a, and then tested the effects of miR-125b overexpression on the levels of pro-inflammatory cytokines again. It has been confirmed that TNFa and IL-1b activates NF-kB via a rapid and dose-dependent process by inducing the phosphorylation and degradation of IkB and results in the translocation of NF-kB to the nucleus where it binds to specific promoter binding sites [51–53]. IL-6 activates NFkB, representing a positive feedback loop [54]. The data demonstrated that the upregulated pro-inflammatory cytokines were statistically downregulated by PDTC and were further downregulated by co-transfection with pcDNA-IkB-a. In conclusion, our results suggest that miR-125b serves as a stimulator of inflammatory response in RA, and the effects might be by activation of NF-kB pathway. Our data may provide evidence of miR-125b in RA, thereby reducing the expression of miR-125b may be benefit for treating RA. Authors’ contribution Conceived and designed the experiments: H. Hou and W. Li. Performed the experiments and analyzed the data: H. Hou. Wrote the Paper and approved the final submission: All authors. Conflict of interest Authors declare that there is no conflict of interests. Funding This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. Acknowledgment None. References [1] T.M. Farragher, M. Lunt, B. Fu, D. Bunn, D.P. Symmons, Early treatment with, and time receiving, first disease-modifying antirheumatic drug predicts longterm function in patients with inflammatory polyarthritis, Ann. Rheum. Dis. 69 (4) (2010) 689–695. [2] M.P. van der Linden, S. Le Cessie, K. Raza, D. van der Woude, R. Knevel, T.W. Huizinga, A. van der Helm-van Mil, Long-term impact of delay in assessment of patients with early arthritis, Arthritis &, Rheumatism 62 (12) (2010) 3537– 3546. [3] D. Scublinsky, C.D. Gonzalez, Quantifying disease in challenging conditions: incidence and prevalence of rheumatoid arthritis, J. Rheumatol. 43 (7) (2016) 1263–1264. [4] T. Uhlig, R.H. Moe, T.K. Kvien, The burden of disease in rheumatoid arthritis, Pharmacoeconomics 32 (9) (2014) 841–851.
[5] L.I. Filippin, R. Vercelino, N.P. Marroni, R.M. Xavier, Redox signalling and the inflammatory response in rheumatoid arthritis, Clin. Exp. Immunol. 152 (3) (2008) 415–422. [6] F.A. van de Loo, L.A. Joosten, P.L. van Lent, O.J. Arntz, W.B. van den Berg, Role of interleukin-1, tumor necrosis factor alpha, and interleukin-6 in cartilage proteoglycan metabolism and destruction. Effect of in situ blocking in murine antigen- and zymosan-induced arthritis, Arthritis Rheum. 38 (2) (1995) 164– 172. [7] Y. Zheng, L. Sun, T. Jiang, D. Zhang, D. He, H. Nie, TNFa promotes Th17 cell differentiation through IL-6 and IL-1b produced by monocytes in rheumatoid arthritis, J. Immunol. Res. 2014 (2014) 385352. [8] M. Iborra, F. Bernuzzi, P. Invernizzi, S. Danese, MicroRNAs in autoimmunity and inflammatory bowel disease: crucial regulators in immune response, Autoimmun. Rev. 11 (5) (2012) 305–314. [9] R.P. Singh, I. Massachi, S. Manickavel, S. Singh, N.P. Rao, S. Hasan, D.K. Mc Curdy, S. Sharma, D. Wong, B.H. Hahn, The role of miRNA in inflammation and autoimmunity, Autoimmun. Rev. 12 (12) (2013) 1160–1165. [10] A. Chatzikyriakidou, P.V. Voulgari, I. Georgiou, A.A. Drosos, miRNAs and related polymorphisms in rheumatoid arthritis susceptibility, Autoimmun. Rev. 11 (9) (2012) 636–641. [11] A.V. Churov, E.K. Oleinik, M. Knip, MicroRNAs in rheumatoid arthritis: altered expression and diagnostic potential, Autoimmun. Rev. 14 (11) (2015) 1029– 1037. [12] M. Filková, A. Jüngel, R.E. Gay, S. Gay, MicroRNAs in rheumatoid arthritis, BioDrugs 26 (3) (2012) 131–141. [13] A. Ceribelli, M.A. Nahid, M. Satoh, E.K. Chan, MicroRNAs in rheumatoid arthritis, FEBS Lett. 585 (23) (2011) 3667–3674. [14] E. Salehi, R. Eftekhari, M. Oraei, A. Gharib, K. Bidad, MicroRNAs in rheumatoid arthritis, Clin. Rheumatol. 34 (4) (2015) 615–628. [15] S.-W. Kim, K. Ramasamy, H. Bouamar, A.-P. Lin, D. Jiang, R.C. Aguiar, MicroRNAs miR-125a and miR-125b constitutively activate the NF-kB pathway by targeting the tumor necrosis factor alpha-induced protein 3 (TNFAIP3, A20), Proc. Natl. Acad. Sci. 109 (20) (2012) 7865–7870. [16] R. Malumbres, K.A. Sarosiek, E. Cubedo, J.W. Ruiz, X. Jiang, R.D. Gascoyne, R. Tibshirani, I.S. Lossos, Differentiation stage–specific expression of microRNAs in B lymphocytes and diffuse large B-cell lymphomas, Blood 113 (16) (2009) 3754–3764. [17] Y.-M. Sun, K.-Y. Lin, Y.-Q. Chen, Diverse functions of miR-125 family in different cell contexts, J. Hematol. oncol. 6 (1) (2013) 1. [18] I. Duroux-Richard, Y.-M. Pers, S. Fabre, M. Ammari, D. Baeten, G. Cartron, I. Touitou, C. Jorgensen, F. Apparailly, Circulating miRNA-125b is a potential biomarker predicting response to rituximab in rheumatoid arthritis, Mediators Inflammation 2014 (2014). [19] V. Hruskova, R. Jandova, L. Vernerova, H. Mann, O. Pecha, K. Prajzlerova, K. Pavelka, J. Vencovsky, M. Filkova, L. Senolt, MicroRNA-125b: association with disease activity and the treatment response of patients with early rheumatoid arthritis, Arthritis Res. Ther. 18 (1) (2016) 1. [20] Y. Yoshioka, E. Kozawa, H. Urakawa, E. Arai, N. Futamura, L. Zhuo, K. Kimata, N. Ishiguro, Y. Nishida, Suppression of hyaluronan synthesis alleviates inflammatory responses in murine arthritis and in human rheumatoid synovial fibroblasts, Arthritis Rheumatism 65 (5) (2013) 1160–1170. [21] G. Franzoso, V. Bours, S. Park, M. Tomita-Yamaguchi, K. Kelly, U. Siebenlist, The candidate oncoprotein Bcl-3 is an antagonist of p50/NF-kappa B-mediated inhibition, Nature 359 (6393) (1992) 339–342. [22] G.R. Kunkel, R.L. Maser, J.P. Calvet, T. Pederson, U6 small nuclear RNA is transcribed by RNA polymerase III, Proc. Natl. Acad. Sci. U. S. A. 83 (22) (1986) 8575. [23] G. Li, D. Liu, Y. Zhang, Y. Qian, H. Zhang, S. Guo, M. Sunagawa, T. Hisamitsu, Y. Liu, Celastrol inhibits lipopolysaccharide-stimulated rheumatoid fibroblastlike synoviocyte invasion through suppression of TLR4/NF-kB-mediated matrix metalloproteinase-9 expression, PLoS One 8 (7) (2013) e68905. [24] J. Stanczyk, D.M.L. Pedrioli, F. Brentano, O. Sanchez-Pernaute, C. Kolling, R.E. Gay, M. Detmar, S. Gay, D. Kyburz, Altered expression of MicroRNA in synovial fibroblasts and synovial tissue in rheumatoid arthritis, Arthritis Rheumatism 58 (4) (2008) 1001–1009. [25] K. Murata, H. Yoshitomi, S. Tanida, M. Ishikawa, K. Nishitani, H. Ito, T. Nakamura, Plasma and synovial fluid microRNAs as potential biomarkers of rheumatoid arthritis and osteoarthritis, Arthritis Res. Ther. 12 (3) (2010) 1. [26] J. Stanczyk, C. Ospelt, E. Karouzakis, A. Filer, K. Raza, C. Kolling, R. Gay, C.D. Buckley, P.P. Tak, S. Gay, Altered expression of microRNA-203 in rheumatoid arthritis synovial fibroblasts and its role in fibroblast activation, Arthritis Rheumatism 63 (2) (2011) 373–381. [27] F. Niederer, M. Trenkmann, C. Ospelt, E. Karouzakis, M. Neidhart, J. Stanczyk, C. Kolling, R.E. Gay, M. Detmar, S. Gay, Down-regulation of microRNA-34a* in rheumatoid arthritis synovial fibroblasts promotes apoptosis resistance, Arthritis Rheumatism 64 (6) (2012) 1771–1779. [28] H. Shibuya, T. Nakasa, N. Adachi, Y. Nagata, M. Ishikawa, M. Deie, O. Suzuki, M. Ochi, Overexpression of microRNA-223 in rheumatoid arthritis synovium controls osteoclast differentiation, Mod. Rheumatol. 23 (4) (2013) 674–685. [29] N. Semaan, L. Frenzel, G. Alsaleh, G. Suffert, J.-E. Gottenberg, J. Sibilia, S. Pfeffer, D. Wachsmann, miR-346 controls release of TNF-a protein and stability of its mRNA in rheumatoid arthritis via tristetraprolin stabilization, PLoS One 6 (5) (2011) e19827. [30] E. Tili, J.-J. Michaille, A. Cimino, S. Costinean, C.D. Dumitru, B. Adair, M. Fabbri, H. Alder, C.G. Liu, G.A. Calin, Modulation of miR-155 and miR-125b levels following lipopolysaccharide/TNF-a stimulation and their possible roles in
B. Zhang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1151–1157
[31]
[32]
[33]
[34] [35]
[36] [37] [38]
[39] [40] [41] [42]
regulating the response to endotoxin shock, J. Immunol. 179 (8) (2007) 5082– 5089. M.V. Rajaram, B. Ni, J.D. Morris, M.N. Brooks, T.K. Carlson, B. Bakthavachalu, D. R. Schoenberg, J.B. Torrelles, L.S. Schlesinger, Mycobacterium tuberculosis lipomannan blocks TNF biosynthesis by regulating macrophage MAPKactivated protein kinase 2 (MK2) and microRNA miR-125b, Proc. Natl. Acad. Sci. 108 (42) (2011) 17408–17413. H.-C. Huang, H.-R. Yu, L.-T. Huang, H.-C. Huang, R.-F. Chen, I.-C. Lin, C.-Y. Ou, T.Y. Hsu, K.D. Yang, miRNA-125b regulates TNF-a production in CD14+ neonatal monocytes via post-transcriptional regulation, J. Leukoc. Biol. 92 (1) (2012) 171–182. R.L. Rossi, G. Rossetti, L. Wenandy, S. Curti, A. Ripamonti, R.J. Bonnal, R.S. Birolo, M. Moro, M.C. Crosti, P. Gruarin, Distinct microRNA signatures in human lymphocyte subsets and enforcement of the naive state in CD4+ T cells by the microRNA miR-125b, Nat. Immunol. 12 (8) (2011) 796–803. L. Huber, O. Distler, I. Tarner, R. Gay, S. Gay, T. Pap, Synovial fibroblasts: key players in rheumatoid arthritis, Rheumatology 45 (6) (2006) 669–675. Y. Nakamachi, S. Kawano, M. Takenokuchi, K. Nishimura, Y. Sakai, T. Chin, R. Saura, M. Kurosaka, S. Kumagai, MicroRNA-124a is a key regulator of proliferation and monocyte chemoattractant protein 1 secretion in fibroblastlike synoviocytes from patients with rheumatoid arthritis, Arthritis Rheumatism 60 (5) (2009) 1294–1304. F.M. Brennan, I.B. McInnes, Evidence that cytokines play a role in rheumatoid arthritis, J. Clin. Invest. 118 (11) (2008) 3537–3545. M. Odeh, Role of cytokines in rheumatoid arthritis, Drug News Perspect. 11 (6) (1998) 331. M. Feldmann, S.R.N. Maini, Role of cytokines in rheumatoid arthritis: an education in pathophysiology and therapeutics, Immunol. Rev. 223 (1) (2008) 7–19. M. Feldmann, Pathogenesis of arthritis: recent research progress, Nat. Immunol. 2 (9) (2001) 771–773. E.A. Moelants, A. Mortier, J. Van Damme, P. Proost, Regulation of TNF-a with a focus on rheumatoid arthritis, Immunol. Cell Biol. 91 (6) (2013) 393–401. J. Dayer, The pivotal role of interleukin-1 in the clinical manifestations of rheumatoid arthritis, Rheumatology 42 (90002) (2003) 3–10. J. Roman-Blas, S. Jimenez, NF-kB as a potential therapeutic target in osteoarthritis and rheumatoid arthritis, Osteoarthritis Cartilage 14 (9) (2006) 839–848.
1157
[43] S.S. Makarov, NF-kB in rheumatoid arthritis: a pivotal regulator of inflammation, hyperplasia, and tissue destruction, Arthritis. Res. Ther. 3 (4) (2001) 1. [44] R. Scheinman, NF-kB and rheumatoid arthritis will understanding genetic risk lead to a therapeutic reward? forum on immunopathological diseases and therapeutics, Begel House Inc., 2013. [45] X. Ma, L.E.B. Buscaglia, J.R. Barker, Y. Li, MicroRNAs in NF-kB signaling, J. Mol. Cell Biol. 3 (3) (2011) 159–166. [46] J.P. Idrovo, A. Jacob, W.L. Yang, Z. Wang, H.T. Yen, J. Nicastro, G.F. Coppa, P. Wang, A deficiency in cold-inducible RNA-binding protein accelerates the inflammation phase and improves wound healing, Int. J. Mol. Med. 37 (2) (2016). [47] A.J. Murphy, P.M. Guyre, P.A. Pioli, Estradiol suppresses NF-kB activation through coordinated regulation of let-7a and miR-125b in primary human macrophages, J. Immunol. 184 (9) (2010) 5029–5037. [48] D. Wang, L. Cao, Z. Xu, L. Fang, Y. Zhong, Q. Chen, R. Luo, H. Chen, K. Li, S. Xiao, MiR-125b reduces porcine reproductive and respiratory syndrome virus replication by negatively regulating the NF-kB pathway, PLoS One 8 (2) (2013) e55838. [49] F.G. Goh, C.M. Sloss, M.R. Cunningham, M. Nilsson, L. Cadalbert, R. Plevin, Gprotein-dependent and-independent pathways regulate proteinase-activated receptor-2 mediated p65 NFkB serine 536 phosphorylation in human keratinocytes, Cell. Signal. 20 (7) (2008) 1267–1274. [50] Q. Li, I.M. Verma, NF-kB regulation in the immune system, Nat. Rev. Immunol. 2 (10) (2002) 725–734. [51] A.S. Baldwin Jr., The NF-kappa B and I kappa B proteins: new discoveries and insights, Annu. Rev. Immunol. 14 (1996) 649–683. [52] C.K. Lee, E.Y. Lee, Y.G. Kim, S.H. Mun, H.B. Moon, B. Yoo, Alpha-lipoic acid inhibits TNF-alpha induced NF-kappa B activation through blocking of MEKK1-MKK4-IKK signaling cascades, Int. Immunopharmacol. 8 (2) (2008) 362–370. [53] X. Ying, X. Chen, S. Cheng, Y. Shen, L. Peng, H.Z. Xu, Piperine inhibits IL-beta induced expression of inflammatory mediators in human osteoarthritis chondrocyte, Int. Immunopharmacol. 17 (2) (2013) 293–299. [54] E. Piskounova, C. Polytarchou, J.E. Thornton, R.J. LaPierre, C. Pothoulakis, J.P. Hagan, D. Iliopoulos, R.I. Gregory, Lin28A and Lin28 B inhibit let-7 microRNA biogenesis by distinct mechanisms, Cell 147 (5) (2011) 1066–1079.
Available online at
ScienceDirect www.sciencedirect.com
Original article
Elevated microRNA-125b promotes inflammation in rheumatoid arthritis by activation of NF-kB pathway Bo Zhanga , Li-Song Wangb , Yu-Hu Zhouc,* a b c
Weinan Central Hospital, Weinan 714000, Shaanxi Province, China The Second Department of Orthopedics, Shangluo Central Hospital, Shangluo 726300, Shaanxi Province, China Department of Orthopedics, Yanan University Affiliated Hospital, Yanan 716000, Shaanxi Province, China
A R T I C L E I N F O
Article history: Received 13 April 2017 Received in revised form 25 June 2017 Accepted 9 July 2017 Keywords: Rheumatoid arthritis MicroRNA-125b Pro-inflammatory cytokines Nuclear factor kappa B pathway
A B S T R A C T
microRNA-125b (miR-125b) has been reported to be increased in rheumatoid arthritis (RA). However, the role of miR-125b in RA remains to be fully elucidated. We aimed to explore the functional role of miR125b in RA, as well as the underlying mechanism. The expression of miR-125b in serum and synovial tissues of patients with RA and healthy controls was confirmed. In addition, the levels of miR-125b in lipopolysaccharide (LPS)-stimulated fibroblast-like synoviocytes (FLS) were also measured. FLS were transfected with miR-125b mimic, antisense oligonucleotides (ASO)-miR-125b, pcDNA-inhibitor of NFkB (IkB)-a or corresponding controls, and then stimulated with LPS or incubated with nuclear factor kappa B (NF-kB) inhibitors pyrrolidine dithiocarbamate (PDTC). The effects of miR-125b abnormal expression on pro-inflammatory cytokines including tumor necrosis factor (TNF)-a, interleukin (IL)-6 and IL-1b and NF-kB pathway key factors phospho-p65 (p-p65) and IkB-a were assessed. Pearson correlation analysis was performed to assess the relationship between miR-125b expression and proinflammatory cytokines expression. Result showed that, the levels of miR-125b were significantly increased in RA serum and synovial tissues, as well as in LPS-stimulated FLS (P < 0.01). miR-125b overexpression statistically increased the expression of TNF-a, IL-6, IL-1b and p-p65 (P < 0.05 or P < 0.01), but markedly decreased IkB-a (P < 0.05). Contrary results were obtained by miR-125b downregulation. Additionally, there were strong positive relationships between miR-125b and TNF-a (R2 = 0.7569, P < 0.000), IL-6 (R2 = 0.8479, P < 0.000), and IL-1b (R2 = 0.8037, P < 0.000). Moreover, the upregulated levels of pro-inflammatory cytokines were markedly decreased by PDTC (P < 0.01) and further downregulated by co-transfection with pcDNA-IkB-a (P < 0.01). In conclusion, our results suggest that elevated miR-125b promotes inflammation in RA by activation of NF-kB pathway. © 2017 Elsevier Masson SAS. All rights reserved.
1. Introduction Rheumatoid arthritis (RA) is a chronic, destructive, inflammatory, systemic disease, which eventually leads to severe functional deterioration, lifelong disability, and high morbidity and mortality [1,2]. It has been estimated that approximately 1% of the general population is affected by the disease, and the incidence rate seems to be increasing in recent years [3]. RA is an important public
Abbreviations: miR-125b, microRNA-125b; RA, Rheumatoid arthritis; FLS, Fibroblast-like synoviocytes; LPS, Lipopolysaccharide; ASO, antisense oligonucleotides; TNF, Tumor necrosis factor; IL, Interleukin; NF-kB, nuclear factor kappa B; IkB, Inhibitor of NF-kB; EDTA, Ethylenediaminetetraacetic acid; PDTC, Pyrrolidine dithiocarbamate; PBS, Phosphate buffer saline. * Corresponding author at: Department of Orthopedics, Yanan University Affiliated Hospital, No. 43, Beida Street, Yanan, 716000, Shaanxi Province, China. E-mail address: [email protected] (Y.-H. Zhou). http://dx.doi.org/10.1016/j.biopha.2017.07.042 0753-3322/© 2017 Elsevier Masson SAS. All rights reserved.
health issue due to the substantial social and economic burden [4]. Although significant advance has been made in understanding the pathogenesis of RA, the exact mechanism remains elusive. An increasing number of studies have confirmed that inflammatory response plays a significant role in RA [5]. It has been reported that tumor necrosis factor-a (TNF-a), interleukin (IL)-1 and IL-6 are three main pro-inflammatory cytokines that contribute to the proteoglycan metabolism and cartilage catabolism [6]. TNF-a has been considered as an important therapeutic target of RA [7]. Administration of an approved TNF-a blocking antibody could markedly reduce the levels of IL-6 and IL-1b [7]. Thus, reduction of inflammatory response could be benefit for treatment of RA. MicroRNAs (miRNAs) have been reported to play significant roles in the development and progress of autoimmunity diseases [8–10], including in RA [11–14]. miRNAs are a class of small and non-coding RNAs that control the gene expression at the posttranscriptional
1152
B. Zhang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1151–1157
level. Multiply miRNAs are deregulated in RA, which are considered as the most promising and potential non-invasive biomarkers for detection of RA [11]. Among the miRNAs, miR-125b, an evolutionary conserved miRNA, has been identified as an important modulator of inflammation [15], B cell differentiation [16], and apoptosis [17]. Several studies have implicated that miR-125b is involved in RA and plays a critical role in the pathogenesis of RA [18,19]. miR-125b is found to be increased in RA serum and is also associated with disease activity in response to the treatment. However, it is less clear whether and how aberrant expression of miR-125b activated lipopolysaccharide (LPS)-stimulated fibroblast-like synoviocytes (FLS), as well as the relationship between aberrant expression of miR-125b and pro-inflammatory cytokines expression. Therefore, in the present study, we aimed to explore the potential functional role of miR-125b in RA. The expressions of miR-125b in serum and synovial tissues of patients with RA were assessed, as well as in LPS-stimulated FLS. Thereafter, we overexpressed or down-regulated the expression of miR-125b and then analyzed the effects of miR-125b aberrant expression on proinflammatory cytokines expression, the correlation, and potential signaling pathway in LPS-stimulated FLS. Our results might provide an experimental basis for gaining insight into the pathogenesis of RA. 2. Materials and methods 2.1. Patients and healthy controls Between April 2015 and May 2016, a total of twenty patients (8 males and 12 females, mean age: 55.8 years, range: 53–65 years) with RA, 16 healthy controls (7 males and 9 females, mean age: 54.9 years, range: 53–69 years), and 5 emergency trauma amputation patients (3 males and 2 females, mean age: 45.8 years, range: 28–63 years) were recruited in the study. RA was diagnosed according to the American College of Rheumatology (1987 revised criteria). Fresh peripheral blood (5 mL) were collected from the antecubital vein of RA patients and healthy controls in the morning and placed into tubes containing ethylenediaminetetraacetic acid (EDTA) anticoagulant, and then were centrifuged at 1000 g for 10 min at 4 C. In addition, synovial tissues (20 pieces of synovial tissues) were obtained from patients with RA undergoing joint replacement surgery and also were taken from 5 emergency trauma amputation patients. Both the healthy controls and emergency trauma amputation patients had no history of autoimmune diseases and/or infectious diseases. Our study was approved by the medical Ethics Committees of Yanan University Affiliated Hospital, and written informed consent was obtained from all the participants.
IkB-a into pcDNA3.1 (Invitrogen) [21]. Vector expressing miR-125b was acquired after cloning miR-125b genomic sequences in pIRESneo2 expression vector (Clontech). The transfection efficiency in transfected cells was assessed by Quantitative real time polymerase chain reaction (qRT-PCR) analysis 24 h after transfection. Briefly, the cells (2 105 cells) were transfected with miR-125b mimic (a final concentration of 50 nM), ASO-miR-125b (a final concentration of 150 nM), IkB-a or corresponding NCs using Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer’s instruction. After transfection, the cells were stimulated with LPS (10 mg/mL; Sigma-Aldrich) or the nuclear factor kappa B (NF-kB) inhibitor pyrrolidine dithiocarbamate (PDTC; 20 mM; Sigma-Aldrich), for 24 h. The supernatants were collected for further analysis. 2.4. QRT-PCR analysis Total RNA, including miRNA, was isolated from serum, synovial tissues, or FLS using Qiagen miRNeasy mini kit (Valencia, CA, USA) according to the manufacturer's instructions. RNA was purified and quantitated by RNeasy MinElute Cleanup Kit (Qiagen, Hilden, Germany), and then were reversely transcribed into complementary DNA (cDNA) using a reverse transcriptase kit (TAKARA, Dalian, China). qRT-PCR was performed with an ABI Prism 7700 sequence detector (Applied Biosystems, Foster City, CA, USA) and Express SYBR Green ER qPCR Super Master Mix (Invitrogen). The specific primers of miRNA and mRNA were all synthesized by Genepharma (Shanghai, China). The primers were listed as following: miR-125b, 50 - TCCCGAGACCCTAACTTGTGA 30 ; Small nuclear RNA U6 (snU6) primer, F: 50 -CTCGCTTCGGCAGCACA-30 ; R: 50 -AACGCTTCACGAATTT GCGT-30 [22]; TNF-a, F: 50 - TCGAACCCCGAGTGACAAGC30 ; R: 50 - ACC ATCAGCCGGGCTTCAAT-30 ; IL-6, F: 50 - CCTCACCCTCCAACAAAGAT-30 ; R: 50 -GCCTCAGACATCTCCAGTCC-30 ; IL-1b, F: 50 GCTACCCTCAAGCTTTG CCC-30 ; R: 50 -CCAGACGAGTGCGGTCCTTT30 ; GAPDH, F: 50 -TCCTGCACC ACCAACTGCTTAG-30 , R: 50 -AGTGGCAGTGATGGCATGGACT-30 . GAPDH and U6 were respectively loading controls for mRNA and miRNA. 2.5. Enzyme-linked immunosorbent assay (ELISA) The concentrations of pro-inflammatory cytokines including TNF-a, IL-6 and IL-1b were determined by ELISA. Briefly, the cells were transfected with miR-125b mimic, ASO-miR-125b or corresponding NCs, and then the cells were or were not treated with LPS or PDTC. Thereafter, the culture supernatants were collected. The concentrations were then assayed with an ELISA kit (R&D Systems, Minneapolis, MN, USA) according to the manufacturer’s instructions. The absorbance at 450 nm was determined using a microplate reader (DTX 800, Beckman, CA, USA).
2.2. Cell culture 2.6. Western blot analysis FLS were isolated from the synovial tissues according to a previous study [20]. The isolated cells were cultured in Dulbecco's modified Eagle's medium (DMEM; Sigma-Aldrich, St. Louis, MO, USA) supplemented with 10% heat-inactivated fetal calf serum (FCS; Sigma-Aldrich), and 100 mg/mL streptomycin and 100 U/ml penicillin (Sigma-Aldrich) at 37 C in a humidified incubator 5% CO2. At passages 4–6, FLS were used for further experimental procedures. 2.3. Cell transfection and treatment miR-125b mimic, antisense oligonucleotides (ASO)-miR-125b and corresponding negative controls (NCs), i.e. mimic NC and ASONC, were all purchased from Genepharma (Shanghai, China). pcDNA-inhibitor of NF-kB (IkB-a) was constructed by subcloning
After transfection with miR-125b mimic or mimic NC, the cells were collected, washed with phosphate buffer saline (PBS), and then lysed with RIPA lysis buffer (Santa Cruz Biotechnology, CA, USA) supplemented with protease inhibitor cocktail (Santa Cruz Biotechnology). The protein concentration was measured by a BCA protein assay kit (Thermo Scientific, Waltham, MA, USA). Equal amounts of protein (20 mg per lane) were subjected to a 10–15% sodium dodecyl dulfonate (SDS)-polyacrylamide gel electrophoresis (PAGE) and transferred onto polyvinylidene fluoride (PVDF) membranes (Santa Cruz Biotechnology). The membranes were then blocked in 5% non-fat skimmed milk in Tris Buffered Saline with Tween (TBST) for 1 h. Subsequently, the membranes were incubated with anti-phospho-p65 (p-p65; ab28856, 1:1000; Abcam, Cambridge, UK) antibody or anti- IkB-a (#4812, 1:1000;
B. Zhang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1151–1157
Cell Signaling, Danvers, MA, USA) overnight at 4 C. GAPDH (#5174, 1:1000; Cell Signaling, Danvers) was used as the internal control. Thereafter, the membranes were incubated with the appropriate horseradish peroxidase (HRP)-conjugated secondary antibody (Abcam) for 2 h at room temperature. The membrane was finally visualized using enhanced chemiluminescence western blotting substrate reagent (Pierce Biotechnology, Rockford, IL, USA). 2.7. Statistical analysis Each experiment was repeated at least 3 times. All data were presented as the mean standard deviation (SD). Student's t-test or analysis of variance (ANOVA) was used to compare statistical differences. Pearson correlation analysis was performed to assess the relationships between levels of miR-125b and pro-inflammatory cytokines. All data were analyzed using SPSS 19.0 (SPSS Inc., Chicago, IL, USA). P < 0.05 was considered as significant difference between values. 3. Results 3.1. MiR-125b is increased in RA serum, synovial tissues, and LPSstimulated FLS To explore the potential functional role of miR-125b in RA, we determined its expression levels in both serum and synovial tissues of patients with RA, as well as in FLS in response to LPSstimulated by qRT-PCR. As shown in Fig. 1A and B, the results showed that the expression levels of miR-125b were significantly up-regulated in both serum and synovial tissues of patients with RA compared with normal controls (both P < 0.01). Normalization was performed to normalize the expression of miR-125b on its median among samples. LPS is a cell wall constituent of gramnegative bacteria and is released during bacterial growth and disintegration, which is also a well-known potent inducer of inflammation and inflammatory bone loss [23]. Therefore, in the present study, we used LPS to stimulate FLS, aiming to simulate RA. Similarly, we found that the expression levels of miR-125b were also statistically increased in LPS-stimulated human FLS compared to the non-treated cells (P < 0.01) (Fig. 1C). The results indicated that miR-125b might play a significant role in RA. 3.2. MiR-125b promotes the expression of pro-inflammatory cytokines The effects of miR-125b abnormal expression on the proinflammatory cytokines levels were investigated. The expression levels of TNF-a, IL-6, and IL-1b were assayed by ELISA. As indicated
1153
in Fig. 2A–C, the results showed that the expression levels of TNFa, IL-6, and IL-1b were all significantly increased by LPS stimulation (all P < 0.05). However, no significant difference was found in expression levels of TNF-a, IL-6, and IL-1b between mimic NC and miR-125b mimic or between ASO-NC and miR-125b inhibitor without LPS stimulation. When the cells were simultaneously stimulated by LPS and transfected with miR-125b mimic, it was noteworthy that the levels of TNF-a, IL-6, and IL-1b were all markedly increased compared to mimic NC group (P < 0.05 or P < 0.01). However, miR-125 suppression showed contrary results (P < 0.01). The results demonstrated that miR-125b overexpression promoted the expression of pro-inflammatory cytokines. 3.3. MiR-125b positively correlates with TNF-a, IL-6, and IL-1b We then studied the correlations between the expression levels of miR-125b and pro-inflammatory cytokines. The results showed that there were strong positive relationships between serum miR125b level and TNF-a level (R2 = 0.7569, P < 0.001) (Fig. 3A), between serum miR-125b level and IL-6 level (R2 = 0.8479, P < 0.001) (Fig. 3B), and between serum miR-125b level and IL1b level (R2 = 0.8037, P < 0.001) (Fig. 3C). The results indicated that miR-125b positively correlated with the expression of TNF-a, IL-6, and IL-1b. 3.4. MiR-125b activates NF-kB signaling pathway It has been well acknowledged that NF-kB signaling pathway is an important mediator in inflammation and immunity. To examine whether miR-125b is involved in NF-kB signaling pathway, we determined the expression of p-p65 and IkB-a after overexpression of miR-125b by western blot. The results demonstrated that, under condition of LPS stimulation, miR-125b overexpression prominently up-regulated the protein levels of p-p65 compared to the mimic NC group (P < 0.01), but down-regulated the levels of IkB-a (P < 0.05) (Fig. 4A and B). Furthermore, we observed that miR-125b knockdown significantly downregulated the protein levels of p-p65 (P < 0.01), but up-regulated the levels of IkB-a (P < 0.01) (Fig. 4C and D). These results suggested that miR-125b activated NF-kB signaling pathway. To further determine whether miR-125b regulates inflammatory response by modulating the NFkB signaling pathway, we administrated an inhibitor of NF-kB (PDTC) and upregulated the expression of IkB-a, and then analyzed the effects of PDTC on expression of TNF-a, IL-6, and IL-1b. As indicated in Fig. 4E, the data showed that the upregulated levels of TNF-a, IL-6, and IL-1b induced by miR-125b overexpression were all significantly decreased by PDTC and further
Fig. 1. Expression of miR-125b in patients with RA, health controls, trauma amputation patients, and FLS by qRT-PCR. The serum levels (A), synovial tissues levels (B), and the levels in FLS stimulated by LPS (C) were significantly increased compared to the controls. miR, microRNA; RA, rheumatoid arthritis; qRT-PCR, quantitative real time polymerase chain reaction; FLS, fibroblast-like synoviocytes; LPS, lipopolysaccharide. **P < 0.01.
1154
B. Zhang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1151–1157
Fig. 2. Effects of miR-125b aberrant expression on pro-inflammatory cytokines. FLS were transfected with miR-125b mimic, ASO-miR-125b or corresponding NCs and then were stimulated with LPS. Thereafter, the expression levels of TNF-a, IL-6, and IL-1b were assayed by ELISA. The expression of TNF-a (A), IL-6 (B), and IL-1b (C) was significantly increased by miR-125b overexpression but decreased by miR-125b suppression. However, no significant differences were found in the expression levels of proinflammatory cytokines between mimic NC/ASO-NC and miR-125b mimic/ASO-miR-125b without LPS stimulation. miR, microRNA; FLS, fibroblast-like synoviocytes; LPS, lipopolysaccharide; NC, negative controls; ASO, antisense oligonucleotides; ELISA, enzyme-linked immunosorbent assay; TNF, tumor necrosis factor; IL, interleukin; ns, no significance. *P < 0.05; **P < 0.01.
Fig. 3. Correlations between expressions of miR-125b and pro-inflammatory cytokines. To confirm the correlations between expressions of miR-125b and pro-inflammatory cytokines, we performed the correlation analysis. The results showed that miR-125b was positively correlated with expressions of TNF-a (A), IL-6 (B), and IL-1b (C). miR, microRNA; TNF, tumor necrosis factor; IL, interleukin.
downregulated by overexpression of IkB-a (all P < 0.01). Therefore, the results indicated that miR-125b exerted its proinflammatory role by activation of NF-kB signaling pathway. 4. Discussion In the present study, our data suggested that the expression levels of miR-125b were significantly increased in both serum and synovial tissues in patients with RA compared to the healthy controls, as well as in RA FLS in response to LPS. Overexpression of miR-125b statistically upregulated the expression of pro-inflammatory cytokines. In addition, we found that there were strong positive relationships between miR-125b levels and TNF-a, IL-6, and IL-1b expressions. Moreover, that the results showed that overexpression of miR-125b dramatically elevated the protein levels of p-p65 and IkB-a, while administration of an inhibitor of NF-kB (PDTC), the upregulated levels were reversed by PDTC. The results indicated that the miR-125b promoted inflammation in RA by activation of NF-kB pathway. Several miRNAs have been identified to be aberrantly expressed in patients with RA compared with the healthy controls [11,24–28]. Consistent with previous studies [18,19,29], we also observed that the expression patterns of miR-125b were all significantly elevated in both serum and synovial tissues in patients with RA and in FLS in response to LPS compared to controls. In addition to the above results, we analyzed the effects of aberrant expression of miR-125b on pro-inflammatory cytokines with or without LPS stimulation in FLS, along with the relationship between aberrant expression of miR-125b and pro-inflammatory cytokines expression. miR-125b was identified as a critical regulator of pro-inflammatory
cytokines, such as TNF-a, interferon (IFN) g, chemokine (CC motif) ligand (CCL) 4 and matrix metalloproteinase (MMP)-13 [30– 33]. Therefore, we assumed that miR-125b might contribute to the increased inflammatory response of RA. To further confirm the functional role of miR-125b in RA, we performed in vitro studies using cultured human FLS. FLS are a key component of rheumatoid synovium and produce some cytokines, chemokines, and transcription factors, which are responsible for the pathophysiological process of RA [34,35]. In addition, it has been reported that the prolonged life span of these cells plays a critical role in the ongoing of inflammation and destruction of joints [27]. The data demonstrated that overexpression of miR-125b dramatically increased the levels of TNF-a, IL-1b, and IL-6 and while downregulation of miR-125b, the expression of TNF-a, IL-1b, and IL-6 were all significantly decreased. Interestingly, our results found that the expression of TNF-a, IL-1b, and IL-6 were not markedly changed without LPS stimulation, indicating that the effects of miR-125b on expression of pro-inflammatory cytokines might be inflammatory-dependent. It has been well demonstrated that pro-inflammatory cytokines, such as TNF-a, IL-1b, and IL-6, are important mediators of inflammatory response in RA [36–38]. At present, substantial studies have suggested the effects of anti-cytokine therapies on RA. For example, anti-TNF-a and anti-IL-1 agents is established in the treatment of patients with refractory RA [39]. TNF-a is a major proinflammatory cytokine that necessarily stimulates synovial inflammation and joint destruction in the development of RA [40]. In addition, TNF-a could promote the synthesis of other proinflammatory cytokines and activate several intracellular signaling pathways [34]. IL-1b in vitro has also been shown the induction of
B. Zhang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1151–1157
1155
Fig. 4. Effects of miR-125b on NF-kB signaling pathway. To explore whether miR-125b is involved in NF-kB signaling pathway, we measured the expression of p-p65 and IkBa by western blot under the condition of overexpression or down-regulating the expression of miR-125b. Further, an inhibitor of NF-kB (PDTC) was performed and the expression of IkB-a was overexpressed, and then the expression of TNF-a, IL-6, and IL-1b was assayed again. The results showed that miR-125b overexpression significantly increased the protein expression of p-p65 but decreased IkB-a (A and B); and while miR-125b downregulation markedly downregulated the protein expression of p-p65 but increased IkB-a (C and D). The elevated mRNA expression of TNF-a, IL-6, and IL-1b induced by miR-125b overexpression was significantly decreased by PDTC and further downregulated by co-transfection of pcDNA-IkB-a (E). miR, microRNA; TNF, tumor necrosis factor; IL, interleukin; NF-kB, nuclear factor kappa B, PDTC, pyrrolidine dithiocarbamate; p-p65, phospho-p65; IkB, inhibitor of NF-kB; NC, negative controls. *P < 0.05; **P < 0.01.
pro-inflammatory cytokine during RA [41], and IL-6 appears to be the main driver of the acute phase response in RA [36]. Previous studies suggested that TNF-a mRNA was directly regulated by miR125b [30,32]. Similarly, our study also suggested that there was a strong positive relationship between miR-125b and TNF-a. In addition to TNF-a, our results also implied that IL-1b and IL-6 were both positively correlated with the expression of miR-125b. It was noteworthy that although the significant difference was found in the expression of pro-inflammatory cytokines regulated by miR125b in LPS-stimulated FLS, it is unclear whether this is biologically
relevant. Therefore, further animal studies should be performed to confirm the results. NF-kB pathway is responsible for regulation of numerous genes expression in the inflammatory response. An increasing number of in vitro and in vivo studies have confirmed that the NF-kB signaling pathway plays an important activated role in the development and progression of RA [42–44]. Activation of NF-kB mediates the inflammatory response and chondrocyte apoptosis, leading to progressive extracellular matrix damage and cartilage destruction. Inhibition of NF-kB has been shown good therapeutic effects [42].
1156
B. Zhang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1151–1157
Recently, several studies have illustrated the bidirectional interplays between the NF-kB pathway and miRNAs [45,46]. miR-125b has been reported to continuously regulate the NF-kB pathway [15,47,48]. In the present study, we analyzed the expression of pp65 and IkB-a after overexpression and downregulation of miR125b. P65 is one of the key subunits of NF-kB, and p-p65 is a marker for NF-kB activation [49]. IkB-a is a suppressive factor of NF-kB and degradation of IkB-a is a key event in activation of NFkB [50]. In our study, the findings showed that miR-125b overexpression significantly increased the protein levels of pp65 but decreased IkB-a, and while downregulation of miR-125b showed the contrary results, indicating that miR-125b overexpression activates the NF-kB pathway. Furthermore, it has been reported that NF-kB positively regulates genes encoding proinflammatory cytokines, such as TNF-a, IL-1b, IL-6 [42]. To verify whether miR-125b regulates the inflammatory response of RA by modulating NF-kB pathway, we administrated the inhibitor of NFkB pathway, PDTC, and co-transfected with pcDNA-IkB-a, and then tested the effects of miR-125b overexpression on the levels of pro-inflammatory cytokines again. It has been confirmed that TNFa and IL-1b activates NF-kB via a rapid and dose-dependent process by inducing the phosphorylation and degradation of IkB and results in the translocation of NF-kB to the nucleus where it binds to specific promoter binding sites [51–53]. IL-6 activates NFkB, representing a positive feedback loop [54]. The data demonstrated that the upregulated pro-inflammatory cytokines were statistically downregulated by PDTC and were further downregulated by co-transfection with pcDNA-IkB-a. In conclusion, our results suggest that miR-125b serves as a stimulator of inflammatory response in RA, and the effects might be by activation of NF-kB pathway. Our data may provide evidence of miR-125b in RA, thereby reducing the expression of miR-125b may be benefit for treating RA. Authors’ contribution Conceived and designed the experiments: H. Hou and W. Li. Performed the experiments and analyzed the data: H. Hou. Wrote the Paper and approved the final submission: All authors. Conflict of interest Authors declare that there is no conflict of interests. Funding This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. Acknowledgment None. References [1] T.M. Farragher, M. Lunt, B. Fu, D. Bunn, D.P. Symmons, Early treatment with, and time receiving, first disease-modifying antirheumatic drug predicts longterm function in patients with inflammatory polyarthritis, Ann. Rheum. Dis. 69 (4) (2010) 689–695. [2] M.P. van der Linden, S. Le Cessie, K. Raza, D. van der Woude, R. Knevel, T.W. Huizinga, A. van der Helm-van Mil, Long-term impact of delay in assessment of patients with early arthritis, Arthritis &, Rheumatism 62 (12) (2010) 3537– 3546. [3] D. Scublinsky, C.D. Gonzalez, Quantifying disease in challenging conditions: incidence and prevalence of rheumatoid arthritis, J. Rheumatol. 43 (7) (2016) 1263–1264. [4] T. Uhlig, R.H. Moe, T.K. Kvien, The burden of disease in rheumatoid arthritis, Pharmacoeconomics 32 (9) (2014) 841–851.
[5] L.I. Filippin, R. Vercelino, N.P. Marroni, R.M. Xavier, Redox signalling and the inflammatory response in rheumatoid arthritis, Clin. Exp. Immunol. 152 (3) (2008) 415–422. [6] F.A. van de Loo, L.A. Joosten, P.L. van Lent, O.J. Arntz, W.B. van den Berg, Role of interleukin-1, tumor necrosis factor alpha, and interleukin-6 in cartilage proteoglycan metabolism and destruction. Effect of in situ blocking in murine antigen- and zymosan-induced arthritis, Arthritis Rheum. 38 (2) (1995) 164– 172. [7] Y. Zheng, L. Sun, T. Jiang, D. Zhang, D. He, H. Nie, TNFa promotes Th17 cell differentiation through IL-6 and IL-1b produced by monocytes in rheumatoid arthritis, J. Immunol. Res. 2014 (2014) 385352. [8] M. Iborra, F. Bernuzzi, P. Invernizzi, S. Danese, MicroRNAs in autoimmunity and inflammatory bowel disease: crucial regulators in immune response, Autoimmun. Rev. 11 (5) (2012) 305–314. [9] R.P. Singh, I. Massachi, S. Manickavel, S. Singh, N.P. Rao, S. Hasan, D.K. Mc Curdy, S. Sharma, D. Wong, B.H. Hahn, The role of miRNA in inflammation and autoimmunity, Autoimmun. Rev. 12 (12) (2013) 1160–1165. [10] A. Chatzikyriakidou, P.V. Voulgari, I. Georgiou, A.A. Drosos, miRNAs and related polymorphisms in rheumatoid arthritis susceptibility, Autoimmun. Rev. 11 (9) (2012) 636–641. [11] A.V. Churov, E.K. Oleinik, M. Knip, MicroRNAs in rheumatoid arthritis: altered expression and diagnostic potential, Autoimmun. Rev. 14 (11) (2015) 1029– 1037. [12] M. Filková, A. Jüngel, R.E. Gay, S. Gay, MicroRNAs in rheumatoid arthritis, BioDrugs 26 (3) (2012) 131–141. [13] A. Ceribelli, M.A. Nahid, M. Satoh, E.K. Chan, MicroRNAs in rheumatoid arthritis, FEBS Lett. 585 (23) (2011) 3667–3674. [14] E. Salehi, R. Eftekhari, M. Oraei, A. Gharib, K. Bidad, MicroRNAs in rheumatoid arthritis, Clin. Rheumatol. 34 (4) (2015) 615–628. [15] S.-W. Kim, K. Ramasamy, H. Bouamar, A.-P. Lin, D. Jiang, R.C. Aguiar, MicroRNAs miR-125a and miR-125b constitutively activate the NF-kB pathway by targeting the tumor necrosis factor alpha-induced protein 3 (TNFAIP3, A20), Proc. Natl. Acad. Sci. 109 (20) (2012) 7865–7870. [16] R. Malumbres, K.A. Sarosiek, E. Cubedo, J.W. Ruiz, X. Jiang, R.D. Gascoyne, R. Tibshirani, I.S. Lossos, Differentiation stage–specific expression of microRNAs in B lymphocytes and diffuse large B-cell lymphomas, Blood 113 (16) (2009) 3754–3764. [17] Y.-M. Sun, K.-Y. Lin, Y.-Q. Chen, Diverse functions of miR-125 family in different cell contexts, J. Hematol. oncol. 6 (1) (2013) 1. [18] I. Duroux-Richard, Y.-M. Pers, S. Fabre, M. Ammari, D. Baeten, G. Cartron, I. Touitou, C. Jorgensen, F. Apparailly, Circulating miRNA-125b is a potential biomarker predicting response to rituximab in rheumatoid arthritis, Mediators Inflammation 2014 (2014). [19] V. Hruskova, R. Jandova, L. Vernerova, H. Mann, O. Pecha, K. Prajzlerova, K. Pavelka, J. Vencovsky, M. Filkova, L. Senolt, MicroRNA-125b: association with disease activity and the treatment response of patients with early rheumatoid arthritis, Arthritis Res. Ther. 18 (1) (2016) 1. [20] Y. Yoshioka, E. Kozawa, H. Urakawa, E. Arai, N. Futamura, L. Zhuo, K. Kimata, N. Ishiguro, Y. Nishida, Suppression of hyaluronan synthesis alleviates inflammatory responses in murine arthritis and in human rheumatoid synovial fibroblasts, Arthritis Rheumatism 65 (5) (2013) 1160–1170. [21] G. Franzoso, V. Bours, S. Park, M. Tomita-Yamaguchi, K. Kelly, U. Siebenlist, The candidate oncoprotein Bcl-3 is an antagonist of p50/NF-kappa B-mediated inhibition, Nature 359 (6393) (1992) 339–342. [22] G.R. Kunkel, R.L. Maser, J.P. Calvet, T. Pederson, U6 small nuclear RNA is transcribed by RNA polymerase III, Proc. Natl. Acad. Sci. U. S. A. 83 (22) (1986) 8575. [23] G. Li, D. Liu, Y. Zhang, Y. Qian, H. Zhang, S. Guo, M. Sunagawa, T. Hisamitsu, Y. Liu, Celastrol inhibits lipopolysaccharide-stimulated rheumatoid fibroblastlike synoviocyte invasion through suppression of TLR4/NF-kB-mediated matrix metalloproteinase-9 expression, PLoS One 8 (7) (2013) e68905. [24] J. Stanczyk, D.M.L. Pedrioli, F. Brentano, O. Sanchez-Pernaute, C. Kolling, R.E. Gay, M. Detmar, S. Gay, D. Kyburz, Altered expression of MicroRNA in synovial fibroblasts and synovial tissue in rheumatoid arthritis, Arthritis Rheumatism 58 (4) (2008) 1001–1009. [25] K. Murata, H. Yoshitomi, S. Tanida, M. Ishikawa, K. Nishitani, H. Ito, T. Nakamura, Plasma and synovial fluid microRNAs as potential biomarkers of rheumatoid arthritis and osteoarthritis, Arthritis Res. Ther. 12 (3) (2010) 1. [26] J. Stanczyk, C. Ospelt, E. Karouzakis, A. Filer, K. Raza, C. Kolling, R. Gay, C.D. Buckley, P.P. Tak, S. Gay, Altered expression of microRNA-203 in rheumatoid arthritis synovial fibroblasts and its role in fibroblast activation, Arthritis Rheumatism 63 (2) (2011) 373–381. [27] F. Niederer, M. Trenkmann, C. Ospelt, E. Karouzakis, M. Neidhart, J. Stanczyk, C. Kolling, R.E. Gay, M. Detmar, S. Gay, Down-regulation of microRNA-34a* in rheumatoid arthritis synovial fibroblasts promotes apoptosis resistance, Arthritis Rheumatism 64 (6) (2012) 1771–1779. [28] H. Shibuya, T. Nakasa, N. Adachi, Y. Nagata, M. Ishikawa, M. Deie, O. Suzuki, M. Ochi, Overexpression of microRNA-223 in rheumatoid arthritis synovium controls osteoclast differentiation, Mod. Rheumatol. 23 (4) (2013) 674–685. [29] N. Semaan, L. Frenzel, G. Alsaleh, G. Suffert, J.-E. Gottenberg, J. Sibilia, S. Pfeffer, D. Wachsmann, miR-346 controls release of TNF-a protein and stability of its mRNA in rheumatoid arthritis via tristetraprolin stabilization, PLoS One 6 (5) (2011) e19827. [30] E. Tili, J.-J. Michaille, A. Cimino, S. Costinean, C.D. Dumitru, B. Adair, M. Fabbri, H. Alder, C.G. Liu, G.A. Calin, Modulation of miR-155 and miR-125b levels following lipopolysaccharide/TNF-a stimulation and their possible roles in
B. Zhang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1151–1157
[31]
[32]
[33]
[34] [35]
[36] [37] [38]
[39] [40] [41] [42]
regulating the response to endotoxin shock, J. Immunol. 179 (8) (2007) 5082– 5089. M.V. Rajaram, B. Ni, J.D. Morris, M.N. Brooks, T.K. Carlson, B. Bakthavachalu, D. R. Schoenberg, J.B. Torrelles, L.S. Schlesinger, Mycobacterium tuberculosis lipomannan blocks TNF biosynthesis by regulating macrophage MAPKactivated protein kinase 2 (MK2) and microRNA miR-125b, Proc. Natl. Acad. Sci. 108 (42) (2011) 17408–17413. H.-C. Huang, H.-R. Yu, L.-T. Huang, H.-C. Huang, R.-F. Chen, I.-C. Lin, C.-Y. Ou, T.Y. Hsu, K.D. Yang, miRNA-125b regulates TNF-a production in CD14+ neonatal monocytes via post-transcriptional regulation, J. Leukoc. Biol. 92 (1) (2012) 171–182. R.L. Rossi, G. Rossetti, L. Wenandy, S. Curti, A. Ripamonti, R.J. Bonnal, R.S. Birolo, M. Moro, M.C. Crosti, P. Gruarin, Distinct microRNA signatures in human lymphocyte subsets and enforcement of the naive state in CD4+ T cells by the microRNA miR-125b, Nat. Immunol. 12 (8) (2011) 796–803. L. Huber, O. Distler, I. Tarner, R. Gay, S. Gay, T. Pap, Synovial fibroblasts: key players in rheumatoid arthritis, Rheumatology 45 (6) (2006) 669–675. Y. Nakamachi, S. Kawano, M. Takenokuchi, K. Nishimura, Y. Sakai, T. Chin, R. Saura, M. Kurosaka, S. Kumagai, MicroRNA-124a is a key regulator of proliferation and monocyte chemoattractant protein 1 secretion in fibroblastlike synoviocytes from patients with rheumatoid arthritis, Arthritis Rheumatism 60 (5) (2009) 1294–1304. F.M. Brennan, I.B. McInnes, Evidence that cytokines play a role in rheumatoid arthritis, J. Clin. Invest. 118 (11) (2008) 3537–3545. M. Odeh, Role of cytokines in rheumatoid arthritis, Drug News Perspect. 11 (6) (1998) 331. M. Feldmann, S.R.N. Maini, Role of cytokines in rheumatoid arthritis: an education in pathophysiology and therapeutics, Immunol. Rev. 223 (1) (2008) 7–19. M. Feldmann, Pathogenesis of arthritis: recent research progress, Nat. Immunol. 2 (9) (2001) 771–773. E.A. Moelants, A. Mortier, J. Van Damme, P. Proost, Regulation of TNF-a with a focus on rheumatoid arthritis, Immunol. Cell Biol. 91 (6) (2013) 393–401. J. Dayer, The pivotal role of interleukin-1 in the clinical manifestations of rheumatoid arthritis, Rheumatology 42 (90002) (2003) 3–10. J. Roman-Blas, S. Jimenez, NF-kB as a potential therapeutic target in osteoarthritis and rheumatoid arthritis, Osteoarthritis Cartilage 14 (9) (2006) 839–848.
1157
[43] S.S. Makarov, NF-kB in rheumatoid arthritis: a pivotal regulator of inflammation, hyperplasia, and tissue destruction, Arthritis. Res. Ther. 3 (4) (2001) 1. [44] R. Scheinman, NF-kB and rheumatoid arthritis will understanding genetic risk lead to a therapeutic reward? forum on immunopathological diseases and therapeutics, Begel House Inc., 2013. [45] X. Ma, L.E.B. Buscaglia, J.R. Barker, Y. Li, MicroRNAs in NF-kB signaling, J. Mol. Cell Biol. 3 (3) (2011) 159–166. [46] J.P. Idrovo, A. Jacob, W.L. Yang, Z. Wang, H.T. Yen, J. Nicastro, G.F. Coppa, P. Wang, A deficiency in cold-inducible RNA-binding protein accelerates the inflammation phase and improves wound healing, Int. J. Mol. Med. 37 (2) (2016). [47] A.J. Murphy, P.M. Guyre, P.A. Pioli, Estradiol suppresses NF-kB activation through coordinated regulation of let-7a and miR-125b in primary human macrophages, J. Immunol. 184 (9) (2010) 5029–5037. [48] D. Wang, L. Cao, Z. Xu, L. Fang, Y. Zhong, Q. Chen, R. Luo, H. Chen, K. Li, S. Xiao, MiR-125b reduces porcine reproductive and respiratory syndrome virus replication by negatively regulating the NF-kB pathway, PLoS One 8 (2) (2013) e55838. [49] F.G. Goh, C.M. Sloss, M.R. Cunningham, M. Nilsson, L. Cadalbert, R. Plevin, Gprotein-dependent and-independent pathways regulate proteinase-activated receptor-2 mediated p65 NFkB serine 536 phosphorylation in human keratinocytes, Cell. Signal. 20 (7) (2008) 1267–1274. [50] Q. Li, I.M. Verma, NF-kB regulation in the immune system, Nat. Rev. Immunol. 2 (10) (2002) 725–734. [51] A.S. Baldwin Jr., The NF-kappa B and I kappa B proteins: new discoveries and insights, Annu. Rev. Immunol. 14 (1996) 649–683. [52] C.K. Lee, E.Y. Lee, Y.G. Kim, S.H. Mun, H.B. Moon, B. Yoo, Alpha-lipoic acid inhibits TNF-alpha induced NF-kappa B activation through blocking of MEKK1-MKK4-IKK signaling cascades, Int. Immunopharmacol. 8 (2) (2008) 362–370. [53] X. Ying, X. Chen, S. Cheng, Y. Shen, L. Peng, H.Z. Xu, Piperine inhibits IL-beta induced expression of inflammatory mediators in human osteoarthritis chondrocyte, Int. Immunopharmacol. 17 (2) (2013) 293–299. [54] E. Piskounova, C. Polytarchou, J.E. Thornton, R.J. LaPierre, C. Pothoulakis, J.P. Hagan, D. Iliopoulos, R.I. Gregory, Lin28A and Lin28 B inhibit let-7 microRNA biogenesis by distinct mechanisms, Cell 147 (5) (2011) 1066–1079.