Elevation of both maternal and fetal extracellular circulating deoxyribonucleic acid concentrations in the plasma of pregnant women with preeclampsia

Elevation of both maternal and fetal extracellular circulating deoxyribonucleic acid concentrations in the plasma of pregnant women with preeclampsia Xiao Yan Zhong, MD,a Hannele Laivuori, MD,b Jeffrey C. Livingston, MD,c Olavi Ylikorkala, MD,b Baha M. Sibai, MD,c Wolfgang Holzgreve, MD,a and Sinuhe Hahn, PhDa Basel, Switzerland, Helsinki, Finland, and Memphis, Tennessee OBJECTIVE: Elevated amounts of circulating fetal deoxyribonucleic acid in maternal plasma have recently been detected in pregnancies complicated by preeclampsia. We attempted to confirm this finding and simultaneously examined the quantity of maternal circulating deoxyribonucleic acid. STUDY DESIGN: Circulating deoxyribonucleic acid was measured by real-time quantitative polymerase chain reaction in plasma samples obtained from 44 women with preeclampsia and a matched cohort of 53 normotensive pregnant women. RESULTS: We confirmed that circulating fetal deoxyribonucleic acid levels were significantly elevated in pregnancies complicated by preeclampsia (3194.6 vs 332.8 copies/mL; P < .001). We also showed for the first time that circulating maternal deoxyribonucleic acid levels are also elevated (219,023.9 vs 20,235.8 copies/mL; P < .001). The increases in these deoxyribonucleic acid levels corresponded to the severity of the disorder, and values were correlated with each other in pregnancies complicated by preeclampsia (r = 0.556; P < .001) but not normotensive pregnancies (r = 0.046; P = .747). CONCLUSION: The releases of both free fetal and maternal deoxyribonucleic acid were found to be affected in preeclampsia. (Am J Obstet Gynecol 2001;184:414-9.)

Key words: Circulating deoxyribonucleic acid, plasma, preeclampsia

Preeclampsia, a hypertensive disorder of pregnancy, is one of the leading causes of maternal and fetal death in the developed world.1, 2 The incidence of preeclampsia is about 10%, but it varies among different populations. Traditionally, hypertension and proteinuria in previously normotensive pregnant women characterize preeclampsia. Although the exact etiology of preeclampsia remains elusive,2 there appears to be a defect in placentation, with the trophoblast unable to differentiate properly.3 This results in a shallow invasion of the decidua and in diminished infiltration and modification of the spiral arteries,4 a process whereby the high-resistance phenotype of these From the Laboratory for Prenatal Medicine, Department of Obstetrics and Gynaecology, University of Basel,a the Department of Obstetrics and Gynaecology, University of Helsinki,b and the Division of Maternal-Fetal Medicine, Department of Obstetrics and Gynecology, University of Tennessee.c Supported in part by Swiss National Science Foundation grants 3200047112.96 and 3200-055614.98/1, National Institutes of Health contract N01-HD-4-3202, and a grant from the Novartis Research Foundation. Received for publication December 27, 1999; revised May 23, 2000; accepted June 20, 2000. Reprint requests: Sinuhe Hahn, PhD, Laboratory for Prenatal Medicine, Department of Obstetrics and Gynecology, University of Basel, Schanzenstrasse 46, CH 4031 Basel, Switzerland. Copyright © 2001 by Mosby, Inc. 0002-9378/2001 $35.00 + 0 6/1/109594 doi:10.1067/mob.2001.109594

414

arteries is normally altered into one of low pressure to ensure an adequate blood supply to the fetal tissues. Recent studies have indicated that the effects of this disorder are far more systemic5 than previously assumed, with pathologic changes occurring in the brain, kidney, and liver in patients with preeclampsia. Pathologic effects further include gross endothelial cell damage6 and possible overt activation of the maternal immune system.7 Preeclampsia has also been associated with an increased level of shedding of fetal cells or fetal particles into the maternal circulation.8 Increased levels of trophoblast deportation have been observed,9, 10 as has the release of syncytiotrophoblast microparticles, which disrupt normal endothelial cell behavior.11, 12 As part of our ongoing studies to develop a noninvasive method for prenatal diagnosis by enriching fetal cells from the blood of pregnant women,13, 14 we recently made the novel observation that the traffic of fetal cells, specifically erythroblasts, into the peripheral blood of the mother is significantly elevated in cases of preeclampsia.15 Recently, free fetal deoxyribonucleic acid (DNA) has been detected in the maternal circulation through the use of the polymerase chain reaction (PCR).16 By examining the concentrations of this fetal genetic material with a sensitive and reproducible real-time quantitative PCR process, Lo et al17 showed that there is a significant

Zhong et al 415

Volume 184, Number 3 Am J Obstet Gynecol

increase in the amount of this circulating fetal DNA in women with preeclampsia relative to matched control subjects.8, 17 Because both the mother and the fetus are affected in preeclampsia, we investigated whether there is any increase in the level of maternal circulating DNA in the plasma of women with preeclampsia. Material and methods Patients. This study was performed in a retrospective manner. Forty-four plasma samples were collected from women with preeclampsia during pregnancy; these samples were stored frozen. Preeclampsia was determined by a blood pressure of ≥140/90 mm Hg in 2 determinations 4 hours apart or by a diastolic blood pressure of ≥110 mm Hg and an associated proteinuria of ≥300 mg/24 h after 20 weeks’ gestation. Patients with severe preeclampsia also met at least one of the following criteria: blood pressure >160/110 mm Hg on at least 2 occasions, proteinuria of >5 g in a 24-hour urine collection, eclampsia, HELLP (hemolysis, elevated liver enzymes, and low platelet count) syndrome (total bilirubin concentration >1.2 or lactate dehydrogenase activity >600 IU/L; aspartate aminotransferase >70 IU/L; <100,000 platelets/dL), unremitting headache, right upper-quadrant pain, or intrauterine growth at <5th percentile. Twelve of the 44 patients fulfilled these criteria. Fifty-three samples that had been taken from normotensive women with normal pregnancies were matched according to gestational age and used as the control group. All women were pregnant with a single fetus; 39 of those with preeclampsia had a single male fetus, as did 46 of the control cohort. DNA extraction and PCR analysis. The plasma samples were separated by centrifugation and stored frozen. DNA was extracted from 400 µL plasma with the QIAamp Blood Kit (QIAGEN AG, Basel, Switzerland) according to the manufacturer’s protocol. Strict anticontamination procedures were used throughout. These included the use of aerosol-resistant tips (ART Self-Sealing Barrier Tips; Molecular BioProducts, Inc, San Diego, Calif) throughout all the experimental procedures and the addition of multiple negative control samples in each analysis. The DNA was eluted in 50 µL of elution buffer solution (10-mmol/L tris(hydroxymethyl)aminomethane hydrochloride, pH 7.4, and 1-mmol/L ethylenediaminetetraacetic acid), of which 2 µL was used as a template for the PCR reaction. TaqMan PCR analysis. For the TaqMan real-time PCR analysis we used a Perkin Elmer Applied Biosystems 7700 Sequence Detector (PE Biosystems, Foster City, Calif). Circulating male fetal DNA was detected with the following primers and dual-labeled TaqMan probe for the SRY gene located on the Y chromosome: forward, 5´-TCCTCAAAAGAAACCGTGCAT-3´; reverse, 5´-AGATTAATGGTTGCTAAGGACTGGAT-3´; and probe, 5´-(6-carboxyfluorescein; FAM)CACCAGCAGTAACTCCCCACAACCTCTTT(6-carboxytetramethylrhodamine; TAMRA)-3´.

To determine the total amount of circulating DNA present in the maternal plasma samples, we used a TaqMan assay for the glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH), which is present in all genomes. In this analysis the following primers and probe were used: forward, 5´-CCCCACACACATGCACTTACC-3´; reverse, 5´-CCTAGTCCCAGGGCTTTGATT-3´; and probe, 5´-(FAM)AAAGAGCTAGGAAGGACAGGCAACTTGGC(TAMRA)-3´. The TaqMan PCR analysis was carried in 25-µL reaction volumes containing 2 µ-DNA, 300 nmol/L of each amplification primer, and 100 nmol/L of the dual-labeled TaqMan probe and the necessary components provided in the TaqMan PCR Core Reaction Kit (PE Biosystems). This corresponded to 2.5 µL of 10× buffer A, 3.5-mmol/L magnesium chloride, 100-mmol/L deoxyribonucleoside triphosphate, 0.025 unit AmpliTaq Gold, and 0.01 unit Amp Erase. The Amp Erase enzyme contains a uracil Nglycosylase activity, which is used to prevent contamination by the carryover of PCR products that have incorporated deoxyuridine triphosphate. The analysis was designed in such a manner that identical thermal profiles could be used for both the SRY and GAPDH TaqMan assays, because this allowed us to analyze both of these markers on the same plate in the same analytic run. The PCR was carried out under the following conditions: a 2-minute incubation at 50°C, to permit Amp Erase activity, then incubation at 95°C for 10 minutes, to activate the AmpliTaq Gold polymerase, followed by 40 cycles of 1 minute at 60°C and 15 seconds at 95°C. To determine the number of copies of circulating DNA present in the plasma sample, a standard dilution curve with a known concentration of male genomic DNA was used. For the conversion to the number of copies or genome equivalents a factor of 6.6 pg was used, as described elsewhere.18 All samples were analyzed in duplicate and scored in a blinded manner. Data analysis. The data were analyzed with the SPSS for Windows (SPSS Inc, Chicago, Ill) software package. Because the data were not parametric, they were examined with the Mann-Whitney U test. The degree of correlation between the levels of fetal and maternal circulating DNA was expressed by the Pearson correlation coefficient. The data are presented in scatter diagrams with means or as points with error bars illustrating the mean with confidence intervals. Results In this study, which was performed retrospectively and in a blinded manner, 44 plasma samples were obtained from pregnant women with preeclampsia (Table I), 12 cases of which were classified as severe. Thirty-nine of the pregnant women in this study cohort carried male fetuses. Fifty-three plasma samples were obtained from a gestationally matched control cohort of normotensive pregnant women, 46 of whom carried male fetuses.

416 Zhong et al

February 2001 Am J Obstet Gynecol

B

A

Fig 1. Scatter diagrams indicating levels of circulating DNA in plasma samples obtained from normotensive pregnancies (CON) and pregnancies complicated by preeclampsia (PET). A, Levels of circulating male fetal DNA, as measured by real-time quantitative PCR for Y chromosome. B, Total concentration of circulating DNA, as measured by real-time quantitative PCR for ubiquitous GAPDH gene, indicative of free maternal DNA. Analysis includes women pregnant with female fetuses. Horizontal bars, Means.

Table I. Clinical characteristics

Gestational age at admission (wk) Mean Range Gestational age at delivery (wk) Mean Range Fetal weight at birth (g) Mean Range Diastolic blood pressure (mm Hg) Mean Range Systolic blood pressure (mm Hg) Mean Range HELLP syndrome (No.) Eclampsia (No.)

Control (n = 53)

Mild to moderate preeclampsia (n = 32)

Severe preeclampsia (n = 12)

37.9 29.4-42

37.8 31-40.4

33.7 28.6-39.4

38 29.9-4

37.9 31-40.4

34 28.6-39.4

3193.2 1438-4145

2681.37 1190-3780

2062.55 1144-3135

76.6 68-87

99.9 90-110

120.8 98-140

126.4 100.0-139 0 0

161.9 130-191 0 0

195.4 160-239 3 4

Statistical significance*

Statistical significance†

NS

P = .04

NS

P = .01

P = .001

P < .001

P < .001

P < .001

P < .001

P < .001

— —

— —

NS, Not significant. *Mild to moderate preeclampsia versus control, according to Mann-Whitney U test. †Severe preeclampsia versus control, according to Mann-Whitney U test.

By quantifying the amount of Y chromosome–specific DNA, we were able to confirm that the levels of male fetal DNA were indeed significantly elevated in pregnancies complicated by preeclampsia relative to the normotensive control subjects (mean, 1599.07 fetal DNA copies/mL plasma vs 332.82 fetal DNA copies/mL plasma; P < .001; Fig 1, A). The specificity of our assay is indicated by the absence of any detectable male-specific DNA in any of the 12 samples from women carrying a female fetus. In separate studies we did not detect the presence of Y chromosome–specific sequences in 30 women carrying female fetuses, several of whom had previously borne male fetuses, whereas in women carrying male fe-

tuses these sequences could be detected with a sensitivity of 94.4%. By using the TaqMan assay for the ubiquitous GAPDH gene, we were able to simultaneously quantify the total amount of circulating DNA in these samples. All samples analyzed had this sequence detected. These data showed that the amount of circulating fetal DNA constituted between 1.4% and 1.5% of the total circulating DNA in the pregnancies complicated by preeclampsia and normotensive pregnancies, respectively, thereby confirming that the vast amount of circulating DNA in maternal plasma is of maternal and not fetal origin.

Zhong et al 417

Volume 184, Number 3 Am J Obstet Gynecol

A

B

Fig 2. Correspondence of fetal and maternal circulating DNA levels with degree of preeclampsia (PET) severity. A, Levels of circulating male fetal DNA, as measured by real-time quantitative PCR for Y chromosome. B, Total concentration of circulating DNA, as measured by real-time quantitative PCR for ubiquitous GAPDH gene, indicative of free maternal DNA. Data points, Means; error bars, 95% confidence intervals.

Table II. Levels of fetal and maternal circulating DNA

Plasma samples (No.) Samples from pregnancies with male fetuses (No.) Circulating fetal DNA (genome equivalents/mL) Mean Range Total circulating DNA in all samples (genome equivalents/mL) Mean Range

Control

Mild to moderate preeclampsia

Severe preeclampsia

Statistical significance*

Statistical significance†

53 46

32 27

12 12

— —

— —

P = .03

P < .001

P < .001

P < .001

332.82 0-1608.1 20,235.83 477.06-228,465.8

889.94 0-4964.4 65,181.17 1,418.56-463,326.3

3194.61 331.83-7698.4 219,023.9 1,334.38-733,728.1

*Mild to moderate preeclampsia versus control, according to Mann-Whitney U test. †Severe preeclampsia versus control, according to Mann-Whitney U test.

This analysis, however, also demonstrated that the total amount of circulating DNA in maternal plasma was significantly elevated in samples from women with preeclampsia relative to the control samples (mean, 161,469.7 circulating DNA copies/mL plasma vs 32,369.13 circulating DNA copies/mL plasma; P < .001; Fig 1, B). Our analysis also showed that the increases in the levels of both fetal and maternal circulating DNA corresponded to the degree of disease severity. Both levels were significantly higher in patients with severe preeclampsia than in patients with a less severe form of the disorder (Table II and Fig 2, A and B). This observation prompted us to examine whether a correlation existed between the levels of fetal and maternal circulating DNA in pregnancies complicated by preeclampsia. Analysis showed that a significant correlation did indeed exist between these two parameters in women with preeclampsia (r = 0.556; P < .001) but not in women with normotensive pregnancies (r = 0.049; P = .747; Fig 3, A and B).

Comment We have previously shown that fetal-maternal cell trafficking is significantly disturbed in pregnancies complicated by preeclampsia, with elevated numbers of fetal cells detected in the maternal circulation during these pregnancies.14, 15 In a separate study Lo et al17 showed that the fetal circulating DNA level was elevated in a similar manner during pregnancies complicated by preeclampsia. We were able to confirm the latter observation in this study by showing that the levels of circulating fetal DNA were significantly elevated in women with preeclampsia relative to the control cohort. Our study also confirms that the quantification of fetal and maternal circulating DNA by real-time PCR is both reliable and reproducible.17-19 The robustness of this technology is underscored by the fact that when close to 100 samples from Basel, Helsinki, and Memphis were analyzed in a blinded manner, comparable results were obtained for the 2 study cohorts. We did not detect any false-positive results.

418 Zhong et al

A

February 2001 Am J Obstet Gynecol

B Fig 3. Correlation between levels of fetal and maternal circulating DNA in plasma samples obtained from normotensive pregnancies (A) and pregnancies complicated by preeclampsia (B). There was no significant correlation in normotensive pregnancies (r = 0.049; P = .747), but there was significant correlation in pregnancies complicated by preeclampsia (r = 0.556; P < .001).

In addition to confirming previous findings, our study made several novel observations. First, the quantities of maternal circulating DNA were also elevated in pregnancies complicated by preeclampsia. Furthermore, the increments in both fetal and maternal free DNA levels corresponded to the degree of disease severity. Probably the most noteworthy observation, however, is that a significant correlation was shown to exist between the levels of fetal and maternal circulating DNA in pregnancies complicated by preeclampsia but not in normotensive pregnancies. Although the exact mechanism leading to the release of free extracellular DNA into the circulation is not yet clear,20 currently, the most favored explanation for the release of DNA fragments is through apoptosis or some other form of cell death.21, 22 This view is supported by data that indicate that the circulating DNA shares many characteristics of apoptotic DNA fragments.23 Furthermore, the concentration of circulating DNA was generally found to be higher in patients with malignant disorders or injuries, who have higher rates of cell death or damage, than in healthy control subjects.20, 23 Some other studies, however, have indicated that a normal physiologic process may be involved in the release of free circulating DNA.20 Although we do not propose that the elevations in free fetal and maternal DNA levels that we detected play a causal role in preeclampsia, our findings may help to increase our understanding of this enigmatic disorder. As such, it is worth noting that recent reports have indicated that preeclampsia is associated with increased levels of apoptosis, mainly among uterine wall placental cytotrophoblasts.24 Indeed, apoptosis may even constitute an important lesion in the pathogenesis of this disorder.25 It is also well established that preeclampsia is associated with increased shedding into the maternal circulation of syn-

cytiotrophoblast microvilli particles, probably through the breakdown of these cells.6 These particles have in themselves been suggested to contribute to the gross level of maternal endothelial dysfunction characteristic of preeclampsia.11 It is therefore possible that the increased amounts of both fetal and maternal free circulating DNA that we detected in the plasma of women with preeclampsia could reflect on increased levels of cell damage in both the fetal and maternal compartments through a mechanism involving microparticles. Alternatively, it is also possible that another unrelated mechanism could be responsible for the increase in circulating DNA levels associated with preeclampsia. Further, more detailed studies will be necessary to elucidate the underlying mechanisms and permit new insights into this puzzling and medically relevant disorder. Our data provide a new basis for such investigations. REFERENCES

1. Witlin AG, Sibai BM. Hypertension in pregnancy: current concepts of preeclampsia. Annu Rev Med 1997;48:115-27. 2. Dekker GA, Sibai BM. Etiology and pathogenesis of preeclampsia: current concepts. Am J Obstet Gynecol 1998;179:1359-75. 3. Lim KH, Zhou Y, Janatpour M, McMaster M, Bass K, Chun SH. Human cytotrophoblast differentiation/invasion is abnormal in pre-eclampsia. Am J Pathol 1997;151:1809-18. 4. Brosens IA, Robertson WB, Dixon HG. The role of the spiral arteries in the pathogenesis of preeclampsia. Obstet Gynecol Annu 1972;1:177-91. 5. Roberts J, Redman C. Pre-eclampsia: more than pregnancyinduced hypertension. Lancet 1993;341:1447-51. 6. Roberts JM. Endothelial dysfunction in preeclampsia. Semin Reprod Endocrinol 1998;16:5-15. 7. Redman CW, Sacks GP, Sargent IL. Preeclampsia: an excessive maternal inflammatory response to pregnancy. Am J Obstet Gynecol 1999;180:499-506. 8. Holzgreve W, Hahn S. Novel molecular biological approaches for the diagnosis of preeclampsia. Clin Chem 1999;45:451-2. 9. Douglas GW, Thomas L, Carr M, Cullen NM, Morris R. Trophoblasts in the circulating blood during pregnancy. Am J Obstet Gynecol 1959;58:960-73. 10. Johansen M, Redman CW, Wilkins T, Sargent IL. Trophoblast

Zhong et al 419

Volume 184, Number 3 Am J Obstet Gynecol

11.

12.

13. 14.

15.

16. 17.

18.

deportation in human pregnancy: its relevance for pre-eclampsia. Placenta 1999;20:531-9. Knight M, Redman CW, Linton EA, Sargent IL. Shedding of syncytiotrophoblast microvilli into the maternal circulation in preeclamptic pregnancies. BJOG 1998;105:632-40. Kertesz Z, Hurst G, Ward M, Willin AC, Caro H, Linton EA, et al. Purification and characterization of a complex from placental syncytiotrophoblast microvillous membranes which inhibits the proliferation of human umbilical vein endothelial cells. Placenta 1999;20:71-9. Hahn S, Sant R, Holzgreve W. Fetal cells in maternal blood: current and future perspectives. Mol Hum Reprod 1998;4:515-21. Gänshirt D, Smeets FW, Dohr A, Walde C, Stehen I, Lapucci C, et al. Enrichment of fetal nucleated red blood cells from the maternal circulation for prenatal diagnosis: experiences with triple density gradient and MACS based on more than 600 cases. Fetal Diagn Ther 1998;13:276-86. Holzgreve W, Ghezzi F, Di Naro E, Maymon E, Gänshirt D, Hahn S. Disturbed fetomaternal cell traffic in preeclampsia. Obstet Gynecol 1998;91:669-72. Lo YM, Corbetta N, Chamberlain PF, Sargent JL. Presence of fetal DNA in maternal plasma and serum. Lancet 1997;350:485-7. Lo YM, Leung TN, Tein MS, Sargent IL, Zhang J, Lau TK, et al. Quantitative abnormalities of fetal DNA in maternal serum in preeclampsia. Clin Chem 1999;45:184-8. Lo YM, Tein MS, Lau TK, Haines CJ, Leung TN, Poon PM, et al. Quantitative analysis of fetal DNA in maternal plasma and

19.

20.

21.

22.

23.

24.

25.

serum: implications for noninvasive prenatal diagnosis. Am J Hum Genet 1998;62:768-75. Hahn S, Zhong XY, Bürk MR, Troeger C, Holzgreve W. Multiplex and real-time quantitative PCR on fetal DNA in maternal plasma: a comparison with fetal cells isolated from maternal blood. Ann N Y Acad Sci 2000;906:148-52. Anker P, Mulcahy H, Chen XQ, Stroun M. Detection of circulating tumour DNA in the blood (plasma/serum) of cancer patients. Cancer Metastasis Rev 1999;18:65-73. Bret L, Lule J, Alary C, Appolinaire-Pilipenko S, Pourrat JP, Fournie GJ. Quantitation of blood plasma DNA as an index of in vivo cytotoxicity. Toxicology 1990;61:283-92. Holdenrieder S, Stieber P, Forg T, Kuhl M, Schulz L, Busch M, et al. Apoptosis in serum of patients with solid tumours. Anticancer Res 1999;19:2721-4. Giacona MB, Ruben GC, Iczkowski KA, Roos TB, Porter DM, Sorenson GD. Cell-free DNA in human blood plasma: length measurements in patients with pancreatic cancer and healthy controls. Pancreas 1998;17:89-97. DiFederico E, Genbacev O, Fisher SJ. Preeclampsia is associated with widespread apoptosis of placental cytotrophoblasts within the uterine wall. Am J Pathol 1999;155:293-301. Kunjara S, Greenbaum AL, Wang DY, Caro HN, McLean O, Redman CW, et al. Inositol phosphoglycans and signal transduction systems in pregnancy in preeclampsia and diabetes: evidence for a significant regulatory role in preeclampsia at placental and systemic levels. Mol Genet Metab 2000;69:144-58.