- Email: [email protected]
keap1-Nrf2 pathway
Biomedicine & Pharmacotherapy 110 (2019) 85–94
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
Ellagic acid ameliorates oxidative stress and insulin resistance in high glucose-treated HepG2 cells via miR-223/keap1-Nrf2 pathway
T
Xiaoqin Dinga, Tunyu Jiana, Yuexian Wua, Yuanyuan Zuoa, Jiawei Lia, Han Lva, Li Maa, ⁎ ⁎ Bingru Rena, Lei Zhaoa, Weilin Lia,b, , Jian Chena, a b
Institute of Botany, Jiangsu Province and Chinese Academy of Sciences, Nanjing 210014, China Nanjing Forestry University, Nanjing 210037, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Type 2 diabetes mellitus Ellagic acid Oxidative stress Insulin resistance miR-223 keap1-Nrf2 system
As a promising new target, miR-233 may regulate oxidative stress by targeting keap1-Nrf2 system to affect the pathological process of liver injury in T2DM. Ellagic acid (EA) is versatile for protecting oxidative stress damage and metabolic disorders. In the present study, we investigated the effect of EA on oxidative stress and insulin resistance in high glucose-induced T2DM HepG2 cells and examined the role of miR-223/keap1-Nrf2 pathway in system. HepG2 cells were incubated in 30 mM of glucose, with or without EA (15 and 30 μM) or metformin (Met, 150 μM) for 12 h. Glucose consumption, phosphorylation of IRS1, Akt and ERK under insulin stimulation, ROS and O2%− production, MDA level, SOD activity and miR-223 expression, as well as protein levels of keap1, Nrf2, HO-1, SOD1 and SOD2 were analyzed. Furthermore, dual luciferase reporter assay, miR-223 mimic and inhibitor were implemented in cellular studies to explore the possible mechanism. EA upregulated glucose consumption, IRS1, Akt and ERK phosphorylation under insulin stimulation, reduced ROS and O2%− production and MDA level, and increased SOD activity in high glucose-exposed HepG2 cells. In addition, EA elevated miR-223 expression level, downregulated mRNA and protein levels of keap1, and upregulated Nrf2, HO-1, SOD1 and SOD2 protein levels in this cell model. What’s more, dual luciferase reporter assay, miR-223 mimic and inhibitor transfection confirmed that EA activated keap1-Nrf2 system via elevating miR-223. The miR-223, a negative regulator of keap1, represents an attractive therapeutic target in hepatic injury in T2DM. EA ameliorates oxidative stress and insulin resistance via miR-223-mediated keap1-Nrf2 activation in high glucose-induced T2DM HepG2 cells.
1. Introduction Diabetes mellitus (DM) affect about 383 million adults, accounting for 8.3% of adult population worldwide [1]. For developing complications including cardiovascular diseases, mental and nervous system disorders, cancer, infections and liver disease, DM, in particular type 2 diabetes mellitus (T2DM), has grown up to be a global public health problem [2–4]. Owing to its complication of cirrhosis, DM is also known as “hematogenous diabetes”. T2DM in the absence of obesity and hypertriglyceridemia is a risk factor for chronic liver disease [5]. Accumulating evidence has clearly indicated that oxidative stress plays a major role in the pathological process of T2DM [6,7]. There are markers of oxidative stress in the serum of T2DM patients [8]. What’s more, mitochondrial dysfunction, reactive oxygen species (ROS) over production, and lipid peroxidation have been found in the liver of Zucker rats with T2DM [9]. Increased oxidative stress seems to be a
⁎
deleterious factor leading to insulin resistance and impaired glucose tolerance in T2DM [6]. Oxidative stress is often recognized as an imbalance resulting from altered gene expression. Nuclear factor-erythroid-2-related factor 2 (Nrf2), tightly interacts with kelch-like ECHassociated protein 1 (keap1), an important transcription factor responsible for inducing phase II detoxifying and antioxidant enzymes, is a key player in the antioxidant response and glucose metabolism [10,11]. Recent study has confirmed keap1-Nrf2 system as a critical target for preventing the onset of diabetes mellitus [12]. Nrf2 activation contributes to ameliorating oxidative damage in glomeruli of diabetic nephropathy [13]. Keap1-Nrf2 system intimately protects tissues against diabetes-mediated damage and that Nrf2 induction suppresses oxidative damage-mediated diabetic complications [11]. Therefore, the normal expression of keap1-Nrf2 system is important in the prevention of oxidative stress and the maintenance of glucose metabolism in T2DM.
Corresponding authors at: Institute of Botany, Jiangsu Province and Chinese Academy of Sciences, Nanjing 210014, China. E-mail addresses: [email protected] (W. Li), [email protected] (J. Chen).
https://doi.org/10.1016/j.biopha.2018.11.018 Received 16 July 2018; Received in revised form 30 October 2018; Accepted 6 November 2018 0753-3322/ © 2018 Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Biomedicine & Pharmacotherapy 110 (2019) 85–94
X. Ding et al.
2.3. Glucose consumption assay
MicroRNAs (miRNAs) are small, non-coding RNAs that negatively regulate gene expression at the post-transcription level by binding to the 3-untranslated regions (3-UTR) of target mRNAs [14]. Dysregulation of miRNAs expression in various tissues and body fluids has been shown to be associated with T2DM [15,16], including oxidative stress disorder [17]. Meta-analysis revealed the dysregulated highly liverspecific miR-223 as a tissue biomarker of T2DM [16], which is downregulated in hepatocellular carcinoma [18]. In addition, miR-223 knocked mice on a high-fat diet exhibits an increased severity of systemic insulin resistance compared with wild-type mice [19]. Searching TargetScan (http://www.targetscan.org) database reveals putative miR-223-binding sites on the 3′-untranslated region (3′-UTR) of keap1 mRNA. However, the specific role of miR-223 in T2DM and whether it targets keap1 still remains unknown. In recent years, natural polyphenols have gained increasing attention for their potential benefits and facilitates in management of DM [20]. Ellagic acid (EA) is a natural polyphenolic compound found in many fruits, nut galls and plant extracts, which has been proven to possess several biological properties including antidiabetic activity [21], anti-inflammatory [22], antioxidant activities [23,24], and liver protection [25]. However, the effectiveness of oxidative damage and insulin resistance of the liver in T2DM by EA and the molecular mechanism remains to be established. As a cell culture model retains the morphology and most of function in culture, the human hepatocarcinoma cell line (HepG2) is widely used for biochemical and nutritional studies, such as hepatic glucose production, the modulation of the insulin pathway and oxidative stress in vitro [26,27]. We therefore conducted the study on HepG2 cells to assess whether EA protects against high glucose-induced oxidative stress and insulin resistance through the miR-223/keap1-Nrf2 pathway.
Cellular glucose uptake was assayed in the medium by enzymatic methods with a glucose assay kit (Nanjing Jiancheng Bioengineering Institute, Jiangsu, China). HepG2 cells were seeded into a 96-well plate at a density of 2 × 105 cells∙mL−1 with five wells left as blanks, reaching 80% confluence. After the treatment with high glucose, EA or Met as above, the supernatant was replaced by low glucose, no FBS, no phenol red DMEM (FBS and phenol red will affect the accuracy of the glucose concentration assay) with 100 nM of insulin for 15 min, the medium was removed and the glucose concentration of the wells with cells was subtracted from the glucose of the blank wells to obtain the amount of glucose consumption. The MTT assay was utilized to adjust the glucose consumption. 2.4. Measurements of intracellular ROS and O2%− Intracellular ROS and O2%− levels were detected using fluorescenceprobe 2′,7′-dichlorofluorescin diacetate (DCFH-DA) and DHE labeling (Beyotime, Institute of Biotechnology, Haimen, China), as described previously [28]. The cells were seeded on a 96-well black, clearbottom microplate or 6-well plates. After the treatment as above, for ROS measurement, cells were washed twice with PBS and then incubated in PBS containing 10 μM of DCFH-DA for 30 min at 37 °C. Fluorescence intensity was measured at 530 nm with an excitation wavelength of 485 nm using a Tecan Infinite M200 fluorescence plate reader (Tecan, Crailsheim, Germany). For O2%− measurement, cells were washed twice with PBS and then incubated in PBS containing 10 μM of DHE for 30 min at 37 °C. Cells were visualized by an Olympus IX2-SL epifluorescence microscope (Olympus, Tokyo, Japan). 2.5. SOD and MDA assay
2. Materials and methods
HepG2 cells were seeded into a 12-well plate at a density of 2 × 105 cells∙mL−1 and incubated as above before harvest. The cell lysates were prepared with PBS or cell lysis buffer (Beyotime, Institute of Biotechnology, Haimen, China) for SOD activity and MDA levels were measured separately using commercially available assay kit (Beyotime, Institute of Biotechnology, Haimen, China). The SOD activity and MDA levels of HepG2 cells were calibrated by protein content, and the protein determination was measured by BCA method.
2.1. Cell culture and treatments HepG2, obtained from Cell Bank of Shanghai Institute of Cell Biology, Chinese Academy of Sciences, was cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (Gibico) at 37 °C with 5% CO2. Cells were seeded in 6-well, 12well or 96-well plates at a density of 2 × 105 cells·mL−1. To detect time course of high glucose on glucose consumption, tyrosine phosphorylation of IRS-1 and ROS production, HepG2 cells were cultured with 30 mM of glucose for 0–24 h. At the end of the treatment, cells were used to detect ROS production or incubated with 100 nM of insulin for 15 min to detect the glucose consumption and tyrosine phosphorylation of IRS1. To evaluate the protective effect of EA against high-glucose challenge, HepG2 cells were cultured with or without glucose (30 mM), EA (15 μM, 30 μM) and Met (150 μM) for 12 h, then they were harvested or following with treatment of insulin (100 nM) for 15 min for the next assays.
2.6. Dual luciferase reporter assay [29,30] Luciferase assay was performed to prove the direct binding of miR223-3p to the putative binding site in the 3′-UTR of the hkeap1 mRNA. A recombination plasmid containing miR-223 binding sites in keap13′UTR (NM_203500) as keap1-WT and a vector which were deleted the seed sequence of miR-223 binding sites as keap1-MT were constructed and purchased from Genecopoeia Co. Ltd. (China). HepG2 cells were co-transfected with the reporter constructs keap1-WT or keap1-MT (250 ng final) with either 50 nM miR-223 mimic or control mimic using Lipofectamine®2000 according to the manufacturer’s instructions. The vectors (pEZX-FR02) can express both firefly luciferase and renilla luciferase. After 48 h, the relative luciferase activity, defined by the ratio of firefly to renilla luciferase activity, was measured by the dual luciferase reporter assay kit from Genecopoeia Co. Ltd. (China).
2.2. MTT method To assess the cell viability, culture media from cells under exposure to different concentrations of EA (1–200 μM) were tested by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. HepG2 cells were seeded into a 96-well plate at 2 × 105 cells∙mL−1 and cultured in EA (1–200 μM) for 24 h. MTT diluted with PBS at a final concentration of 0.5 mg mL−1 was added to each well for 4 h at 37 °C. Upon termination, the supernatant was aspirated, and the formazan precipitate was dissolved in 150 μL of DMSO for 30 min on a gyratory shaker, and the absorbance was measured at 570 nm with a Molecular Devices Spectra Max Plus automatic plate reader (Molecular Device, Sunnyvale, CA, USA).
2.7. Cell transfection MiR-223 mimic and inhibitor, as well as respective negative control (NC) in HepG2 cells, were synthesized by GenePharma (Shanghai, China). The sequences were listed in Table 1. Transfection of miR-223 mimic (50 nM), miR-223 inhibitor (50 nM), as well as respective negative control in HepG2 cells (6-well or 12-well plate) were performed using Lipofectamine®2000, according to the manufacturer’s 86
Biomedicine & Pharmacotherapy 110 (2019) 85–94
X. Ding et al.
Table 1 RNA oligo and primer sequences. ID
Sense primer (5’→ 3’)
Antisense primer (5’→ 3’)
hmiR-223 URP U6 hkeap1 hβ-actin hmiR-223 mimic hmiR-223 inhibitor Control mimic Control inhibitor
ACACTCCAGCTGGGCGTGTATTTGACAAGC TGGTGTCGTGGAGTCG CTCGCTTCGGCAGCACA CTGGAGGATCATACCAAGCAGG CCGAGGACTTTGATTGCA UGUCAGUUUGUCAAAUACCCCA UGGGGUAUUUGACAAACUGACA UUCUCCGAACGUGUCACGUTT CAGUACUUUUCUCUAGUACAA
CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAACTCAGC AACGCTTCACGAATTTGCGT GGATACCCTCAATGGACACCAC GTGGGGTGGCTTTTAGGA GGGUAUUUGACAAACUGACAUU ACGUGACACGUUCGGAGAATT
h, human.
antibody in 5% milk followed by anti-mouse IgG, HRP-linked antibody (#7076) or Anti-rabbit IgG, HRP-linked Antibody (#7074) purchased from Cell Signaling Technology (Beverly, MA, USA). Immunoreactive bands were visualized via the enhanced chemiluminescence (Vazyme, China) and quantified via densitometry using Image J (version 1.42q, National Institutes of Health, USA).
instructions. After 24 h, qRT-PCR assay was used to identify miR-223 expression to confirm the successful transfection. The protein levels of keap1, Nrf2, SOD and HO-1 were tested by western blot analysis. 2.8. RNA isolation and qRT-PCR analysis The total RNA of HepG2 cells after the treatment as above were isolated using Trizol reagent (Invitrogen) according to the manufacturer’s instructions. The primers were listed in Table 1. For qRT-PCR analysis, the reverse transcription reaction of keap1 was performed using HiScript Q RT SuperMix for qPCR kit according to the manufacturer’s instructions. The reverse transcription reactions of miR-223 contained RNA samples including 2 μg of purified total RNA, 1.5 μl of stem-loop RT primers, 4 μl of RT buffer, 2 μl of 40 U∙μl−1 MultiScribe reverse transcriptase, 2 μl of 10 mM dNTPs, 0.5 μl of 40 U∙μl−1 RNase inhibitor (Vazyme, China), and H2O-DEPC to 20 μl. The reaction mixture was incubated for 15 min at 16 °C, 1 h at 37 °C, 5 min at 85 °C and then held at 4 °C. To carry out the qRT-PCR, sample cDNA was amplified in 96-well optical reaction plates (Invitrogen) containing 2 μl of cDNA, 10 μl of SYBR Green I dye (TAKARA, China), 0.5 μl of primers (stem-loop forward primer: URP: H2O DEPC = 1:1:3) for miR223 or 1 μl of primers (forward and reverse primers) for keap1, and H2O-DEPC to 20 μl. The PCR thermal cycling (qTOWER 3 G, analytikjena, Germany) was performed as follows: 5 min at 95 °C followed by 40 cycles of 15 s at 95 °C, 20 s at 60 °C, melt curve and plate read. The fluorescence signal generated with SYBR Green I DNA dye was measured during annealing steps. Specificity of the amplification was confirmed using a melting curve analysis. The samples for qRT-PCR analysis were evaluated using a single predominant peak as a quality control. Comparative Ct (2-ΔΔCt) method was used to analyze the relative expression of miR-223 or keap1 which was normalized to U6 or β-actin [28].
2.10. Statistical analysis Results were expressed as the mean ± standard error of the mean (SEM). Statistical analysis was performed by ANOVA with Dunnett’s post hoc test. Difference was considered significant at p < 0.05. 3. Results 3.1. High glucose induced insulin signaling impair and oxidative stress in HepG2 Cells Insulin resistance in hepatocytes mainly causes impaired insulin signaling and decreased glucose uptake, which is the major contribution to hyperglycaemia. Treatment of HepG2 cells with high glucose triggers a significant reduction of insulin signaling and oxidative stress [26,27]. In order to establish an in vitro insulin resistant model of HepG2 cells and evaluate the effects of time course of high glucose on glucose metabolism in the cell model, HepG2 cells were incubated with 30 mM of glucose for 0–24 h. As shown in Fig. 1A and B, glucose consumption under insulin stimulation was significantly decreased from 1 h, down to the minimum at 12 h, and the tyrosine phosphorylated IRS1 was also reduced at 12 and 24 h. High glucose consumption also increased ROS production from 1 h, up to the peak at 12 h (Fig. 1C). 3.2. Cell viability and proliferation HepG2 cells were exposed to a serious of concentrations of EA (1–200 μM) for 24 h to determine their potential effects on cell viability. Treatment of HepG2 cells for 24 h with EA did not evoke significant changes in cell viability, as determined by the MTT assay (Fig. 2A), indicating that the concentrations selected for the study did not damage cell integrity during the period of incubation.
2.9. Western blot analysis Cell lysates of HepG2 cells were prepared in cell lysis buffer (Beyotime Institute of Biotechnology, Haimen, China) containing 0.1 mM of PMSF, and then centrifuged at 3000 g for 15 min at 4 °C. These supernatant samples were centrifuged again at 12,000 g for 20 min at 4 °C, respectively. After resolution of sample protein (equal loading for each sample) by 10% SDS-PAGE, the protein was electrophoretically transferred onto polyvinylidene difluoride membranes (Millipore, Bedford, MA, USA). The primary antibodies used in this study included: anti-phospho-IRS-1 (Tyr895) (#3070S), anti-IRS-1 (#2382S), anti-ERK (#9102), anti-phospho-ERK (#9101), anti-Akt (#9272), anti-phospho-Akt (#9271), anti-Nrf2 (#12721S) and anti-βactin (#4970) purchased from Cell Signaling Technology (Beverly, MA, USA); anti-keap1 (sc-365626), SOD1 (sc-101523), anti-HO-1 (sc136256) purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA); anti-SOD2 (24127-1-AP) purchased from Proteintech Group (Chicago, USA). Bots were incubated overnight at 4 °C in primary
3.3. EA prevented high glucose induced insulin resistance in HepG2 cells IRS1, belonging to insulin receptor substrates (IRSs) family which connects insulin receptor activation to essential downstream insulin signaling protein kinase B (Akt) and extracellular signal-regulated kinases (ERK) pathway activation [31]. Compared to control group cells, 30 mM of glucose exposure for 12 h significantly decreased glucose consumption and reduced phosphorylation of IRS1 at tyrosine site, Akt and ERK in HepG2 cells (Fig. 2B and C). EA (15, 30 μM) and Met (150 μM) significantly elevated glucose consumption and increased phosphorylation of IRS1, Akt and ERK in high glucose-exposed HepG2 87
Biomedicine & Pharmacotherapy 110 (2019) 85–94
X. Ding et al.
Fig. 1. High glucose induced insulin resistant and ROS over production in HepG2 cells. (A and B) Time course of glucose consumption (n = 8) and IRS-1 tyrosine phosphorylation under insulin (100 nM) stimulated in HepG2 cells incubated with 30 mM of glucose for 0–24 h. (C) Time course of ROS production in HepG2 cells incubated with 30 mM of glucose for 0–24 h (n = 8). Data are expressed as mean ± SEM. +P < 0.05, ++P < 0.01, ++ +P < 0.001 versus Normal cell control.
keap1-MT, there is no statistical difference with respect to the control group, these data suggested miR-223 target keap1 (Fig. 5B). Furthermore, HepG2 cells were transiently transfected with miR-223 mimic or inhibitor for 24 h. The efficiency of miR-223 mimic or inhibitor transfection was detected by qRT-PCR. It turned out that the endogenous miR-223 expression was upregulated in miR-223 mimic transfectedHepG2 cells and the reduction of keap1 protein level was observed as expected (Fig. 5A and B). The significant decrease of miR-223 expression and increase of keap1 protein level was observed in miR-223 inhibitor transfected HepG2 cells (Fig. 5C and D). These observations indicated that miR-223 expression might partly control the protein level of keap1 in HepG2 cells. Since high-glucose provokes oxidative stress and insulin resistance, and miR-223 and its target keap1/Nrf2 may be involved in, the effect of EA, miR-223 mimic and inhibitor transfection on oxidative stress and insulin resistance in HepG2 cells under high-glucose concentration was analyzed. Transfection with miR-223 mimic partly abolished high glucose-induced upregulation of keap1 protein level, elevated Nrf2, SOD1, SOD2, HO-1, p-IRS1, p-Akt and p-ERK protein levels, as well as reversed ROS and O2%− overproduction in HepG2 cells (Fig. 6A–D). On the other hand, transfection of miR-223 inhibitor partly aggravated high glucose-induced dysregulation of keap1, Nrf2, SOD1, SOD2, HO-1, p-IRS1, p-Akt and p-ERK, as well as ROS and O2%− overproduction in HepG2 cells (Fig. 7A–D). These observations indicated that miR-223 might partly mediate keap1-Nrf2 system-dependent oxidative stress and insulin signaling impairment in high glucose-exposed HepG2 cells. In miR-223 mimic transfected HepG2 cells, EA or Met remarkably abolished high glucose-induced keap1/Nrf2 pathway dysregulation, oxidative stress and insulin resistance in HepG2 cells (Fig. 6A–D). Of note, transfection with miR-223 inhibitor partially prevented EA or Met-mediated regulation of keap1, Nrf2, SOD, HO-1 and p-IRS1, as well as ROS overproduction in HepG2 cells under high glucose condition (Fig. 7A–D). These data demonstrated that EA might upregulate miR223 expression to partly alleviate high glucose-induced dysregulation of keap1-Nrf2 system in HepG2 cells.
cells (Fig. 2B and C). 3.4. EA ameliorated high glucose induced oxidative stress in HepG2 cells via keap1-Nrf2 system To test the protective effect of EA on HepG2 cells submitted to oxidative stress, HepG2 cells were cultured with or without 30 mM of glucose, EA (15 and 30 μM) and Met (150 μM) for 12 h, subsequently, O2%− and ROS production, MDA level and SOD activity were evaluated, respectively. From the results, O2%− production was distinctly raised in high glucose treated HepG2 cells compared with control group cells, as well as ROS production in vehicle group (Fig. 3A and B). What’s more, a significant increase of MDA level and a remarkable decrease of SOD activity was observed in high glucose-exposed HepG2 cells compared with control group cells (Fig. 3C and D). EA decreased ROS and O2%− production, downregulated MDA level and increased SOD activity in high glucose-exposed HepG2 cells, as shown in Fig. 3A–D. Time course of keap1 and Nrf2 protein levels throughout the high glucose treatment were also analyzed in Fig. 4A. Keap1 protein level was increased but Nrf2 protein level was decreased within 12 h after exposure to 30 mM of glucose. Furthermore, the elevated protein level of keap1 and the decreased protein levels of Nrf2, HO-1, SOD1 and SOD2 were also observed in high glucose-incubated HepG2 cells (Fig. 4B). Above situation was reversed by EA and Met, indicating their similar activity in regulation of keap1-Nrf2 system in HepG2 cells under high glucose condition. 3.5. EA ameliorated oxidative stress and insulin resistance via miR-223/ keap1-Nrf2 pathway in HepG2 under high glucose condition Searching TargetScan database revealed putative miR-223 binding sites on the 3′-UTR of keap1 mRNA. In addition, miR-223 expression was downregulated in high glucose-exposed HepG2 cells (Fig. 4C). EA and Met both effectively upregulated miR-223 expression in HepG2 cells under high glucose condition (Fig. 4D). What’s more, the mRNA expression level was increased in high glucose-exposed HepG2 cells, which was reversed by EA and Met (Fig. 5A). To address whether miR223 targets keap1, the whole 3′-UTR sequence from human keap1 mRNA or the sequence which deleted the seed region were inserted into pEZX-FR02 luciferase reporter vector. As shown in Fig. 5A, when miR223 was co-transfected with keap1-WT, it significantly reduced the luciferase activity, however, when miR-223 was co-transfected with
4. Discussion DM has emerged as a major threat to health worldwide, and over 90% of people with diabetes have T2DM [32]. Patients with T2DM have an increased risk of chronic liver disease, including non-alcoholic fatty liver disease and steatohepatitis, and about one-third of cirrhotic 88
Biomedicine & Pharmacotherapy 110 (2019) 85–94
X. Ding et al.
Fig. 2. EA improved insulin resistance in high glucose-exposed HepG2 cells. (A) Cell viability of HepG2 cells in different concentrations of EA from 0 to 200 μM for 24 h. (B) Glucose consumption of HepG2 cells incubated with or without 30 mM of glucose, EA (15, 30 μM) or Met (150 μM) for 12 h, following 15 min stimulate of insulin (100 nM) (n = 8). (C) Protein levels of p-IRS1, p-Akt and p-ERK in HepG2 cells incubated with or without 30 mM of glucose, EA (15, 30 μM) or Met (150 μM) for 12 h, following 15 min stimulate of insulin (100 nM). Data are expressed as mean ± SEM. +p < 0.05, ++p < 0.01, +++p < 0.001 versus normal cell group. *p < 0.05, **p < 0.01, ***p < 0.001 versus glucose-vehicle cell group.
oxidative stress is a deleterious factor leading to insulin resistance in T2DM [6]. Oxidative stress plays the major role in the association with the insulin resistance pathogenesis by insulin signals disruption. Research has shown that Nrf2 depletion increases blood glucose level, worsens glucose intolerance and impairs insulin signaling [11]. Decreased phosphorylation in the insulin signaling pathway is a hallmark of insulin resistance. IRS1 is the key target of the insulin receptor tyrosinekinase and is required for hormonal control of metabolism [33], which transduces downstream enzymes, such as Akt and ERK. Decreased IRS-1 phosphorylation at tyrosinesite has been observed in liver of T2DM [34]. In keeping with previous studies, we observed elevated keap1 protein level, suppressed Nrf2 protein level, as well as reduced HO-1, SOD1 and SOD2 protein levels in this cell model. Insulin signaling impairment was also found in this study, showing as the decreased IRS1, Akt and ERK phosphorylation. In vitro studies and in animal models, antioxidants have been shown to improve insulin sensitivity. Several clinical trials have demonstrated that treatment with antioxidants improves insulin sensitivity in insulin-resistant individuals [37]. EA has been demonstrated to have unusually versatile for protecting against oxidative stress in multiple diseases including UVA
patients have diabetes [33]. Due to their biological properties, polyphenols may be appropriate nutraceuticals and supplementary treatments for various aspects of DM. There is accumulating evidence suggesting the antidiabetic activity of polyphenols [20,34]. Consolidated data have confirmed that EA is a potent natural polyphenolic antioxidant with beneficial effects in DM and metabolic syndrome [21,34]. In the present study, the principal findings are as follows: 1. EA ameliorates insulin resistance and oxidative stress in high glucose-induced T2DM HepG2 cells. 2. EA activates keap1-Nrf2 system to improve oxidative stress in this cell model. 3. EA may elevate miR-223 to suppress keap1 and activate Nrf2 and the downstream proteins, which may be the possible mechanism of EA treatment for liver injury in T2DM. Keap1-Nrf2 system, acts as a key regulator for protecting against ROS, RNS, and electrophiles [35], plays an important role in oxidative stress response and metabolism, as well as in prevention of DM [12].The release of reactive oxygen species (ROS) and the generation of oxidative stress, which has been proven as results of long-term high glucose and mediate diabetic complications, are considered critical factors for the pathogenesis of T2DM [8,36]. Playing a key role in the pathogenesis of micro- and macrovascular diabetic complications, 89
Biomedicine & Pharmacotherapy 110 (2019) 85–94
X. Ding et al.
Fig. 3. EA alleviated oxidative stress in high glucose-exposed HepG2 cells. (A and B) O2%− and ROS production in HepG2 cells incubated with or without 30 mM of glucose, EA (15, 30 μM) or Met (150 μM) for 12 h detected by DHE labeling and quantitative immunofluoresce of H2DCF-DA labeling (n = 8), respectively. (C and D) MDA level and SOD activity in HepG2 cells incubated with or without 30 mM of glucose, EA (15, 30 μM) or Met (150 μM) for 12 h (n = 8). Data are expressed as mean ± SEM. +p < 0.05, ++p < 0.01 versus normal cell group. *p < 0.05, **p < 0.01, ***p < 0.001 versus glucose-vehicle cell group.
induced apoptosis [38], cyclosporine A-induced testicular and spermatozoal damages [39], high-carbohydrate, high-fat diet-induced metabolic syndrome [34] and streptozotocin-induced DM [21]. EA has also
been confirmed to reduce high glucose-induced vascular oxidative stress [40]. We also observed the amelioration of oxidative stress by EA in high glucose-exposed HepG2 cells. EA reduced ROS and O2%−
Fig. 4. Ellagic activate keap1-Nrf2 system and upregulated miR-223 levels in high glucose-exposed HepG2 cells. (A) Keap1 and Nrf2 protein levels in HepG2 cells incubated with 30 mM of glucose for 0–24 h. (B) Keap1, Nrf2, HO-1, SOD1 and SOD2 protein levels in HepG2 cells incubated with or without 30 mM of glucose, EA (15, 30 μM) or Met (150 μM) for 12 h. (C) Relative miR-223 mRNA level in HepG2 cells incubated with 30 mM of glucose for 0–24 h (n = 5). (D) Relative miR-223 mRNA levels in HepG2 cells incubated with or without 30 mM of glucose, EA (15, 30 μM) or Met (150 μM) for 12 h (n = 5). Data are expressed as mean ± SEM. +p < 0.05, ++p < 0.01, +++p < 0.001 versus normal cell group. *p < 0.05, **p < 0.01, ***p < 0.001 versus glucose-vehicle cell group. 90
Biomedicine & Pharmacotherapy 110 (2019) 85–94
X. Ding et al.
Fig. 5. miR-223 target keap1 in HepG2 cells. (A) keap1 mRNA expression (n = 5) in HepG2 cells incubated with or without 30 mM of glucose, EA (15, 30 μM) or Met (150 μM) for 12 h. (B) HepG2 cells transiently transfected with pEZX-FR02 luciferase reporter vector of keap1-WT or keap1-MT together with either 50 nM miR-223 mimic or control mimic for 48 h. Relative luciferase activity was measured and normalized by renilla luciferase activity (n = 6). (C and D) miR-223 expression (n = 5) and keap1 protein level in HepG2 cells transfected with miR-223 mimic (50 nM) or the negative control (50 nM) for 24 h. (E and F) miR-223 expression (n = 5) and keap1 protein level in HepG2 cells transfected with miR-223 inhibitor (50 nM) or the negative control (50 nM) for 24 h. Data are expressed as mean ± SEM. ++p < 0.01, +++p < 0.001 versus normal cell group, **p < 0.01 versus glucose-vehicle cell group.
These findings suggest the possibility that keap1/Nrf2 may be regulated by some miRNAs in high glucose-exposed HepG2 cells. As a potential liver biomarker of T2DM, miR-223 is predicted to bind the 3′UTR site of keap1 by the algorithm targetscan. Of note, knockout of miR-223 exhibits an increased severity of systemic insulin resistance [19]. Therefore, we focused on the role of miR-223 in insulin signaling and oxidative stress in high glucose-exposed HepG2 cells and whether miR-223 exert the effect on oxidative stress through targeting keap1. In La Sala’s research, the association of microRNA21 with oscillating and high glucose and early mitochondrial dysfunction was demonstrated, and microRNA21 may promote the suppression of homeostatic signalling that normally limits ROS damage [29], which was of great help to us. Referencing to this research, we confirmed that miR-223 binds the
production, downregulated MDA level, and upregulated SOD activity in this cell model. Previous studies have shown that EA ameliorates UVAinduced oxidative stress via adjustment of keap1-Nrf2 system in human keratinocyte cells [38] and improves oxidant-induced endothelial dysfunction and atherosclerosis via activation of Nrf2 in mice [41]. Notably, the antioxidant potential of EA was directly correlated with the increased expression of HO-1, SOD1 and SOD2, which was followed by the downregulation of Keap1 and upregulation of Nrf2 in high glucoseexposed HepG2 cells. There is ample evidence that miRNAs are associated with the progress of DM and T2DM [16,42,43], including oxidative stress in DM [17]. In addition, studies have confirmed that keap1-Nrf2 system could be controlled by miRNAs in different metabolic disorders [44,45]. 91
Biomedicine & Pharmacotherapy 110 (2019) 85–94
X. Ding et al.
Fig. 6. EA increases miR-223 expression to activated keap1-Nrf2 system in high glucose-exposed HepG2 cells. (A and B) Relative keap1, Nrf2, HO-1, SOD1, SOD2, pIRS1, p-Akt and p-ERK protein levels in HepG2 cells transfected with miR-223 mimic (50 nM) or its negative control (50 nM), and then incubated with or without 30 mM of glucose, EA (15, 30 μM) or Met (150 μM) for 12 h (n = 3). (C and D) O2%− and ROS production in these HepG2 cells detected by DHE labeling and quantitative immunofluoresce of H2DCF-DA labeling (n = 8), respectively. Data are expressed as mean ± SEM. ++p < 0.01, +++p < 0.001 versus normal cell control group. *p < 0.05, **p < 0.01, ***p < 0.001 versus glucose-vehicle + Control mimic cell group.
levels, as well as ROS over production, and miR-223 inhibitor aggravated these abnormalities induced by HepG2. These findings indicated that the reduced miR-223 expression may increase keap1 expression to aggravate oxidative stress and insulin resistance in this cell model. EA and Met remarkably elevated miR-223 protein level in high glucose-exposed HepG2 cells, indicating EA and Met-mediated miR-223 upregulation may contribute to their antioxidant effect in HepG2 cells under high glucose condition. To address this, we observed that EA and Met abolished high glucose-induced keap1-Nrf2 inactivation and ROS
3′UTR site of keap1 by dual luciferase reporter assay. In this study, miR223 expression was found to be downregulated, while keap1 mRNA expression was upregulated in high glucose-exposed HepG2 cells, which were consistent with keap1-Nrf2 inactivation, oxidative stress and insulin signaling impairment. Endogenous keap1 protein level in HepG2 cells was significantly upregulated by transfection of miR-223 inhibitor, but downregulated by transfection of miR-223 mimic, indicating that miR-223 regulats keap1 in HepG2 cells under normal condition. Transfection with miR-223 mimic prevented high glucose-caused elevated keap1 protein level, downregulated Nrf2, HO-1 and SOD1 protein 92
Biomedicine & Pharmacotherapy 110 (2019) 85–94
X. Ding et al.
Fig. 7. Transfection with miR-223 inhibitor partially prevents EA-mediated regulation of keap1-Nrf2 system in HepG2 cells under high glucose condition. (A and B) Relative keap1, Nrf2, HO-1, SOD1, SOD2, p-IRS1, p-Akt and p-ERK protein levels in HepG2 cells transfected with miR-223 inhibitor (50 nM) or its negative control (50 nM), and then incubated with or without 30 mM of glucose, EA (15, 30 μM) or Met (150 μM) for 12 h. (C and D) O2%− and ROS production in these HepG2 cells detected by DHE labeling and quantitative immunofluoresce of H2DCF-DA labeling (n = 8), respectively. Data are expressed as mean ± SEM. +p < 0.05, + +p < 0.01, +++p < 0.001 versus normal cell control group. *p < 0.05, **p < 0.01, ***p < 0.001 versus glucose-vehicle + Control inhibitor cell group. # p < 0.05, ##p < 0.01, ###p < 0.001 versus glucose-vehicle + miR-223 inhibitor cell group.
suppression in HepG2 cells, thereby elevates keap1 protein level to decrease Nrf2 and the following HO1, SOD1 and SOD2 protein levels, on the other hand, impairs insulin signaling in HepG2 cells, and ultimately caused oxidative stress and insulin resistance in T2DM. EA’s beneficial effect on oxidative stress and insulin resistance in high-glucose included T2DM HepG2 model was proven via miR-223/keap1Nrf2 signaling, further investigations to trace out the intimate mechanism of action are required.
overproduction in HepG2 cells after miR-223 mimic-transfection. While miR-223 inhibitor partially blocked EA and Met-mediated keap1-Nrf2 activation and ROS elimination in high-glucose-exposed HepG2 cells. These findings indicating that increasing miR-223 expression by EA and Met may protect against high glucose-induced oxidative stress and insulin resistance. 5. Conclusions In summary, this study indicates that high glucose causes miR-223 93
Biomedicine & Pharmacotherapy 110 (2019) 85–94
X. Ding et al.
Conflict of interest
[18] Q.W. Wong, R.W. Lung, P.T. Law, P.B. Lai, K.Y. Chan, K.F. To, N. Wong, MicroRNA223 is commonly repressed in hepatocellular carcinoma and potentiates expression of Stathmin1, Gastroenterology 135 (1) (2008) 257–269. [19] G. Zhuang, C. Meng, X. Guo, P.S. Cheruku, L. Shi, H. Xu, H. Li, G. Wang, A.R. Evans, S. Safe, C. Wu, B. Zhou, A novel regulator of macrophage activation: miR-223 in obesity-associated adipose tissue inflammation, Circulation 125 (23) (2012) 2892–2903. [20] Z. Bahadoran, P. Mirmiran, F. Azizi, Dietary polyphenols as potential nutraceuticals in management of diabetes: a review, J. Diabetes Metab. Disord. 12 (1) (2013) 43. [21] E. Uzar, H. Alp, M.U. Cevik, U. Firat, O. Evliyaoglu, A. Tufek, Y. Altun, Ellagic acid attenuates oxidative stress on brain and sciatic nerve and improves histopathology of brain in streptozotocin-induced diabetic rats, Neurol. Sci. 33 (3) (2012) 567–574. [22] A. Ahad, A.A. Ganai, M. Mujeeb, W.A. Siddiqui, Ellagic acid, an NF-kappaB inhibitor, ameliorates renal function in experimental diabetic nephropathy, Chem. Biol. Interact. 219 (2014) 64–75. [23] B. Baek, S.H. Lee, K. Kim, H.W. Lim, C.J. Lim, Ellagic acid plays a protective role against UV-B-induced oxidative stress by up-regulating antioxidant components in human dermal fibroblasts, Korean J. Physiol. Pharmacol. 20 (3) (2016) 269–277. [24] Z. Qiu, B. Zhou, L. Jin, H. Yu, L. Liu, Y. Liu, C. Qin, S. Xie, F. Zhu, In vitro antioxidant and antiproliferative effects of ellagic acid and its colonic metabolite, urolithins, on human bladder cancer T24 cells, Food Chem. Toxicol. 59 (2013) 428–437. [25] W.R. Garcia-Nino, C. Zazueta, Ellagic acid: pharmacological activities and molecular mechanisms involved in liver protection, Pharmacol. Res. 97 (2015) 84–103. [26] I. Cordero-Herrera, M.A. Martin, L. Goya, S. Ramos, Cocoa flavonoids attenuate high glucose-induced insulin signalling blockade and modulate glucose uptake and production in human HepG2 cells, Food Chem. Toxicol. 64 (2014) 10–19. [27] X. Zhang, J.H. Zhang, X.Y. Chen, Q.H. Hu, M.X. Wang, R. Jin, Q.Y. Zhang, W. Wang, R. Wang, L.L. Kang, J.S. Li, M. Li, Y. Pan, J.J. Huang, L.D. Kong, Reactive oxygen species-induced TXNIP drives fructose-mediated hepatic inflammation and lipid accumulation through NLRP3 inflammasome activation, Antioxid. Redox Signal. 22 (10) (2015) 848–870. [28] W. Wang, X.Q. Ding, T.T. Gu, L. Song, J.M. Li, Q.C. Xue, L.D. Kong, Pterostilbene and allopurinol reduce fructose-induced podocyte oxidative stress and inflammation via microRNA-377, Free Radic. Biol. Med. 83 (2015) 214–226. [29] L. La Sala, S. Mrakic-Sposta, S. Micheloni, F. Prattichizzo, A. Ceriello, Glucosesensing microRNA-21 disrupts ROS homeostasis and impairs antioxidant responses in cellular glucose variability, Cardiovasc. Diabetol. 17 (1) (2018) 105. [30] Y. Dong, Y. Zheng, C. Wang, X. Ding, Y. Du, L. Liu, W. Zhang, W. Zhang, Y. Zhong, Y. Wu, X. Song, MiR-876-5p modulates head and neck squamous cell carcinoma metastasis and invasion by targeting vimentin, Cancer Cell Int. 18 (2018) 121. [31] X.Q. Ding, T.T. Gu, W. Wang, L. Song, T.Y. Chen, Q.C. Xue, F. Zhou, J.M. Li, L.D. Kong, Curcumin protects against fructose-induced podocyte insulin signaling impairment through upregulation of miR-206, Mol. Nutr. Food Res. 59 (12) (2015) 2355–2370. [32] G. Thomas, K. Khunti, V. Curcin, M. Molokhia, C. Millett, A. Majeed, S. Paul, Obesity paradox in people newly diagnosed with type 2 diabetes with and without prior cardiovascular disease, Diabetes Obes. Metab. 16 (4) (2014) 317–325. [33] A.J. Scheen, Pharmacokinetics in patients with chronic liver disease and hepatic safety of incretin-based therapies for the management of type 2 diabetes mellitus, Clin. Pharmacokinet. 53 (9) (2014) 773–785. [34] S.K. Panchal, L. Ward, L. Brown, Ellagic acid attenuates high-carbohydrate, high-fat diet-induced metabolic syndrome in rats, Eur. J. Nutr. 52 (2) (2013) 559–568. [35] J.D. Hayes, A.T. Dinkova-Kostova, The Nrf2 regulatory network provides an interface between redox and intermediary metabolism, Trends Biochem. Sci. 39 (4) (2014) 199–218. [36] I. Cordero-Herrera, M.A. Martin, L. Goya, S. Ramos, Cocoa flavonoids protect hepatic cells against high-glucose-induced oxidative stress: relevance of MAPKs, Mol. Nutr. Food Res. 59 (4) (2015) 597–609. [37] A. Ceriello, E. Motz, Is oxidative stress the pathogenic mechanism underlying insulin resistance, diabetes, and cardiovascular disease? The common soil hypothesis revisited, Arterioscler. Thromb. Vasc. Biol. 24 (5) (2004) 816–823. [38] Y.C. Hseu, C.W. Chou, K.J. Senthil Kumar, K.T. Fu, H.M. Wang, L.S. Hsu, Y.H. Kuo, C.R. Wu, S.C. Chen, H.L. Yang, Ellagic acid protects human keratinocyte (HaCaT) cells against UVA-induced oxidative stress and apoptosis through the upregulation of the HO-1 and Nrf-2 antioxidant genes, Food Chem. Toxicol. 50 (5) (2012) 1245–1255. [39] G. Turk, M. Sonmez, A.O. Ceribasi, A. Yuce, A. Atessahin, Attenuation of cyclosporine A-induced testicular and spermatozoal damages associated with oxidative stress by ellagic acid, Int. Immunopharmacol. 10 (2) (2010) 177–182. [40] A. Rozentsvit, K. Vinokur, S. Samuel, Y. Li, A.M. Gerdes, M.A. Carrillo-Sepulveda, Ellagic acid reduces high glucose-induced vascular oxidative stress through ERK1/ 2/NOX4 signaling pathway, Cell. Physiol. Biochem. 44 (3) (2017) 1174–1187. [41] Y. Ding, B. Zhang, K. Zhou, M. Chen, M. Wang, Y. Jia, Y. Song, Y. Li, A. Wen, Dietary ellagic acid improves oxidant-induced endothelial dysfunction and atherosclerosis: role of Nrf2 activation, Int. J. Cardiol. 175 (3) (2014) 508–514. [42] M.R. Ashoori, M. Rahmati-Yamchi, A. Ostadrahimi, S. Fekri Aval, N. Zarghami, MicroRNAs and adipocytokines: promising biomarkers for pharmacological targets in diabetes mellitus and its complications, Biomed. Pharmacother. 93 (2017) 1326–1336. [43] C. Zhang, D. Qian, H. Zhao, N. Lv, P. Yu, Z. Sun, MiR17 improves insulin sensitivity through inhibiting expression of ASK1 and anti-inflammation of macrophages, Biomed. Pharmacother. 100 (2018) 448–454. [44] J.J. Yang, H. Tao, W. Hu, L.P. Liu, K.H. Shi, Z.Y. Deng, J. Li, MicroRNA-200a controls Nrf2 activation by target Keap1 in hepatic stellate cell proliferation and fibrosis, Cell. Signal. 26 (11) (2014) 2381–2389. [45] S. Kabaria, D.C. Choi, A.D. Chaudhuri, M.R. Jain, H. Li, E. Junn, MicroRNA-7 activates Nrf2 pathway by targeting Keap1 expression, Free Radic. Biol. Med. 89 (2015) 548–556.
The authors declare no conflict of interest. Acknowledgements This study was supported by the National Natural Science Foundation of China (No. 81773885; No. 31770366; No. 81703224), Jiangsu Province and Technology Modern Agricultural Plan (No. BE2016383), Jiangsu Research and development center for Medicinal Plants (Institute of Botany, Jiangsu Province and Chinese Academy of Sciences) (YY201401) and Jiangsu Key Laboratory for the Research and Utilization of Plant Resources (No. JSPKLB201825; No. JSPKLB201833). Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.biopha.2018.11.018. References [1] C.P. Domingueti, L.M. Dusse, M. Carvalho, L.P. de Sousa, K.B. Gomes, A.P. Fernandes, Diabetes mellitus: the linkage between oxidative stress, inflammation, hypercoagulability and vascular complications, J. Diabetes Comp. 30 (4) (2016) 738–745. [2] G.S. Andersen, T. Thybo, H. Cederberg, M. Oresic, M. Esteller, A. Zorzano, B. Carr, M. Walker, J. Cobb, C. Clissmann, D.J. O’Gorman, J.J. Nolan, D. Consortium, The DEXLIFE study methods: identifying novel candidate biomarkers that predict progression to type 2 diabetes in high risk individuals, Diabetes Res. Clin. Pract. 106 (2) (2014) 383–389. [3] C. Emerging Risk Factors, N. Sarwar, P. Gao, S.R. Seshasai, R. Gobin, S. Kaptoge, E. Di Angelantonio, E. Ingelsson, D.A. Lawlor, E. Selvin, M. Stampfer, C.D. Stehouwer, S. Lewington, L. Pennells, A. Thompson, N. Sattar, I.R. White, K.K. Ray, J. Danesh, Diabetes mellitus, fasting blood glucose concentration, and risk of vascular disease: a collaborative meta-analysis of 102 prospective studies, Lancet 375 (9733) (2010) 2215–2222. [4] S. Rao Kondapally Seshasai, S. Kaptoge, A. Thompson, E. Di Angelantonio, P. Gao, N. Sarwar, P.H. Whincup, K.J. Mukamal, R.F. Gillum, I. Holme, I. Njolstad, A. Fletcher, P. Nilsson, S. Lewington, R. Collins, V. Gudnason, S.G. Thompson, N. Sattar, E. Selvin, F.B. Hu, J. Danesh, C. Emerging Risk Factors, Diabetes mellitus, fasting glucose, and risk of cause-specific death, N. Engl. J. Med. 364 (9) (2011) 829–841. [5] D. Garcia-Compean, J.O. Jaquez-Quintana, J.A. Gonzalez-Gonzalez, H. MaldonadoGarza, Liver cirrhosis and diabetes: risk factors, pathophysiology, clinical implications and management, World J. Gastroenterol. 15 (3) (2009) 280–288. [6] S. Tangvarasittichai, Oxidative stress, insulin resistance, dyslipidemia and type 2 diabetes mellitus, World J. Diabetes 6 (3) (2015) 456–480. [7] E.J. Henriksen, M.K. Diamond-Stanic, E.M. Marchionne, Oxidative stress and the etiology of insulin resistance and type 2 diabetes, Free Radic. Biol. Med. 51 (5) (2011) 993–999. [8] K. Maiese, New insights for oxidative stress and diabetes mellitus, Oxid. Med. Cell. Longev. 2015 (2015) 875961. [9] H. Raza, A. John, F.C. Howarth, Increased oxidative stress and mitochondrial dysfunction in zucker diabetic rat liver and brain, Cell. Physiol. Biochem. 35 (3) (2015) 1241–1251. [10] W.N. Wan Hasan, M.K. Kwak, S. Makpol, W.Z. Wan Ngah, Y.A. Mohd Yusof, Piper betle induces phase I & II genes through Nrf2/ARE signaling pathway in mouse embryonic fibroblasts derived from wild type and Nrf2 knockout cells, BMC Complement. Altern. Med. 14 (2014) 72. [11] A. Uruno, Y. Yagishita, M. Yamamoto, The Keap1-Nrf2 system and diabetes mellitus, Arch. Biochem. Biophys. 566 (2015) 76–84. [12] A. Uruno, Y. Furusawa, Y. Yagishita, T. Fukutomi, H. Muramatsu, T. Negishi, A. Sugawara, T.W. Kensler, M. Yamamoto, The Keap1-Nrf2 system prevents onset of diabetes mellitus, Mol. Cell. Biol. 33 (15) (2013) 2996–3010. [13] H. Zheng, S.A. Whitman, W. Wu, G.T. Wondrak, P.K. Wong, D. Fang, D.D. Zhang, Therapeutic potential of Nrf2 activators in streptozotocin-induced diabetic nephropathy, Diabetes 60 (11) (2011) 3055–3066. [14] D. Dong, Y. Zhang, E.A. Reece, L. Wang, C.R. Harman, P. Yang, microRNA expression profiling and functional annotation analysis of their targets modulated by oxidative stress during embryonic heart development in diabetic mice, Reprod. Toxicol. 65 (2016) 365–374. [15] Y. Song, D. Jin, X. Jiang, C. Lv, H. Zhu, Overexpression of microRNA-26a protects against deficient beta-cell function via targeting phosphatase with tensin homology in mouse models of type 2 diabetes, Biochem. Biophys. Res. Commun. 495 (1) (2018) 1312–1316. [16] H. Zhu, S.W. Leung, Identification of microRNA biomarkers in type 2 diabetes: a meta-analysis of controlled profiling studies, Diabetologia 58 (5) (2015) 900–911. [17] M. Yu, Y. Liu, B. Zhang, Y. Shi, L. Cui, X. Zhao, Inhibiting microRNA-144 abates oxidative stress and reduces apoptosis in hearts of streptozotocin-induced diabetic mice, Cardiovasc. Pathol. 24 (6) (2015) 375–381.
94
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
Ellagic acid ameliorates oxidative stress and insulin resistance in high glucose-treated HepG2 cells via miR-223/keap1-Nrf2 pathway
T
Xiaoqin Dinga, Tunyu Jiana, Yuexian Wua, Yuanyuan Zuoa, Jiawei Lia, Han Lva, Li Maa, ⁎ ⁎ Bingru Rena, Lei Zhaoa, Weilin Lia,b, , Jian Chena, a b
Institute of Botany, Jiangsu Province and Chinese Academy of Sciences, Nanjing 210014, China Nanjing Forestry University, Nanjing 210037, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Type 2 diabetes mellitus Ellagic acid Oxidative stress Insulin resistance miR-223 keap1-Nrf2 system
As a promising new target, miR-233 may regulate oxidative stress by targeting keap1-Nrf2 system to affect the pathological process of liver injury in T2DM. Ellagic acid (EA) is versatile for protecting oxidative stress damage and metabolic disorders. In the present study, we investigated the effect of EA on oxidative stress and insulin resistance in high glucose-induced T2DM HepG2 cells and examined the role of miR-223/keap1-Nrf2 pathway in system. HepG2 cells were incubated in 30 mM of glucose, with or without EA (15 and 30 μM) or metformin (Met, 150 μM) for 12 h. Glucose consumption, phosphorylation of IRS1, Akt and ERK under insulin stimulation, ROS and O2%− production, MDA level, SOD activity and miR-223 expression, as well as protein levels of keap1, Nrf2, HO-1, SOD1 and SOD2 were analyzed. Furthermore, dual luciferase reporter assay, miR-223 mimic and inhibitor were implemented in cellular studies to explore the possible mechanism. EA upregulated glucose consumption, IRS1, Akt and ERK phosphorylation under insulin stimulation, reduced ROS and O2%− production and MDA level, and increased SOD activity in high glucose-exposed HepG2 cells. In addition, EA elevated miR-223 expression level, downregulated mRNA and protein levels of keap1, and upregulated Nrf2, HO-1, SOD1 and SOD2 protein levels in this cell model. What’s more, dual luciferase reporter assay, miR-223 mimic and inhibitor transfection confirmed that EA activated keap1-Nrf2 system via elevating miR-223. The miR-223, a negative regulator of keap1, represents an attractive therapeutic target in hepatic injury in T2DM. EA ameliorates oxidative stress and insulin resistance via miR-223-mediated keap1-Nrf2 activation in high glucose-induced T2DM HepG2 cells.
1. Introduction Diabetes mellitus (DM) affect about 383 million adults, accounting for 8.3% of adult population worldwide [1]. For developing complications including cardiovascular diseases, mental and nervous system disorders, cancer, infections and liver disease, DM, in particular type 2 diabetes mellitus (T2DM), has grown up to be a global public health problem [2–4]. Owing to its complication of cirrhosis, DM is also known as “hematogenous diabetes”. T2DM in the absence of obesity and hypertriglyceridemia is a risk factor for chronic liver disease [5]. Accumulating evidence has clearly indicated that oxidative stress plays a major role in the pathological process of T2DM [6,7]. There are markers of oxidative stress in the serum of T2DM patients [8]. What’s more, mitochondrial dysfunction, reactive oxygen species (ROS) over production, and lipid peroxidation have been found in the liver of Zucker rats with T2DM [9]. Increased oxidative stress seems to be a
⁎
deleterious factor leading to insulin resistance and impaired glucose tolerance in T2DM [6]. Oxidative stress is often recognized as an imbalance resulting from altered gene expression. Nuclear factor-erythroid-2-related factor 2 (Nrf2), tightly interacts with kelch-like ECHassociated protein 1 (keap1), an important transcription factor responsible for inducing phase II detoxifying and antioxidant enzymes, is a key player in the antioxidant response and glucose metabolism [10,11]. Recent study has confirmed keap1-Nrf2 system as a critical target for preventing the onset of diabetes mellitus [12]. Nrf2 activation contributes to ameliorating oxidative damage in glomeruli of diabetic nephropathy [13]. Keap1-Nrf2 system intimately protects tissues against diabetes-mediated damage and that Nrf2 induction suppresses oxidative damage-mediated diabetic complications [11]. Therefore, the normal expression of keap1-Nrf2 system is important in the prevention of oxidative stress and the maintenance of glucose metabolism in T2DM.
Corresponding authors at: Institute of Botany, Jiangsu Province and Chinese Academy of Sciences, Nanjing 210014, China. E-mail addresses: [email protected] (W. Li), [email protected] (J. Chen).
https://doi.org/10.1016/j.biopha.2018.11.018 Received 16 July 2018; Received in revised form 30 October 2018; Accepted 6 November 2018 0753-3322/ © 2018 Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Biomedicine & Pharmacotherapy 110 (2019) 85–94
X. Ding et al.
2.3. Glucose consumption assay
MicroRNAs (miRNAs) are small, non-coding RNAs that negatively regulate gene expression at the post-transcription level by binding to the 3-untranslated regions (3-UTR) of target mRNAs [14]. Dysregulation of miRNAs expression in various tissues and body fluids has been shown to be associated with T2DM [15,16], including oxidative stress disorder [17]. Meta-analysis revealed the dysregulated highly liverspecific miR-223 as a tissue biomarker of T2DM [16], which is downregulated in hepatocellular carcinoma [18]. In addition, miR-223 knocked mice on a high-fat diet exhibits an increased severity of systemic insulin resistance compared with wild-type mice [19]. Searching TargetScan (http://www.targetscan.org) database reveals putative miR-223-binding sites on the 3′-untranslated region (3′-UTR) of keap1 mRNA. However, the specific role of miR-223 in T2DM and whether it targets keap1 still remains unknown. In recent years, natural polyphenols have gained increasing attention for their potential benefits and facilitates in management of DM [20]. Ellagic acid (EA) is a natural polyphenolic compound found in many fruits, nut galls and plant extracts, which has been proven to possess several biological properties including antidiabetic activity [21], anti-inflammatory [22], antioxidant activities [23,24], and liver protection [25]. However, the effectiveness of oxidative damage and insulin resistance of the liver in T2DM by EA and the molecular mechanism remains to be established. As a cell culture model retains the morphology and most of function in culture, the human hepatocarcinoma cell line (HepG2) is widely used for biochemical and nutritional studies, such as hepatic glucose production, the modulation of the insulin pathway and oxidative stress in vitro [26,27]. We therefore conducted the study on HepG2 cells to assess whether EA protects against high glucose-induced oxidative stress and insulin resistance through the miR-223/keap1-Nrf2 pathway.
Cellular glucose uptake was assayed in the medium by enzymatic methods with a glucose assay kit (Nanjing Jiancheng Bioengineering Institute, Jiangsu, China). HepG2 cells were seeded into a 96-well plate at a density of 2 × 105 cells∙mL−1 with five wells left as blanks, reaching 80% confluence. After the treatment with high glucose, EA or Met as above, the supernatant was replaced by low glucose, no FBS, no phenol red DMEM (FBS and phenol red will affect the accuracy of the glucose concentration assay) with 100 nM of insulin for 15 min, the medium was removed and the glucose concentration of the wells with cells was subtracted from the glucose of the blank wells to obtain the amount of glucose consumption. The MTT assay was utilized to adjust the glucose consumption. 2.4. Measurements of intracellular ROS and O2%− Intracellular ROS and O2%− levels were detected using fluorescenceprobe 2′,7′-dichlorofluorescin diacetate (DCFH-DA) and DHE labeling (Beyotime, Institute of Biotechnology, Haimen, China), as described previously [28]. The cells were seeded on a 96-well black, clearbottom microplate or 6-well plates. After the treatment as above, for ROS measurement, cells were washed twice with PBS and then incubated in PBS containing 10 μM of DCFH-DA for 30 min at 37 °C. Fluorescence intensity was measured at 530 nm with an excitation wavelength of 485 nm using a Tecan Infinite M200 fluorescence plate reader (Tecan, Crailsheim, Germany). For O2%− measurement, cells were washed twice with PBS and then incubated in PBS containing 10 μM of DHE for 30 min at 37 °C. Cells were visualized by an Olympus IX2-SL epifluorescence microscope (Olympus, Tokyo, Japan). 2.5. SOD and MDA assay
2. Materials and methods
HepG2 cells were seeded into a 12-well plate at a density of 2 × 105 cells∙mL−1 and incubated as above before harvest. The cell lysates were prepared with PBS or cell lysis buffer (Beyotime, Institute of Biotechnology, Haimen, China) for SOD activity and MDA levels were measured separately using commercially available assay kit (Beyotime, Institute of Biotechnology, Haimen, China). The SOD activity and MDA levels of HepG2 cells were calibrated by protein content, and the protein determination was measured by BCA method.
2.1. Cell culture and treatments HepG2, obtained from Cell Bank of Shanghai Institute of Cell Biology, Chinese Academy of Sciences, was cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (Gibico) at 37 °C with 5% CO2. Cells were seeded in 6-well, 12well or 96-well plates at a density of 2 × 105 cells·mL−1. To detect time course of high glucose on glucose consumption, tyrosine phosphorylation of IRS-1 and ROS production, HepG2 cells were cultured with 30 mM of glucose for 0–24 h. At the end of the treatment, cells were used to detect ROS production or incubated with 100 nM of insulin for 15 min to detect the glucose consumption and tyrosine phosphorylation of IRS1. To evaluate the protective effect of EA against high-glucose challenge, HepG2 cells were cultured with or without glucose (30 mM), EA (15 μM, 30 μM) and Met (150 μM) for 12 h, then they were harvested or following with treatment of insulin (100 nM) for 15 min for the next assays.
2.6. Dual luciferase reporter assay [29,30] Luciferase assay was performed to prove the direct binding of miR223-3p to the putative binding site in the 3′-UTR of the hkeap1 mRNA. A recombination plasmid containing miR-223 binding sites in keap13′UTR (NM_203500) as keap1-WT and a vector which were deleted the seed sequence of miR-223 binding sites as keap1-MT were constructed and purchased from Genecopoeia Co. Ltd. (China). HepG2 cells were co-transfected with the reporter constructs keap1-WT or keap1-MT (250 ng final) with either 50 nM miR-223 mimic or control mimic using Lipofectamine®2000 according to the manufacturer’s instructions. The vectors (pEZX-FR02) can express both firefly luciferase and renilla luciferase. After 48 h, the relative luciferase activity, defined by the ratio of firefly to renilla luciferase activity, was measured by the dual luciferase reporter assay kit from Genecopoeia Co. Ltd. (China).
2.2. MTT method To assess the cell viability, culture media from cells under exposure to different concentrations of EA (1–200 μM) were tested by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. HepG2 cells were seeded into a 96-well plate at 2 × 105 cells∙mL−1 and cultured in EA (1–200 μM) for 24 h. MTT diluted with PBS at a final concentration of 0.5 mg mL−1 was added to each well for 4 h at 37 °C. Upon termination, the supernatant was aspirated, and the formazan precipitate was dissolved in 150 μL of DMSO for 30 min on a gyratory shaker, and the absorbance was measured at 570 nm with a Molecular Devices Spectra Max Plus automatic plate reader (Molecular Device, Sunnyvale, CA, USA).
2.7. Cell transfection MiR-223 mimic and inhibitor, as well as respective negative control (NC) in HepG2 cells, were synthesized by GenePharma (Shanghai, China). The sequences were listed in Table 1. Transfection of miR-223 mimic (50 nM), miR-223 inhibitor (50 nM), as well as respective negative control in HepG2 cells (6-well or 12-well plate) were performed using Lipofectamine®2000, according to the manufacturer’s 86
Biomedicine & Pharmacotherapy 110 (2019) 85–94
X. Ding et al.
Table 1 RNA oligo and primer sequences. ID
Sense primer (5’→ 3’)
Antisense primer (5’→ 3’)
hmiR-223 URP U6 hkeap1 hβ-actin hmiR-223 mimic hmiR-223 inhibitor Control mimic Control inhibitor
ACACTCCAGCTGGGCGTGTATTTGACAAGC TGGTGTCGTGGAGTCG CTCGCTTCGGCAGCACA CTGGAGGATCATACCAAGCAGG CCGAGGACTTTGATTGCA UGUCAGUUUGUCAAAUACCCCA UGGGGUAUUUGACAAACUGACA UUCUCCGAACGUGUCACGUTT CAGUACUUUUCUCUAGUACAA
CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAACTCAGC AACGCTTCACGAATTTGCGT GGATACCCTCAATGGACACCAC GTGGGGTGGCTTTTAGGA GGGUAUUUGACAAACUGACAUU ACGUGACACGUUCGGAGAATT
h, human.
antibody in 5% milk followed by anti-mouse IgG, HRP-linked antibody (#7076) or Anti-rabbit IgG, HRP-linked Antibody (#7074) purchased from Cell Signaling Technology (Beverly, MA, USA). Immunoreactive bands were visualized via the enhanced chemiluminescence (Vazyme, China) and quantified via densitometry using Image J (version 1.42q, National Institutes of Health, USA).
instructions. After 24 h, qRT-PCR assay was used to identify miR-223 expression to confirm the successful transfection. The protein levels of keap1, Nrf2, SOD and HO-1 were tested by western blot analysis. 2.8. RNA isolation and qRT-PCR analysis The total RNA of HepG2 cells after the treatment as above were isolated using Trizol reagent (Invitrogen) according to the manufacturer’s instructions. The primers were listed in Table 1. For qRT-PCR analysis, the reverse transcription reaction of keap1 was performed using HiScript Q RT SuperMix for qPCR kit according to the manufacturer’s instructions. The reverse transcription reactions of miR-223 contained RNA samples including 2 μg of purified total RNA, 1.5 μl of stem-loop RT primers, 4 μl of RT buffer, 2 μl of 40 U∙μl−1 MultiScribe reverse transcriptase, 2 μl of 10 mM dNTPs, 0.5 μl of 40 U∙μl−1 RNase inhibitor (Vazyme, China), and H2O-DEPC to 20 μl. The reaction mixture was incubated for 15 min at 16 °C, 1 h at 37 °C, 5 min at 85 °C and then held at 4 °C. To carry out the qRT-PCR, sample cDNA was amplified in 96-well optical reaction plates (Invitrogen) containing 2 μl of cDNA, 10 μl of SYBR Green I dye (TAKARA, China), 0.5 μl of primers (stem-loop forward primer: URP: H2O DEPC = 1:1:3) for miR223 or 1 μl of primers (forward and reverse primers) for keap1, and H2O-DEPC to 20 μl. The PCR thermal cycling (qTOWER 3 G, analytikjena, Germany) was performed as follows: 5 min at 95 °C followed by 40 cycles of 15 s at 95 °C, 20 s at 60 °C, melt curve and plate read. The fluorescence signal generated with SYBR Green I DNA dye was measured during annealing steps. Specificity of the amplification was confirmed using a melting curve analysis. The samples for qRT-PCR analysis were evaluated using a single predominant peak as a quality control. Comparative Ct (2-ΔΔCt) method was used to analyze the relative expression of miR-223 or keap1 which was normalized to U6 or β-actin [28].
2.10. Statistical analysis Results were expressed as the mean ± standard error of the mean (SEM). Statistical analysis was performed by ANOVA with Dunnett’s post hoc test. Difference was considered significant at p < 0.05. 3. Results 3.1. High glucose induced insulin signaling impair and oxidative stress in HepG2 Cells Insulin resistance in hepatocytes mainly causes impaired insulin signaling and decreased glucose uptake, which is the major contribution to hyperglycaemia. Treatment of HepG2 cells with high glucose triggers a significant reduction of insulin signaling and oxidative stress [26,27]. In order to establish an in vitro insulin resistant model of HepG2 cells and evaluate the effects of time course of high glucose on glucose metabolism in the cell model, HepG2 cells were incubated with 30 mM of glucose for 0–24 h. As shown in Fig. 1A and B, glucose consumption under insulin stimulation was significantly decreased from 1 h, down to the minimum at 12 h, and the tyrosine phosphorylated IRS1 was also reduced at 12 and 24 h. High glucose consumption also increased ROS production from 1 h, up to the peak at 12 h (Fig. 1C). 3.2. Cell viability and proliferation HepG2 cells were exposed to a serious of concentrations of EA (1–200 μM) for 24 h to determine their potential effects on cell viability. Treatment of HepG2 cells for 24 h with EA did not evoke significant changes in cell viability, as determined by the MTT assay (Fig. 2A), indicating that the concentrations selected for the study did not damage cell integrity during the period of incubation.
2.9. Western blot analysis Cell lysates of HepG2 cells were prepared in cell lysis buffer (Beyotime Institute of Biotechnology, Haimen, China) containing 0.1 mM of PMSF, and then centrifuged at 3000 g for 15 min at 4 °C. These supernatant samples were centrifuged again at 12,000 g for 20 min at 4 °C, respectively. After resolution of sample protein (equal loading for each sample) by 10% SDS-PAGE, the protein was electrophoretically transferred onto polyvinylidene difluoride membranes (Millipore, Bedford, MA, USA). The primary antibodies used in this study included: anti-phospho-IRS-1 (Tyr895) (#3070S), anti-IRS-1 (#2382S), anti-ERK (#9102), anti-phospho-ERK (#9101), anti-Akt (#9272), anti-phospho-Akt (#9271), anti-Nrf2 (#12721S) and anti-βactin (#4970) purchased from Cell Signaling Technology (Beverly, MA, USA); anti-keap1 (sc-365626), SOD1 (sc-101523), anti-HO-1 (sc136256) purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA); anti-SOD2 (24127-1-AP) purchased from Proteintech Group (Chicago, USA). Bots were incubated overnight at 4 °C in primary
3.3. EA prevented high glucose induced insulin resistance in HepG2 cells IRS1, belonging to insulin receptor substrates (IRSs) family which connects insulin receptor activation to essential downstream insulin signaling protein kinase B (Akt) and extracellular signal-regulated kinases (ERK) pathway activation [31]. Compared to control group cells, 30 mM of glucose exposure for 12 h significantly decreased glucose consumption and reduced phosphorylation of IRS1 at tyrosine site, Akt and ERK in HepG2 cells (Fig. 2B and C). EA (15, 30 μM) and Met (150 μM) significantly elevated glucose consumption and increased phosphorylation of IRS1, Akt and ERK in high glucose-exposed HepG2 87
Biomedicine & Pharmacotherapy 110 (2019) 85–94
X. Ding et al.
Fig. 1. High glucose induced insulin resistant and ROS over production in HepG2 cells. (A and B) Time course of glucose consumption (n = 8) and IRS-1 tyrosine phosphorylation under insulin (100 nM) stimulated in HepG2 cells incubated with 30 mM of glucose for 0–24 h. (C) Time course of ROS production in HepG2 cells incubated with 30 mM of glucose for 0–24 h (n = 8). Data are expressed as mean ± SEM. +P < 0.05, ++P < 0.01, ++ +P < 0.001 versus Normal cell control.
keap1-MT, there is no statistical difference with respect to the control group, these data suggested miR-223 target keap1 (Fig. 5B). Furthermore, HepG2 cells were transiently transfected with miR-223 mimic or inhibitor for 24 h. The efficiency of miR-223 mimic or inhibitor transfection was detected by qRT-PCR. It turned out that the endogenous miR-223 expression was upregulated in miR-223 mimic transfectedHepG2 cells and the reduction of keap1 protein level was observed as expected (Fig. 5A and B). The significant decrease of miR-223 expression and increase of keap1 protein level was observed in miR-223 inhibitor transfected HepG2 cells (Fig. 5C and D). These observations indicated that miR-223 expression might partly control the protein level of keap1 in HepG2 cells. Since high-glucose provokes oxidative stress and insulin resistance, and miR-223 and its target keap1/Nrf2 may be involved in, the effect of EA, miR-223 mimic and inhibitor transfection on oxidative stress and insulin resistance in HepG2 cells under high-glucose concentration was analyzed. Transfection with miR-223 mimic partly abolished high glucose-induced upregulation of keap1 protein level, elevated Nrf2, SOD1, SOD2, HO-1, p-IRS1, p-Akt and p-ERK protein levels, as well as reversed ROS and O2%− overproduction in HepG2 cells (Fig. 6A–D). On the other hand, transfection of miR-223 inhibitor partly aggravated high glucose-induced dysregulation of keap1, Nrf2, SOD1, SOD2, HO-1, p-IRS1, p-Akt and p-ERK, as well as ROS and O2%− overproduction in HepG2 cells (Fig. 7A–D). These observations indicated that miR-223 might partly mediate keap1-Nrf2 system-dependent oxidative stress and insulin signaling impairment in high glucose-exposed HepG2 cells. In miR-223 mimic transfected HepG2 cells, EA or Met remarkably abolished high glucose-induced keap1/Nrf2 pathway dysregulation, oxidative stress and insulin resistance in HepG2 cells (Fig. 6A–D). Of note, transfection with miR-223 inhibitor partially prevented EA or Met-mediated regulation of keap1, Nrf2, SOD, HO-1 and p-IRS1, as well as ROS overproduction in HepG2 cells under high glucose condition (Fig. 7A–D). These data demonstrated that EA might upregulate miR223 expression to partly alleviate high glucose-induced dysregulation of keap1-Nrf2 system in HepG2 cells.
cells (Fig. 2B and C). 3.4. EA ameliorated high glucose induced oxidative stress in HepG2 cells via keap1-Nrf2 system To test the protective effect of EA on HepG2 cells submitted to oxidative stress, HepG2 cells were cultured with or without 30 mM of glucose, EA (15 and 30 μM) and Met (150 μM) for 12 h, subsequently, O2%− and ROS production, MDA level and SOD activity were evaluated, respectively. From the results, O2%− production was distinctly raised in high glucose treated HepG2 cells compared with control group cells, as well as ROS production in vehicle group (Fig. 3A and B). What’s more, a significant increase of MDA level and a remarkable decrease of SOD activity was observed in high glucose-exposed HepG2 cells compared with control group cells (Fig. 3C and D). EA decreased ROS and O2%− production, downregulated MDA level and increased SOD activity in high glucose-exposed HepG2 cells, as shown in Fig. 3A–D. Time course of keap1 and Nrf2 protein levels throughout the high glucose treatment were also analyzed in Fig. 4A. Keap1 protein level was increased but Nrf2 protein level was decreased within 12 h after exposure to 30 mM of glucose. Furthermore, the elevated protein level of keap1 and the decreased protein levels of Nrf2, HO-1, SOD1 and SOD2 were also observed in high glucose-incubated HepG2 cells (Fig. 4B). Above situation was reversed by EA and Met, indicating their similar activity in regulation of keap1-Nrf2 system in HepG2 cells under high glucose condition. 3.5. EA ameliorated oxidative stress and insulin resistance via miR-223/ keap1-Nrf2 pathway in HepG2 under high glucose condition Searching TargetScan database revealed putative miR-223 binding sites on the 3′-UTR of keap1 mRNA. In addition, miR-223 expression was downregulated in high glucose-exposed HepG2 cells (Fig. 4C). EA and Met both effectively upregulated miR-223 expression in HepG2 cells under high glucose condition (Fig. 4D). What’s more, the mRNA expression level was increased in high glucose-exposed HepG2 cells, which was reversed by EA and Met (Fig. 5A). To address whether miR223 targets keap1, the whole 3′-UTR sequence from human keap1 mRNA or the sequence which deleted the seed region were inserted into pEZX-FR02 luciferase reporter vector. As shown in Fig. 5A, when miR223 was co-transfected with keap1-WT, it significantly reduced the luciferase activity, however, when miR-223 was co-transfected with
4. Discussion DM has emerged as a major threat to health worldwide, and over 90% of people with diabetes have T2DM [32]. Patients with T2DM have an increased risk of chronic liver disease, including non-alcoholic fatty liver disease and steatohepatitis, and about one-third of cirrhotic 88
Biomedicine & Pharmacotherapy 110 (2019) 85–94
X. Ding et al.
Fig. 2. EA improved insulin resistance in high glucose-exposed HepG2 cells. (A) Cell viability of HepG2 cells in different concentrations of EA from 0 to 200 μM for 24 h. (B) Glucose consumption of HepG2 cells incubated with or without 30 mM of glucose, EA (15, 30 μM) or Met (150 μM) for 12 h, following 15 min stimulate of insulin (100 nM) (n = 8). (C) Protein levels of p-IRS1, p-Akt and p-ERK in HepG2 cells incubated with or without 30 mM of glucose, EA (15, 30 μM) or Met (150 μM) for 12 h, following 15 min stimulate of insulin (100 nM). Data are expressed as mean ± SEM. +p < 0.05, ++p < 0.01, +++p < 0.001 versus normal cell group. *p < 0.05, **p < 0.01, ***p < 0.001 versus glucose-vehicle cell group.
oxidative stress is a deleterious factor leading to insulin resistance in T2DM [6]. Oxidative stress plays the major role in the association with the insulin resistance pathogenesis by insulin signals disruption. Research has shown that Nrf2 depletion increases blood glucose level, worsens glucose intolerance and impairs insulin signaling [11]. Decreased phosphorylation in the insulin signaling pathway is a hallmark of insulin resistance. IRS1 is the key target of the insulin receptor tyrosinekinase and is required for hormonal control of metabolism [33], which transduces downstream enzymes, such as Akt and ERK. Decreased IRS-1 phosphorylation at tyrosinesite has been observed in liver of T2DM [34]. In keeping with previous studies, we observed elevated keap1 protein level, suppressed Nrf2 protein level, as well as reduced HO-1, SOD1 and SOD2 protein levels in this cell model. Insulin signaling impairment was also found in this study, showing as the decreased IRS1, Akt and ERK phosphorylation. In vitro studies and in animal models, antioxidants have been shown to improve insulin sensitivity. Several clinical trials have demonstrated that treatment with antioxidants improves insulin sensitivity in insulin-resistant individuals [37]. EA has been demonstrated to have unusually versatile for protecting against oxidative stress in multiple diseases including UVA
patients have diabetes [33]. Due to their biological properties, polyphenols may be appropriate nutraceuticals and supplementary treatments for various aspects of DM. There is accumulating evidence suggesting the antidiabetic activity of polyphenols [20,34]. Consolidated data have confirmed that EA is a potent natural polyphenolic antioxidant with beneficial effects in DM and metabolic syndrome [21,34]. In the present study, the principal findings are as follows: 1. EA ameliorates insulin resistance and oxidative stress in high glucose-induced T2DM HepG2 cells. 2. EA activates keap1-Nrf2 system to improve oxidative stress in this cell model. 3. EA may elevate miR-223 to suppress keap1 and activate Nrf2 and the downstream proteins, which may be the possible mechanism of EA treatment for liver injury in T2DM. Keap1-Nrf2 system, acts as a key regulator for protecting against ROS, RNS, and electrophiles [35], plays an important role in oxidative stress response and metabolism, as well as in prevention of DM [12].The release of reactive oxygen species (ROS) and the generation of oxidative stress, which has been proven as results of long-term high glucose and mediate diabetic complications, are considered critical factors for the pathogenesis of T2DM [8,36]. Playing a key role in the pathogenesis of micro- and macrovascular diabetic complications, 89
Biomedicine & Pharmacotherapy 110 (2019) 85–94
X. Ding et al.
Fig. 3. EA alleviated oxidative stress in high glucose-exposed HepG2 cells. (A and B) O2%− and ROS production in HepG2 cells incubated with or without 30 mM of glucose, EA (15, 30 μM) or Met (150 μM) for 12 h detected by DHE labeling and quantitative immunofluoresce of H2DCF-DA labeling (n = 8), respectively. (C and D) MDA level and SOD activity in HepG2 cells incubated with or without 30 mM of glucose, EA (15, 30 μM) or Met (150 μM) for 12 h (n = 8). Data are expressed as mean ± SEM. +p < 0.05, ++p < 0.01 versus normal cell group. *p < 0.05, **p < 0.01, ***p < 0.001 versus glucose-vehicle cell group.
induced apoptosis [38], cyclosporine A-induced testicular and spermatozoal damages [39], high-carbohydrate, high-fat diet-induced metabolic syndrome [34] and streptozotocin-induced DM [21]. EA has also
been confirmed to reduce high glucose-induced vascular oxidative stress [40]. We also observed the amelioration of oxidative stress by EA in high glucose-exposed HepG2 cells. EA reduced ROS and O2%−
Fig. 4. Ellagic activate keap1-Nrf2 system and upregulated miR-223 levels in high glucose-exposed HepG2 cells. (A) Keap1 and Nrf2 protein levels in HepG2 cells incubated with 30 mM of glucose for 0–24 h. (B) Keap1, Nrf2, HO-1, SOD1 and SOD2 protein levels in HepG2 cells incubated with or without 30 mM of glucose, EA (15, 30 μM) or Met (150 μM) for 12 h. (C) Relative miR-223 mRNA level in HepG2 cells incubated with 30 mM of glucose for 0–24 h (n = 5). (D) Relative miR-223 mRNA levels in HepG2 cells incubated with or without 30 mM of glucose, EA (15, 30 μM) or Met (150 μM) for 12 h (n = 5). Data are expressed as mean ± SEM. +p < 0.05, ++p < 0.01, +++p < 0.001 versus normal cell group. *p < 0.05, **p < 0.01, ***p < 0.001 versus glucose-vehicle cell group. 90
Biomedicine & Pharmacotherapy 110 (2019) 85–94
X. Ding et al.
Fig. 5. miR-223 target keap1 in HepG2 cells. (A) keap1 mRNA expression (n = 5) in HepG2 cells incubated with or without 30 mM of glucose, EA (15, 30 μM) or Met (150 μM) for 12 h. (B) HepG2 cells transiently transfected with pEZX-FR02 luciferase reporter vector of keap1-WT or keap1-MT together with either 50 nM miR-223 mimic or control mimic for 48 h. Relative luciferase activity was measured and normalized by renilla luciferase activity (n = 6). (C and D) miR-223 expression (n = 5) and keap1 protein level in HepG2 cells transfected with miR-223 mimic (50 nM) or the negative control (50 nM) for 24 h. (E and F) miR-223 expression (n = 5) and keap1 protein level in HepG2 cells transfected with miR-223 inhibitor (50 nM) or the negative control (50 nM) for 24 h. Data are expressed as mean ± SEM. ++p < 0.01, +++p < 0.001 versus normal cell group, **p < 0.01 versus glucose-vehicle cell group.
These findings suggest the possibility that keap1/Nrf2 may be regulated by some miRNAs in high glucose-exposed HepG2 cells. As a potential liver biomarker of T2DM, miR-223 is predicted to bind the 3′UTR site of keap1 by the algorithm targetscan. Of note, knockout of miR-223 exhibits an increased severity of systemic insulin resistance [19]. Therefore, we focused on the role of miR-223 in insulin signaling and oxidative stress in high glucose-exposed HepG2 cells and whether miR-223 exert the effect on oxidative stress through targeting keap1. In La Sala’s research, the association of microRNA21 with oscillating and high glucose and early mitochondrial dysfunction was demonstrated, and microRNA21 may promote the suppression of homeostatic signalling that normally limits ROS damage [29], which was of great help to us. Referencing to this research, we confirmed that miR-223 binds the
production, downregulated MDA level, and upregulated SOD activity in this cell model. Previous studies have shown that EA ameliorates UVAinduced oxidative stress via adjustment of keap1-Nrf2 system in human keratinocyte cells [38] and improves oxidant-induced endothelial dysfunction and atherosclerosis via activation of Nrf2 in mice [41]. Notably, the antioxidant potential of EA was directly correlated with the increased expression of HO-1, SOD1 and SOD2, which was followed by the downregulation of Keap1 and upregulation of Nrf2 in high glucoseexposed HepG2 cells. There is ample evidence that miRNAs are associated with the progress of DM and T2DM [16,42,43], including oxidative stress in DM [17]. In addition, studies have confirmed that keap1-Nrf2 system could be controlled by miRNAs in different metabolic disorders [44,45]. 91
Biomedicine & Pharmacotherapy 110 (2019) 85–94
X. Ding et al.
Fig. 6. EA increases miR-223 expression to activated keap1-Nrf2 system in high glucose-exposed HepG2 cells. (A and B) Relative keap1, Nrf2, HO-1, SOD1, SOD2, pIRS1, p-Akt and p-ERK protein levels in HepG2 cells transfected with miR-223 mimic (50 nM) or its negative control (50 nM), and then incubated with or without 30 mM of glucose, EA (15, 30 μM) or Met (150 μM) for 12 h (n = 3). (C and D) O2%− and ROS production in these HepG2 cells detected by DHE labeling and quantitative immunofluoresce of H2DCF-DA labeling (n = 8), respectively. Data are expressed as mean ± SEM. ++p < 0.01, +++p < 0.001 versus normal cell control group. *p < 0.05, **p < 0.01, ***p < 0.001 versus glucose-vehicle + Control mimic cell group.
levels, as well as ROS over production, and miR-223 inhibitor aggravated these abnormalities induced by HepG2. These findings indicated that the reduced miR-223 expression may increase keap1 expression to aggravate oxidative stress and insulin resistance in this cell model. EA and Met remarkably elevated miR-223 protein level in high glucose-exposed HepG2 cells, indicating EA and Met-mediated miR-223 upregulation may contribute to their antioxidant effect in HepG2 cells under high glucose condition. To address this, we observed that EA and Met abolished high glucose-induced keap1-Nrf2 inactivation and ROS
3′UTR site of keap1 by dual luciferase reporter assay. In this study, miR223 expression was found to be downregulated, while keap1 mRNA expression was upregulated in high glucose-exposed HepG2 cells, which were consistent with keap1-Nrf2 inactivation, oxidative stress and insulin signaling impairment. Endogenous keap1 protein level in HepG2 cells was significantly upregulated by transfection of miR-223 inhibitor, but downregulated by transfection of miR-223 mimic, indicating that miR-223 regulats keap1 in HepG2 cells under normal condition. Transfection with miR-223 mimic prevented high glucose-caused elevated keap1 protein level, downregulated Nrf2, HO-1 and SOD1 protein 92
Biomedicine & Pharmacotherapy 110 (2019) 85–94
X. Ding et al.
Fig. 7. Transfection with miR-223 inhibitor partially prevents EA-mediated regulation of keap1-Nrf2 system in HepG2 cells under high glucose condition. (A and B) Relative keap1, Nrf2, HO-1, SOD1, SOD2, p-IRS1, p-Akt and p-ERK protein levels in HepG2 cells transfected with miR-223 inhibitor (50 nM) or its negative control (50 nM), and then incubated with or without 30 mM of glucose, EA (15, 30 μM) or Met (150 μM) for 12 h. (C and D) O2%− and ROS production in these HepG2 cells detected by DHE labeling and quantitative immunofluoresce of H2DCF-DA labeling (n = 8), respectively. Data are expressed as mean ± SEM. +p < 0.05, + +p < 0.01, +++p < 0.001 versus normal cell control group. *p < 0.05, **p < 0.01, ***p < 0.001 versus glucose-vehicle + Control inhibitor cell group. # p < 0.05, ##p < 0.01, ###p < 0.001 versus glucose-vehicle + miR-223 inhibitor cell group.
suppression in HepG2 cells, thereby elevates keap1 protein level to decrease Nrf2 and the following HO1, SOD1 and SOD2 protein levels, on the other hand, impairs insulin signaling in HepG2 cells, and ultimately caused oxidative stress and insulin resistance in T2DM. EA’s beneficial effect on oxidative stress and insulin resistance in high-glucose included T2DM HepG2 model was proven via miR-223/keap1Nrf2 signaling, further investigations to trace out the intimate mechanism of action are required.
overproduction in HepG2 cells after miR-223 mimic-transfection. While miR-223 inhibitor partially blocked EA and Met-mediated keap1-Nrf2 activation and ROS elimination in high-glucose-exposed HepG2 cells. These findings indicating that increasing miR-223 expression by EA and Met may protect against high glucose-induced oxidative stress and insulin resistance. 5. Conclusions In summary, this study indicates that high glucose causes miR-223 93
Biomedicine & Pharmacotherapy 110 (2019) 85–94
X. Ding et al.
Conflict of interest
[18] Q.W. Wong, R.W. Lung, P.T. Law, P.B. Lai, K.Y. Chan, K.F. To, N. Wong, MicroRNA223 is commonly repressed in hepatocellular carcinoma and potentiates expression of Stathmin1, Gastroenterology 135 (1) (2008) 257–269. [19] G. Zhuang, C. Meng, X. Guo, P.S. Cheruku, L. Shi, H. Xu, H. Li, G. Wang, A.R. Evans, S. Safe, C. Wu, B. Zhou, A novel regulator of macrophage activation: miR-223 in obesity-associated adipose tissue inflammation, Circulation 125 (23) (2012) 2892–2903. [20] Z. Bahadoran, P. Mirmiran, F. Azizi, Dietary polyphenols as potential nutraceuticals in management of diabetes: a review, J. Diabetes Metab. Disord. 12 (1) (2013) 43. [21] E. Uzar, H. Alp, M.U. Cevik, U. Firat, O. Evliyaoglu, A. Tufek, Y. Altun, Ellagic acid attenuates oxidative stress on brain and sciatic nerve and improves histopathology of brain in streptozotocin-induced diabetic rats, Neurol. Sci. 33 (3) (2012) 567–574. [22] A. Ahad, A.A. Ganai, M. Mujeeb, W.A. Siddiqui, Ellagic acid, an NF-kappaB inhibitor, ameliorates renal function in experimental diabetic nephropathy, Chem. Biol. Interact. 219 (2014) 64–75. [23] B. Baek, S.H. Lee, K. Kim, H.W. Lim, C.J. Lim, Ellagic acid plays a protective role against UV-B-induced oxidative stress by up-regulating antioxidant components in human dermal fibroblasts, Korean J. Physiol. Pharmacol. 20 (3) (2016) 269–277. [24] Z. Qiu, B. Zhou, L. Jin, H. Yu, L. Liu, Y. Liu, C. Qin, S. Xie, F. Zhu, In vitro antioxidant and antiproliferative effects of ellagic acid and its colonic metabolite, urolithins, on human bladder cancer T24 cells, Food Chem. Toxicol. 59 (2013) 428–437. [25] W.R. Garcia-Nino, C. Zazueta, Ellagic acid: pharmacological activities and molecular mechanisms involved in liver protection, Pharmacol. Res. 97 (2015) 84–103. [26] I. Cordero-Herrera, M.A. Martin, L. Goya, S. Ramos, Cocoa flavonoids attenuate high glucose-induced insulin signalling blockade and modulate glucose uptake and production in human HepG2 cells, Food Chem. Toxicol. 64 (2014) 10–19. [27] X. Zhang, J.H. Zhang, X.Y. Chen, Q.H. Hu, M.X. Wang, R. Jin, Q.Y. Zhang, W. Wang, R. Wang, L.L. Kang, J.S. Li, M. Li, Y. Pan, J.J. Huang, L.D. Kong, Reactive oxygen species-induced TXNIP drives fructose-mediated hepatic inflammation and lipid accumulation through NLRP3 inflammasome activation, Antioxid. Redox Signal. 22 (10) (2015) 848–870. [28] W. Wang, X.Q. Ding, T.T. Gu, L. Song, J.M. Li, Q.C. Xue, L.D. Kong, Pterostilbene and allopurinol reduce fructose-induced podocyte oxidative stress and inflammation via microRNA-377, Free Radic. Biol. Med. 83 (2015) 214–226. [29] L. La Sala, S. Mrakic-Sposta, S. Micheloni, F. Prattichizzo, A. Ceriello, Glucosesensing microRNA-21 disrupts ROS homeostasis and impairs antioxidant responses in cellular glucose variability, Cardiovasc. Diabetol. 17 (1) (2018) 105. [30] Y. Dong, Y. Zheng, C. Wang, X. Ding, Y. Du, L. Liu, W. Zhang, W. Zhang, Y. Zhong, Y. Wu, X. Song, MiR-876-5p modulates head and neck squamous cell carcinoma metastasis and invasion by targeting vimentin, Cancer Cell Int. 18 (2018) 121. [31] X.Q. Ding, T.T. Gu, W. Wang, L. Song, T.Y. Chen, Q.C. Xue, F. Zhou, J.M. Li, L.D. Kong, Curcumin protects against fructose-induced podocyte insulin signaling impairment through upregulation of miR-206, Mol. Nutr. Food Res. 59 (12) (2015) 2355–2370. [32] G. Thomas, K. Khunti, V. Curcin, M. Molokhia, C. Millett, A. Majeed, S. Paul, Obesity paradox in people newly diagnosed with type 2 diabetes with and without prior cardiovascular disease, Diabetes Obes. Metab. 16 (4) (2014) 317–325. [33] A.J. Scheen, Pharmacokinetics in patients with chronic liver disease and hepatic safety of incretin-based therapies for the management of type 2 diabetes mellitus, Clin. Pharmacokinet. 53 (9) (2014) 773–785. [34] S.K. Panchal, L. Ward, L. Brown, Ellagic acid attenuates high-carbohydrate, high-fat diet-induced metabolic syndrome in rats, Eur. J. Nutr. 52 (2) (2013) 559–568. [35] J.D. Hayes, A.T. Dinkova-Kostova, The Nrf2 regulatory network provides an interface between redox and intermediary metabolism, Trends Biochem. Sci. 39 (4) (2014) 199–218. [36] I. Cordero-Herrera, M.A. Martin, L. Goya, S. Ramos, Cocoa flavonoids protect hepatic cells against high-glucose-induced oxidative stress: relevance of MAPKs, Mol. Nutr. Food Res. 59 (4) (2015) 597–609. [37] A. Ceriello, E. Motz, Is oxidative stress the pathogenic mechanism underlying insulin resistance, diabetes, and cardiovascular disease? The common soil hypothesis revisited, Arterioscler. Thromb. Vasc. Biol. 24 (5) (2004) 816–823. [38] Y.C. Hseu, C.W. Chou, K.J. Senthil Kumar, K.T. Fu, H.M. Wang, L.S. Hsu, Y.H. Kuo, C.R. Wu, S.C. Chen, H.L. Yang, Ellagic acid protects human keratinocyte (HaCaT) cells against UVA-induced oxidative stress and apoptosis through the upregulation of the HO-1 and Nrf-2 antioxidant genes, Food Chem. Toxicol. 50 (5) (2012) 1245–1255. [39] G. Turk, M. Sonmez, A.O. Ceribasi, A. Yuce, A. Atessahin, Attenuation of cyclosporine A-induced testicular and spermatozoal damages associated with oxidative stress by ellagic acid, Int. Immunopharmacol. 10 (2) (2010) 177–182. [40] A. Rozentsvit, K. Vinokur, S. Samuel, Y. Li, A.M. Gerdes, M.A. Carrillo-Sepulveda, Ellagic acid reduces high glucose-induced vascular oxidative stress through ERK1/ 2/NOX4 signaling pathway, Cell. Physiol. Biochem. 44 (3) (2017) 1174–1187. [41] Y. Ding, B. Zhang, K. Zhou, M. Chen, M. Wang, Y. Jia, Y. Song, Y. Li, A. Wen, Dietary ellagic acid improves oxidant-induced endothelial dysfunction and atherosclerosis: role of Nrf2 activation, Int. J. Cardiol. 175 (3) (2014) 508–514. [42] M.R. Ashoori, M. Rahmati-Yamchi, A. Ostadrahimi, S. Fekri Aval, N. Zarghami, MicroRNAs and adipocytokines: promising biomarkers for pharmacological targets in diabetes mellitus and its complications, Biomed. Pharmacother. 93 (2017) 1326–1336. [43] C. Zhang, D. Qian, H. Zhao, N. Lv, P. Yu, Z. Sun, MiR17 improves insulin sensitivity through inhibiting expression of ASK1 and anti-inflammation of macrophages, Biomed. Pharmacother. 100 (2018) 448–454. [44] J.J. Yang, H. Tao, W. Hu, L.P. Liu, K.H. Shi, Z.Y. Deng, J. Li, MicroRNA-200a controls Nrf2 activation by target Keap1 in hepatic stellate cell proliferation and fibrosis, Cell. Signal. 26 (11) (2014) 2381–2389. [45] S. Kabaria, D.C. Choi, A.D. Chaudhuri, M.R. Jain, H. Li, E. Junn, MicroRNA-7 activates Nrf2 pathway by targeting Keap1 expression, Free Radic. Biol. Med. 89 (2015) 548–556.
The authors declare no conflict of interest. Acknowledgements This study was supported by the National Natural Science Foundation of China (No. 81773885; No. 31770366; No. 81703224), Jiangsu Province and Technology Modern Agricultural Plan (No. BE2016383), Jiangsu Research and development center for Medicinal Plants (Institute of Botany, Jiangsu Province and Chinese Academy of Sciences) (YY201401) and Jiangsu Key Laboratory for the Research and Utilization of Plant Resources (No. JSPKLB201825; No. JSPKLB201833). Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.biopha.2018.11.018. References [1] C.P. Domingueti, L.M. Dusse, M. Carvalho, L.P. de Sousa, K.B. Gomes, A.P. Fernandes, Diabetes mellitus: the linkage between oxidative stress, inflammation, hypercoagulability and vascular complications, J. Diabetes Comp. 30 (4) (2016) 738–745. [2] G.S. Andersen, T. Thybo, H. Cederberg, M. Oresic, M. Esteller, A. Zorzano, B. Carr, M. Walker, J. Cobb, C. Clissmann, D.J. O’Gorman, J.J. Nolan, D. Consortium, The DEXLIFE study methods: identifying novel candidate biomarkers that predict progression to type 2 diabetes in high risk individuals, Diabetes Res. Clin. Pract. 106 (2) (2014) 383–389. [3] C. Emerging Risk Factors, N. Sarwar, P. Gao, S.R. Seshasai, R. Gobin, S. Kaptoge, E. Di Angelantonio, E. Ingelsson, D.A. Lawlor, E. Selvin, M. Stampfer, C.D. Stehouwer, S. Lewington, L. Pennells, A. Thompson, N. Sattar, I.R. White, K.K. Ray, J. Danesh, Diabetes mellitus, fasting blood glucose concentration, and risk of vascular disease: a collaborative meta-analysis of 102 prospective studies, Lancet 375 (9733) (2010) 2215–2222. [4] S. Rao Kondapally Seshasai, S. Kaptoge, A. Thompson, E. Di Angelantonio, P. Gao, N. Sarwar, P.H. Whincup, K.J. Mukamal, R.F. Gillum, I. Holme, I. Njolstad, A. Fletcher, P. Nilsson, S. Lewington, R. Collins, V. Gudnason, S.G. Thompson, N. Sattar, E. Selvin, F.B. Hu, J. Danesh, C. Emerging Risk Factors, Diabetes mellitus, fasting glucose, and risk of cause-specific death, N. Engl. J. Med. 364 (9) (2011) 829–841. [5] D. Garcia-Compean, J.O. Jaquez-Quintana, J.A. Gonzalez-Gonzalez, H. MaldonadoGarza, Liver cirrhosis and diabetes: risk factors, pathophysiology, clinical implications and management, World J. Gastroenterol. 15 (3) (2009) 280–288. [6] S. Tangvarasittichai, Oxidative stress, insulin resistance, dyslipidemia and type 2 diabetes mellitus, World J. Diabetes 6 (3) (2015) 456–480. [7] E.J. Henriksen, M.K. Diamond-Stanic, E.M. Marchionne, Oxidative stress and the etiology of insulin resistance and type 2 diabetes, Free Radic. Biol. Med. 51 (5) (2011) 993–999. [8] K. Maiese, New insights for oxidative stress and diabetes mellitus, Oxid. Med. Cell. Longev. 2015 (2015) 875961. [9] H. Raza, A. John, F.C. Howarth, Increased oxidative stress and mitochondrial dysfunction in zucker diabetic rat liver and brain, Cell. Physiol. Biochem. 35 (3) (2015) 1241–1251. [10] W.N. Wan Hasan, M.K. Kwak, S. Makpol, W.Z. Wan Ngah, Y.A. Mohd Yusof, Piper betle induces phase I & II genes through Nrf2/ARE signaling pathway in mouse embryonic fibroblasts derived from wild type and Nrf2 knockout cells, BMC Complement. Altern. Med. 14 (2014) 72. [11] A. Uruno, Y. Yagishita, M. Yamamoto, The Keap1-Nrf2 system and diabetes mellitus, Arch. Biochem. Biophys. 566 (2015) 76–84. [12] A. Uruno, Y. Furusawa, Y. Yagishita, T. Fukutomi, H. Muramatsu, T. Negishi, A. Sugawara, T.W. Kensler, M. Yamamoto, The Keap1-Nrf2 system prevents onset of diabetes mellitus, Mol. Cell. Biol. 33 (15) (2013) 2996–3010. [13] H. Zheng, S.A. Whitman, W. Wu, G.T. Wondrak, P.K. Wong, D. Fang, D.D. Zhang, Therapeutic potential of Nrf2 activators in streptozotocin-induced diabetic nephropathy, Diabetes 60 (11) (2011) 3055–3066. [14] D. Dong, Y. Zhang, E.A. Reece, L. Wang, C.R. Harman, P. Yang, microRNA expression profiling and functional annotation analysis of their targets modulated by oxidative stress during embryonic heart development in diabetic mice, Reprod. Toxicol. 65 (2016) 365–374. [15] Y. Song, D. Jin, X. Jiang, C. Lv, H. Zhu, Overexpression of microRNA-26a protects against deficient beta-cell function via targeting phosphatase with tensin homology in mouse models of type 2 diabetes, Biochem. Biophys. Res. Commun. 495 (1) (2018) 1312–1316. [16] H. Zhu, S.W. Leung, Identification of microRNA biomarkers in type 2 diabetes: a meta-analysis of controlled profiling studies, Diabetologia 58 (5) (2015) 900–911. [17] M. Yu, Y. Liu, B. Zhang, Y. Shi, L. Cui, X. Zhao, Inhibiting microRNA-144 abates oxidative stress and reduces apoptosis in hearts of streptozotocin-induced diabetic mice, Cardiovasc. Pathol. 24 (6) (2015) 375–381.
94