Embryonic Stem Cell-Specific MicroRNAs

Developmental Cell, Vol. 5, 351–358, August, 2003, Copyright 2003 by Cell Press

Embryonic Stem Cell-Specific MicroRNAs

Hristo B. Houbaviy,1 Michael F. Murray,1 and Phillip A. Sharp1,2,* 1 Center for Cancer Research 2 The McGovern Institute for Brain Research and Department of Biology Massachusetts Institute of Technology 77 Massachusetts Avenue Cambridge, Massachusetts 02139

Summary We have identified microRNAs (miRNAs) in undifferentiated and differentiated mouse embryonic stem (ES) cells. Some of these appear to be ES cell specific, have related sequences, and are encoded by genomic loci clustered within 2.2 kb of each other. Their expression is repressed as ES cells differentiate into embryoid bodies and is undetectable in adult mouse organs. In contrast, the levels of many previously described miRNAs remain constant or increase upon differentiation. Our results suggest that miRNAs may have a role in the maintenance of the pluripotent cell state and in the regulation of early mammalian development. Introduction Cloning of short, 20–24 nt RNAs from a variety of sources identified a family of RNA species designated as microRNAs (miRNAs) (Dostie et al., 2003; Lagos-Quintana et al., 2001, 2002, 2003; Lau et al., 2001; Lim et al., 2003a, 2003b; Llave et al., 2002a; Mourelatos et al., 2002; Reinhart et al., 2002). Over 200 distinct miRNAs have been discovered experimentally, and additional ones have been identified via computational approaches (Lim et al., 2003a, 2003b). miRNAs are structurally and functionally related to the short interfering RNAs (siRNA) that cause RNA silencing (Elbashir et al., 2001a, 2001b; Hamilton and Baulcombe, 1999; Hammond et al., 2000; Zamore et al., 2000). Both miRNAs and siRNAs are produced by the RNase III nuclease Dicer, and both depend on the PAZ/PIWI domain (PPD) proteins for function and/or stability (Grishok et al., 2001; Hutvagner et al., 2001). miRNAs silence gene expression by repressing translation or by directing the degradation of mRNA. For example, miRNAs encoded by the C. elegans genes lin-4 and let-7 (Lee et al., 1993; Reinhart et al., 2000) bind to partially complementary sites within their mRNA targets and cause translational repression (Olsen and Ambros, 1999; Slack et al., 2000). However, the let-7 miRNA can cause mRNA degradation in vitro if a perfectly complementary target site is present (Hutvagner and Zamore, 2002), and, similarly, many plant miRNAs cleave mRNA in vivo and in vitro (Llave et al., 2002b; Tang et al., 2003; Xie et al., 2003). An important biological function of some miRNAs is *Correspondence: [email protected]

the regulation of development. In plants, miRNAs have a striking propensity to target transcription factors involved in development (Rhoades et al., 2002), in C. elegans, mutations in lin-4 and let-7 cause heterochronic phenotypes (Lee et al., 1993; Olsen and Ambros, 1999; Reinhart et al., 2000), and, in D. melanogaster, the miRNA encoded by the gene bantam is temporally and spatially expressed during development to control cell proliferation and apoptosis (Brennecke et al., 2003). A survey of miRNAs cloned from mouse organs revealed that many were organ specific, consistent with roles in development (Lagos-Quintana et al., 2002, 2003). Embryonic stem (ES) cells are totipotent cell lines derived from the inner cell mass (ICM) of the mammalian blastocyst (Smith, 2001). In vitro differentiation of ES cells recapitulates some of the global genomic methylation that takes place shortly after implantation and has been used to study the epigenetic events that accompany X chromosome inactivation during midblastula (Wutz and Jaenisch, 2000). To elucidate the roles of miRNAs during these early developmental transitions, we cloned short, 20–26 nt RNAs from undifferentiated and differentiated ES cells. Results and Discussion miRNA Libraries from Undifferentiated and Differentiated ES Cells We constructed miRNA libraries from three different sources: (1) ES cells grown on a feeder layer of irradiated mouse embryonic fibroblasts (MEF) and in the presence of 500 U/ml leukemia inhibitory factor (LIF) (library L1), (2) ES cells grown in the absence of feeders and in the presence of 1000 U/mL LIF (library L2), and (3) differentiated ES cells maintained for 4 days in media containing 100 nmol/l all-trans-retinoic acid (RA) and no LIF (library L3). While library L1 could potentially be contaminated by MEF-derived miRNA sequences, the corresponding culture should contain the highest fraction of undifferentiated ES cells. Conversely, while some differentiation may have occurred in the cell population used to generate library L2, it should not contain MEF-derived sequences. Finally, the sequences of miRNAs induced during ES cell differentiation should be present in library L3. To assess the degree of differentiation, we determined the steady-state levels of Oct4 mRNA by Northern analysis, and the distribution of alternatively spliced isoforms of the ␣6-integrin mRNA was analyzed by RT-PCR (Figure 1). Oct4 is dramatically downregulated during differentiation (Rosner et al., 1990), and there are quantitative shifts among the splicing isoforms of the ␣6-integrin (Cooper et al., 1991). ES cells grown with and without feeders were indistinguishable by both criteria—they expressed high levels of Oct4 mRNA and the short isoform of the ␣6-integrin message (Figure 1, lanes 1 and 2). In contrast, after 4 days of growth in the presence of RA, the Oct4 mRNA levels decreased more than 5-fold (Figure 1A, compare lanes 1 and 2 with lane 3), and the culture began to express the long isoform of the ␣6integrin mRNA, consistent with differentiation (Figure

Developmental Cell 352

Figure 1. Molecular Markers of Undifferentiated and Differentiated ES Cell Cultures (A) Northern analyses of the expression of Oct4 (top) and the ␤-actin mRNA (middle) and 18S rRNA (bottom) loading controls in undifferentiated ES cells grown with (lane 1) and without (lane 2) a feeder layer and in ES cells differentiated with RA in monolayer for 4 days (lane 3) or 14 days as embryoid bodies without (lane 4) and with RA (lane 5). (B) Expression of ␣6-integrin mRNA isoforms analyzed by RT-PCR. Bands corresponding to the alternatively spliced variants are indicated by arrows. Lanes 1–5 correspond to lanes 1–5 in (A). Lanes 6 and 7 correspond to samples prepared from NIH/3T3 cells and the MEF feeders, respectively.

1B, lane 3). Moreover, both markers had similar expression patterns in the RA-induced monolayer culture and in embryoid bodies after 14 days of differentiation (Figure 1, lanes 3–5). Thus, both undifferentiated ES cell cultures contained a significant proportion of totipotent ES cells, and most cells underwent differentiation in monolayer upon treatment with RA. Data Analysis and Identification of miRNAs A total of 681 short RNA clones were isolated and sequenced, of which 192 were from L1, 219 were from L2, and 270 were from L3. The data from the three libraries were pooled, and multiple instances of the same sequence were assigned to the longest clone. This resulted in a nonredundant dataset comprised of 388 short RNAs. Most sequences (73%) were observed only once. Thus, the dataset probably does not represent the complete pool of short RNAs present in undifferentiated and differentiated ES cells. In the final nonredundant dataset, a total of 179 clones (46%) were between 20 and 24 nt long, as expected for Dicer cleavage products (Elbashir et al., 2001b; Zamore et al., 2000). Of these 37 matched known rRNA and tRNA sequences. To distinguish miRNAs from degradation products and potential siRNAs, we evaluated the ability of RNA corresponding to the genomic sequences surrounding the above 179 nonredundant clones to fold into potential hairpin miRNA precursors. This criterion, together with phylogenetic conservation of the hairpin fold, is now generally accepted as good evidence for the existence of an miRNA (Ambros et al., 2003; Lim et al., 2003a, 2003b). The 53 candidate miRNAs that formed hairpins

with flanking sequences are listed in Table 1. These constitute 30% of the nonredundant clones in the 20–24 nt range. We do not know whether any of the remaining 20–24 nt sequences are siRNAs. Database searches did not reveal clones derived from annotated mRNAs. None of the sequences match the mouse centromeric minor satellite, whose S. pombe counterpart has been implicated in siRNA-mediated heterochromatin silencing (Reinhart and Bartel, 2002; Volpe et al., 2002). Similarly, none of the clones could be mapped to repetitive elements.

Novel miRNAs from ES Cells Of the 53 potential miRNA clones for which hairpin precursors could be proposed, 32 were identical to previously identified miRNAs, 5 additional clones were clear homologs of known miRNAs (miR-34a, miR-34b, miR106a, miR-106b, and miR-130b), and one (let-7d-as) was excised from the opposite side of a known miRNA hairpin precursor (Table 1). The remaining 15 sequences are unrelated to any previously described miRNAs in the RFAM database (Ambros et al., 2003) (Table 1; miR290–miR-302). Interestingly, these miRNAs are relatively poorly conserved (Table 1). While hairpin folds corresponding to most of them could be found in other mammalian genomes, i.e., human and rat, only one (miR-301) had a conserved hairpin in the fish Fugu rubripes, and none had homologs in invertebrates. One of the above clones, miR-297, was identical to 20 genomic segments and varied by one position from 81 other loci. These sites overlapped annotated (CA)n,

ES Cell-Specific MicroRNAs 353

Table 1. miRNAs from Undifferentiated and Differentiated ES Cells Observationsc

Conservationg

Lengthd

IDa

Sequenceb

L1 L2 L3 Average Maximum Minimum Rmsd Hitse Expressionf Hs Rn Fr

let-7d-as miR-34a miR-34b miR-106a miR-106b miR-130b miR-290 miR-291-s miR-291-as miR-292-s miR-292-as miR-293 miR-294 miR-295 miR-296 miR-297 miR-298 miR-299 miR-300 miR-301 miR-302 let-7c miR-15a miR-15b miR-16 miR-18 miR-19b miR-20 miR-21 miR-22 miR-24 miR-27a miR-29a miR-29b miR-30e miR-31 miR-92 miR-93 miR-94 miR-96 miR-99b miR-124-a miR-127 miR-130 miR-141a miR-142s miR-142-as miR-143a miR-172 miR-183 miR-193 miR-199-s miR-199-as

CUAUACGACCUGCUGCCUUUCU AGGCAGUGUAGUUAGCUGAUUGC UAGGCAGUGUAAUUAGCUGAUUG CAAAGUGCUAACAGUGCAGGUA UAAAGUGCUGACAGUGCAGAU CAGUGCAAUGAUGAAAGGGCAU CUCAAACUAUGGGGGCACUUUUU CAUCAAAGUGGAGGCCCUCUCU AAAGUGCUUCCACUUUGUGUGCC ACUCAAACUGGGGGCUCUUUUG AAGUGCCGCCAGGUUUUGAGUGU AGUGCCGCAGAGUUUGUAGUGU AAAGUGCUUCCCUUUUGUGUGU AAAGUGCUACUACUUUUGAGUCU AGGGCCCCCCCUCAAUCCUGU AUGUAUGUGUGCAUGUGCAUG GGCAGAGGAGGGCUGUUCUUCC UGGUUUACCGUCCCACAUACAU UAUGCAAGGGCAAGCUCUCUUC CAGUGCAAUAGUAUUGUCAAAGC UAAGUGCUUCCAUGUUUUGGUGA UGAGGUAGUAGGUUGUAUGGUUA UAGCAGCACAUAAUGGUUUGUG UAGCAGCACAUCAUGGUUUAC UAGCAGCACGUAAAUAUUGGCG UAAGGUGCAUCUAGUGCAGAUA UGUGCAAAUCCAUGCAAAACUGA UAAAGUGCUUAUAGUGCAGGUAG UAGCUUAUCAGACUGAUGUUGAC AAGCUGCCAGUUGAAGAACUGU UGGCUCAGUUCAGCAGGAACAG UUCACAGUGGCUAAGUUCCGC UAGCACCAUCUGAAAUCGGUUA UAGCACCAUUUGAAAUCAGUGUU UGUAAACAUCCUUGACUGGAAGC AGGCAAGAUGCUGGCAUAGCUG UAUUGCACUUGUCCCGGCCUG CAAAGUGCUGUUCGUGCAGGUAG UAAAGUGCUGACAGUGCAGAU UUUGGCACUAGCACAUUUUUGCU CACCCGUAGAACCGACCUUGCG UAAGGCACGCGGUGAAUGCCA UCGGAUCCGUCUGAGCUUGGCUA CAGUGCAAUGUUAAAAGGGCAU UAACACUGUCUGGUAAAGAUGGCC CCCAUAAAGUAGAAAGCACUA UGUAGUGUUUCCUACUUUAUGGA UGAGAUGAAGCACUGUAGCUCUUA UGGCAGUGUCUUAGCUGGUUGUU UAUGGCACUGGUAGAAUUCAC AACUGGCCUACAAAGUCCCAGU CCCAGUGUUCAGACUACCUGUUC ACAGUAGUCUGCACAUUGGUUA

1 1 0 0 1 1 2 1 6 1 2 4 4 3 0 0 0 0 0 0 0 3 2 1 5 1 3 2 11 1 0 1 2 5 1 2 2 2 1 0 0 2 1 5 0 1 1 1 3 0 1 3 2

a

0 0 0 1 0 0 2 1 1 1 0 1 0 0 0 0 0 0 2 0 0 0 0 0 0 1 1 1 1 0 0 0 0 0 0 0 0 1 0 0 0 1 0 3 0 0 1 0 2 0 0 0 0

0 0 1 0 0 0 1 0 0 1 0 1 2 0 1 1 1 1 0 1 1 0 2 0 2 0 1 0 10 1 1 1 0 0 0 0 4 1 0 1 1 0 0 4 2 0 0 0 2 1 0 0 0

22 23 23 22 21 22 22 23 22 22 22 22 22 22 21 21 22 22 22 23 23 22 23 21 21 21 22 22 22 22 22 21 22 23 23 22 21 22 21 23 22 20 23 22 23 21 22 24 21 21 22 22 22

22 23 23 22 21 22 23 24 23 23 23 22 23 23 21 21 22 22 23 23 23 23 23 21 22 22 23 23 23 22 22 21 22 23 23 22 22 23 21 23 22 21 23 25 24 21 23 24 23 21 22 23 22

22 23 23 22 21 22 22 22 22 21 22 21 22 22 21 21 22 22 22 23 23 21 22 21 20 21 22 22 18 22 22 21 22 22 23 22 17 22 21 23 22 20 23 22 23 21 22 24 16 21 22 22 22

0.0 0.0 0.0 0.0 0.0 0.0 0.4 1.0 0.3 0.8 0.5 0.4 0.4 0.5 0.0 0.0 0.0 0.0 0.5 0.0 0.0 0.8 0.4 0.0 0.7 0.5 0.5 0.5 1.1 0.0 0.0 0.0 0.0 0.5 0.0 0.0 1.8 0.5 0.0 0.0 0.0 0.5 0.0 0.8 0.5 0.0 0.5 0.0 2.2 0.0 0.0 0.5 0.0

1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 20 1 1 1 1 1 1 1 1 2 1 1 1 1 1 2 1 1 2 1 1 1 1 1 1 1 3 1 1 1 1 1 1 1 1 1 2 3

S00S0 00000

22221 01110 Rn 01110 01110 01220 01110 01120 01120 01110 00010 SSSS0 00000 00000 00021 00110 200S1 11121

Hs Rn Rn Hs Hs Rn

Rn Hs Hs Rn Hs Rn Rn Hs Rn Fr Hs

11121 05551 91153 91185 20021 10011 10001 10001

01120 01110 01110 S00S0

11111 000S0 00000

10010 SSSS0 S00S1 10001 20001

miRNAs experimentally determined for the first time in this study are listed first. The letters “s” and “as” designate miRNAs excised from the 5⬘’ and 3⬘ strands of the same hairpin stem respectively, according to Lagos-Quintana et al. (2002). b The longest clone that matches perfectly the mouse genomic sequence is given. c Number of observations in libraries L1, L2, and L3 d Average, maximum and minimum lengths. Rmsd, root-mean-square deviation from the average. e Number of genomic hits. f Expression patterns by Northern analysis. Single digit numbers indicate the approximate relative band intensities as shown in Figure 2 and give no information about the relative levels of different miRNAs. S indicates the presence of a smear that precluded detection of the miRNA. g For miR-290–miR-302, which do not have previously reported homologs, the presence of conserved stem loops in the human (Hs), rat (Rn), and pufferfish (Fr) genomes is indicated.

Developmental Cell 354

ES Cell-Specific MicroRNAs 355

(TG)n, SINE, B3, and B4 repeats in the ENSEMBL database. Hairpin miRNA precursors could be derived from three of these locations. While it could be argued that stem loop structures would occur by chance in (CA)n, (TG)n-rich sequences, expression data support the existence of miR-297 (discussed below). The remaining 14 potential miRNAs map to 12 distinct stem loop precursors. Two of these hairpins (miR-291 and miR-292) yield cloned RNAs corresponding to both strands of the stem (Table 1). Multiple sequence alignment revealed that six premiRNA precursors (miR-290, miR-291, miR-292, miR293, miR-294, and miR-295) have related sequences (Figure 2A). Mature miRNAs were processed from both the 5⬘ and the 3⬘ sides of these hairpins (Figure 2A; miRNA consensus sequences 5⬘-ACUCAAANUGGGG GCNCUCUUUU-3⬘ and 5⬘-AAAGUGCGC(N)2–4UUUUGA GUGU-3⬘, respectively), and clones corresponding to the 3⬘ sides were more frequently observed (Table 1). When two miRNAs are processed from the opposing strands of the same hairpin stem, it is thought that the more abundant miRNA has a biological function, whereas the less abundant species is a nonfunctional byproduct of the reaction catalyzed by Dicer (LagosQuintana et al., 2002; Lau et al., 2001). Interestingly, the above six related pre-miRNAs map in the same relative orientation within a 2.2 kb region of genomic sequence that has not been assigned a specific chromosomal location in the mouse genome assembly (Figure 2B). Thus, adjacent hairpins in the cluster may be initially synthesized as common primary transcripts (pri-miRNA) (Lee et al., 2002). Over 200 miRNAs have been cloned from mammalian cell lines and mouse organs, but none have been derived from early embryos. Therefore, the fact that miRNAs expressed from the hairpin cluster have not been observed previously strongly suggests that they are indeed ES cell specific. To obtain additional support for this conclusion, we searched the expressed sequence tag (EST) database for entries homologous to the 2.2 kb segment containing the cluster of six pre-miRNAs. Consistent with the miRNA cloning data, the top sevenscoring ESTs (score, ⱖ315, and identity, ⱖ98%) that map within this genomic segment correspond to cDNAs prepared from preimplantation embryos or ES cells (Figure 2B). ESTs derived from preimplantation embryos or ES cells constitute approximately 5% of the total mouse EST data in GenBank. ESTs from the remainder of the database aligned better elsewhere in the mouse genome and/or were homologous to multiple genomic locations (data not shown). Thus, the EST data strongly suggests that expression of the miRNA cluster is restricted to preimplantation embryos and ES cells and supports the existence of a large primary transcript encompassing several hairpins (Figure 2B).

BLAST searches identified only a single human homolog (miR-hes1, located on chromosome 19) of the six hairpins in the mouse cluster. However, systematic scanning of the genomic region adjacent to miR-hes1 for sequences that can fold into hairpins identified two additional potential human pre-miRNAs (miR-hes2 and miR-hes3) related to the members of the mouse cluster (Figures 2A and 2C). Within the corresponding human and mouse genomic segments, the pre-miRNA hairpins are the only regions with obvious sequence homology. miRNA Expression Patterns during ES Cell Differentiation To confirm expression of miRNAs, we performed Northern analyses on samples from undifferentiated and differentiated ES cell cultures (Figure 3A, lanes 2–4 in all panels) as well as from the MEF feeder layer and NIH/ 3T3 cells (Figure 3A, lanes 1 and 5, respectively). A total of 39 (74%) of the miRNAs shown in Table 1 were analyzed. Of these, 30 gave robust bands migrating as RNA of approximately 20–24 nt in at least one lane (Figure 3A and Table 1). The rest either showed no detectable signal or a smear that made it difficult to determine whether a discrete band was present. Of the 15 clones unrelated to previously described miRNAs, we confirmed the expression of 11 by Northern analysis, including at least 1 mature miRNA from each of the 6 clustered hairpins (Figure 3A and Table 1). Three of the remaining four clones could not be detected (miR-298, miR-299, and miR-300), and one other clone (miR-291-s) was not tested. Northern analyses showed that miR-29a, miR-29b, miR-193, miR-199-s, and miR-199-as were detectable only in the MEFs and NIH/3T3 cells, but not in undifferentiated or differentiated ES cell cultures (Table 1 and data not shown). Thus, library L1 did contain some MEF sequence contamination. miRNAs processed from the hairpin cluster (miR-290, miR-291-as, miR-292-as, miR-293, miR-294, and miR295) were expressed in ES cells grown with feeders, ES cells grown without feeders, and ES cells differentiated for 4 days in monolayer in the presence of RA, but not in MEFs or NIH/3T3 cells (Figure 3A and Table 1). More importantly, these miRNAs were repressed in embryoid bodies prepared by culturing ES cells for 14 days in either the presence or absence of RA (Figure 3B, compare lanes 1 and 2 with lanes 3 and 4). Furthermore, Northern analyses failed to detect miRNAs from the cluster in adult mouse organs (Figure 3B, lanes 5–12). In contrast, consistent with previous reports, let-7c and miR-16 were readily detectable in many of the organs (Lagos-Quintana et al., 2002, 2003). The above results strongly suggest that expression of the pre-miRNA cluster is specific for pluripotent ES cells and is either silenced or downregulated upon differentiation. This conclusion does not conflict with the expression of the

Figure 2. Genomic Organization of the ES Cell-Specific miRNA Clusters (A) Multiple sequence alignment of the genomic DNA segments corresponding to the cluster of mouse ES cell-specific pre-miRNAs (miR-290, 291, 292, 293, 294, and 295) and their human homologs (miR-hes1, 2, and 3). The positions of mature miRNAs that were cloned are highlighted in yellow. Conserved residues are shown in red. The mouse and human clusters are illustrated in (B) and (C), respectively, together with the secondary structures of proposed precursor RNAs. The experimentally determined (B) and hypothetical (C) positions of the mature miRNAs are shown in red. Genomic coordinates are given as chromosome:start-end (Un, unmapped sequence space). ESTs that map to the mouse cluster are shown with their GenBank accession numbers in (B).

Developmental Cell 356

Figure 3. Northern Analyses of the miRNA Expression Patterns In (A) the arrangement of samples is identical in all panels and is as follows: lane 1, feeder layer; lane 2, ES cells grown on feeders; lane 3, ES cells grown without feeders; lane 4, ES cells differentiated in monolayer with RA; lane 5, NIH/3T3 cells. The names of the miRNAs analyzed are given above each panel. tRNA-Ile-ATT serves as a loading control. Because of different exposures, comparisons of the signals between panels are not meaningful. (B) Expression of miRNAs in ES cells (lane 1), ES cells differentiated in monolayer in the presence of RA (lane 2), embryoid bodies cultured for 14 days without (lane 3) and with (lane 4) RA, and mouse organs (lanes 5–12). The names of the organs are given on top, and the names of the miRNAs are given on the right.

above cluster in ES cells differentiated in monolayer. The half-life of these miRNAs may be sufficiently long that 4 days of culture might not be adequate for their clearance. Four other miRNAs, unrelated to previously described sequences, were detected by Northern analyses (miR296, miR-297, miR-301, and miR-302). Their expression patterns suggest that only miR-296 could potentially be ES cell specific (Figure 3A and Table 1). It is difficult, with the results to date, to conclude that an miRNA is expressed in undifferentiated ES cells if this same miRNA is induced upon differentiation. This difficulty arises because all ES cell cultures contain a small proportion of spontaneously differentiated cells. In spite of this, it is tempting to group the miRNA expression data into the following three patterns. (1) The set of miRNAs, the levels of which remain relatively constant in undifferentiated ES cells and in monolayer cultures differentiated with RA and which were not found in adult tissues by either Northern analyses or previous cloning. This set is likely to have ES cell-specific functions and

consists of the miRNAs processed from the hairpin cluster and, potentially, miR-296. (2) miRNAs that are expressed in ES cell cultures as in (1) but were found in adult tissues by previous cloning. These are likely to regulate general aspects of cell physiology. This set consists of miR-15a, miR-16, miR-19b, miR-92, miR-93, miR-96, miR-130 and miR-130b. (3) The set of miRNAs cloned from undifferentiated ES cells, the expression of which increases dramatically upon differentiation. Such miRNAs are almost certainly contributed by the subpopulation of spontaneously differentiated cells in the culture. Among this set are miR-21 and miR-22. The cluster of ES cell-specific pre-miRNAs could have important roles in maintaining the pluripotent cell state. Short, 20–24 nt RNAs, either miRNAs or siRNAs, are known to regulate gene expression by three different mechanisms. The first is the silencing of a gene by directing mRNA degradation. This requires extensive complementarity between the short RNA and a target site in the mRNA (Doench et al., 2003; Hutvagner and Zamore, 2002; Llave et al., 2002b; Tang et al., 2003).

ES Cell-Specific MicroRNAs 357

Pertinent to this, none of the miRNAs processed from the hairpin cluster are exactly complementary to known mRNAs. The second mechanism involves directing inhibition of transcription due to either chromatin modification or DNA methylation (Hall et al., 2002; Jones et al., 2001; Mette et al., 2000; Volpe et al., 2002). While the extent of complementarity required for transcriptional silencing by short RNAs has not been investigated, we note that no loci within the mouse genome, other than the actual hairpin precursors, are exactly complementary to clones originating from the pre-miRNA cluster. The third mechanism is the traditional role of inhibiting translation by miRNAs pairing with partial complementarity to 3⬘ untranslated regions of mRNAs (Olsen and Ambros, 1999; Slack et al., 2000). We believe that this is the probable role of the ES cell-specific miRNAs. As yet, their targets have not been identified. Given that miRNAs in this family have conserved consensus sequences at their 5⬘ and 3⬘ ends (Figure 2A), it is possible that they pair to the same set of mRNA targets. Since ES cells are derived from the ICM of blastocysts, the cluster of ES cell-specific miRNAs is likely to be involved in the regulation of early embryonic development. Because the sequence of events that takes place prior to implantation is unique to mammals, our failure to identify homologs of the ES cell-specific miRNAs in the fish D. rerio and F. rubripes may suggest a role in developmental transitions that only occur in mammals, such as the differentiation of the epiblast and trophoblast lineages in the blastocyst. Alternatively, these ES cell-specific miRNAs could be related to the pluripotent status of the ES cell. In this case, the same miRNAs might be expressed in adult stem cells, and homologs would be present in all vertebrates. Experimental Procedures ES Cell Growth and Differentiation J1 ES cells were grown under standard conditions. Differentiation in monolayer and embryoid bodies was as described (Guan et al., 2001; Wutz and Jaenisch, 2000). miRNA Preparation, Cloning, and Northern Analyses Oct4 was detected with a mixture of radiolabeled RT-PCR products from ES cell total RNA amplified with primer pairs 5⬘-GTGAACAT CAGGTGCCCACT-3⬘/5⬘-GTATCGGGGAATGCTGTCAT-3⬘ and 5⬘-ACC AGGCTCAGAGGTATTGG-3⬘/5⬘-TTCATGTCCTGGGACTCCTC-3⬘. The ␤-actin and 18S rRNA probes were synthesized by random priming of DECAtemplates (Ambion). miRNAs were extracted via the acid guanidinium method (Chomczynski and Sacchi, 1987), except that all precipitations were done with 3 volumes of ethanol, instead of isopropanol, in order to ensure the recovery of short oligonucleotides. Northern analysis and cloning of short RNAs were performed essentially as previously described (Hamilton and Baulcombe, 1999; Lau et al., 2001). Bioinformatics Database searches were performed at the ENSEMBL server (http:// www.ensembl.org). PERL scripts for the automatic submission of blast jobs and for the retrieval of the search results were based on the standard LWP, HTML, and HTTP PERL modules. Scripts for the analysis of miRNAs against the ENSEMBL genomic annotations interacted directly with the relational database and relied extensively on the ENSEMBL PERL API. miRNA sequence comparisons were performed by multiple sequence alignment with CLUSTALW (Higgins and Sharp, 1988). Folding of miRNA precursors was performed with MFOLD (Zuker et al., 1999).

Acknowledgments We would like to thank N. Lau and D. Bartel for sharing their miRNA cloning protocols and D. Bartel, A. Grishok, D. Tantin, D. Dimova, C. Novina, J. Doench, C. Petersen, D. Dykxhoorn, C. Cheng, and V. Wang for discussions and critical review of the manuscript. This research was supported by fellowship 61-1154 from the Jane Coffin Childs Fund for Medical Research to H.B.H., genetics training grant T32-GM07748 from the National Institutes of Health to M.F.M., United States Public Health Service MERIT Award R37-GM34277 from the National Institutes of Health, National Science Foundation Grant 021850, and PO1 grant CA42063 from the National Cancer Institute to P.A.S., and, partially, by Cancer Center Support (core) grant P30-CA14051 from the National Cancer Institute. Received: May 9, 2003 Revised: June 3, 2003 Accepted: June 18, 2003 Published online: July 3, 2003 References Ambros, V., Bartel, B., Bartel, D.P., Burge, C.B., Carrington, J.C., Chen, X., Dreyfuss, G., Eddy, S.R., Griffiths-Jones, S., Marshall, M., et al. (2003). A uniform system for microRNA annotation. RNA 9, 277–279. Brennecke, J., Hipfner, D.R., Stark, A., Russell, R.B., and Cohen, S.M. (2003). Bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila. Cell 113, 25–36. Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159. Cooper, H.M., Tamura, R.N., and Quaranta, V. (1991). The major laminin receptor of mouse embryonic stem cells is a novel isoform of the alpha 6 beta 1 integrin. J. Cell Biol. 115, 843–850. Doench, J.G., Petersen, C.P., and Sharp, P.A. (2003). siRNAs can function as miRNAs. Genes Dev. 17, 438–442. Dostie, J., Mourelatos, Z., Yang, M., Sharma, A., and Dreyfuss, G. (2003). Numerous microRNPs in neuronal cells containing novel microRNAs. RNA 9, 631–632. Elbashir, S.M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., and Tuschl, T. (2001a). Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411, 494–498. Elbashir, S.M., Lendeckel, W., and Tuschl, T. (2001b). RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes Dev. 15, 188–200. Grishok, A., Pasquinelli, A.E., Conte, D., Li, N., Parrish, S., Ha, I., Baillie, D.L., Fire, A., Ruvkun, G., and Mello, C.C. (2001). Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C. elegans developmental timing. Cell 106, 23–34. Guan, K., Chang, H., Rolletschek, A., and Wobus, A.M. (2001). Embryonic stem cell-derived neurogenesis. Retinoic acid induction and lineage selection of neuronal cells. Cell Tissue Res. 305, 171–176. Hall, I.M., Shankaranarayana, G.D., Noma, K., Ayoub, N., Cohen, A., and Grewal, S.I. (2002). Establishment and maintenance of a heterochromatin domain. Science 297, 2232–2237. Hamilton, A.J., and Baulcombe, D.C. (1999). A species of small antisense RNA in posttranscriptional gene silencing in plants. Science 286, 950–952. Hammond, S.M., Bernstein, E., Beach, D., and Hannon, G.J. (2000). An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature 404, 293–296. Higgins, D.G., and Sharp, P.M. (1988). CLUSTAL: a package for performing multiple sequence alignment on a microcomputer. Gene 73, 237–244. Hutvagner, G., and Zamore, P.D. (2002). A microRNA in a multipleturnover RNAi enzyme complex. Science 297, 2056–2060. Hutvagner, G., McLachlan, J., Pasquinelli, A.E., Balint, E., Tuschl, T.,

Developmental Cell 358

and Zamore, P.D. (2001). A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNA. Science 293, 834–838.

Tang, G., Reinhart, B.J., Bartel, D.P., and Zamore, P.D. (2003). A biochemical framework for RNA silencing in plants. Genes Dev. 17, 49–63.

Jones, L., Ratcliff, F., and Baulcombe, D.C. (2001). RNA-directed transcriptional gene silencing in plants can be inherited independently of the RNA trigger and requires Met1 for maintenance. Curr. Biol. 11, 747–757.

Volpe, T.A., Kidner, C., Hall, I.M., Teng, G., Grewal, S.I., and Martienssen, R.A. (2002). Regulation of heterochromatic silencing and histone H3 lysine-9 methylation by RNAi. Science 297, 1833–1837.

Lagos-Quintana, M., Rauhut, R., Lendeckel, W., and Tuschl, T. (2001). Identification of novel genes coding for small expressed RNAs. Science 294, 853–858. Lagos-Quintana, M., Rauhut, R., Yalcin, A., Meyer, J., Lendeckel, W., and Tuschl, T. (2002). Identification of tissue-specific microRNAs from mouse. Curr. Biol. 12, 735–739. Lagos-Quintana, M., Rauhut, R., Meyer, J., Borkhardt, A., and Tuschl, T. (2003). New microRNAs from mouse and human. RNA 9, 175–179. Lau, N.C., Lim, L.P., Weinstein, E.G., and Bartel, D.P. (2001). An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science 294, 858–862. Lee, R.C., Feinbaum, R.L., and Ambros, V. (1993). The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75, 843–854. Lee, Y., Jeon, K., Lee, J.T., Kim, S., and Kim, V.N. (2002). MicroRNA maturation: stepwise processing and subcellular localization. EMBO J. 21, 4663–4670. Lim, L.P., Glasner, M.E., Yekta, S., Burge, C.B., and Bartel, D.P. (2003a). Vertebrate microRNA Genes. Science 299, 1540. Lim, L.P., Lau, N.C., Weinstein, E.G., Abdelhakim, A., Yekta, S., Rhoades, M.W., Burge, C.B., and Bartel, D.P. (2003b). The microRNAs of Caenorhabditis elegans. Genes Dev. 17, 991–1008. Llave, C., Kasschau, K.D., Rector, M.A., and Carrington, J.C. (2002a). Endogenous and silencing-associated small RNAs in plants. Plant Cell 14, 1605–1619. Llave, C., Xie, Z., Kasschau, K.D., and Carrington, J.C. (2002b). Cleavage of Scarecrow-like mRNA targets directed by a class of Arabidopsis miRNA. Science 297, 2053–2056. Mette, M.F., Aufsatz, W., van der Winden, J., Matzke, M.A., and Matzke, A.J. (2000). Transcriptional silencing and promoter methylation triggered by double-stranded RNA. EMBO J. 19, 5194–5201. Mourelatos, Z., Dostie, J., Paushkin, S., Sharma, A., Charroux, B., Abel, L., Rappsilber, J., Mann, M., and Dreyfuss, G. (2002). miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs. Genes Dev. 16, 720–728. Olsen, P.H., and Ambros, V. (1999). The lin-4 regulatory RNA controls developmental timing in Caenorhabditis elegans by blocking LIN-14 protein synthesis after the initiation of translation. Dev. Biol. 216, 671–680. Reinhart, B.J., and Bartel, D.P. (2002). Small RNAs correspond to centromere heterochromatic repeats. Science 297, 1831. Reinhart, B.J., Slack, F.J., Basson, M., Pasquinelli, A.E., Bettinger, J.C., Rougvie, A.E., Horvitz, H.R., and Ruvkun, G. (2000). The 21nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature 403, 901–906. Reinhart, B.J., Weinstein, E.G., Rhoades, M.W., Bartel, B., and Bartel, D.P. (2002). MicroRNAs in plants. Genes Dev. 16, 1616–1626. Rhoades, M.W., Reinhart, B.J., Lim, L.P., Burge, C.B., Bartel, B., and Bartel, D.P. (2002). Prediction of plant microRNA targets. Cell 110, 513–520. Rosner, M.H., Vigano, M.A., Ozato, K., Timmons, P.M., Poirier, F., Rigby, P.W., and Staudt, L.M. (1990). A POU-domain transcription factor in early stem cells and germ cells of the mammalian embryo. Nature 345, 686–692. Slack, F.J., Basson, M., Liu, Z., Ambros, V., Horvitz, H.R., and Ruvkun, G. (2000). The lin-41 RBCC gene acts in the C. elegans heterochronic pathway between the let-7 regulatory RNA and the LIN-29 transcription factor. Mol. Cell 5, 659–669. Smith, A. (2001). Embryonic stem cells. In Stem Cell Biology, D.R. Marshak, R.L. Gardner, and D. Gottlieb, eds. (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press), pp. 205–230.

Wutz, A., and Jaenisch, R. (2000). A shift from reversible to irreversible X inactivation is triggered during ES cell differentiation. Mol. Cell 5, 695–705. Xie, Z., Kasschau, K.D., and Carrington, J.C. (2003). Negative Feedback Regulation of Dicer-Like1 in Arabidopsis by microRNA-Guided mRNA Degradation. Curr. Biol. 13, 784–789. Zamore, P.D., Tuschl, T., Sharp, P.A., and Bartel, D.P. (2000). RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell 101, 25–33. Zuker, M., Mathews, D.H., and Turner, D.H. (1999). Algorithms and thermodynamics for RNA secondary structure prediction: a practical guide. In RNA Biochemistry and Biotechnology, J. Barciszewski, and B.F.C. Clark, eds. (Dordrecht, The Netherlands: Kluwer Academic Publishers).