- Email: [email protected]
Emergence and characterization of nosocomial multidrug-resistant and extensively drug-resistant Acinetobacter baumannii isolates in Tehran, Iran
J Infect Chemother xxx (2018) 1e9
Contents lists available at ScienceDirect
Journal of Infection and Chemotherapy journal homepage: http://www.elsevier.com/locate/jic
Original Article
Emergence and characterization of nosocomial multidrug-resistant and extensively drug-resistant Acinetobacter baumannii isolates in Tehran, Iran* Bahare Salehi a, Hossein Goudarzi a, Bahram Nikmanesh b, Hamidreza Houri a, Mostafa Alavi-Moghaddam c, Zohreh Ghalavand a, * a b c
Department of Microbiology, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran Department of Medical Laboratory Sciences, School of Allied Medical Sciences, Tehran University of Medical Sciences, Tehran, Iran Imam Hossein Hospital, Shahid Beheshti University of Medical Sciences, Tehran, Iran
a r t i c l e i n f o
a b s t r a c t
Article history: Received 25 October 2017 Received in revised form 1 February 2018 Accepted 19 February 2018 Available online xxx
Rationale: Acinetobacter baumannii is one of the antibiotic-resistant superbugs that threatens hospitalized patients. Emergence and spread of the multidrug-resistant (MDR) and extensively drug-resistant (XDR) clones cause erratic outbreaks following environmental contamination of hospital settings. Objective: The present study intended to characterize the antimicrobial resistant profiles and the genotypes of clinical and environmental isolates of A. baumannii as a result of dissemination of resistant strains. Methods: Clinical and environmental isolates of A. baumannii were obtained from patients, staff, and environment of an educational hospital in Tehran. Antimicrobial susceptibility testing was carried out using the disk diffusion and E-test methods. Multiplex PCR was performed for detection of OXA-type genes (blaOXA-23-like, blaOXA-24-like, blaOXA-58-like, and blaOXA-51-like). Genotypic relatedness of the isolates was achieved using repetitive extragenic palindromic element PCR (Rep-PCR) technique. Results: All the isolates were found to be susceptible to colistin and most of them (77%) were nonsusceptible to tigecycline. A majority of the clinical and environmental isolates (97%) were considered as MDR strains and 41% as XDR. In multiplex detection, blaOXA-23-like was found in 54% of the isolates, which was the most frequent OXA-type gene. In addition, the frequency of the carbapenem-resistant A. baumannii (CRAB) was observed to be high (96%). In addition, molecular typing showed different Rep patterns of clinical isolates and clonal spread of environmental isolates. Conclusion: The present study highlights the circulation of drug-resistant A. baumannii strains in different wards of hospitals principally in intensive care unit (ICU) as a nosocomial pathogen due to unwise managements. © 2018 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Keywords: Acinetobacter baumannii Multidrug-resistant Extensively drug-resistant Nosocomial infection Carbapenem-resistant A. baumannii Environmental
1. Introduction Outbreaks of hospital-acquired infections (HAIs) are a substantial problem that pose extensive burdens on healthcare systems giving rise to economic costs and increasing the rate of
*
All authors meet the ICMJE authorship criteria * Corresponding author. Department of Microbiology, School of Medicine, Koodakyar Ave, Daneshjoo Blvd, Velenjak, Tehran, 19839-63113, Iran. E-mail address: [email protected] (Z. Ghalavand).
morbidity and mortality. As for healthcare-associated infections (HCAIs), Acinetobacter baumannii has been emerged as a drug resistant infectious agent principally in the developing countries. A. baumannii belongs to a group of nosocomial pathogens called ESKAPE (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, A. baumannii, Pseudomonas aeruginosa, and Enterobacter spp.), which accounts for most of the significant lifethreatening HAIs and are characterized by numerous potential antimicrobial resistance mechanisms [1e3]. Considering the capability of A. baumannii to adhere, resist desiccation on abiotic surfaces, survive in moist devices such as ventilators, form
https://doi.org/10.1016/j.jiac.2018.02.009 1341-321X/© 2018 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Please cite this article in press as: Salehi B, et al., Emergence and characterization of nosocomial multidrug-resistant and extensively drugresistant Acinetobacter baumannii isolates in Tehran, Iran, J Infect Chemother (2018), https://doi.org/10.1016/j.jiac.2018.02.009
2
B. Salehi et al. / J Infect Chemother xxx (2018) 1e9
biofilm, tolerate various environments, and resistance acquisition to various antimicrobial agents, the bacterium has become ubiquitous in different hospital wards, especially in intensive care units (ICUs). The circulation of A. baumannii strains among hospitalized patients, hospital environment, medical equipment, and health care staff can occur due to inappropriate disinfecting or lack of response to such strategies, which result in durability of this bacterium in hospitals [4,5]. As a matter of fact, A. baumannii strains are capable of developing various antimicrobial resistance mechanisms, including deficiency in cell membrane permeability caused by alteration in OMP expression, modification of topoisomerases and DNA gyrases, over-expression of multidrug efflux pump, variation of penicillin binding proteins (PBPs), and production of b-lactamase enzymes. Among these, b-lactamases, which belongs to Ambler class B, referred to as metallo-b-lactamases and carbapenem-hydrolyzing class D OXA-like enzymes (CHDLs), have been reported as the most common resistance mechanisms to carbapenem agents. Carbapenem-resistant A. baumannii (CRAB) isolates, which are rising much clinical concerns worldwide due to their prevalence and limitation of therapeutic choices, are considered mainly in immunocompromised patients in ICU wards [6,7]. Increasing incidence of CRAB outbreaks in the developing countries, like Iran, has been considered as an alarming health issue. This emergence is due to unwise prescription of antibiotics and resistance to antimicrobial agents as a result of natural genetic transformation other than the potential of stability and widespread dissemination [8e10]. As a result, the present study was conducted to evaluate the antimicrobial susceptibility and to determine the prevalence of blaOXA-23, blaOXA-24, blaOXA-58, and blaOXA-51 genes of clinical and environmental isolates of inpatients in an educational hospital in Tehran, Iran. Furthermore, we typed the disseminated clones to find a reasonable pattern for transmission of resistant strains and to discover their possible reservoir. 2. Materials and methods
according to Clinical Laboratory and Standards Institute (CLSI; 2016) guidelines. A total of 12 antimicrobial agents were tested, including imipenem (10 mg), meropenem (10 mg), piperacillin/ tazobactam (100/10 mg), gentamycin (10 mg), amikacin (30 mg), cefepime (30 mg), ceftazidime (30 mg), ceftriaxone (30 mg), trimethoprim/sulfamethoxazole (1.25/23.75 mg), ciprofloxacin (5 mg), levofloxacin (5 mg), and tigecycline (15 mg) (Mast Co., Merseyside, UK). In addition, minimum inhibitory concentration (MIC) for four antibiotics, i.e. imipenem, cefepime, colistin, and levofloxacin, was determined using E-test strips (Liofilchem Co., Roseto, Italy). Pseudomonas aeruginosa ATCC 27853 and Escherichia coli ATCC 25922 were used in antimicrobial susceptibility test as quality control. In the present study, the multi-drug resistant (MDR) isolates were considered as those resistant to at least three classes of antibiotics (all cephalosporins and penicillins (including inhibitor combinations), aminoglycosides, and fluoroquinolones) and the extensively drug resistant (XDR) isolates as those resistant to all antibiotics (all active antibiotic categories against considered microorganism), except colistin or tigecycline [12]. According to CLSI guidelines, Acinetobacter spp. that are nonsusceptible to one or more carbapenems (imipenem, meropenem, or doripenem), are considered as carbapenem-resistant isolates. Resistance to one antibiotic in each category is included. 2.3. Genomic DNA extraction DNA extraction was carried out using phenol-chloroform method, as previously described [13]. 2.4. Multiplex PCR assay The multiplex PCR assay was carried out in order to detect common CHDLs, including OXA-23, OXA-24, OXA-58, and OXA-51 using specific primers (Table 1). Evaluation of primers against control strain was separately performed and substantially assessed in multiplex format. The control strains NCTC 13304, NCTC 13303, NCTC 13305, and NCTC 12156 were used for blaOXA-23, blaOXA-24, blaOXA-58, and blaOXA-51 genes, respectively.
2.1. Study design and bacterial isolates The current cross-sectional study was conducted on clinical and environmental A. baumannii isolates collected in 7 months. The clinical isolates were collected from patients who were hospitalized at least 72 h after admission in various wards of an educational hospital in Tehran. To collect environmental samples, careful gathering of specimens was accomplished using a wet swab from clothes and hands of staff, medical equipment, and patients' environment. Subsequently, all the isolates were cultured on MacConkey and blood agar instantly after sampling and incubated at 37 C for 24 h. In order to identify A. baumannii isolates, first we used conventional and biochemical methods, including oxidase test, motility, oxidative-fermentative (OF) test, and growth in 44 C. In rieux, Marcy-l’Etoile, addition, API20NE system (Biome France) was implemented. To confirm the identification of A. baumannii strains, intrinsic blaOXA-51-like and rpoB amplification were performed as previously described [11]. 2.2. Antimicrobial susceptibility testing Antimicrobial susceptibility of A. baumannii isolates was carried out on the Mueller-Hinton agar (MHA) (Merck Co., Darmstadt, Germany) using Kirby-Bauer disk diffusion method
2.5. Repetitive extragenic palindromic element PCR (Rep-PCR) genotyping Genotyping of the isolates was performed using repetitive extragenic palindromic element PCR (Rep-PCR) analysis with the aim of finding a perspective of clonal relation. The Rep-like elements in the bacterial chromosomes were amplified using Rep 1 and Rep 2 specific primers (Table 1). The PCR products were analyzed using electrophoresis (1% agarose) at 90 V for 1.5 h. Also, the Rep-PCR DNA profiles of the A. baumannii isolates were analyzed using Gelcompar II software, version 4.0 (Applied Maths, Belgium). Evaluation of Rep type similarity and cluster relationship analysis of Rep-PCR were done using dice coefficient and unweighted pair group method with arithmetic averages (UPGMA). 2.6. Statistical analysis SPSS, version 22.0 (IBM Corp., NY, USA) was used for statistical analysis. The groups under the study were assessed via Chi-square test for categorical variables and independent t-test for differences in the mean change between groups. A p-value < 0.05 was considered to be statistically significant.
Please cite this article in press as: Salehi B, et al., Emergence and characterization of nosocomial multidrug-resistant and extensively drugresistant Acinetobacter baumannii isolates in Tehran, Iran, J Infect Chemother (2018), https://doi.org/10.1016/j.jiac.2018.02.009
B. Salehi et al. / J Infect Chemother xxx (2018) 1e9
3
Table 1 Primer sets used in this study. PCR target
Primer Sequence (50 -30 )
Product size (bp)
Annealing Temperature (oC)
References
blaOXA-51-like
F: TAA TGC TTT GAT CGG CCT TG R: TGG ATT GCA CTT CAT CTT GG F: GAT CGG ATT GGA GAA CCA GA R: ATT TCT GAC CGC ATT TCC AT F: GGT TAG TTG GCC CCC TTA AA R: AGT TGA GCG AAA AGG GGA TT F: AAG TAT TGG GGC TTG TGC TG R: CCC CTC TGC GCT CTA CAT AC F: AGTCACGCGAAGTTGAAGGT R: GCGGTATGGAGTTTCCAAGA Rep1: IIIICGICGICATCIGGC Rep2: ICGICTTATCIGGCCTAC
353
54
[11]
501
54
[11]
246
54
[11]
599
54
[11]
542
55
[14]
Variable
43
[15]
blaOXA-23 blaOXA-24 blaOXA-58 rpoB Rep-elements
bp, base pair; F, forward primer; R, reverse primer.
3. Results 3.1. Characterization of A. baumannii isolates and antimicrobial susceptibility A total of 125 non-duplicate clinical isolates of A. baumannii (from 53 females and 72 males, with the mean age of 51.90 years old) were collected from a 564-bed medical educational hospital. The specimens from which bacteria were obtained comprised of sputum (52.8%, n ¼ 66), wound (12.7%, n ¼ 16), urine (12.7%, n ¼ 16), blood (9.5%, n ¼ 12), catheter (7.1%, n ¼ 9), eye (0.8%, n ¼ 1),
CSF (2.4%, n ¼ 3) and other body fluids (1.6%, n ¼ 2). A majority of clinical isolates were collected from ICU (75%, n ¼ 93) and others were from surgery, neurology, orthopedic, infection, internal, and neonatal wards, in the order of percentage. Moreover, 22 environmental A. baumannii were collected from hospital setting. The distribution of the environmental isolates from various sites is illustrated in Fig. 1. Table 2 shows the antimicrobial resistance pattern. In our study, all the clinical isolates (n ¼ 125) were considered as MDR and 40% (n ¼ 50) as XDR isolates. Among environmental isolates, 81.8% (n ¼ 18) A. baumannii were MDR and 50% (n ¼ 11) isolates XDR (5
Fig. 1. Clonal spread of environmental isolates (EI). Rep types, Rep elements pattern for each isolate using Rep-PCR method; antimicrobial resistance pattern, resistance profile of isolates obtained from antimicrobial susceptibility testing; clone, denoting isolates with common features emerged from a single ancestral strain. ICU, Intensive Care Unit; XDR, Extensively Drug Resistant; MDR, Multiple Drug Resistant. Common types are illustrated with brackets.
Please cite this article in press as: Salehi B, et al., Emergence and characterization of nosocomial multidrug-resistant and extensively drugresistant Acinetobacter baumannii isolates in Tehran, Iran, J Infect Chemother (2018), https://doi.org/10.1016/j.jiac.2018.02.009
4
B. Salehi et al. / J Infect Chemother xxx (2018) 1e9
Table 2 Antimicrobial susceptibility of clinical and environmental A.baumannii isolates. Antimicrobial agent
Piperacillin/tazobactam Trimethoprim/sulfamethoxazole Ceftriaxone Ceftazidime Cefepimea Ciprofloxacin Levofloxacina Meropenem Imipenema Gentamicin Amikacin Tigecycline Colistina a b
Clinical isolates; No (%)
Environmental isolates; No (%)
S
I
R
MIC50/90
S
I
R
MIC50/90
0 (0) 1 (0.8) 0 (0) 1 (0.8) 1 (0.8) 0 (0) 1 (0.8) 1 (0.8) 6 (4.8) 6 (4.8) 21 (16.8) 24 (19.2) _
0 (0) 0 (0) 1 (0.80) 0 (0) 13 (10.4) 1 (0.8) 1 (0.8) 0 (0) 5 (4) 4 (3.2) 31 (24.8) 99 (79.2) _
125 (100) 124 (99.2) 124 (99.2) 124 (99.2) 111 (88.8) 124 (99.2) 123 (98.4) 124 (99.2) 114 (91.2) 115 (92) 73 (58.4) 2 (1.6) _
_ _ _ _ 192/256 _ 6/32 _ 32/32 _ _ _ 0.75/1.0b
4 (18.18) 4 (18.18) 3 (13.64) 4 (18.18) 4 (18.18) 4 (18.18) 4 (18.18) 4 (18.18) 5 (22.73) 5 (22.73) 6 (27.27) 11 (50) _
0 (0) 0 (0) 1 (4.54) 0 (0) 10 (45.46) 0 (0) 0 (0) 0 (0) 1 (4.54) 1 (4.54) 5 (22.73) 11 (50) _
18 (81.82) 18 (81.82) 18 (81.82) 18 (81.82) 8 (36.36) 18 (81.82) 18 (81.82) 18 (81.82) 16 (72.73) 16 (72.73) 11 (50) 0 (0) _
_ _ _ _ 16/64 _ 12/48 _ 16/32 _ _ _ 0.5/1.0b
MIC evaluated for these four antibiotics using E-test method (S, sensitive; I, intermediate; R, resistant.). According to CLSI 2016, MIC interpretive criteria for colistin are as follows: 2 (mg/ml): sensitive and 4 (mg/ml): resistant.
isolates were from ICU). In addition, a total of 142 (96.59%) CRAB isolates were assessed. All of the isolates were susceptible to colistin and we discovered 77% tigecycline non-susceptible A. baumannii strains. 3.2. Detection of OXA-like resistance genes The PCR analysis demonstrated that in addition to all clinical isolates, all environmental isolates had blaoxa-51-like. Blaoxa-23-like with the rate of 59.2% (n ¼ 74) was the most prevalent gene among clinical isolates and moreover 14 and only 2 isolates were positive for OXA-58 and OXA-24, respectively. Besides, 6 out of 22 environmental isolates had OXA-23-like gene. 3.3. Genotypic analysis and clonal relationship The MDR clinical isolates of A. baumannii together with environmental isolates (147 isolates) clustered into 38 common types and 33 single types, which were concluded from Rep-PCR typing. These Rep-PCR clusters were considered at 80% similarity. Some of the common types, comprising of 2 to max 9 strains, consisted of both clinical and environmental isolates. With the intention of associating and comparing the clusters, sampling sites, carbapenem resistance genes, and antimicrobial resistant profiles are illustrated in Figs. 1 and 2. 4. Discussion A.baumannii is principally remarkable for its propensity to turn out to be MDR and XDR worldwide, specifically in the developing countries [5]. In the present investigation, we firstly assessed the resistance profile which demonstrated high ratios of resistance except for colistin and tigecycline. These two effective antibiotics play a major role in determining XDR isolates and have synergistic effects with other antibiotic families against drug-resistant A.baumannii, even though colistin is nephrotoxic and neurotoxic [4]. Following 100% colistin sensitivity, our results were in line with those presented by Farshadzade et al. from Tehran, but in contradiction with those of Maspi et al., who reported 52% sensitivity for colistin in the same city. The interesting point to consider in this study was the high incidence of tigecycline non-susceptible A. baumannii strains (77%), which is in contrast with the findings reported in the previous studies in Iran [4,10,16]. Furthermore, we evaluated some of the noteworthy drug resistant A. baumannii strains that have been risen much concerns
in hospital infections. In the current study, XDR frequency of the clinical isolates was similar to that reported by Nasrolahei et al., in 2014 (37%). However, the rates of XDR in Maspi et al., in 2016 and Bahador et al., in 2015 were reported to be 70% and 20%, respectively [10,17,18], which indicates the increased rate of XDR incidence in Iran. Moreover, our findings indicated that a majority (97%) of the collected isolates were considered as MDR strains, which was closely similar to the incidence of MDR strains in other reports in Iran (94%) [10], (97%) [19] and Malaysia (>70%) [6], but higher than that reported in India (54%) [20]. The reported frequencies of MDR strains from Iran have been high (>65%) during the past two years. Therefore, combination of two classes of antibiotics are recommended in the treatment of drug resistant A. baumannii infections [10,18,19]. The limited treatment alternatives caused by MDR strains can increase the use of colistin and tigecycline as the last-line therapeutic agents [12,21]. Proper procedures to disinfect patient surroundings, severe patient screening, controlling infection reservoir, fortifying routine hygiene, and discriminating the prescription of broad-spectrum antibiotics can be implemented with the hope of preventing nosocomial XDR and MDR strains transmission and abstaining intermittent outbreaks [22,23]. Although carbapenems are the first line choice in the treatment of A. baumannii infections, the occurrence of MDR and XDR carbapenem-resistant clones in hospital epidemics worldwide has caused a great deal of concern. Thus, to achieve an efficacious and adequate treatment essentially for patients in critical care units and then managing the imminent outbreaks, especial precautionary approaches should be executed [9]. OXA-type b-lactamases have a main role in the emergence of CRAB isolates and are the most prevalent carbapenemases in A. baumannii. In multiplex PCR outcome, 54% (80/147) of our isolates harbored blaOXA-23-like gene similar to the results of another study in Iran by Nasrolahei et al. [17]. On the other hand, Kohlenberg et al. and Andriamanantena et al. reported a 100% prevalence of blaOXA-23-like among clinical isolates of A. baumannii meaning that this gene has the highest percentage among OXA-like genes [5,16,19,24,25]. Thereafter, 9% (14/147) and 1% (2/147) of the isolates had blaOXA-58-like and blaOXA24-like, respectively. However, blaOXA-58 and blaOXA-24 were not detected in environmental isolates. BlaOXA-24-like gene has the least prevalence among OXA-type carbapenemases as reported in former studies [11,25,26]. Also, another report from Iran showed increased incidence rate of blaOXA-24 (64%) [19]. Furthermore, presence of insertion sequence (IS) elements such as ISAba1 in upstream of OXA-23, OXA-24/40, and OXA-51 genes as a strong
Please cite this article in press as: Salehi B, et al., Emergence and characterization of nosocomial multidrug-resistant and extensively drugresistant Acinetobacter baumannii isolates in Tehran, Iran, J Infect Chemother (2018), https://doi.org/10.1016/j.jiac.2018.02.009
B. Salehi et al. / J Infect Chemother xxx (2018) 1e9
5
Fig. 2. Rep-PCR typing of all the clinical samples and the environmental strains, sample site, carbapenem resistant genes and antimicrobial resistant profiles. AN, amikacin; LEV, levofloxacin; GM, gentamicin; FEP, cefepime; IMP, imipenem; MEM, meropenem; COT, cotrimoxazol; PTZ, piperacillin-tazobactam; CIP, ciprofloxacin; CAZ, ceftazidem; CRO, ceftriaxone; EI, environmental isolates. Common types are illustrated with brackets.
promoter, can lead to overexpress of oxacillinase encoding genes and increase the rate of resistance to carbapenems according to previous studies [6,12,18]. In the current study, we found a high prevalence of CRAB (96%) based on the antimicrobial susceptibility results that was similar to the findings reported in Iran by Farsiani et al. (97%) and India by Ringa et al. (85%) [19,21]. However, these findings do not support those in Abdalhamid et al. in Saudi Arabia [27]. According to phenotypic results of carbapenems (imipenem and meropenem) in
our study, a majority of isolates confirm carbapenem resistant phenotype; on the other hand, we only detected OXA-type genes whereas other resistant mechanisms exist. Except for CHDLs OXAlike enzymes (for instance OXA-23, -24/40, -48, -58, and -143 types), especially OXA-23, which are the major cause of carbapenem resistant in A. baumannii, there are other carbapenem hydrolyzing enzymes, like class B metallo-b-lactamases (MBLs) (most current; VIM-1, IMP-1, NDM-1, and SIM-1) and Ambler class A blactamases (such as KPC-2 and GES-14). Likewise, efflux pumps,
Please cite this article in press as: Salehi B, et al., Emergence and characterization of nosocomial multidrug-resistant and extensively drugresistant Acinetobacter baumannii isolates in Tehran, Iran, J Infect Chemother (2018), https://doi.org/10.1016/j.jiac.2018.02.009
6
B. Salehi et al. / J Infect Chemother xxx (2018) 1e9
Fig. 2. (continued)
decreased permeability of outer membrane (OM), and penicillinbinding proteins alteration are known to contribute to the emergence of CRAB strains [5,7,9]. According to a study in 2016 in Tehran, Iran; the prevalence of VIM-1, IMP-1, NDM-1, and SIM-1 genes were 2.3%, 15.1%, 0%, and 2.3%, respectively [10]. The prospect of this microorganism transmission within the different wards of hospitals has become the turning-point of the
spread of resistance amongst the strains and their constancy in any corner of environments principally in ICU, which consequently increases hospitalization period [22]. In the current study, most of the isolates were collected from ICU, which was in consistent with the previous studies in Iran [10,19] and in India [21]. Since the temperature and humidity of ICU atmosphere is appropriate for stability of opportunistic pathogens, surveillance should be the first
Please cite this article in press as: Salehi B, et al., Emergence and characterization of nosocomial multidrug-resistant and extensively drugresistant Acinetobacter baumannii isolates in Tehran, Iran, J Infect Chemother (2018), https://doi.org/10.1016/j.jiac.2018.02.009
B. Salehi et al. / J Infect Chemother xxx (2018) 1e9
7
Fig. 2. (continued)
crucial stage in stabilizing the priorities of patients' health with immunodeficiency to preclude suffering from nosocomial infections [28]. Among ICU isolates, we acquired 38 clinical and 4 environmental XDR strains. The presence and dissemination of XDR strains in such critical wards are a great threat in the infection control issues. Circulation of A. baumannii inside the hospital via patients' contact can occur directly or indirectly by an individual colonized with A. baumannii, which was able to contaminate the inanimate surroundings. Moreover, healthcare staff have a critical role in the transmission of such healthcare-associated pathogens to other patients or medical equipment, most frequently with contaminated hands, which clarifies the prominence of hand hygiene [23]. As it is shown in Fig. 1, in three cases, the role of nurse hands in contamination of the high-touch surfaces near the patients and hospital environment is evident. Several epidemiological typing methods have been introduced with the purpose of investigating the A. baumannii distribution
within hospitals, finding out the association between circulating clones and reservoir of infection, and assessing the incidence of antimicrobial resistance so as to develop proper guidelines to prevent nosocomial infections. We employed Rep-PCR, which is a practicable PCR-based typing method and has a high discriminatory power and, moreover, is a cost-effective, fast and feasible molecular technique for assessment of clonal relatedness and genetic profiles of circulating local isolates in a hospital [6,29]. The clonal relationship of environmental isolates is shown in Fig. 1. Among all clones, clone G is comprised of most isolates (n ¼ 5), which were collected from three wards: neurology, ICU, and orthopedic. The antibio-type profile of all these five isolates was similar. Among the strains in the mentioned clone, the only environmental isolate harboring blaOXA-23-like gene, that has an important contribution to resistance to carbapenem agents, was recovered from the hand of a nurse in ICU. The other isolates were found from the near patient settings in neurology and orthopedic wards that confirm the circulation of isolates.
Please cite this article in press as: Salehi B, et al., Emergence and characterization of nosocomial multidrug-resistant and extensively drugresistant Acinetobacter baumannii isolates in Tehran, Iran, J Infect Chemother (2018), https://doi.org/10.1016/j.jiac.2018.02.009
8
B. Salehi et al. / J Infect Chemother xxx (2018) 1e9
In Fig. 2, we have provided a dendrogram of all 147 clinical and environmental isolates all together in comparison with each other in some characteristic, including detection of OXA-type genes, site of sampling, and antibiotic resistance profile. Hereby we can reconnoiter the dissemination of isolates between wards, patients, health-workers, medical electronic devices, and patients surrounding to discuss the sources of the infections and the outbreaks in the hospital. Since the majority of isolates are MDR and, furthermore, we had observed the incidence of XDR A. baumannii strains emerging particularly in ICU, taking into account the emergency state of the patients, circulation of declared strains are crucial in the increase in morbidity and mortality rate. The clone number 10 (C10) in Fig. 2 consists of 9 strains with antibio-type resemblance. Seven isolates were collected from ICU, yet two others, one of which was environmental, are from others wards, which reveals the probable transmission of these isolate between distant parts by healthcare staff or transferring of patients or devices. The excessive number of clones specifies different reservoirs and among them a considerable number of single clones reveals that they were derived from distinct strains. The variety of reservoirs can be due to both hospital-acquired and communityacquired infection, sharing of common healthcare workers and transmission of patients between hospitals. The most probable cause of such nosocomial infections is inappropriate antiseptic practices and verification for eliminating A. baumannii infections in hospitals since this microorganism can persist in the environment and therefore gives rise to the risk of infections in bedridden individuals. A limitation of the present study was lack of a molecular epidemiological genotyping with higher discriminatory power, which is the gold standard method for typing of A. baumannii strains, e.g., pulse-field gel electrophoresis (PFGE).
5. Conclusion Our findings highlight the intra-hospital spread of resistant isolates which can be problematic particularly in ICUs. Taking into account these findings, we can promote therapeutic policies and stabilize strict and continuous surveillance and prevention programs in the control of nosocomial infections so as to reduce the dissemination of refractory isolates in further epidemic and endemic incidences in the hospitals. To eradicate the occurrence of multidrug-resistant organisms (MDROs), based on the Healthcare Infection Control Practices Advisory Committee (HICPAC) recommendations, which provides guidance to Centers for Disease Control and Prevention (CDC) concerning control of infections as well as strategies for surveillance, seven categories are to be considered; education, prudential use of antibiotics, decolonization, routine and enhanced surveillance, infection control precautions, administrative support, and environmental measures [30].
Authors contribution Bahare Salehi: Conception of study, analysis and interpretation of data, revising and final approval. Hossein Goudarzi: Acquisition of data, drafting and final approval. Bahram Nikmanesh: Acquisition of data, drafting and final approval. Hamidreza Houri: Interpretation and acquisition of data, revising and final approval. Mostafa Alavi- Moghaddam: Acquisition of data and final approval. Zohreh Ghalavand: Design of the study and acquisition of data, revising and final approval of the version to be submitted.
Conflicts of interest We wish to confirm that there are no known conflicts of interest associated with this publication and there has been no significant financial support for this work that could have influenced its outcome. Acknowledgment We would like to thank the members of the Department of Microbiology at the School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, for their kind cooperation. References [1] Armin S, Karimi A, Fallah F, Tabatabaii SR, Alfatemi SMH, Khiabanirad P, et al. Antimicrobial resistance patterns of Acinetobacter baumannii, Pseudomonas aeruginosa and Staphylococcus aureus isolated from patients with nosocomial infections admitted to tehran hospitals. Arch Pediatr Infect Dis 2015;3. [2] Moghnieh R, Siblani L, Ghadban D, El Mchad H, Zeineddine R, Abdallah D, et al. Extensively drug-resistant Acinetobacter baumannii in a Lebanese intensive care unit: risk factors for acquisition and determination of a colonization score. J Hosp Infect 2016;92:47e53. [3] Santajit S, Indrawattana N. Mechanisms of antimicrobial resistance in ESKAPE pathogens. BioMed Res Int 2016;2016:2475067. [4] Lei J, Han S, Wu W, Wang X, Xu J, Han L. Extensively drug-resistant Acinetobacter baumannii outbreak cross-transmitted in an intensive care unit and respiratory intensive care unit. Am J Infect Control 2016;44:1280e4. [5] Zenati K, Touati A, Bakour S, Sahli F, Rolain JM. Characterization of NDM-1and OXA-23-producing acinetobacter baumannii isolates from inanimate surfaces in a hospital environment in Algeria. J Hosp Infect 2016;92:19e26. [6] Biglari S, Hanafiah A, Mohd Puzi S, Ramli R, Rahman M, Lopes BS. Antimicrobial resistance mechanisms and genetic diversity of multidrug-resistant acinetobacter baumannii isolated from a teaching hospital in Malaysia. Microb Drug Resist (Larchmont, NY) 2017;23:545e55. [7] Al-Agamy MH, Jeannot K, El-Mahdy TS, Shibl AM, Kattan W, Plesiat P, et al. First detection of GES-5 carbapenemase-producing acinetobacter baumannii isolate. Microb Drug Resist (Larchmont, NY) 2017;23:556e62. [8] Mirnejad R, Mostofi S, Masjedian F. Antibiotic resistance and carriage class 1 and 2 integrons in clinical isolates of acinetobacter baumannii from Tehran, Iran. Asian Pac J Trop Biomed 2013;3:140e5. [9] Pourhajibagher M, Hashemi FB, Pourakbari B, Aziemzadeh M, Bahador A. Antimicrobial resistance of acinetobacter baumannii to imipenem in Iran: a systematic review and meta-analysis. Open Microbiol J 2016;10:32e42. [10] Maspi H, Mahmoodzadeh Hosseini H, Amin M, Imani Fooladi AA. High prevalence of extensively drug-resistant and metallo beta-lactamase-producing clinical acinetobacter baumannii in Iran. Microb Pathog 2016;98:155e9. [11] Woodford N, Ellington MJ, Coelho JM, Turton JF, Ward ME, Brown S, et al. Multiplex PCR for genes encoding prevalent OXA carbapenemases in Acinetobacter spp. Int J Antimicrob Agents 2006;27:351e3. [12] Wright MS, Iovleva A, Jacobs MR, Bonomo RA, Adams MD. Genome dynamics of multidrug-resistant acinetobacter baumannii during infection and treatment. Genome Med 2016;8:26. [13] Chang HL, Tang CH, Hsu YM, Wan L, Chang YF, Lin CT, et al. Nosocomial outbreak of infection with multidrug-resistant acinetobacter baumannii in a medical center in Taiwan. Infect Control Hosp Epidemiol 2009;30:34e8. [14] Lin MF, Lin YY, Yeh HW, Lan CY. Role of the BaeSR two-component system in the regulation of Acinetobacter baumannii adeAB genes and its correlation with tigecycline susceptibility. BMC Microbiol 2014;14:119. [15] Snelling AM, Gerner-Smidt P, Hawkey PM, Heritage J, Parnell P, Porter C, et al. Validation of use of whole-cell repetitive extragenic palindromic sequencebased PCR (REP-PCR) for typing strains belonging to the Acinetobacter calcoaceticus-Acinetobacter baumannii complex and application of the method to the investigation of a hospital outbreak. J Clin Microbiol 1996;34: 1193e202. [16] Farshadzadeh Z, Hashemi FB, Rahimi S, Pourakbari B, Esmaeili D, Haghighi MA, et al. Wide distribution of carbapenem resistant Acinetobacter baumannii in burns patients in Iran. Front Microbiol 2015;6:1146. [17] Nasrolahei M, Zahedi B, Bahador A, Saghi H, Kholdi S, Jalalvand N, et al. Distribution of bla(OXA-23), ISAba, Aminoglycosides resistant genes among burned & ICU patients in Tehran and Sari, Iran. Ann Clin Microbiol Antimicrob 2014;13:38. [18] Bahador A, Raoofian R, Pourakbari B, Taheri M, Hashemizadeh Z, Hashemi FB. Genotypic and antimicrobial susceptibility of carbapenem-resistant Acinetobacter baumannii: analysis of ISAba elements and blaOXA-23-like genes including a new variant. Front Microbiol 2015;6. [19] Farsiani H, Mosavat A, Soleimanpour S, Nasab MN, Salimizand H, Jamehdar SA, et al. Limited genetic diversity and extensive antimicrobial resistance in clinical isolates of acinetobacter baumannii in North-East Iran. J Med Microbiol 2015;64:767e73.
Please cite this article in press as: Salehi B, et al., Emergence and characterization of nosocomial multidrug-resistant and extensively drugresistant Acinetobacter baumannii isolates in Tehran, Iran, J Infect Chemother (2018), https://doi.org/10.1016/j.jiac.2018.02.009
B. Salehi et al. / J Infect Chemother xxx (2018) 1e9 [20] Dash M, Padhi S, Pattnaik S, Mohanty I, Misra P. Frequency, risk factors, and antibiogram of Acinetobacter species isolated from various clinical samples in a tertiary care hospital in Odisha, India. Avicenna J Med 2013;3:97. [21] Rynga D, Shariff M, Deb M. Phenotypic and molecular characterization of clinical isolates of Acinetobacter baumannii isolated from Delhi, India. Ann Clin Microbiol Antimicrob 2015;14:40. R, Tannenbaum T, Lefebvre B, Le vesque S, et al. Man[22] Gray A, Allard R, Pare agement of a hospital outbreak of extensively drug-resistant Acinetobacter baumannii using a multimodal intervention including daily chlorhexidine baths. J Hosp Infect 2016;93:29e34. [23] Casini B, Selvi C, Cristina M, Totaro M, Costa A, Valentini P, et al. Evaluation of a modified cleaning procedure in the prevention of carbapenem-resistant Acinetobacter baumannii clonal spread in a burn intensive care unit using a high-sensitivity luminometer. J Hosp Infect 2017;95:46e52. [24] Kohlenberg A, Brümmer S, Higgins PG, Sohr D, Piening BC, de Grahl C, et al. Outbreak of carbapenem-resistant Acinetobacter baumannii carrying the carbapenemase OXA-23 in a German university medical centre. J Med Microbiol 2009;58:1499e507. [25] Andriamanantena TS, Ratsima E, Rakotonirina HC, Randrianirina F, Ramparany L, Carod J-F, et al. Dissemination of multidrug resistant
[26]
[27]
[28]
[29]
[30]
9
acinetobacter baumannii in various hospitals of Antananarivo Madagascar. Ann Clin Microbiol Antimicrob 2010;9:17. Cherkaoui A, Emonet S, Renzi G, Schrenzel J. Characteristics of multidrugresistant Acinetobacter baumannii strains isolated in Geneva during colonization or infection. Ann Clin Microbiol Antimicrob 2015;14:42. Abdalhamid B, Hassan H, Itbaileh A, Shorman M. Characterization of carbapenem-resistant acinetobacter baumannii clinical isolates in a tertiary care hospital in Saudi Arabia. New Microbiol 2014;37:65e73. Choi JY, Kwak YG, Yoo H, Lee SO, Kim HB, Han SH, et al. Trends in the incidence rate of device-associated infections in intensive care units after the establishment of the Korean nosocomial infections surveillance system. J Hosp Infect 2015;91:28e34. Salimizand H, Menbari S, Ramazanzadeh R, Khonsha M, Saleh Vahedi M. DNA fingerprinting and antimicrobial susceptibility pattern of clinical and environmental Acinetobacter baumannii isolates: a multicentre study. J Chemother (Florence, Italy) 2016;28:277e83. Seigel JDRE, Jackson M, Chairello L. Healthcare infection control practices advisory committee. Management of multidrug-resistant organisms. In: Healthcare settings; 2006. Available at: https://www.cdc.gov/infectioncontrol/ pdf/guidelines/mdro-guidelines.pdf (last accessed July 2017).
Please cite this article in press as: Salehi B, et al., Emergence and characterization of nosocomial multidrug-resistant and extensively drugresistant Acinetobacter baumannii isolates in Tehran, Iran, J Infect Chemother (2018), https://doi.org/10.1016/j.jiac.2018.02.009
Contents lists available at ScienceDirect
Journal of Infection and Chemotherapy journal homepage: http://www.elsevier.com/locate/jic
Original Article
Emergence and characterization of nosocomial multidrug-resistant and extensively drug-resistant Acinetobacter baumannii isolates in Tehran, Iran* Bahare Salehi a, Hossein Goudarzi a, Bahram Nikmanesh b, Hamidreza Houri a, Mostafa Alavi-Moghaddam c, Zohreh Ghalavand a, * a b c
Department of Microbiology, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran Department of Medical Laboratory Sciences, School of Allied Medical Sciences, Tehran University of Medical Sciences, Tehran, Iran Imam Hossein Hospital, Shahid Beheshti University of Medical Sciences, Tehran, Iran
a r t i c l e i n f o
a b s t r a c t
Article history: Received 25 October 2017 Received in revised form 1 February 2018 Accepted 19 February 2018 Available online xxx
Rationale: Acinetobacter baumannii is one of the antibiotic-resistant superbugs that threatens hospitalized patients. Emergence and spread of the multidrug-resistant (MDR) and extensively drug-resistant (XDR) clones cause erratic outbreaks following environmental contamination of hospital settings. Objective: The present study intended to characterize the antimicrobial resistant profiles and the genotypes of clinical and environmental isolates of A. baumannii as a result of dissemination of resistant strains. Methods: Clinical and environmental isolates of A. baumannii were obtained from patients, staff, and environment of an educational hospital in Tehran. Antimicrobial susceptibility testing was carried out using the disk diffusion and E-test methods. Multiplex PCR was performed for detection of OXA-type genes (blaOXA-23-like, blaOXA-24-like, blaOXA-58-like, and blaOXA-51-like). Genotypic relatedness of the isolates was achieved using repetitive extragenic palindromic element PCR (Rep-PCR) technique. Results: All the isolates were found to be susceptible to colistin and most of them (77%) were nonsusceptible to tigecycline. A majority of the clinical and environmental isolates (97%) were considered as MDR strains and 41% as XDR. In multiplex detection, blaOXA-23-like was found in 54% of the isolates, which was the most frequent OXA-type gene. In addition, the frequency of the carbapenem-resistant A. baumannii (CRAB) was observed to be high (96%). In addition, molecular typing showed different Rep patterns of clinical isolates and clonal spread of environmental isolates. Conclusion: The present study highlights the circulation of drug-resistant A. baumannii strains in different wards of hospitals principally in intensive care unit (ICU) as a nosocomial pathogen due to unwise managements. © 2018 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Keywords: Acinetobacter baumannii Multidrug-resistant Extensively drug-resistant Nosocomial infection Carbapenem-resistant A. baumannii Environmental
1. Introduction Outbreaks of hospital-acquired infections (HAIs) are a substantial problem that pose extensive burdens on healthcare systems giving rise to economic costs and increasing the rate of
*
All authors meet the ICMJE authorship criteria * Corresponding author. Department of Microbiology, School of Medicine, Koodakyar Ave, Daneshjoo Blvd, Velenjak, Tehran, 19839-63113, Iran. E-mail address: [email protected] (Z. Ghalavand).
morbidity and mortality. As for healthcare-associated infections (HCAIs), Acinetobacter baumannii has been emerged as a drug resistant infectious agent principally in the developing countries. A. baumannii belongs to a group of nosocomial pathogens called ESKAPE (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, A. baumannii, Pseudomonas aeruginosa, and Enterobacter spp.), which accounts for most of the significant lifethreatening HAIs and are characterized by numerous potential antimicrobial resistance mechanisms [1e3]. Considering the capability of A. baumannii to adhere, resist desiccation on abiotic surfaces, survive in moist devices such as ventilators, form
https://doi.org/10.1016/j.jiac.2018.02.009 1341-321X/© 2018 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Please cite this article in press as: Salehi B, et al., Emergence and characterization of nosocomial multidrug-resistant and extensively drugresistant Acinetobacter baumannii isolates in Tehran, Iran, J Infect Chemother (2018), https://doi.org/10.1016/j.jiac.2018.02.009
2
B. Salehi et al. / J Infect Chemother xxx (2018) 1e9
biofilm, tolerate various environments, and resistance acquisition to various antimicrobial agents, the bacterium has become ubiquitous in different hospital wards, especially in intensive care units (ICUs). The circulation of A. baumannii strains among hospitalized patients, hospital environment, medical equipment, and health care staff can occur due to inappropriate disinfecting or lack of response to such strategies, which result in durability of this bacterium in hospitals [4,5]. As a matter of fact, A. baumannii strains are capable of developing various antimicrobial resistance mechanisms, including deficiency in cell membrane permeability caused by alteration in OMP expression, modification of topoisomerases and DNA gyrases, over-expression of multidrug efflux pump, variation of penicillin binding proteins (PBPs), and production of b-lactamase enzymes. Among these, b-lactamases, which belongs to Ambler class B, referred to as metallo-b-lactamases and carbapenem-hydrolyzing class D OXA-like enzymes (CHDLs), have been reported as the most common resistance mechanisms to carbapenem agents. Carbapenem-resistant A. baumannii (CRAB) isolates, which are rising much clinical concerns worldwide due to their prevalence and limitation of therapeutic choices, are considered mainly in immunocompromised patients in ICU wards [6,7]. Increasing incidence of CRAB outbreaks in the developing countries, like Iran, has been considered as an alarming health issue. This emergence is due to unwise prescription of antibiotics and resistance to antimicrobial agents as a result of natural genetic transformation other than the potential of stability and widespread dissemination [8e10]. As a result, the present study was conducted to evaluate the antimicrobial susceptibility and to determine the prevalence of blaOXA-23, blaOXA-24, blaOXA-58, and blaOXA-51 genes of clinical and environmental isolates of inpatients in an educational hospital in Tehran, Iran. Furthermore, we typed the disseminated clones to find a reasonable pattern for transmission of resistant strains and to discover their possible reservoir. 2. Materials and methods
according to Clinical Laboratory and Standards Institute (CLSI; 2016) guidelines. A total of 12 antimicrobial agents were tested, including imipenem (10 mg), meropenem (10 mg), piperacillin/ tazobactam (100/10 mg), gentamycin (10 mg), amikacin (30 mg), cefepime (30 mg), ceftazidime (30 mg), ceftriaxone (30 mg), trimethoprim/sulfamethoxazole (1.25/23.75 mg), ciprofloxacin (5 mg), levofloxacin (5 mg), and tigecycline (15 mg) (Mast Co., Merseyside, UK). In addition, minimum inhibitory concentration (MIC) for four antibiotics, i.e. imipenem, cefepime, colistin, and levofloxacin, was determined using E-test strips (Liofilchem Co., Roseto, Italy). Pseudomonas aeruginosa ATCC 27853 and Escherichia coli ATCC 25922 were used in antimicrobial susceptibility test as quality control. In the present study, the multi-drug resistant (MDR) isolates were considered as those resistant to at least three classes of antibiotics (all cephalosporins and penicillins (including inhibitor combinations), aminoglycosides, and fluoroquinolones) and the extensively drug resistant (XDR) isolates as those resistant to all antibiotics (all active antibiotic categories against considered microorganism), except colistin or tigecycline [12]. According to CLSI guidelines, Acinetobacter spp. that are nonsusceptible to one or more carbapenems (imipenem, meropenem, or doripenem), are considered as carbapenem-resistant isolates. Resistance to one antibiotic in each category is included. 2.3. Genomic DNA extraction DNA extraction was carried out using phenol-chloroform method, as previously described [13]. 2.4. Multiplex PCR assay The multiplex PCR assay was carried out in order to detect common CHDLs, including OXA-23, OXA-24, OXA-58, and OXA-51 using specific primers (Table 1). Evaluation of primers against control strain was separately performed and substantially assessed in multiplex format. The control strains NCTC 13304, NCTC 13303, NCTC 13305, and NCTC 12156 were used for blaOXA-23, blaOXA-24, blaOXA-58, and blaOXA-51 genes, respectively.
2.1. Study design and bacterial isolates The current cross-sectional study was conducted on clinical and environmental A. baumannii isolates collected in 7 months. The clinical isolates were collected from patients who were hospitalized at least 72 h after admission in various wards of an educational hospital in Tehran. To collect environmental samples, careful gathering of specimens was accomplished using a wet swab from clothes and hands of staff, medical equipment, and patients' environment. Subsequently, all the isolates were cultured on MacConkey and blood agar instantly after sampling and incubated at 37 C for 24 h. In order to identify A. baumannii isolates, first we used conventional and biochemical methods, including oxidase test, motility, oxidative-fermentative (OF) test, and growth in 44 C. In rieux, Marcy-l’Etoile, addition, API20NE system (Biome France) was implemented. To confirm the identification of A. baumannii strains, intrinsic blaOXA-51-like and rpoB amplification were performed as previously described [11]. 2.2. Antimicrobial susceptibility testing Antimicrobial susceptibility of A. baumannii isolates was carried out on the Mueller-Hinton agar (MHA) (Merck Co., Darmstadt, Germany) using Kirby-Bauer disk diffusion method
2.5. Repetitive extragenic palindromic element PCR (Rep-PCR) genotyping Genotyping of the isolates was performed using repetitive extragenic palindromic element PCR (Rep-PCR) analysis with the aim of finding a perspective of clonal relation. The Rep-like elements in the bacterial chromosomes were amplified using Rep 1 and Rep 2 specific primers (Table 1). The PCR products were analyzed using electrophoresis (1% agarose) at 90 V for 1.5 h. Also, the Rep-PCR DNA profiles of the A. baumannii isolates were analyzed using Gelcompar II software, version 4.0 (Applied Maths, Belgium). Evaluation of Rep type similarity and cluster relationship analysis of Rep-PCR were done using dice coefficient and unweighted pair group method with arithmetic averages (UPGMA). 2.6. Statistical analysis SPSS, version 22.0 (IBM Corp., NY, USA) was used for statistical analysis. The groups under the study were assessed via Chi-square test for categorical variables and independent t-test for differences in the mean change between groups. A p-value < 0.05 was considered to be statistically significant.
Please cite this article in press as: Salehi B, et al., Emergence and characterization of nosocomial multidrug-resistant and extensively drugresistant Acinetobacter baumannii isolates in Tehran, Iran, J Infect Chemother (2018), https://doi.org/10.1016/j.jiac.2018.02.009
B. Salehi et al. / J Infect Chemother xxx (2018) 1e9
3
Table 1 Primer sets used in this study. PCR target
Primer Sequence (50 -30 )
Product size (bp)
Annealing Temperature (oC)
References
blaOXA-51-like
F: TAA TGC TTT GAT CGG CCT TG R: TGG ATT GCA CTT CAT CTT GG F: GAT CGG ATT GGA GAA CCA GA R: ATT TCT GAC CGC ATT TCC AT F: GGT TAG TTG GCC CCC TTA AA R: AGT TGA GCG AAA AGG GGA TT F: AAG TAT TGG GGC TTG TGC TG R: CCC CTC TGC GCT CTA CAT AC F: AGTCACGCGAAGTTGAAGGT R: GCGGTATGGAGTTTCCAAGA Rep1: IIIICGICGICATCIGGC Rep2: ICGICTTATCIGGCCTAC
353
54
[11]
501
54
[11]
246
54
[11]
599
54
[11]
542
55
[14]
Variable
43
[15]
blaOXA-23 blaOXA-24 blaOXA-58 rpoB Rep-elements
bp, base pair; F, forward primer; R, reverse primer.
3. Results 3.1. Characterization of A. baumannii isolates and antimicrobial susceptibility A total of 125 non-duplicate clinical isolates of A. baumannii (from 53 females and 72 males, with the mean age of 51.90 years old) were collected from a 564-bed medical educational hospital. The specimens from which bacteria were obtained comprised of sputum (52.8%, n ¼ 66), wound (12.7%, n ¼ 16), urine (12.7%, n ¼ 16), blood (9.5%, n ¼ 12), catheter (7.1%, n ¼ 9), eye (0.8%, n ¼ 1),
CSF (2.4%, n ¼ 3) and other body fluids (1.6%, n ¼ 2). A majority of clinical isolates were collected from ICU (75%, n ¼ 93) and others were from surgery, neurology, orthopedic, infection, internal, and neonatal wards, in the order of percentage. Moreover, 22 environmental A. baumannii were collected from hospital setting. The distribution of the environmental isolates from various sites is illustrated in Fig. 1. Table 2 shows the antimicrobial resistance pattern. In our study, all the clinical isolates (n ¼ 125) were considered as MDR and 40% (n ¼ 50) as XDR isolates. Among environmental isolates, 81.8% (n ¼ 18) A. baumannii were MDR and 50% (n ¼ 11) isolates XDR (5
Fig. 1. Clonal spread of environmental isolates (EI). Rep types, Rep elements pattern for each isolate using Rep-PCR method; antimicrobial resistance pattern, resistance profile of isolates obtained from antimicrobial susceptibility testing; clone, denoting isolates with common features emerged from a single ancestral strain. ICU, Intensive Care Unit; XDR, Extensively Drug Resistant; MDR, Multiple Drug Resistant. Common types are illustrated with brackets.
Please cite this article in press as: Salehi B, et al., Emergence and characterization of nosocomial multidrug-resistant and extensively drugresistant Acinetobacter baumannii isolates in Tehran, Iran, J Infect Chemother (2018), https://doi.org/10.1016/j.jiac.2018.02.009
4
B. Salehi et al. / J Infect Chemother xxx (2018) 1e9
Table 2 Antimicrobial susceptibility of clinical and environmental A.baumannii isolates. Antimicrobial agent
Piperacillin/tazobactam Trimethoprim/sulfamethoxazole Ceftriaxone Ceftazidime Cefepimea Ciprofloxacin Levofloxacina Meropenem Imipenema Gentamicin Amikacin Tigecycline Colistina a b
Clinical isolates; No (%)
Environmental isolates; No (%)
S
I
R
MIC50/90
S
I
R
MIC50/90
0 (0) 1 (0.8) 0 (0) 1 (0.8) 1 (0.8) 0 (0) 1 (0.8) 1 (0.8) 6 (4.8) 6 (4.8) 21 (16.8) 24 (19.2) _
0 (0) 0 (0) 1 (0.80) 0 (0) 13 (10.4) 1 (0.8) 1 (0.8) 0 (0) 5 (4) 4 (3.2) 31 (24.8) 99 (79.2) _
125 (100) 124 (99.2) 124 (99.2) 124 (99.2) 111 (88.8) 124 (99.2) 123 (98.4) 124 (99.2) 114 (91.2) 115 (92) 73 (58.4) 2 (1.6) _
_ _ _ _ 192/256 _ 6/32 _ 32/32 _ _ _ 0.75/1.0b
4 (18.18) 4 (18.18) 3 (13.64) 4 (18.18) 4 (18.18) 4 (18.18) 4 (18.18) 4 (18.18) 5 (22.73) 5 (22.73) 6 (27.27) 11 (50) _
0 (0) 0 (0) 1 (4.54) 0 (0) 10 (45.46) 0 (0) 0 (0) 0 (0) 1 (4.54) 1 (4.54) 5 (22.73) 11 (50) _
18 (81.82) 18 (81.82) 18 (81.82) 18 (81.82) 8 (36.36) 18 (81.82) 18 (81.82) 18 (81.82) 16 (72.73) 16 (72.73) 11 (50) 0 (0) _
_ _ _ _ 16/64 _ 12/48 _ 16/32 _ _ _ 0.5/1.0b
MIC evaluated for these four antibiotics using E-test method (S, sensitive; I, intermediate; R, resistant.). According to CLSI 2016, MIC interpretive criteria for colistin are as follows: 2 (mg/ml): sensitive and 4 (mg/ml): resistant.
isolates were from ICU). In addition, a total of 142 (96.59%) CRAB isolates were assessed. All of the isolates were susceptible to colistin and we discovered 77% tigecycline non-susceptible A. baumannii strains. 3.2. Detection of OXA-like resistance genes The PCR analysis demonstrated that in addition to all clinical isolates, all environmental isolates had blaoxa-51-like. Blaoxa-23-like with the rate of 59.2% (n ¼ 74) was the most prevalent gene among clinical isolates and moreover 14 and only 2 isolates were positive for OXA-58 and OXA-24, respectively. Besides, 6 out of 22 environmental isolates had OXA-23-like gene. 3.3. Genotypic analysis and clonal relationship The MDR clinical isolates of A. baumannii together with environmental isolates (147 isolates) clustered into 38 common types and 33 single types, which were concluded from Rep-PCR typing. These Rep-PCR clusters were considered at 80% similarity. Some of the common types, comprising of 2 to max 9 strains, consisted of both clinical and environmental isolates. With the intention of associating and comparing the clusters, sampling sites, carbapenem resistance genes, and antimicrobial resistant profiles are illustrated in Figs. 1 and 2. 4. Discussion A.baumannii is principally remarkable for its propensity to turn out to be MDR and XDR worldwide, specifically in the developing countries [5]. In the present investigation, we firstly assessed the resistance profile which demonstrated high ratios of resistance except for colistin and tigecycline. These two effective antibiotics play a major role in determining XDR isolates and have synergistic effects with other antibiotic families against drug-resistant A.baumannii, even though colistin is nephrotoxic and neurotoxic [4]. Following 100% colistin sensitivity, our results were in line with those presented by Farshadzade et al. from Tehran, but in contradiction with those of Maspi et al., who reported 52% sensitivity for colistin in the same city. The interesting point to consider in this study was the high incidence of tigecycline non-susceptible A. baumannii strains (77%), which is in contrast with the findings reported in the previous studies in Iran [4,10,16]. Furthermore, we evaluated some of the noteworthy drug resistant A. baumannii strains that have been risen much concerns
in hospital infections. In the current study, XDR frequency of the clinical isolates was similar to that reported by Nasrolahei et al., in 2014 (37%). However, the rates of XDR in Maspi et al., in 2016 and Bahador et al., in 2015 were reported to be 70% and 20%, respectively [10,17,18], which indicates the increased rate of XDR incidence in Iran. Moreover, our findings indicated that a majority (97%) of the collected isolates were considered as MDR strains, which was closely similar to the incidence of MDR strains in other reports in Iran (94%) [10], (97%) [19] and Malaysia (>70%) [6], but higher than that reported in India (54%) [20]. The reported frequencies of MDR strains from Iran have been high (>65%) during the past two years. Therefore, combination of two classes of antibiotics are recommended in the treatment of drug resistant A. baumannii infections [10,18,19]. The limited treatment alternatives caused by MDR strains can increase the use of colistin and tigecycline as the last-line therapeutic agents [12,21]. Proper procedures to disinfect patient surroundings, severe patient screening, controlling infection reservoir, fortifying routine hygiene, and discriminating the prescription of broad-spectrum antibiotics can be implemented with the hope of preventing nosocomial XDR and MDR strains transmission and abstaining intermittent outbreaks [22,23]. Although carbapenems are the first line choice in the treatment of A. baumannii infections, the occurrence of MDR and XDR carbapenem-resistant clones in hospital epidemics worldwide has caused a great deal of concern. Thus, to achieve an efficacious and adequate treatment essentially for patients in critical care units and then managing the imminent outbreaks, especial precautionary approaches should be executed [9]. OXA-type b-lactamases have a main role in the emergence of CRAB isolates and are the most prevalent carbapenemases in A. baumannii. In multiplex PCR outcome, 54% (80/147) of our isolates harbored blaOXA-23-like gene similar to the results of another study in Iran by Nasrolahei et al. [17]. On the other hand, Kohlenberg et al. and Andriamanantena et al. reported a 100% prevalence of blaOXA-23-like among clinical isolates of A. baumannii meaning that this gene has the highest percentage among OXA-like genes [5,16,19,24,25]. Thereafter, 9% (14/147) and 1% (2/147) of the isolates had blaOXA-58-like and blaOXA24-like, respectively. However, blaOXA-58 and blaOXA-24 were not detected in environmental isolates. BlaOXA-24-like gene has the least prevalence among OXA-type carbapenemases as reported in former studies [11,25,26]. Also, another report from Iran showed increased incidence rate of blaOXA-24 (64%) [19]. Furthermore, presence of insertion sequence (IS) elements such as ISAba1 in upstream of OXA-23, OXA-24/40, and OXA-51 genes as a strong
Please cite this article in press as: Salehi B, et al., Emergence and characterization of nosocomial multidrug-resistant and extensively drugresistant Acinetobacter baumannii isolates in Tehran, Iran, J Infect Chemother (2018), https://doi.org/10.1016/j.jiac.2018.02.009
B. Salehi et al. / J Infect Chemother xxx (2018) 1e9
5
Fig. 2. Rep-PCR typing of all the clinical samples and the environmental strains, sample site, carbapenem resistant genes and antimicrobial resistant profiles. AN, amikacin; LEV, levofloxacin; GM, gentamicin; FEP, cefepime; IMP, imipenem; MEM, meropenem; COT, cotrimoxazol; PTZ, piperacillin-tazobactam; CIP, ciprofloxacin; CAZ, ceftazidem; CRO, ceftriaxone; EI, environmental isolates. Common types are illustrated with brackets.
promoter, can lead to overexpress of oxacillinase encoding genes and increase the rate of resistance to carbapenems according to previous studies [6,12,18]. In the current study, we found a high prevalence of CRAB (96%) based on the antimicrobial susceptibility results that was similar to the findings reported in Iran by Farsiani et al. (97%) and India by Ringa et al. (85%) [19,21]. However, these findings do not support those in Abdalhamid et al. in Saudi Arabia [27]. According to phenotypic results of carbapenems (imipenem and meropenem) in
our study, a majority of isolates confirm carbapenem resistant phenotype; on the other hand, we only detected OXA-type genes whereas other resistant mechanisms exist. Except for CHDLs OXAlike enzymes (for instance OXA-23, -24/40, -48, -58, and -143 types), especially OXA-23, which are the major cause of carbapenem resistant in A. baumannii, there are other carbapenem hydrolyzing enzymes, like class B metallo-b-lactamases (MBLs) (most current; VIM-1, IMP-1, NDM-1, and SIM-1) and Ambler class A blactamases (such as KPC-2 and GES-14). Likewise, efflux pumps,
Please cite this article in press as: Salehi B, et al., Emergence and characterization of nosocomial multidrug-resistant and extensively drugresistant Acinetobacter baumannii isolates in Tehran, Iran, J Infect Chemother (2018), https://doi.org/10.1016/j.jiac.2018.02.009
6
B. Salehi et al. / J Infect Chemother xxx (2018) 1e9
Fig. 2. (continued)
decreased permeability of outer membrane (OM), and penicillinbinding proteins alteration are known to contribute to the emergence of CRAB strains [5,7,9]. According to a study in 2016 in Tehran, Iran; the prevalence of VIM-1, IMP-1, NDM-1, and SIM-1 genes were 2.3%, 15.1%, 0%, and 2.3%, respectively [10]. The prospect of this microorganism transmission within the different wards of hospitals has become the turning-point of the
spread of resistance amongst the strains and their constancy in any corner of environments principally in ICU, which consequently increases hospitalization period [22]. In the current study, most of the isolates were collected from ICU, which was in consistent with the previous studies in Iran [10,19] and in India [21]. Since the temperature and humidity of ICU atmosphere is appropriate for stability of opportunistic pathogens, surveillance should be the first
Please cite this article in press as: Salehi B, et al., Emergence and characterization of nosocomial multidrug-resistant and extensively drugresistant Acinetobacter baumannii isolates in Tehran, Iran, J Infect Chemother (2018), https://doi.org/10.1016/j.jiac.2018.02.009
B. Salehi et al. / J Infect Chemother xxx (2018) 1e9
7
Fig. 2. (continued)
crucial stage in stabilizing the priorities of patients' health with immunodeficiency to preclude suffering from nosocomial infections [28]. Among ICU isolates, we acquired 38 clinical and 4 environmental XDR strains. The presence and dissemination of XDR strains in such critical wards are a great threat in the infection control issues. Circulation of A. baumannii inside the hospital via patients' contact can occur directly or indirectly by an individual colonized with A. baumannii, which was able to contaminate the inanimate surroundings. Moreover, healthcare staff have a critical role in the transmission of such healthcare-associated pathogens to other patients or medical equipment, most frequently with contaminated hands, which clarifies the prominence of hand hygiene [23]. As it is shown in Fig. 1, in three cases, the role of nurse hands in contamination of the high-touch surfaces near the patients and hospital environment is evident. Several epidemiological typing methods have been introduced with the purpose of investigating the A. baumannii distribution
within hospitals, finding out the association between circulating clones and reservoir of infection, and assessing the incidence of antimicrobial resistance so as to develop proper guidelines to prevent nosocomial infections. We employed Rep-PCR, which is a practicable PCR-based typing method and has a high discriminatory power and, moreover, is a cost-effective, fast and feasible molecular technique for assessment of clonal relatedness and genetic profiles of circulating local isolates in a hospital [6,29]. The clonal relationship of environmental isolates is shown in Fig. 1. Among all clones, clone G is comprised of most isolates (n ¼ 5), which were collected from three wards: neurology, ICU, and orthopedic. The antibio-type profile of all these five isolates was similar. Among the strains in the mentioned clone, the only environmental isolate harboring blaOXA-23-like gene, that has an important contribution to resistance to carbapenem agents, was recovered from the hand of a nurse in ICU. The other isolates were found from the near patient settings in neurology and orthopedic wards that confirm the circulation of isolates.
Please cite this article in press as: Salehi B, et al., Emergence and characterization of nosocomial multidrug-resistant and extensively drugresistant Acinetobacter baumannii isolates in Tehran, Iran, J Infect Chemother (2018), https://doi.org/10.1016/j.jiac.2018.02.009
8
B. Salehi et al. / J Infect Chemother xxx (2018) 1e9
In Fig. 2, we have provided a dendrogram of all 147 clinical and environmental isolates all together in comparison with each other in some characteristic, including detection of OXA-type genes, site of sampling, and antibiotic resistance profile. Hereby we can reconnoiter the dissemination of isolates between wards, patients, health-workers, medical electronic devices, and patients surrounding to discuss the sources of the infections and the outbreaks in the hospital. Since the majority of isolates are MDR and, furthermore, we had observed the incidence of XDR A. baumannii strains emerging particularly in ICU, taking into account the emergency state of the patients, circulation of declared strains are crucial in the increase in morbidity and mortality rate. The clone number 10 (C10) in Fig. 2 consists of 9 strains with antibio-type resemblance. Seven isolates were collected from ICU, yet two others, one of which was environmental, are from others wards, which reveals the probable transmission of these isolate between distant parts by healthcare staff or transferring of patients or devices. The excessive number of clones specifies different reservoirs and among them a considerable number of single clones reveals that they were derived from distinct strains. The variety of reservoirs can be due to both hospital-acquired and communityacquired infection, sharing of common healthcare workers and transmission of patients between hospitals. The most probable cause of such nosocomial infections is inappropriate antiseptic practices and verification for eliminating A. baumannii infections in hospitals since this microorganism can persist in the environment and therefore gives rise to the risk of infections in bedridden individuals. A limitation of the present study was lack of a molecular epidemiological genotyping with higher discriminatory power, which is the gold standard method for typing of A. baumannii strains, e.g., pulse-field gel electrophoresis (PFGE).
5. Conclusion Our findings highlight the intra-hospital spread of resistant isolates which can be problematic particularly in ICUs. Taking into account these findings, we can promote therapeutic policies and stabilize strict and continuous surveillance and prevention programs in the control of nosocomial infections so as to reduce the dissemination of refractory isolates in further epidemic and endemic incidences in the hospitals. To eradicate the occurrence of multidrug-resistant organisms (MDROs), based on the Healthcare Infection Control Practices Advisory Committee (HICPAC) recommendations, which provides guidance to Centers for Disease Control and Prevention (CDC) concerning control of infections as well as strategies for surveillance, seven categories are to be considered; education, prudential use of antibiotics, decolonization, routine and enhanced surveillance, infection control precautions, administrative support, and environmental measures [30].
Authors contribution Bahare Salehi: Conception of study, analysis and interpretation of data, revising and final approval. Hossein Goudarzi: Acquisition of data, drafting and final approval. Bahram Nikmanesh: Acquisition of data, drafting and final approval. Hamidreza Houri: Interpretation and acquisition of data, revising and final approval. Mostafa Alavi- Moghaddam: Acquisition of data and final approval. Zohreh Ghalavand: Design of the study and acquisition of data, revising and final approval of the version to be submitted.
Conflicts of interest We wish to confirm that there are no known conflicts of interest associated with this publication and there has been no significant financial support for this work that could have influenced its outcome. Acknowledgment We would like to thank the members of the Department of Microbiology at the School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, for their kind cooperation. References [1] Armin S, Karimi A, Fallah F, Tabatabaii SR, Alfatemi SMH, Khiabanirad P, et al. Antimicrobial resistance patterns of Acinetobacter baumannii, Pseudomonas aeruginosa and Staphylococcus aureus isolated from patients with nosocomial infections admitted to tehran hospitals. Arch Pediatr Infect Dis 2015;3. [2] Moghnieh R, Siblani L, Ghadban D, El Mchad H, Zeineddine R, Abdallah D, et al. Extensively drug-resistant Acinetobacter baumannii in a Lebanese intensive care unit: risk factors for acquisition and determination of a colonization score. J Hosp Infect 2016;92:47e53. [3] Santajit S, Indrawattana N. Mechanisms of antimicrobial resistance in ESKAPE pathogens. BioMed Res Int 2016;2016:2475067. [4] Lei J, Han S, Wu W, Wang X, Xu J, Han L. Extensively drug-resistant Acinetobacter baumannii outbreak cross-transmitted in an intensive care unit and respiratory intensive care unit. Am J Infect Control 2016;44:1280e4. [5] Zenati K, Touati A, Bakour S, Sahli F, Rolain JM. Characterization of NDM-1and OXA-23-producing acinetobacter baumannii isolates from inanimate surfaces in a hospital environment in Algeria. J Hosp Infect 2016;92:19e26. [6] Biglari S, Hanafiah A, Mohd Puzi S, Ramli R, Rahman M, Lopes BS. Antimicrobial resistance mechanisms and genetic diversity of multidrug-resistant acinetobacter baumannii isolated from a teaching hospital in Malaysia. Microb Drug Resist (Larchmont, NY) 2017;23:545e55. [7] Al-Agamy MH, Jeannot K, El-Mahdy TS, Shibl AM, Kattan W, Plesiat P, et al. First detection of GES-5 carbapenemase-producing acinetobacter baumannii isolate. Microb Drug Resist (Larchmont, NY) 2017;23:556e62. [8] Mirnejad R, Mostofi S, Masjedian F. Antibiotic resistance and carriage class 1 and 2 integrons in clinical isolates of acinetobacter baumannii from Tehran, Iran. Asian Pac J Trop Biomed 2013;3:140e5. [9] Pourhajibagher M, Hashemi FB, Pourakbari B, Aziemzadeh M, Bahador A. Antimicrobial resistance of acinetobacter baumannii to imipenem in Iran: a systematic review and meta-analysis. Open Microbiol J 2016;10:32e42. [10] Maspi H, Mahmoodzadeh Hosseini H, Amin M, Imani Fooladi AA. High prevalence of extensively drug-resistant and metallo beta-lactamase-producing clinical acinetobacter baumannii in Iran. Microb Pathog 2016;98:155e9. [11] Woodford N, Ellington MJ, Coelho JM, Turton JF, Ward ME, Brown S, et al. Multiplex PCR for genes encoding prevalent OXA carbapenemases in Acinetobacter spp. Int J Antimicrob Agents 2006;27:351e3. [12] Wright MS, Iovleva A, Jacobs MR, Bonomo RA, Adams MD. Genome dynamics of multidrug-resistant acinetobacter baumannii during infection and treatment. Genome Med 2016;8:26. [13] Chang HL, Tang CH, Hsu YM, Wan L, Chang YF, Lin CT, et al. Nosocomial outbreak of infection with multidrug-resistant acinetobacter baumannii in a medical center in Taiwan. Infect Control Hosp Epidemiol 2009;30:34e8. [14] Lin MF, Lin YY, Yeh HW, Lan CY. Role of the BaeSR two-component system in the regulation of Acinetobacter baumannii adeAB genes and its correlation with tigecycline susceptibility. BMC Microbiol 2014;14:119. [15] Snelling AM, Gerner-Smidt P, Hawkey PM, Heritage J, Parnell P, Porter C, et al. Validation of use of whole-cell repetitive extragenic palindromic sequencebased PCR (REP-PCR) for typing strains belonging to the Acinetobacter calcoaceticus-Acinetobacter baumannii complex and application of the method to the investigation of a hospital outbreak. J Clin Microbiol 1996;34: 1193e202. [16] Farshadzadeh Z, Hashemi FB, Rahimi S, Pourakbari B, Esmaeili D, Haghighi MA, et al. Wide distribution of carbapenem resistant Acinetobacter baumannii in burns patients in Iran. Front Microbiol 2015;6:1146. [17] Nasrolahei M, Zahedi B, Bahador A, Saghi H, Kholdi S, Jalalvand N, et al. Distribution of bla(OXA-23), ISAba, Aminoglycosides resistant genes among burned & ICU patients in Tehran and Sari, Iran. Ann Clin Microbiol Antimicrob 2014;13:38. [18] Bahador A, Raoofian R, Pourakbari B, Taheri M, Hashemizadeh Z, Hashemi FB. Genotypic and antimicrobial susceptibility of carbapenem-resistant Acinetobacter baumannii: analysis of ISAba elements and blaOXA-23-like genes including a new variant. Front Microbiol 2015;6. [19] Farsiani H, Mosavat A, Soleimanpour S, Nasab MN, Salimizand H, Jamehdar SA, et al. Limited genetic diversity and extensive antimicrobial resistance in clinical isolates of acinetobacter baumannii in North-East Iran. J Med Microbiol 2015;64:767e73.
Please cite this article in press as: Salehi B, et al., Emergence and characterization of nosocomial multidrug-resistant and extensively drugresistant Acinetobacter baumannii isolates in Tehran, Iran, J Infect Chemother (2018), https://doi.org/10.1016/j.jiac.2018.02.009
B. Salehi et al. / J Infect Chemother xxx (2018) 1e9 [20] Dash M, Padhi S, Pattnaik S, Mohanty I, Misra P. Frequency, risk factors, and antibiogram of Acinetobacter species isolated from various clinical samples in a tertiary care hospital in Odisha, India. Avicenna J Med 2013;3:97. [21] Rynga D, Shariff M, Deb M. Phenotypic and molecular characterization of clinical isolates of Acinetobacter baumannii isolated from Delhi, India. Ann Clin Microbiol Antimicrob 2015;14:40. R, Tannenbaum T, Lefebvre B, Le vesque S, et al. Man[22] Gray A, Allard R, Pare agement of a hospital outbreak of extensively drug-resistant Acinetobacter baumannii using a multimodal intervention including daily chlorhexidine baths. J Hosp Infect 2016;93:29e34. [23] Casini B, Selvi C, Cristina M, Totaro M, Costa A, Valentini P, et al. Evaluation of a modified cleaning procedure in the prevention of carbapenem-resistant Acinetobacter baumannii clonal spread in a burn intensive care unit using a high-sensitivity luminometer. J Hosp Infect 2017;95:46e52. [24] Kohlenberg A, Brümmer S, Higgins PG, Sohr D, Piening BC, de Grahl C, et al. Outbreak of carbapenem-resistant Acinetobacter baumannii carrying the carbapenemase OXA-23 in a German university medical centre. J Med Microbiol 2009;58:1499e507. [25] Andriamanantena TS, Ratsima E, Rakotonirina HC, Randrianirina F, Ramparany L, Carod J-F, et al. Dissemination of multidrug resistant
[26]
[27]
[28]
[29]
[30]
9
acinetobacter baumannii in various hospitals of Antananarivo Madagascar. Ann Clin Microbiol Antimicrob 2010;9:17. Cherkaoui A, Emonet S, Renzi G, Schrenzel J. Characteristics of multidrugresistant Acinetobacter baumannii strains isolated in Geneva during colonization or infection. Ann Clin Microbiol Antimicrob 2015;14:42. Abdalhamid B, Hassan H, Itbaileh A, Shorman M. Characterization of carbapenem-resistant acinetobacter baumannii clinical isolates in a tertiary care hospital in Saudi Arabia. New Microbiol 2014;37:65e73. Choi JY, Kwak YG, Yoo H, Lee SO, Kim HB, Han SH, et al. Trends in the incidence rate of device-associated infections in intensive care units after the establishment of the Korean nosocomial infections surveillance system. J Hosp Infect 2015;91:28e34. Salimizand H, Menbari S, Ramazanzadeh R, Khonsha M, Saleh Vahedi M. DNA fingerprinting and antimicrobial susceptibility pattern of clinical and environmental Acinetobacter baumannii isolates: a multicentre study. J Chemother (Florence, Italy) 2016;28:277e83. Seigel JDRE, Jackson M, Chairello L. Healthcare infection control practices advisory committee. Management of multidrug-resistant organisms. In: Healthcare settings; 2006. Available at: https://www.cdc.gov/infectioncontrol/ pdf/guidelines/mdro-guidelines.pdf (last accessed July 2017).
Please cite this article in press as: Salehi B, et al., Emergence and characterization of nosocomial multidrug-resistant and extensively drugresistant Acinetobacter baumannii isolates in Tehran, Iran, J Infect Chemother (2018), https://doi.org/10.1016/j.jiac.2018.02.009