- Email: [email protected]
EMX homeobox genes regulate microphthalmia and alter melanocyte biology
Experimental Cell Research 311 (2005) 27 – 38 www.elsevier.com/locate/yexcr
Research Article
EMX homeobox genes regulate microphthalmia and alter melanocyte biology Walter Bordogna a,1, James D. Hudson a, Joanna Buddle c, Dorothy C. Bennett d, David H. Beach a,e, Amancio Carnero b,* b
a Wolfson Institute for Biomedical Research, London WC1E 6BT, UK Experimental Therapeutics Programme, Spanish National Cancer Centre (CNIO), c/Melchor Fernandez Almagro n-3 28029 Madrid, Spain c Institute of Child Health, London WC1N 1EH, UK d St. George’s Hospital Medical School, London SW17 0RE, UK e Center for Cutaneous Biology, Institute for Cell and Molecular Sciences, 2 Newark St., Whitechapel, E12AT London, UK
Received 16 May 2005, revised version received 26 July 2005, accepted 5 August 2005 Available online 27 September 2005
Abstract Melanocytes are specialized cells that produce melanin, the pigment responsible for skin, hair and retina color. They derive during embryogenesis from the precursor cells melanoblasts, which are neural crest cells committed to the pigment cell lineage. The differentiation of melanoblasts into melanocytes involves the expression of melanocyte-specific genes, particularly those responsible for melanin production, such as Tyr, Tyrp-1 and Dct, the expression of which depends on the melanocyte-specific transcription factor microphthalmia (Mitf). We have developed and executed a functional screen on melanocytes, with the aim of identifying genes involved in pigment cell biology. We have found Emx1 and Emx2, two highly related homeobox genes that when overexpressed in melanocytes can downregulate Mitf, Tyrp1, Dct and Tyr. Constitutive expression of Emx alters pigment cell morphology and growth properties: it confers TPA independence but not the ability to grow in soft agar. Spatial and temporal expression of Emx and Mitf during embryonic development suggests that Emx could be one factor that regulates correct expression of Mitf by inhibiting its activation in neuroepithelial derivatives other than melanocytes. D 2005 Elsevier Inc. All rights reserved. Keywords: Microphthalmia; Melanocyte; EMX; Genetic screening
Introduction Melanocytes are specialized cells that produce melanin, the pigment responsible for skin, hair and retina color [1,2]. While melanocytes of the retinal pigment epithelium (RPE) originate from the optic cup and therefore derive from the neuroectoderm of the forebrain, pigment cells of the skin and hair follicle originate from precursor cells called melanoblasts, which are neural crest-derived cells committed to the pigment cell lineage. The differentiation of * Corresponding author. Fax: +34 91 224 6976. E-mail address: [email protected] (A. Carnero). 1 Current address: Argenta Discovery, 8/9 Spire Green Centre, Flex Meadow, CM19 5TR Harlow, UK. 0014-4827/$ - see front matter D 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.yexcr.2005.08.013
melanoblasts into pigment-producing melanocytes involves the expression of melanocyte-specific genes, including several enzymes responsible for melanin production (Tyr/ tyrosinase, Tyrp-1 and Dct), the expression of which depends on the melanocyte-specific transcription factor, microphthalmia-associated transcription factor (Mitf) [2– 5]. The activation of Mitf in melanoblasts causes profound functional and phenotypic alterations, so that the derived melanocytes show little resemblance to their precursors. The most obvious differences between the two cell types are the high degree of dendricity and pigmentation of melanocytes as opposed to the unpigmented and generally round-shaped melanoblasts [6,7]. Activation of Mitf is also essential for the correct development of RPE melanocytes in the optic cup, and
28
W. Bordogna et al. / Experimental Cell Research 311 (2005) 27 – 38
lack of Mitf activity leads to the loss of these pigmented cells resulting in a phenotype characterized by small eye size, also known as microphthalmia [8]. Mutations affecting melanocyte growth regulation can lead to their uncontrolled proliferation and cancer. Although malignant melanoma is less common among skin cancers, its incidence is rapidly increasing, and it currently represents one of the fastest growing cancers worldwide, especially among Caucasians [9]. Interestingly, similarities can be observed between melanoblasts and unpigmented melanoma cells such as lack of pigmentation in some advanced melanomas (amelanotic melanoma) and downregulation of the melanogenic enzymes Tyr, Tyrp1 and Dct [10]. Furthermore, melanocyte cell lines have been reported to lose differentiation traits such as dendricity and pigmentation when transfected with oncogenes such as activated Ras, Neu, FGF2, Myc, E1A and Braf [11– 16]. Mitf is a basic-helix– loop-helix/leucine-zipper (bHLHZip) transcription factor whose mutation produces melanocyte defects in mice and humans [2,5]. Mitf belongs to the Myc superfamily of transcription factors and binds E box sequences [17–19]. The three major pigmentary enzymes, Tyr, Tyrp1 and Dct, are transcriptional targets of Mitf [4,17,20–22], suggesting that the pigmentation pathway in general is regulated by Mitf’s activity. Other targets involved in melanocytic differentiation include the Silv/ Pmel17 gene [23], which encodes the GP100/HMB45 antigen commonly used for melanoma diagnosis and immune therapy [24,25], receptors Kit and Mc1r, and survival factor Bcl2 [2]. Mitf deficiency affects melanocyte viability as well as pigmentation, suggesting that transcriptional targets other than pigment genes are also likely to be of significance. While the expression of many melanocytic markers is often lost in melanoma, Mitf expression is usually (if not always) maintained in human melanoma specimens, suggesting that Mitf might be particularly important for melanoma maintenance (reviewed in [26]). One particular Mitf target that may be of relevance for viability is Bcl2 [27]. However, Bcl2 cannot fully mediate Mitf’s proliferation/survival effects because Mitf deficiency produces earlier melanocyte deficiency than Bcl2 knockout. In addition, Bcl2 overexpression cannot rescue clonogenic growth in the setting of Mitf disruption in melanoma cells [27]. Mitf might also modulate CDK2 expression in melanocytes, and CDK2 expression levels are tightly correlated to Mitf levels in a panel of primary human melanomas and melanoma cell lines. In addition, functional studies have shown that CDK2 regulation by Mitf is essential for melanoma clonogenic growth [28]. The importance of Mitf as a determining factor in melanocyte development was highlighted when it was shown that expression of Mitf in fibroblasts expressing ectopic Dct conferred on them characteristics of melanocytes [29]. Similarly, ectopic expression of Mitf can induce transdifferentiation of neuroretina in melanocytes [30], and misexpression of Mitf in zebrafish results in ectopic
melanized cells [31]. Thus, it would appear that at least in some cells, the expression of Mitf is sufficient to establish a program of melanocyte-specific gene expression. Mitf is the earliest known marker of specification to the melanocyte lineage. Analysis of the promoter of the Mitf-M isoform in neural crest-derived melanocytes suggests that the onset of Mitf-M expression may be dictated by an array of cooperating transcription factors acting in synergy to raise Mitf expression above a critical threshold. To date, the transcription factors implicated in regulating the Mitf promoter include Pax3, CREB, Sox10, and Lef1 (via the Wnt pathway), each factor conferring the ability of responding to specific signals (reviewed in [2,32]). The link between Mitf expression and Pax3, Sox10, and Lef1 is underscored by the existence of known mutations in each of these genes that provoke loss of melanoblasts and, in the case of PAX3 and SOX10, syndromes characterized by pigmentation defects [1]. In this study, we describe the development and execution of a functional screen on melanocytes aimed at the identification of genes involved in pigment cell biology. We have found that Emx1 and Emx2, two highly related homeobox genes [33], when overexpressed in melanocytes, can downregulate Mitf transcription and alter pigment cell morphology and growth characteristics.
Materials and methods Cells Melan-a mouse melanocytes [34] were grown in RPMI 1640 medium (Gibco) supplemented with 10% FCS, 2 mM l-glutamine and 200 nM TPA. Cells were kept in a 37-C humidified incubator with 10% CO2. The ecotropic packaging cell line LinXE [35] was routinely kept in DMEM medium (Gibco) supplemented with 10% FCS and 50 Ag/ml hygromycin B, in a 5% CO2 humidified incubator at 37-C. When producing the virus, they were grown in RPMI medium (Gibco) supplemented with 10% FCS and 2 mM l-glutamine and grown in a 5% CO2 humidified incubator at 32-C. Library construction and screen strategy Tissues for RNA extraction (day 7 and day 15 mouse embryos, adult mouse testis and brain) were provided by Cold Spring Harbor Laboratories. RNA was extracted using TRIzol (Gibco, cat #15596-026) according to the manufacturer’s instructions. Messenger RNA (PolyA+) was enriched using an oligo-dT cellulose resin (Boehringer, cat #808 229). Construction of the library was performed using the ZAP Express cDNA synthesis and cloning kit (Stratagene, cat #200403 and #200451). The synthesized cDNAs were cloned into the EcoRI and XhoI sites of the pHygroMaRXII retroviral vector [35].
W. Bordogna et al. / Experimental Cell Research 311 (2005) 27 – 38
Ten 10-cm dishes of LinXE cells were transfected by the calcium phosphate method with 25 Ag of library DNA each. At 48 h post-transfection, viral supernatants were collected, filtered, supplemented with 8 Ag/ml of polybrene and 200 nM TPA, and used to infect twenty 10-cm dishes of melan-a seeded the day before at 5 104 cells/ml. After infection, cells were selected with 100 Ag/ml of hygromycin B for 10 days. The surviving cells were passed through a Cell Sorter (Beckman-Coulter ALTRA) using a 488-nm laser at 1500 cells/s with a pressure of 12 psi, gating for the unpigmented ones. Finally, cells were seeded at low density (250 cells/ml) to allow colony formation. After 14 days, unpigmented colonies were selected and subcloned to allow provirus recovery. Recovery of viral genomes and analysis of the recovered proviruses Genomic DNA was extracted from 5 106 cells using the Blood and Cell Culture DNA Midi Kit (Qiagen #13343). Ten micrograms of the genomic DNA recovered was treated with CRE recombinase, phenol extracted, ethanol precipitated and transformed into electrocompetent bacteria. The recovered proviruses were analyzed by restriction digestion, retested into melan-a cells and sequenced. Melanin assay Cells from a confluent 10-cm dish were lysed in 1 ml of lysis buffer (1% SDS, 10 mM Tris – Cl, pH 7, 100 mM EDTA). 10 Al was diluted in water to 200 Al and used to measure the protein content with a standard Bio-Rad protein assay. The remaining lysates were treated with H2O2 at a final concentration of 1% for 30 min at 80-C. Samples were diluted 1 in 5 with water, and melanin contents were measured with a spectrophotometer at 410 nm. Results were standardized to the protein content.
29
Generation of Emx1 mutants Emx1 mutants were generated by PCR using primers bearing restriction sites to facilitate cloning into the pHMII vector. Mutants were confirmed by sequencing. M0, M1, and M3 PCRs were performed with forward and reverse primers bearing an EcoRI or XhoI site respectively. Mutants M2 and M4 were generated by amplifying the relevant 5V and 3V portions with primers bearing the EcoRI and HindIII, and the HindIII and XhoI cloning sites respectively. Sequences in italic bold represent restriction sites: gaattc (EcoRI), ctcgag (XhoI), aagctt (HindIII). E1:ggggaatcc atgtgccaggcttggtgc; E3:gggaagcttaaacggcagaagctggaa; E4:gggctcgag tcacagcttctgccgtttgta; E5:ggggaattc atgggccgctcgctctatgga; E6:gggctcgagctagtcattggaggtgac; E7:gggaagctt cgcaagcccaagcggatt; E8:gggaagctt tgcgaagggcccgtgcaa; E10:gggaagctttccatagagcgagcggcc. M0: E1-E6; M1: E1-E4; M2: E1-E8 and E3-E6; M3: E5E6; M4: E1-E10 and E7-E6. Growth curves 2 103 melanocytes infected with either Emx1 or Emx2 were plated in 24-well plates in triplicate and grown in presence of 200 nM TPA. At 2-day intervals, cells were fixed and stained with crystal violet. Following extensive washing in water, the crystal violet dye was dissolved in 10% acetic acid and quantified at 595 nm as a relative measure of cell number. Growth in soft agar 104 cells were plated in 0.3% low-melting point agarose/ growth medium on to 6-cm dishes with a 0.5% agarose/ growth medium base. Colonies were left to grow for 21 days in a 37-C, 10% CO2 humidified incubator. Luciferase assays
Western blots Total cell lysates were prepared from a confluent 10-cm dish. Cells were trypsinized, washed in 1 PBS and lysed in 1 ml of lysis buffer. Genomic DNA was shredded by sonicating the sample through a 26-gauge needle, and insoluble material was removed spinning at 13,000 rpm for 10 min. 20 Ag of each sample (Bio-Rad protein assay) was electrophoresed on a 10% SDS-PAGE gel and transferred to a nitrocellulose membrane. Western blot analysis was carried out using standard procedures and detected using ECL (Amersham). Ab-1(C5) (NeoMarkers) was used to detect Mitf; TRP2(G15) (Santa Cruz) was used to detect Dct; aPEP7 and aPEP1 were provided by Dr. V. Hearing and were used to detect Tyr and Tyrp1, respectively; AC-74 (Sigma) was used to detect h-actin. HRP-conjugated anti-mouse, goat and rabbit IgG were from Santa Cruz.
Melan-a cells were seeded in 6-well plates and cultured during 24 h at 37-C. The medium was changed, and 2 h later, cells were transiently transfected with the appropriate DNAs using the lipofectamine protocol. Cells were washed with PBS, and, when necessary, a glycerol shock (medium supplemented with 10% glycerol) was performed for 1 min. Fresh medium was added to the transfected cells and cultured at 37-C. Cells were harvested 48 h after transfection and lysed with 200 ml of 1 Reporter Lysis Buffer (Promega). Lysates were frozen, thawed and centrifuged for 2 min at 13,200 rpm, 4-C. 20 ml of each sample was transferred to a 96-well plate and luciferase activity measured with the automated addition of 100 Al or luciferase substrate (Promega) by a Victor II (Wallac Oy) reader. Luciferase activity was normalized to the protein content of each sample (obtained through the Bradford procedure).
30
W. Bordogna et al. / Experimental Cell Research 311 (2005) 27 – 38
Fig. 1. Screening reconstruction. (A) Melan-a infected with pHMII/Agouti and pHMII/Hras(val12) lose differentiation traits such as pigmentation and dendricity (bright field pictures). (B) Unpigmented cells can be efficiently separated from pigmented melanocytes based on their forward and side scatter characteristics using a cell sorter. (C) Screening cascade. Following infection of melan-a with library cDNA and selection of infected cells using hygromycin, unpigmented cells were enriched using a cell sorter. Gated cells were collected, plated at low density and allowed to form colonies for 14 days. Unpigmented colonies were subcloned and expanded to allow for cDNA recovery.
W. Bordogna et al. / Experimental Cell Research 311 (2005) 27 – 38
Results Screen development In order to search for new genes involved in melanocyte differentiation, we decided to design a functional screen on the mouse melanocyte cell line melan-a. Since melanocytes derive from unpigmented precursor cells characterized by the absence of differentiation markers such as dendricity and melanin production, we used pigmentation, or rather the lack of it, as the selective marker for positive clones. In order to optimize the screening conditions, reconstruction experiments were carried out using melan-a cells co-infected with Agouti or activated Hras(val12) genes and the LacZ reporter gene. Agouti (agouti signal protein) is a secreted molecule known to compete with MSH for binding to the melanocortin 1 receptor (Mc1r) thereby producing a switch in melanin production from the default black eumelanin to yellow pheomelanin [36,37]. Activated Hras has been reported, together with other oncogenes such as bFGF and E1A, to provoke depigmentation when transduced in melanocytes [11 – 15]. Melan-a mouse melanocytes infected with either the pHMII/Agouti or the pHMII/Hras constructs became unpigmented in about a week (Fig. 1A) and could be efficiently separated from pigmented cells using a cell sorter (Fig. 1B). Reconstitution experiments were carried out by mixing Agouti/LacZ melan-a with wild type melan-a, followed by fluorescence activated cell sorting to select for the unpigmented population. The collected cells were seeded
31
at low density and left to grow for 14 days. Under these conditions, wild-type melan-a cells produced highly pigmented colonies, whereas the Agouti/LacZ infected ones produced colonies that were totally unpigmented. Identification of the unpigmented colonies was facilitated by X-Gal staining, and the enrichment of the Agouti infected melanocytes was estimated to be ¨300-fold from a ratio of 1/10,000 to 1/30. The screening was carried out as shown in Fig. 1C. Melan-a cells were infected with a mouse cDNA retroviral library with a complexity of 6 106 clones, and a total of 1.5 106 independent clones were screened. Successfully infected cells were selected with hygromycin B, and the unpigmented cell population was enriched using the cell sorter. The collected cells were seeded at low density (2500 cells/10-cm dish), and after 14 days, the unpigmented colonies were singly subcloned and expanded for genomic DNA extraction and excision of the provirus using the appropriate recombinase. Emx1 and Emx2 provoke depigmentation of melan-a Out of the 1.5 106 clones screened, the cDNA representing the Emx1 homeobox gene was isolated twice independently. The two independent clones were sequenced and were found to be almost identical except for the size of the PolyA+ tail, proving that they originated from different reverse transcriptase reactions during library construction. Our sequence shows that the Emx1 cds is 873 bp long resulting
Fig. 2. Emx protein sequences and domain structure. (A) Amino acid alignment of murine Emx1 and Emx2. The two proteins have high homology (80%). (B) Domain structure of the Emx1 and Emx2 genes. Ala-rich: alanine-rich domain; Pro-rich: proline-rich domain; HD: homeobox domain; NLS: nuclear localization signal.
32
W. Bordogna et al. / Experimental Cell Research 311 (2005) 27 – 38
in a predicted protein of 290 aa (Fig. 2A). The predicted Emx2 protein is 253 aa long and includes a proline-rich region (aa 79– 108), a homeobox domain (aa 153– 213) and a nuclear localization signal (aa 211 –228) (Fig. 2B).
Emx1 and Emx2 are homeobox transcription factors homologous to the Drosophila empty spiracles gene [33]. The two proteins are highly related (80% identity, Fig. 2A) and are believed to partially rescue each other in case of
W. Bordogna et al. / Experimental Cell Research 311 (2005) 27 – 38
inactivating mutations. In particular, the C-terminus of the two proteins, including the homeobox domains and the nuclear localization signal, shows 88% identity. For these reasons, we decided to investigate both Emx1 and Emx2 in relation to their biological effects when overexpressed in melan-a cells. The ability of both genes to induce loss of pigmentation when overexpressed in melan-a was assessed visually (Figs. 3A and B) and quantified with a melanin assay (Fig. 3C). These results clearly show that both genes can considerably reduce the amount of melanin produced to levels comparable to those observed using the Agouti positive control. Emx1 and Emx2 downregulate microphthalmia and melanogenic enzymes It has been previously shown that overexpression of oncogenes in melanocytes, such as activated Hras, causes loss of pigmentation through the downregulation of the melanocyte-specific transcription factor microphthalmia. This bHLH transcription factor promotes the expression of the melanogenic enzymes Tyr, Tyrp1 and, to a lower degree, Dct. To establish the effect of Emx1 or Emx2 overexpression on melanogenic enzyme levels, we performed Western blot analysis of cell extracts from wild-type, Hras(val12) infected and Emx1 or Emx2 infected melan-a. As shown in Fig. 3D, cells overexpressing each of these sequences had reduced levels of Mitf, Tyr, Tyrp1 and Dct proteins, suggesting that, as seen with oncogene overexpression, Emx1 and Emx2 cause microphthalmia downregulation and consequently melanocyte depigmentation. Although little is known about the transcriptional targets of the Emx genes, it is likely that these nuclear factors are involved in regulating the expression of genes implicated in brain development [38]. To assess whether the Emx genes alter the transcription of Mitf, we measured the expression of a luciferase reporter gene driven by the Mitf promoter, ectopically co-expressed in melanocytes with the Emx genes. We found that the expression of Emx genes reduced by 80 – 90% the transcriptional activation of the Mitf promoter (Fig. 3E). As a control, a non-specific DNA (lacZ) did not alter the activity of the promoter. To study whether EMX exhibit a non-specific repressing activity, we have performed transactivation assays of E2F-responsive promoters in the presence of EMX genes. Fig. 3F shows that EMX does not inhibit this promoter and, therefore, does not show an unspecific repressing activity.
33
Full length Emx gene is required for melan-a depigmentation In order to establish whether Emx1-triggered depigmentation in melanocytes is caused by its activity in the nucleus, we generated a mutant lacking the nuclear localization signal (M1). We also decided to investigate if any of the recognizable regions of the protein were indispensable for the observed phenotype. We therefore created mutants lacking the homeobox domain (M2), the alanine-rich region (M3) and the 83aa long region between the two (M4) (Fig. 4A). Mutants were generated by PCR reaction, subcloned into pHMII and tested for their ability to inhibit pigment production when overexpressed in melanocytes. As positive controls, we used the original Emx1 clone and the full length PCR amplification of the Emx1 cds (M0). As shown in Fig. 4B, none of the mutants were able to inhibit melanin synthesis, suggesting that the full-length protein is required for melan-a depigmentation. Emx1 and Emx2 overexpression promotes growth of melanocytes Since the pattern of melanogenic enzyme downregulation was similar to that observed when overexpressing oncogenes, we decided to investigate whether overexpression of the Emx genes could stimulate growth. 2 103 melanocytes infected with either Emx1 or Emx2 were plated in 24-well plates in triplicate and grown in the presence of 200 nM tetradecanoyl phorbol acetate (TPA). Melan-a cells infected with empty vector and Hras were used as controls. Cell growth was analyzed at different time points. As shown in Fig. 5A, melanocytes expressing either of the Emx genes were growing at a faster rate compared to those infected with empty vector or activated Hras. Indeed, in these conditions, melanocytes infected with Hras oncogene were the slowest to grow. This is probably because prolonged high doses of TPA can downregulate PKC activity, an important effector of Ras mediated mitogenic properties [39]. Melan-a cells are normally dependent on TPA for growth but, upon transduction with oncogenes, they can grow in the absence of the mitogen. We therefore tested the ability of Emx1 and Emx2 to confer TPA independence when overexpressed in melanocytes. This experiment was carried out by plating at low density (2000 cells in a 10-cm dish) melanocytes infected with empty
Fig. 3. Effects of Emx gene overexpression in melan-a cells on pigmentation and melanogenic enzyme expression. (A) Cells overexpressing Emx1 or Emx2 become unpigmented (bright field pictures). (B) mRNA levels of EMX1 and EMX2 genes ectopically expressed in melan-a cells. Northern blot was performed by random priming as reported elsewhere using EMX1 or EMX2 genes as templates. (C) Quantification of eumelanin in melan-a cells expressing Agouti, Emx1 or Emx2. Results were normalized to the total protein content. (D) Mitf, Tyr, Tyrp1 and Dct protein levels in cell lysates from control melan-a and melana expressing Hras(val12), Emx1 or Emx2. h-actin levels were assessed as loading control. (E) Luciferase expression under the control of the Mitf promoter is reduced upon co-transfection of constructs expressing activated Hras, Emx1 or Emx2. A lacZ control did not affect the reporter gene expression. Results were normalized to total protein content. (F) Luciferase expression under the control of an E2F-reponsive promoter is not altered by co-transfection with Emx1 or Emx2.
34
W. Bordogna et al. / Experimental Cell Research 311 (2005) 27 – 38
Fig. 4. Emx1 mutants and their effect on melan-a pigment production. (A) Schematic of the Emx1 mutants assessed. M0: full-length control; M1: deleted nuclear localization signal; M2: deleted homeobox domain; M3: deleted alanine-rich region; M4: deleted region comprised between the alanine-rich and the homeobox domains. (B) Quantification of eumelanin in control melan-a and melan-a cell expressing the original Emx1 clone and its mutants. Results were normalized to the total protein content.
pHMII (negative control), activated Hras (positive control) or the Emx clones in media containing 200 nM TPA or without the mitogen. Cells were grown for 12 days, and the resulting colonies were stained with crystal violet (Fig. 5B). EMX-infected melan-a grown without TPA formed roughly the same number of colonies as the control (Fig. 5B), although smaller in size. This suggests that Emx gene overexpression in melanocytes can confer TPA independence but growth remains at a faster rate in the presence of the mitogen.
colonies/104 cells). Neither the negative control nor the Emx1 or Emx2 infected cells were able to form colonies in soft agar (Fig. 5C). Collectively, these data suggest that overexpression of Emx1 or Emx2 in melanocytes, despite conferring growth advantages such as TPA independence and lower doubling time in the presence of TPA, does not cause the cells to lose anchorage dependence and therefore to acquire a fully transformed phenotype.
Melanocytes overexpressing Emx1 or Emx2 are not transformed
Discussion
In order to test the transforming potential of the Emx clones, we assessed cell growth in soft agar. 104 cells were seeded in triplicate in 6-well plates. Melanocytes infected with empty pHMII and Hras(val12) were used as negative and positive controls respectively. After 3 weeks, colonies were visible only in the Hras(val12) infected melanocyte cultures (average of 107
In this study, we have described the development and execution of a functional screen on melanocytes aimed at the identification of genes involved in pigment cell biology. We screened 1.5 106 clones, resulting in the isolation of two positive clones. These were sequenced and found to be two full-length independent clones of the Emx1 homeobox gene. Emx1 (like Emx2) was originally isolated by Simeone and collaborators in 1992 in an attempt to find murine
W. Bordogna et al. / Experimental Cell Research 311 (2005) 27 – 38
35
Fig 5. Emx gene overexpression in melan-a cells confers growth advantages. (A) Growth curves over a period of 10 days on control melan-a and melan-a expressing Hras(val12), Emx1 or Emx2. 2000 cells/well were seeded in 24-well plates in triplicate, and cell numbers were assessed at 2-day intervals with crystal violet staining. (B) TPA independence test. Control cells and melan-a expressing Hras(val12), Emx1 or Emx2 were seeded at low density in 10-cm dishes and grown in the presence or absence of TPA for 12 days. Colonies were visualized by crystal violet staining. (C) Growth in soft agar test. Control cells and melan-a expressing Hras(val12), Emx1 or Emx2 were seeded at low density in a soft agar matrix and left to form three-dimensional colonies for 21 days. Colonies were visible only in melan-a expressing Hras(val12).
homologues to the Drosophila empty spiracles gene. Like the fruit-fly counterpart, Emx1 and Emx2 are involved in brain development and are prevalently expressed in the cerebral cortex during embryogenesis between days E8.5 and E16. Interestingly, neither Emx1 nor Emx2 has been associated with melanocyte biology. Since the two proteins are highly related (80% identity) and are believed to have partially redundant functions, we decided to investigate both Emx1 and Emx2 in relation to their biological effects when overexpressed in melanocytes.
We have shown that expression of Emx genes in melanocytes downregulates Mitf transcription. This is probably the mechanism of loss of the melanogenic enzymes Tyrp1, Dct and Tyr (Fig. 3). It has been reported that overexpression of certain oncogenes in melanocytes leads to downregulation of the same proteins, with consequent loss of pigmentation [13 – 15] (Fig. 3, Hras). This prompted us to investigate the ability of the Emx genes to alter melanocyte growth characteristics. Emxexpressing melanocytes were able to grow at least 50%
36
W. Bordogna et al. / Experimental Cell Research 311 (2005) 27 – 38
faster than wild-type melan-a in normal media containing TPA. It is generally the case that TPA inhibits the growth of transformed melanocytes and melanoma cells. However, Emx expressing melanocytes growth faster in TPA-containing media, suggesting that either Emx expression bypasses the TPA-inhibitory effect, or EMX does not induce melanocyte transformation despite conferring TPA independence to melanocytes (Fig. 5). Finally, we tested the ability of Emx genes to transform melan-a cells by analyzing anchorage-independent growth (in soft agar). Contrary to what was observed with activated Hras, neither Emx1- nor Emx2-infected melan-a cells could form colonies in soft agar (Fig 5) and still responded to contact inhibition (not shown). A clear morphologic change could be observed: the cells lost dendricity and acquired a more rounded shape, but this may be associated with dedifferentiation to melanoblast-like cells [7] rather than transformation. Taken together, our results suggest that Emx expression might force dedifferentiation of melanocytes to melanoblastlike cells. Interestingly, this pattern of increased growth without a fully transformed phenotype was similar to that reported when overexpressing bFGF in melanocytes [11,12]. Since bFGF is a very well characterized oncogene involved in melanoma progression, it seemed possible that the Emx genes were involved in melanoma progression. However, neither EMX1 nor EMX2 was expressed in 9 human melanoma cell lines tested (data not shown). This is consistent with previous reports suggesting that Mitf expression is necessary for the survival of melanoma cells [40]. Although the function of Emx genes in melanocyte biology is not immediately apparent, it is clear that when ectopically expressed in pigmented cells, they can perturb the levels of the key transcription factor Mitf and the melanogenic enzymes, as well as affect the cell’s morphologic characteristics and growth, contributing to the regulation of the survival of melanocytes. In the mouse, neural crest melanocytes originate as nonpigmented precursors termed melanoblasts at around the embryonic day 10.5 (E10.5) and, following migration and proliferation, reach the limb buds by E12 and enter the epidermis at the level of the lateral trunk by E13/E14 [41]. In the mouse forebrain, Mitf expression can be detected in the neuroepithelium during optic vesicle formation (E9– E9.5) and later in the retinal pigment melanocytes (RPE) during optic cup formation (E10– E11.5) [42]. Overexpression of Mitf in cultured quail RPE causes cells to develop into neural crest-like pigmented cells [30]. On the other hand, Mitf inactivating mutations result in defects or absence of RPE development and produce eyes that are small in size (microphthalmia) [8]. Collectively, these data suggest that Mitf expression in specific areas of the neuroectoderm is key to RPE development and has to be tightly regulated. Mammalian homeobox genes of the Emx family, Emx1 and Emx2, are expressed in the developing cerebral cortex
and are involved in the patterning of the rostral brain. In mice, Emx1 expression is detected beginning on day E9.5 and is confined to the presumptive cerebral cortex and olfactory bulbs, whereas Emx2 expression starts on day E8.5 and is also found in the neuroectoderm [43]. It is therefore possible that expression of Emx in the neuroectoderm plays a role in repressing Mitf expression in neuroepithelial cells that are not committed to the RPE melanocyte lineage. Although little is known about the downstream transcriptional targets of Emx2, it has been suggested that this gene is a direct inhibitor of Wnt-1 expression [38] via an Emx2 DNA-binding site found on the Wnt-1 gene enhancer. Mitf-M (isoform present in melanocytes) is known to be positively regulated by the Wnt pathway, and both Wnt-1 and Wnt-3a are known to be important in determining the fate of neural crest-derived cells, including melanocytes [44,45]. Wnt-1 at least is expressed in neural crest-derived cells [46]. We speculate that expression of Emx2 in the neuroectoderm plays a role in repressing Mitf expression in neuroepithelial cells that are not committed to the RPE melanocyte lineage, perhaps via repression of the Wnt signaling pathway. Mitf-A is the expressed isoform in the RPE lineage, so more research is now needed to determine how the Mitf-A promoter may be regulated by the Wnt and Emx pathways.
Acknowledgments We thank Dr. G.J. Hannon and Dr. P. Sun for helping to construct the library. We also would like to thank Dr. V. Hearing for providing the melanogenic enzymes antibodies, Dr. A. Simeone for providing the murine Emx2 clone and Dr. C. Goding for the Mitf promoter construct, and W. Link and A. Wren for critical reading of the manuscript. WB was funded through a Medical Research Council Studentship. This work has been funded in part by the Spanish Ministry of Health (FIS-02/0126 to AC) and CRUK (SP-2366/0201 to DHB).
References [1] R.A. Spritz, P.W. Chiang, N. Oiso, A. Alkhateeb, Human and mouse disorders of pigmentation, Curr. Opin. Genet. Dev. 13 (2003) 284 – 289. [2] E. Steingrimsson, N.G. Copeland, N.A. Jenkins, Melanocytes and the microphthalmia transcription factor network, Annu. Rev. Genet. 38 (2004) 365 – 411. [3] R. Ganss, G. Schutz, F. Beermann, The mouse tyrosinase gene. Promoter modulation by positive and negative regulatory elements, J. Biol. Chem. 269 (1994) 29808 – 29816. [4] K. Yasumoto, K. Yokoyama, K. Shibata, Y. Tomita, S. Shibahara, Microphthalmia-associated transcription factor as a regulator for melanocyte-specific transcription of the human tyrosinase gene, Mol. Cell. Biol. 14 (1994) 8058 – 8070. [5] C.R. Goding, Mitf from neural crest to melanoma: signal transduction
W. Bordogna et al. / Experimental Cell Research 311 (2005) 27 – 38
[6]
[7]
[8]
[9] [10]
[11]
[12]
[13]
[14]
[15]
[16]
[17]
[18]
[19]
[20]
[21]
[22]
and transcription in the melanocyte lineage, Genes Dev. 14 (2000) 1712 – 1728. T. Hirobe, Keratinocytes are involved in regulating the developmental changes in the proliferative activity of mouse epidermal melanoblasts in serum- free culture, Dev. Biol. 161 (1994) 59 – 69. E.V. Sviderskaya, W.F. Wakeling, D.C. Bennett, A cloned, immortal line of murine melanoblasts inducible to differentiate to melanocytes, Development 121 (1995) 1547 – 1557. M. Nguyen, H. Arnheiter, Signaling and transcriptional regulation in early mammalian eye development: a link between FGF and MITF, Development 127 (2000) 3581 – 3591. M.A. Tucker, A.M. Goldstein, Melanoma etiology: where are we? Oncogene 22 (2003) 3042 – 3052. S.J. Orlow, W.K. Silvers, B.K. Zhou, B. Mintz, Comparative decreases in tyrosinase, TRP-1, TRP-2, and Pmel 17/silver antigenic proteins from melanotic to amelanotic stages of syngeneic mouse cutaneous melanomas and metastases, Cancer Res. 58 (1998) 1521 – 1523. G.P. Dotto, G. Moellmann, S. Ghosh, M. Edwards, R. Halaban, Transformation of murine melanocytes by basic fibroblast growth factor cDNA and oncogenes and selective suppression of the transformed phenotype in a reconstituted cutaneous environment, J. Cell Biol. 109 (1989) 3115 – 3128. S. Cajal, S. Suster, R. Halaban, E. Filvaroff, G.P. Dotto, Induction of different morphologic features of malignant melanoma and pigmented lesions after transformation of murine melanocytes with bFGF- cDNA and H-ras, myc, neu, and E1a oncogenes, Am. J. Pathol. 138 (1991) 349 – 358. U. Yavuzer, E. Keenan, P. Lowings, J. Vachtenheim, G. Currie, C.R. Goding, The Microphthalmia gene product interacts with the retinoblastoma protein in vitro and is a target for deregulation of melanocyte- specific transcription, Oncogene 10 (1995) 123 – 134. P.D. Donatien, S.L. Diment, R.E. Boissy, S.J. Orlow, Melanosomal and lysosomal alterations in murine melanocytes following transfection with the v-rasHa oncogene, Int. J. Cancer 66 (1996) 557 – 563. R. Halaban, M. Bohm, P. Dotto, G. Moellmann, E. Cheng, Y. Zhang, Growth regulatory proteins that repress differentiation markers in melanocytes also downregulate the transcription factor microphthalmia, J. Invest. Dermatol. 106 (1996) 1266 – 1272. C. Wellbrock, L. Ogilvie, D. Hedley, M. Karasarides, J. Martin, D. Niculescu-Duvaz, C.J. Springer, R. Marais, V599EB-RAF is an oncogene in melanocytes, Cancer Res. 64 (2004) 2338 – 2342. T.J. Hemesath, E. Steingrimsson, G. McGill, M.J. Hansen, J. Vaught, C.A. Hodgkinson, H. Arnheiter, N.G. Copeland, N.A. Jenkins, D.E. Fisher, Microphthalmia, a critical factor in melanocyte development, defines a discrete transcription factor family, Genes Dev. 8 (1994) 2770 – 2780. C.A. Hodgkinson, K.J. Moore, A. Nakayama, E. Steingrimsson, N.G. Copeland, N.A. Jenkins, H. Arnheiter, Mutations at the mouse microphthalmia locus are associated with defects in a gene encoding a novel basic-helix – loop-helix – zipper protein, Cell 74 (1993) 395 – 404. M. Tachibana, L.A. Perez-Jurado, A. Nakayama, C.A. Hodgkinson, X. Li, M. Schneider, T. Miki, J. Fex, U. Francke, H. Arnheiter, Cloning of MITF, the human homolog of the mouse microphthalmia gene and assignment to chromosome 3p14.1-p12.3, Hum. Mol. Genet. 3 (1994) 553 – 557. N.J. Bentley, T. Eisen, C.R. Goding, Melanocyte-specific expression of the human tyrosinase promoter: activation by the microphthalmia gene product and role of the initiator, Mol. Cell. Biol. 14 (1994) 7996 – 8006. K. Yasumoto, H. Mahalingam, H. Suzuki, M. Yoshizawa, K. Yokoyama, Transcriptional activation of the melanocyte-specific genes by the human homolog of the mouse Microphthalmia protein, J. Biochem. 118 (1995) 874 – 881. K. Yasumoto, K. Yokoyama, K. Takahashi, Y. Tomita, S. Shibahara, Functional analysis of microphthalmia-associated transcription factor
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
[31]
[32]
[33]
[34]
[35]
[36] [37]
[38]
[39]
37
in pigment cell-specific transcription of the human tyrosinase family genes, J. Biol. Chem. 272 (1997) 503 – 509. J. Du, A.J. Miller, H.R. Widlund, M.A. Horstmann, S. Ramaswamy, D.E. Fisher, MLANA/MART1 and SILV/PMEL17/GP100 are transcriptionally regulated by MITF in melanocytes and melanoma, Am. J. Pathol. 163 (2003) 333 – 343. G.J. Adema, A.J. de Boer, R. van ’t Hullenaar, M. Denijn, D.J. Ruiter, A.M. Vogel, C.G. Figdor, Melanocyte lineage-specific antigens recognized by monoclonal antibodies NKI-beteb, HMB-50, and HMB-45 are encoded by a single cDNA, Am. J. Pathol. 143 (1993) 1579 – 1585. S.N. Wagner, C. Wagner, H. Hofler, M.J. Atkinson, M. Goos, Expression cloning of the cDNA encoding a melanoma-associated Ag recognized by mAb HMB-45. Identification as melanocytespecific Pmel 17 cDNA, Lab. Invest. 73 (1995) 229 – 235. K.L. Chang, A.L. Folpe, Diagnostic utility of microphthalmia transcription factor in malignant melanoma and other tumors, Adv. Anat. Pathol. 8 (2001) 273 – 275. G.G. McGill, M. Horstmann, H.R. Widlund, J. Du, G. Motyckova, E.K. Nishimura, Y.L. Lin, S. Ramaswamy, W. Avery, H.F. Ding, S.A. Jordan, I.J. Jackson, S.J. Korsmeyer, T.R. Golub, D.E. Fisher, Bcl2 regulation by the melanocyte master regulator Mitf modulates lineage survival and melanoma cell viability, Cell 109 (2002) 707 – 718. J. Du, H.R. Widlund, M.A. Horstmann, S. Ramaswamy, K. Ross, W.E. Huber, E.K. Nishimura, T.R. Golub, D.E. Fisher, Critical role of CDK2 for melanoma growth linked to its melanocyte-specific transcriptional regulation by MITF, Cancer Cells 6 (2004) 565 – 576. M. Tachibana, K. Takeda, Y. Nobukuni, K. Urabe, J.E. Long, K.A. Meyers, S.A. Aaronson, T. Miki, Ectopic expression of MITF, a gene for Waardenburg syndrome type 2, converts fibroblasts to cells with melanocyte characteristics, Nat. Genet. 14 (1996) 50 – 54. N. Planque, G. Raposo, L. Leconte, O. Anezo, P. Martin, S. Saule, Microphthalmia transcription factor induces both retinal pigmented epithelium and neural crest melanocytes from neuroretina cells, J. Biol. Chem. 279 (2004) 41911 – 41917. J.A. Lister, C.P. Robertson, T. Lepage, S.L. Johnson, D.W. Raible, Nacre encodes a zebrafish microphthalmia-related protein that regulates neural-crest-derived pigment cell fate, Development 126 (1999) 3757 – 3767. S. Shibahara, K. Takeda, K. Yasumoto, T. Udono, K. Watanabe, H. Saito, K. Takahashi, Microphthalmia-associated transcription factor (MITF): multiplicity in structure, function, and regulation, J. Investig. Dermatol. Symp. Proc. 6 (2001) 99 – 104. A. Simeone, M. Gulisano, D. Acampora, A. Stornaiuolo, M. Rambaldi, E. Boncinelli, Two vertebrate homeobox genes related to the Drosophila empty spiracles gene are expressed in the embryonic cerebral cortex, EMBO J. 11 (1992) 2541 – 2550. D.C. Bennett, P.J. Cooper, I.R. Hart, A line of non-tumorigenic mouse melanocytes, syngeneic with the B16 melanoma and requiring a tumour promoter for growth, Int. J. Cancer 39 (1987) 414 – 418. G.J. Hannon, P. Sun, A. Carnero, L.Y. Xie, R. Maestro, D.S. Conklin, D. Beach, MaRX: an approach to genetics in mammalian cells, Science 283 (1999) 1129 – 1130. S.J. Bultman, E.J. Michaud, R.P. Woychik, Molecular characterization of the mouse agouti locus, Cell 71 (1992) 1195 – 1204. S.E. Millar, M.W. Miller, M.E. Stevens, G.S. Barsh, Expression and transgenic studies of the mouse agouti gene provide insight into the mechanisms by which mammalian coat color patterns are generated, Development 121 (1995) 3223 – 3232. K.L. Ligon, Y. Echelard, S. Assimacopoulos, P.S. Danielian, S. Kaing, E.A. Grove, A.P. McMahon, D.H. Rowitch, Loss of Emx2 function leads to ectopic expression of Wnt1 in the developing telencephalon and cortical dysplasia, Development 130 (2003) 2275 – 2287. J.C. Lacal, T.P. Fleming, B.S. Warren, P.M. Blumberg, S.A. Aaronson, Involvement of functional protein kinase C in the
38
W. Bordogna et al. / Experimental Cell Research 311 (2005) 27 – 38
mitogenic response to the H-ras oncogene product, Mol. Cell. Biol. 7 (1987) 4146 – 4149. [40] R. King, K.N. Weilbaecher, G. McGill, E. Cooley, M. Mihm, D.E. Fisher, Microphthalmia transcription factor. A sensitive and specific melanocyte marker for melanoma diagnosis, Am. J. Pathol. 155 (1999) 731 – 738. [41] T.C. Mayer, The migratory pathway of neural crest cells into the skin of mouse embryos, Dev. Biol. 34 (1973) 39 – 46. [42] N. Bora, S.J. Conway, H. Liang, S.B. Smith, Transient overexpression of the microphthalmia gene in the eyes of microphthalmia vitiligo mutant mice, Dev. Dyn. 213 (1998) 283 – 292.
[43] C. Cecchi, E. Boncinelli, Emx homeogenes and mouse brain development, Trends Neurosci. 23 (2000) 347 – 352. [44] K. Takeda, K. Yasumoto, R. Takada, S. Takada, K. Watanabe, T. Udono, H. Saito, K. Takahashi, S. Shibahara, Induction of melanocyte-specific microphthalmia-associated transcription factor by Wnt3a, J. Biol. Chem. 275 (2000) 14013 – 14016. [45] C.R. Goding, D.E. Fisher, Regulation of melanocyte differentiation and growth, Cell Growth Differ. 8 (1997) 935 – 940. [46] S. Brewer, W. Feng, J. Huang, S. Sullivan, T. Williams, Wnt1-Cremediated deletion of AP-2alpha causes multiple neural crest-related defects, Dev. Biol. 267 (2004) 135 – 152.
Research Article
EMX homeobox genes regulate microphthalmia and alter melanocyte biology Walter Bordogna a,1, James D. Hudson a, Joanna Buddle c, Dorothy C. Bennett d, David H. Beach a,e, Amancio Carnero b,* b
a Wolfson Institute for Biomedical Research, London WC1E 6BT, UK Experimental Therapeutics Programme, Spanish National Cancer Centre (CNIO), c/Melchor Fernandez Almagro n-3 28029 Madrid, Spain c Institute of Child Health, London WC1N 1EH, UK d St. George’s Hospital Medical School, London SW17 0RE, UK e Center for Cutaneous Biology, Institute for Cell and Molecular Sciences, 2 Newark St., Whitechapel, E12AT London, UK
Received 16 May 2005, revised version received 26 July 2005, accepted 5 August 2005 Available online 27 September 2005
Abstract Melanocytes are specialized cells that produce melanin, the pigment responsible for skin, hair and retina color. They derive during embryogenesis from the precursor cells melanoblasts, which are neural crest cells committed to the pigment cell lineage. The differentiation of melanoblasts into melanocytes involves the expression of melanocyte-specific genes, particularly those responsible for melanin production, such as Tyr, Tyrp-1 and Dct, the expression of which depends on the melanocyte-specific transcription factor microphthalmia (Mitf). We have developed and executed a functional screen on melanocytes, with the aim of identifying genes involved in pigment cell biology. We have found Emx1 and Emx2, two highly related homeobox genes that when overexpressed in melanocytes can downregulate Mitf, Tyrp1, Dct and Tyr. Constitutive expression of Emx alters pigment cell morphology and growth properties: it confers TPA independence but not the ability to grow in soft agar. Spatial and temporal expression of Emx and Mitf during embryonic development suggests that Emx could be one factor that regulates correct expression of Mitf by inhibiting its activation in neuroepithelial derivatives other than melanocytes. D 2005 Elsevier Inc. All rights reserved. Keywords: Microphthalmia; Melanocyte; EMX; Genetic screening
Introduction Melanocytes are specialized cells that produce melanin, the pigment responsible for skin, hair and retina color [1,2]. While melanocytes of the retinal pigment epithelium (RPE) originate from the optic cup and therefore derive from the neuroectoderm of the forebrain, pigment cells of the skin and hair follicle originate from precursor cells called melanoblasts, which are neural crest-derived cells committed to the pigment cell lineage. The differentiation of * Corresponding author. Fax: +34 91 224 6976. E-mail address: [email protected] (A. Carnero). 1 Current address: Argenta Discovery, 8/9 Spire Green Centre, Flex Meadow, CM19 5TR Harlow, UK. 0014-4827/$ - see front matter D 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.yexcr.2005.08.013
melanoblasts into pigment-producing melanocytes involves the expression of melanocyte-specific genes, including several enzymes responsible for melanin production (Tyr/ tyrosinase, Tyrp-1 and Dct), the expression of which depends on the melanocyte-specific transcription factor, microphthalmia-associated transcription factor (Mitf) [2– 5]. The activation of Mitf in melanoblasts causes profound functional and phenotypic alterations, so that the derived melanocytes show little resemblance to their precursors. The most obvious differences between the two cell types are the high degree of dendricity and pigmentation of melanocytes as opposed to the unpigmented and generally round-shaped melanoblasts [6,7]. Activation of Mitf is also essential for the correct development of RPE melanocytes in the optic cup, and
28
W. Bordogna et al. / Experimental Cell Research 311 (2005) 27 – 38
lack of Mitf activity leads to the loss of these pigmented cells resulting in a phenotype characterized by small eye size, also known as microphthalmia [8]. Mutations affecting melanocyte growth regulation can lead to their uncontrolled proliferation and cancer. Although malignant melanoma is less common among skin cancers, its incidence is rapidly increasing, and it currently represents one of the fastest growing cancers worldwide, especially among Caucasians [9]. Interestingly, similarities can be observed between melanoblasts and unpigmented melanoma cells such as lack of pigmentation in some advanced melanomas (amelanotic melanoma) and downregulation of the melanogenic enzymes Tyr, Tyrp1 and Dct [10]. Furthermore, melanocyte cell lines have been reported to lose differentiation traits such as dendricity and pigmentation when transfected with oncogenes such as activated Ras, Neu, FGF2, Myc, E1A and Braf [11– 16]. Mitf is a basic-helix– loop-helix/leucine-zipper (bHLHZip) transcription factor whose mutation produces melanocyte defects in mice and humans [2,5]. Mitf belongs to the Myc superfamily of transcription factors and binds E box sequences [17–19]. The three major pigmentary enzymes, Tyr, Tyrp1 and Dct, are transcriptional targets of Mitf [4,17,20–22], suggesting that the pigmentation pathway in general is regulated by Mitf’s activity. Other targets involved in melanocytic differentiation include the Silv/ Pmel17 gene [23], which encodes the GP100/HMB45 antigen commonly used for melanoma diagnosis and immune therapy [24,25], receptors Kit and Mc1r, and survival factor Bcl2 [2]. Mitf deficiency affects melanocyte viability as well as pigmentation, suggesting that transcriptional targets other than pigment genes are also likely to be of significance. While the expression of many melanocytic markers is often lost in melanoma, Mitf expression is usually (if not always) maintained in human melanoma specimens, suggesting that Mitf might be particularly important for melanoma maintenance (reviewed in [26]). One particular Mitf target that may be of relevance for viability is Bcl2 [27]. However, Bcl2 cannot fully mediate Mitf’s proliferation/survival effects because Mitf deficiency produces earlier melanocyte deficiency than Bcl2 knockout. In addition, Bcl2 overexpression cannot rescue clonogenic growth in the setting of Mitf disruption in melanoma cells [27]. Mitf might also modulate CDK2 expression in melanocytes, and CDK2 expression levels are tightly correlated to Mitf levels in a panel of primary human melanomas and melanoma cell lines. In addition, functional studies have shown that CDK2 regulation by Mitf is essential for melanoma clonogenic growth [28]. The importance of Mitf as a determining factor in melanocyte development was highlighted when it was shown that expression of Mitf in fibroblasts expressing ectopic Dct conferred on them characteristics of melanocytes [29]. Similarly, ectopic expression of Mitf can induce transdifferentiation of neuroretina in melanocytes [30], and misexpression of Mitf in zebrafish results in ectopic
melanized cells [31]. Thus, it would appear that at least in some cells, the expression of Mitf is sufficient to establish a program of melanocyte-specific gene expression. Mitf is the earliest known marker of specification to the melanocyte lineage. Analysis of the promoter of the Mitf-M isoform in neural crest-derived melanocytes suggests that the onset of Mitf-M expression may be dictated by an array of cooperating transcription factors acting in synergy to raise Mitf expression above a critical threshold. To date, the transcription factors implicated in regulating the Mitf promoter include Pax3, CREB, Sox10, and Lef1 (via the Wnt pathway), each factor conferring the ability of responding to specific signals (reviewed in [2,32]). The link between Mitf expression and Pax3, Sox10, and Lef1 is underscored by the existence of known mutations in each of these genes that provoke loss of melanoblasts and, in the case of PAX3 and SOX10, syndromes characterized by pigmentation defects [1]. In this study, we describe the development and execution of a functional screen on melanocytes aimed at the identification of genes involved in pigment cell biology. We have found that Emx1 and Emx2, two highly related homeobox genes [33], when overexpressed in melanocytes, can downregulate Mitf transcription and alter pigment cell morphology and growth characteristics.
Materials and methods Cells Melan-a mouse melanocytes [34] were grown in RPMI 1640 medium (Gibco) supplemented with 10% FCS, 2 mM l-glutamine and 200 nM TPA. Cells were kept in a 37-C humidified incubator with 10% CO2. The ecotropic packaging cell line LinXE [35] was routinely kept in DMEM medium (Gibco) supplemented with 10% FCS and 50 Ag/ml hygromycin B, in a 5% CO2 humidified incubator at 37-C. When producing the virus, they were grown in RPMI medium (Gibco) supplemented with 10% FCS and 2 mM l-glutamine and grown in a 5% CO2 humidified incubator at 32-C. Library construction and screen strategy Tissues for RNA extraction (day 7 and day 15 mouse embryos, adult mouse testis and brain) were provided by Cold Spring Harbor Laboratories. RNA was extracted using TRIzol (Gibco, cat #15596-026) according to the manufacturer’s instructions. Messenger RNA (PolyA+) was enriched using an oligo-dT cellulose resin (Boehringer, cat #808 229). Construction of the library was performed using the ZAP Express cDNA synthesis and cloning kit (Stratagene, cat #200403 and #200451). The synthesized cDNAs were cloned into the EcoRI and XhoI sites of the pHygroMaRXII retroviral vector [35].
W. Bordogna et al. / Experimental Cell Research 311 (2005) 27 – 38
Ten 10-cm dishes of LinXE cells were transfected by the calcium phosphate method with 25 Ag of library DNA each. At 48 h post-transfection, viral supernatants were collected, filtered, supplemented with 8 Ag/ml of polybrene and 200 nM TPA, and used to infect twenty 10-cm dishes of melan-a seeded the day before at 5 104 cells/ml. After infection, cells were selected with 100 Ag/ml of hygromycin B for 10 days. The surviving cells were passed through a Cell Sorter (Beckman-Coulter ALTRA) using a 488-nm laser at 1500 cells/s with a pressure of 12 psi, gating for the unpigmented ones. Finally, cells were seeded at low density (250 cells/ml) to allow colony formation. After 14 days, unpigmented colonies were selected and subcloned to allow provirus recovery. Recovery of viral genomes and analysis of the recovered proviruses Genomic DNA was extracted from 5 106 cells using the Blood and Cell Culture DNA Midi Kit (Qiagen #13343). Ten micrograms of the genomic DNA recovered was treated with CRE recombinase, phenol extracted, ethanol precipitated and transformed into electrocompetent bacteria. The recovered proviruses were analyzed by restriction digestion, retested into melan-a cells and sequenced. Melanin assay Cells from a confluent 10-cm dish were lysed in 1 ml of lysis buffer (1% SDS, 10 mM Tris – Cl, pH 7, 100 mM EDTA). 10 Al was diluted in water to 200 Al and used to measure the protein content with a standard Bio-Rad protein assay. The remaining lysates were treated with H2O2 at a final concentration of 1% for 30 min at 80-C. Samples were diluted 1 in 5 with water, and melanin contents were measured with a spectrophotometer at 410 nm. Results were standardized to the protein content.
29
Generation of Emx1 mutants Emx1 mutants were generated by PCR using primers bearing restriction sites to facilitate cloning into the pHMII vector. Mutants were confirmed by sequencing. M0, M1, and M3 PCRs were performed with forward and reverse primers bearing an EcoRI or XhoI site respectively. Mutants M2 and M4 were generated by amplifying the relevant 5V and 3V portions with primers bearing the EcoRI and HindIII, and the HindIII and XhoI cloning sites respectively. Sequences in italic bold represent restriction sites: gaattc (EcoRI), ctcgag (XhoI), aagctt (HindIII). E1:ggggaatcc atgtgccaggcttggtgc; E3:gggaagcttaaacggcagaagctggaa; E4:gggctcgag tcacagcttctgccgtttgta; E5:ggggaattc atgggccgctcgctctatgga; E6:gggctcgagctagtcattggaggtgac; E7:gggaagctt cgcaagcccaagcggatt; E8:gggaagctt tgcgaagggcccgtgcaa; E10:gggaagctttccatagagcgagcggcc. M0: E1-E6; M1: E1-E4; M2: E1-E8 and E3-E6; M3: E5E6; M4: E1-E10 and E7-E6. Growth curves 2 103 melanocytes infected with either Emx1 or Emx2 were plated in 24-well plates in triplicate and grown in presence of 200 nM TPA. At 2-day intervals, cells were fixed and stained with crystal violet. Following extensive washing in water, the crystal violet dye was dissolved in 10% acetic acid and quantified at 595 nm as a relative measure of cell number. Growth in soft agar 104 cells were plated in 0.3% low-melting point agarose/ growth medium on to 6-cm dishes with a 0.5% agarose/ growth medium base. Colonies were left to grow for 21 days in a 37-C, 10% CO2 humidified incubator. Luciferase assays
Western blots Total cell lysates were prepared from a confluent 10-cm dish. Cells were trypsinized, washed in 1 PBS and lysed in 1 ml of lysis buffer. Genomic DNA was shredded by sonicating the sample through a 26-gauge needle, and insoluble material was removed spinning at 13,000 rpm for 10 min. 20 Ag of each sample (Bio-Rad protein assay) was electrophoresed on a 10% SDS-PAGE gel and transferred to a nitrocellulose membrane. Western blot analysis was carried out using standard procedures and detected using ECL (Amersham). Ab-1(C5) (NeoMarkers) was used to detect Mitf; TRP2(G15) (Santa Cruz) was used to detect Dct; aPEP7 and aPEP1 were provided by Dr. V. Hearing and were used to detect Tyr and Tyrp1, respectively; AC-74 (Sigma) was used to detect h-actin. HRP-conjugated anti-mouse, goat and rabbit IgG were from Santa Cruz.
Melan-a cells were seeded in 6-well plates and cultured during 24 h at 37-C. The medium was changed, and 2 h later, cells were transiently transfected with the appropriate DNAs using the lipofectamine protocol. Cells were washed with PBS, and, when necessary, a glycerol shock (medium supplemented with 10% glycerol) was performed for 1 min. Fresh medium was added to the transfected cells and cultured at 37-C. Cells were harvested 48 h after transfection and lysed with 200 ml of 1 Reporter Lysis Buffer (Promega). Lysates were frozen, thawed and centrifuged for 2 min at 13,200 rpm, 4-C. 20 ml of each sample was transferred to a 96-well plate and luciferase activity measured with the automated addition of 100 Al or luciferase substrate (Promega) by a Victor II (Wallac Oy) reader. Luciferase activity was normalized to the protein content of each sample (obtained through the Bradford procedure).
30
W. Bordogna et al. / Experimental Cell Research 311 (2005) 27 – 38
Fig. 1. Screening reconstruction. (A) Melan-a infected with pHMII/Agouti and pHMII/Hras(val12) lose differentiation traits such as pigmentation and dendricity (bright field pictures). (B) Unpigmented cells can be efficiently separated from pigmented melanocytes based on their forward and side scatter characteristics using a cell sorter. (C) Screening cascade. Following infection of melan-a with library cDNA and selection of infected cells using hygromycin, unpigmented cells were enriched using a cell sorter. Gated cells were collected, plated at low density and allowed to form colonies for 14 days. Unpigmented colonies were subcloned and expanded to allow for cDNA recovery.
W. Bordogna et al. / Experimental Cell Research 311 (2005) 27 – 38
Results Screen development In order to search for new genes involved in melanocyte differentiation, we decided to design a functional screen on the mouse melanocyte cell line melan-a. Since melanocytes derive from unpigmented precursor cells characterized by the absence of differentiation markers such as dendricity and melanin production, we used pigmentation, or rather the lack of it, as the selective marker for positive clones. In order to optimize the screening conditions, reconstruction experiments were carried out using melan-a cells co-infected with Agouti or activated Hras(val12) genes and the LacZ reporter gene. Agouti (agouti signal protein) is a secreted molecule known to compete with MSH for binding to the melanocortin 1 receptor (Mc1r) thereby producing a switch in melanin production from the default black eumelanin to yellow pheomelanin [36,37]. Activated Hras has been reported, together with other oncogenes such as bFGF and E1A, to provoke depigmentation when transduced in melanocytes [11 – 15]. Melan-a mouse melanocytes infected with either the pHMII/Agouti or the pHMII/Hras constructs became unpigmented in about a week (Fig. 1A) and could be efficiently separated from pigmented cells using a cell sorter (Fig. 1B). Reconstitution experiments were carried out by mixing Agouti/LacZ melan-a with wild type melan-a, followed by fluorescence activated cell sorting to select for the unpigmented population. The collected cells were seeded
31
at low density and left to grow for 14 days. Under these conditions, wild-type melan-a cells produced highly pigmented colonies, whereas the Agouti/LacZ infected ones produced colonies that were totally unpigmented. Identification of the unpigmented colonies was facilitated by X-Gal staining, and the enrichment of the Agouti infected melanocytes was estimated to be ¨300-fold from a ratio of 1/10,000 to 1/30. The screening was carried out as shown in Fig. 1C. Melan-a cells were infected with a mouse cDNA retroviral library with a complexity of 6 106 clones, and a total of 1.5 106 independent clones were screened. Successfully infected cells were selected with hygromycin B, and the unpigmented cell population was enriched using the cell sorter. The collected cells were seeded at low density (2500 cells/10-cm dish), and after 14 days, the unpigmented colonies were singly subcloned and expanded for genomic DNA extraction and excision of the provirus using the appropriate recombinase. Emx1 and Emx2 provoke depigmentation of melan-a Out of the 1.5 106 clones screened, the cDNA representing the Emx1 homeobox gene was isolated twice independently. The two independent clones were sequenced and were found to be almost identical except for the size of the PolyA+ tail, proving that they originated from different reverse transcriptase reactions during library construction. Our sequence shows that the Emx1 cds is 873 bp long resulting
Fig. 2. Emx protein sequences and domain structure. (A) Amino acid alignment of murine Emx1 and Emx2. The two proteins have high homology (80%). (B) Domain structure of the Emx1 and Emx2 genes. Ala-rich: alanine-rich domain; Pro-rich: proline-rich domain; HD: homeobox domain; NLS: nuclear localization signal.
32
W. Bordogna et al. / Experimental Cell Research 311 (2005) 27 – 38
in a predicted protein of 290 aa (Fig. 2A). The predicted Emx2 protein is 253 aa long and includes a proline-rich region (aa 79– 108), a homeobox domain (aa 153– 213) and a nuclear localization signal (aa 211 –228) (Fig. 2B).
Emx1 and Emx2 are homeobox transcription factors homologous to the Drosophila empty spiracles gene [33]. The two proteins are highly related (80% identity, Fig. 2A) and are believed to partially rescue each other in case of
W. Bordogna et al. / Experimental Cell Research 311 (2005) 27 – 38
inactivating mutations. In particular, the C-terminus of the two proteins, including the homeobox domains and the nuclear localization signal, shows 88% identity. For these reasons, we decided to investigate both Emx1 and Emx2 in relation to their biological effects when overexpressed in melan-a cells. The ability of both genes to induce loss of pigmentation when overexpressed in melan-a was assessed visually (Figs. 3A and B) and quantified with a melanin assay (Fig. 3C). These results clearly show that both genes can considerably reduce the amount of melanin produced to levels comparable to those observed using the Agouti positive control. Emx1 and Emx2 downregulate microphthalmia and melanogenic enzymes It has been previously shown that overexpression of oncogenes in melanocytes, such as activated Hras, causes loss of pigmentation through the downregulation of the melanocyte-specific transcription factor microphthalmia. This bHLH transcription factor promotes the expression of the melanogenic enzymes Tyr, Tyrp1 and, to a lower degree, Dct. To establish the effect of Emx1 or Emx2 overexpression on melanogenic enzyme levels, we performed Western blot analysis of cell extracts from wild-type, Hras(val12) infected and Emx1 or Emx2 infected melan-a. As shown in Fig. 3D, cells overexpressing each of these sequences had reduced levels of Mitf, Tyr, Tyrp1 and Dct proteins, suggesting that, as seen with oncogene overexpression, Emx1 and Emx2 cause microphthalmia downregulation and consequently melanocyte depigmentation. Although little is known about the transcriptional targets of the Emx genes, it is likely that these nuclear factors are involved in regulating the expression of genes implicated in brain development [38]. To assess whether the Emx genes alter the transcription of Mitf, we measured the expression of a luciferase reporter gene driven by the Mitf promoter, ectopically co-expressed in melanocytes with the Emx genes. We found that the expression of Emx genes reduced by 80 – 90% the transcriptional activation of the Mitf promoter (Fig. 3E). As a control, a non-specific DNA (lacZ) did not alter the activity of the promoter. To study whether EMX exhibit a non-specific repressing activity, we have performed transactivation assays of E2F-responsive promoters in the presence of EMX genes. Fig. 3F shows that EMX does not inhibit this promoter and, therefore, does not show an unspecific repressing activity.
33
Full length Emx gene is required for melan-a depigmentation In order to establish whether Emx1-triggered depigmentation in melanocytes is caused by its activity in the nucleus, we generated a mutant lacking the nuclear localization signal (M1). We also decided to investigate if any of the recognizable regions of the protein were indispensable for the observed phenotype. We therefore created mutants lacking the homeobox domain (M2), the alanine-rich region (M3) and the 83aa long region between the two (M4) (Fig. 4A). Mutants were generated by PCR reaction, subcloned into pHMII and tested for their ability to inhibit pigment production when overexpressed in melanocytes. As positive controls, we used the original Emx1 clone and the full length PCR amplification of the Emx1 cds (M0). As shown in Fig. 4B, none of the mutants were able to inhibit melanin synthesis, suggesting that the full-length protein is required for melan-a depigmentation. Emx1 and Emx2 overexpression promotes growth of melanocytes Since the pattern of melanogenic enzyme downregulation was similar to that observed when overexpressing oncogenes, we decided to investigate whether overexpression of the Emx genes could stimulate growth. 2 103 melanocytes infected with either Emx1 or Emx2 were plated in 24-well plates in triplicate and grown in the presence of 200 nM tetradecanoyl phorbol acetate (TPA). Melan-a cells infected with empty vector and Hras were used as controls. Cell growth was analyzed at different time points. As shown in Fig. 5A, melanocytes expressing either of the Emx genes were growing at a faster rate compared to those infected with empty vector or activated Hras. Indeed, in these conditions, melanocytes infected with Hras oncogene were the slowest to grow. This is probably because prolonged high doses of TPA can downregulate PKC activity, an important effector of Ras mediated mitogenic properties [39]. Melan-a cells are normally dependent on TPA for growth but, upon transduction with oncogenes, they can grow in the absence of the mitogen. We therefore tested the ability of Emx1 and Emx2 to confer TPA independence when overexpressed in melanocytes. This experiment was carried out by plating at low density (2000 cells in a 10-cm dish) melanocytes infected with empty
Fig. 3. Effects of Emx gene overexpression in melan-a cells on pigmentation and melanogenic enzyme expression. (A) Cells overexpressing Emx1 or Emx2 become unpigmented (bright field pictures). (B) mRNA levels of EMX1 and EMX2 genes ectopically expressed in melan-a cells. Northern blot was performed by random priming as reported elsewhere using EMX1 or EMX2 genes as templates. (C) Quantification of eumelanin in melan-a cells expressing Agouti, Emx1 or Emx2. Results were normalized to the total protein content. (D) Mitf, Tyr, Tyrp1 and Dct protein levels in cell lysates from control melan-a and melana expressing Hras(val12), Emx1 or Emx2. h-actin levels were assessed as loading control. (E) Luciferase expression under the control of the Mitf promoter is reduced upon co-transfection of constructs expressing activated Hras, Emx1 or Emx2. A lacZ control did not affect the reporter gene expression. Results were normalized to total protein content. (F) Luciferase expression under the control of an E2F-reponsive promoter is not altered by co-transfection with Emx1 or Emx2.
34
W. Bordogna et al. / Experimental Cell Research 311 (2005) 27 – 38
Fig. 4. Emx1 mutants and their effect on melan-a pigment production. (A) Schematic of the Emx1 mutants assessed. M0: full-length control; M1: deleted nuclear localization signal; M2: deleted homeobox domain; M3: deleted alanine-rich region; M4: deleted region comprised between the alanine-rich and the homeobox domains. (B) Quantification of eumelanin in control melan-a and melan-a cell expressing the original Emx1 clone and its mutants. Results were normalized to the total protein content.
pHMII (negative control), activated Hras (positive control) or the Emx clones in media containing 200 nM TPA or without the mitogen. Cells were grown for 12 days, and the resulting colonies were stained with crystal violet (Fig. 5B). EMX-infected melan-a grown without TPA formed roughly the same number of colonies as the control (Fig. 5B), although smaller in size. This suggests that Emx gene overexpression in melanocytes can confer TPA independence but growth remains at a faster rate in the presence of the mitogen.
colonies/104 cells). Neither the negative control nor the Emx1 or Emx2 infected cells were able to form colonies in soft agar (Fig. 5C). Collectively, these data suggest that overexpression of Emx1 or Emx2 in melanocytes, despite conferring growth advantages such as TPA independence and lower doubling time in the presence of TPA, does not cause the cells to lose anchorage dependence and therefore to acquire a fully transformed phenotype.
Melanocytes overexpressing Emx1 or Emx2 are not transformed
Discussion
In order to test the transforming potential of the Emx clones, we assessed cell growth in soft agar. 104 cells were seeded in triplicate in 6-well plates. Melanocytes infected with empty pHMII and Hras(val12) were used as negative and positive controls respectively. After 3 weeks, colonies were visible only in the Hras(val12) infected melanocyte cultures (average of 107
In this study, we have described the development and execution of a functional screen on melanocytes aimed at the identification of genes involved in pigment cell biology. We screened 1.5 106 clones, resulting in the isolation of two positive clones. These were sequenced and found to be two full-length independent clones of the Emx1 homeobox gene. Emx1 (like Emx2) was originally isolated by Simeone and collaborators in 1992 in an attempt to find murine
W. Bordogna et al. / Experimental Cell Research 311 (2005) 27 – 38
35
Fig 5. Emx gene overexpression in melan-a cells confers growth advantages. (A) Growth curves over a period of 10 days on control melan-a and melan-a expressing Hras(val12), Emx1 or Emx2. 2000 cells/well were seeded in 24-well plates in triplicate, and cell numbers were assessed at 2-day intervals with crystal violet staining. (B) TPA independence test. Control cells and melan-a expressing Hras(val12), Emx1 or Emx2 were seeded at low density in 10-cm dishes and grown in the presence or absence of TPA for 12 days. Colonies were visualized by crystal violet staining. (C) Growth in soft agar test. Control cells and melan-a expressing Hras(val12), Emx1 or Emx2 were seeded at low density in a soft agar matrix and left to form three-dimensional colonies for 21 days. Colonies were visible only in melan-a expressing Hras(val12).
homologues to the Drosophila empty spiracles gene. Like the fruit-fly counterpart, Emx1 and Emx2 are involved in brain development and are prevalently expressed in the cerebral cortex during embryogenesis between days E8.5 and E16. Interestingly, neither Emx1 nor Emx2 has been associated with melanocyte biology. Since the two proteins are highly related (80% identity) and are believed to have partially redundant functions, we decided to investigate both Emx1 and Emx2 in relation to their biological effects when overexpressed in melanocytes.
We have shown that expression of Emx genes in melanocytes downregulates Mitf transcription. This is probably the mechanism of loss of the melanogenic enzymes Tyrp1, Dct and Tyr (Fig. 3). It has been reported that overexpression of certain oncogenes in melanocytes leads to downregulation of the same proteins, with consequent loss of pigmentation [13 – 15] (Fig. 3, Hras). This prompted us to investigate the ability of the Emx genes to alter melanocyte growth characteristics. Emxexpressing melanocytes were able to grow at least 50%
36
W. Bordogna et al. / Experimental Cell Research 311 (2005) 27 – 38
faster than wild-type melan-a in normal media containing TPA. It is generally the case that TPA inhibits the growth of transformed melanocytes and melanoma cells. However, Emx expressing melanocytes growth faster in TPA-containing media, suggesting that either Emx expression bypasses the TPA-inhibitory effect, or EMX does not induce melanocyte transformation despite conferring TPA independence to melanocytes (Fig. 5). Finally, we tested the ability of Emx genes to transform melan-a cells by analyzing anchorage-independent growth (in soft agar). Contrary to what was observed with activated Hras, neither Emx1- nor Emx2-infected melan-a cells could form colonies in soft agar (Fig 5) and still responded to contact inhibition (not shown). A clear morphologic change could be observed: the cells lost dendricity and acquired a more rounded shape, but this may be associated with dedifferentiation to melanoblast-like cells [7] rather than transformation. Taken together, our results suggest that Emx expression might force dedifferentiation of melanocytes to melanoblastlike cells. Interestingly, this pattern of increased growth without a fully transformed phenotype was similar to that reported when overexpressing bFGF in melanocytes [11,12]. Since bFGF is a very well characterized oncogene involved in melanoma progression, it seemed possible that the Emx genes were involved in melanoma progression. However, neither EMX1 nor EMX2 was expressed in 9 human melanoma cell lines tested (data not shown). This is consistent with previous reports suggesting that Mitf expression is necessary for the survival of melanoma cells [40]. Although the function of Emx genes in melanocyte biology is not immediately apparent, it is clear that when ectopically expressed in pigmented cells, they can perturb the levels of the key transcription factor Mitf and the melanogenic enzymes, as well as affect the cell’s morphologic characteristics and growth, contributing to the regulation of the survival of melanocytes. In the mouse, neural crest melanocytes originate as nonpigmented precursors termed melanoblasts at around the embryonic day 10.5 (E10.5) and, following migration and proliferation, reach the limb buds by E12 and enter the epidermis at the level of the lateral trunk by E13/E14 [41]. In the mouse forebrain, Mitf expression can be detected in the neuroepithelium during optic vesicle formation (E9– E9.5) and later in the retinal pigment melanocytes (RPE) during optic cup formation (E10– E11.5) [42]. Overexpression of Mitf in cultured quail RPE causes cells to develop into neural crest-like pigmented cells [30]. On the other hand, Mitf inactivating mutations result in defects or absence of RPE development and produce eyes that are small in size (microphthalmia) [8]. Collectively, these data suggest that Mitf expression in specific areas of the neuroectoderm is key to RPE development and has to be tightly regulated. Mammalian homeobox genes of the Emx family, Emx1 and Emx2, are expressed in the developing cerebral cortex
and are involved in the patterning of the rostral brain. In mice, Emx1 expression is detected beginning on day E9.5 and is confined to the presumptive cerebral cortex and olfactory bulbs, whereas Emx2 expression starts on day E8.5 and is also found in the neuroectoderm [43]. It is therefore possible that expression of Emx in the neuroectoderm plays a role in repressing Mitf expression in neuroepithelial cells that are not committed to the RPE melanocyte lineage. Although little is known about the downstream transcriptional targets of Emx2, it has been suggested that this gene is a direct inhibitor of Wnt-1 expression [38] via an Emx2 DNA-binding site found on the Wnt-1 gene enhancer. Mitf-M (isoform present in melanocytes) is known to be positively regulated by the Wnt pathway, and both Wnt-1 and Wnt-3a are known to be important in determining the fate of neural crest-derived cells, including melanocytes [44,45]. Wnt-1 at least is expressed in neural crest-derived cells [46]. We speculate that expression of Emx2 in the neuroectoderm plays a role in repressing Mitf expression in neuroepithelial cells that are not committed to the RPE melanocyte lineage, perhaps via repression of the Wnt signaling pathway. Mitf-A is the expressed isoform in the RPE lineage, so more research is now needed to determine how the Mitf-A promoter may be regulated by the Wnt and Emx pathways.
Acknowledgments We thank Dr. G.J. Hannon and Dr. P. Sun for helping to construct the library. We also would like to thank Dr. V. Hearing for providing the melanogenic enzymes antibodies, Dr. A. Simeone for providing the murine Emx2 clone and Dr. C. Goding for the Mitf promoter construct, and W. Link and A. Wren for critical reading of the manuscript. WB was funded through a Medical Research Council Studentship. This work has been funded in part by the Spanish Ministry of Health (FIS-02/0126 to AC) and CRUK (SP-2366/0201 to DHB).
References [1] R.A. Spritz, P.W. Chiang, N. Oiso, A. Alkhateeb, Human and mouse disorders of pigmentation, Curr. Opin. Genet. Dev. 13 (2003) 284 – 289. [2] E. Steingrimsson, N.G. Copeland, N.A. Jenkins, Melanocytes and the microphthalmia transcription factor network, Annu. Rev. Genet. 38 (2004) 365 – 411. [3] R. Ganss, G. Schutz, F. Beermann, The mouse tyrosinase gene. Promoter modulation by positive and negative regulatory elements, J. Biol. Chem. 269 (1994) 29808 – 29816. [4] K. Yasumoto, K. Yokoyama, K. Shibata, Y. Tomita, S. Shibahara, Microphthalmia-associated transcription factor as a regulator for melanocyte-specific transcription of the human tyrosinase gene, Mol. Cell. Biol. 14 (1994) 8058 – 8070. [5] C.R. Goding, Mitf from neural crest to melanoma: signal transduction
W. Bordogna et al. / Experimental Cell Research 311 (2005) 27 – 38
[6]
[7]
[8]
[9] [10]
[11]
[12]
[13]
[14]
[15]
[16]
[17]
[18]
[19]
[20]
[21]
[22]
and transcription in the melanocyte lineage, Genes Dev. 14 (2000) 1712 – 1728. T. Hirobe, Keratinocytes are involved in regulating the developmental changes in the proliferative activity of mouse epidermal melanoblasts in serum- free culture, Dev. Biol. 161 (1994) 59 – 69. E.V. Sviderskaya, W.F. Wakeling, D.C. Bennett, A cloned, immortal line of murine melanoblasts inducible to differentiate to melanocytes, Development 121 (1995) 1547 – 1557. M. Nguyen, H. Arnheiter, Signaling and transcriptional regulation in early mammalian eye development: a link between FGF and MITF, Development 127 (2000) 3581 – 3591. M.A. Tucker, A.M. Goldstein, Melanoma etiology: where are we? Oncogene 22 (2003) 3042 – 3052. S.J. Orlow, W.K. Silvers, B.K. Zhou, B. Mintz, Comparative decreases in tyrosinase, TRP-1, TRP-2, and Pmel 17/silver antigenic proteins from melanotic to amelanotic stages of syngeneic mouse cutaneous melanomas and metastases, Cancer Res. 58 (1998) 1521 – 1523. G.P. Dotto, G. Moellmann, S. Ghosh, M. Edwards, R. Halaban, Transformation of murine melanocytes by basic fibroblast growth factor cDNA and oncogenes and selective suppression of the transformed phenotype in a reconstituted cutaneous environment, J. Cell Biol. 109 (1989) 3115 – 3128. S. Cajal, S. Suster, R. Halaban, E. Filvaroff, G.P. Dotto, Induction of different morphologic features of malignant melanoma and pigmented lesions after transformation of murine melanocytes with bFGF- cDNA and H-ras, myc, neu, and E1a oncogenes, Am. J. Pathol. 138 (1991) 349 – 358. U. Yavuzer, E. Keenan, P. Lowings, J. Vachtenheim, G. Currie, C.R. Goding, The Microphthalmia gene product interacts with the retinoblastoma protein in vitro and is a target for deregulation of melanocyte- specific transcription, Oncogene 10 (1995) 123 – 134. P.D. Donatien, S.L. Diment, R.E. Boissy, S.J. Orlow, Melanosomal and lysosomal alterations in murine melanocytes following transfection with the v-rasHa oncogene, Int. J. Cancer 66 (1996) 557 – 563. R. Halaban, M. Bohm, P. Dotto, G. Moellmann, E. Cheng, Y. Zhang, Growth regulatory proteins that repress differentiation markers in melanocytes also downregulate the transcription factor microphthalmia, J. Invest. Dermatol. 106 (1996) 1266 – 1272. C. Wellbrock, L. Ogilvie, D. Hedley, M. Karasarides, J. Martin, D. Niculescu-Duvaz, C.J. Springer, R. Marais, V599EB-RAF is an oncogene in melanocytes, Cancer Res. 64 (2004) 2338 – 2342. T.J. Hemesath, E. Steingrimsson, G. McGill, M.J. Hansen, J. Vaught, C.A. Hodgkinson, H. Arnheiter, N.G. Copeland, N.A. Jenkins, D.E. Fisher, Microphthalmia, a critical factor in melanocyte development, defines a discrete transcription factor family, Genes Dev. 8 (1994) 2770 – 2780. C.A. Hodgkinson, K.J. Moore, A. Nakayama, E. Steingrimsson, N.G. Copeland, N.A. Jenkins, H. Arnheiter, Mutations at the mouse microphthalmia locus are associated with defects in a gene encoding a novel basic-helix – loop-helix – zipper protein, Cell 74 (1993) 395 – 404. M. Tachibana, L.A. Perez-Jurado, A. Nakayama, C.A. Hodgkinson, X. Li, M. Schneider, T. Miki, J. Fex, U. Francke, H. Arnheiter, Cloning of MITF, the human homolog of the mouse microphthalmia gene and assignment to chromosome 3p14.1-p12.3, Hum. Mol. Genet. 3 (1994) 553 – 557. N.J. Bentley, T. Eisen, C.R. Goding, Melanocyte-specific expression of the human tyrosinase promoter: activation by the microphthalmia gene product and role of the initiator, Mol. Cell. Biol. 14 (1994) 7996 – 8006. K. Yasumoto, H. Mahalingam, H. Suzuki, M. Yoshizawa, K. Yokoyama, Transcriptional activation of the melanocyte-specific genes by the human homolog of the mouse Microphthalmia protein, J. Biochem. 118 (1995) 874 – 881. K. Yasumoto, K. Yokoyama, K. Takahashi, Y. Tomita, S. Shibahara, Functional analysis of microphthalmia-associated transcription factor
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
[31]
[32]
[33]
[34]
[35]
[36] [37]
[38]
[39]
37
in pigment cell-specific transcription of the human tyrosinase family genes, J. Biol. Chem. 272 (1997) 503 – 509. J. Du, A.J. Miller, H.R. Widlund, M.A. Horstmann, S. Ramaswamy, D.E. Fisher, MLANA/MART1 and SILV/PMEL17/GP100 are transcriptionally regulated by MITF in melanocytes and melanoma, Am. J. Pathol. 163 (2003) 333 – 343. G.J. Adema, A.J. de Boer, R. van ’t Hullenaar, M. Denijn, D.J. Ruiter, A.M. Vogel, C.G. Figdor, Melanocyte lineage-specific antigens recognized by monoclonal antibodies NKI-beteb, HMB-50, and HMB-45 are encoded by a single cDNA, Am. J. Pathol. 143 (1993) 1579 – 1585. S.N. Wagner, C. Wagner, H. Hofler, M.J. Atkinson, M. Goos, Expression cloning of the cDNA encoding a melanoma-associated Ag recognized by mAb HMB-45. Identification as melanocytespecific Pmel 17 cDNA, Lab. Invest. 73 (1995) 229 – 235. K.L. Chang, A.L. Folpe, Diagnostic utility of microphthalmia transcription factor in malignant melanoma and other tumors, Adv. Anat. Pathol. 8 (2001) 273 – 275. G.G. McGill, M. Horstmann, H.R. Widlund, J. Du, G. Motyckova, E.K. Nishimura, Y.L. Lin, S. Ramaswamy, W. Avery, H.F. Ding, S.A. Jordan, I.J. Jackson, S.J. Korsmeyer, T.R. Golub, D.E. Fisher, Bcl2 regulation by the melanocyte master regulator Mitf modulates lineage survival and melanoma cell viability, Cell 109 (2002) 707 – 718. J. Du, H.R. Widlund, M.A. Horstmann, S. Ramaswamy, K. Ross, W.E. Huber, E.K. Nishimura, T.R. Golub, D.E. Fisher, Critical role of CDK2 for melanoma growth linked to its melanocyte-specific transcriptional regulation by MITF, Cancer Cells 6 (2004) 565 – 576. M. Tachibana, K. Takeda, Y. Nobukuni, K. Urabe, J.E. Long, K.A. Meyers, S.A. Aaronson, T. Miki, Ectopic expression of MITF, a gene for Waardenburg syndrome type 2, converts fibroblasts to cells with melanocyte characteristics, Nat. Genet. 14 (1996) 50 – 54. N. Planque, G. Raposo, L. Leconte, O. Anezo, P. Martin, S. Saule, Microphthalmia transcription factor induces both retinal pigmented epithelium and neural crest melanocytes from neuroretina cells, J. Biol. Chem. 279 (2004) 41911 – 41917. J.A. Lister, C.P. Robertson, T. Lepage, S.L. Johnson, D.W. Raible, Nacre encodes a zebrafish microphthalmia-related protein that regulates neural-crest-derived pigment cell fate, Development 126 (1999) 3757 – 3767. S. Shibahara, K. Takeda, K. Yasumoto, T. Udono, K. Watanabe, H. Saito, K. Takahashi, Microphthalmia-associated transcription factor (MITF): multiplicity in structure, function, and regulation, J. Investig. Dermatol. Symp. Proc. 6 (2001) 99 – 104. A. Simeone, M. Gulisano, D. Acampora, A. Stornaiuolo, M. Rambaldi, E. Boncinelli, Two vertebrate homeobox genes related to the Drosophila empty spiracles gene are expressed in the embryonic cerebral cortex, EMBO J. 11 (1992) 2541 – 2550. D.C. Bennett, P.J. Cooper, I.R. Hart, A line of non-tumorigenic mouse melanocytes, syngeneic with the B16 melanoma and requiring a tumour promoter for growth, Int. J. Cancer 39 (1987) 414 – 418. G.J. Hannon, P. Sun, A. Carnero, L.Y. Xie, R. Maestro, D.S. Conklin, D. Beach, MaRX: an approach to genetics in mammalian cells, Science 283 (1999) 1129 – 1130. S.J. Bultman, E.J. Michaud, R.P. Woychik, Molecular characterization of the mouse agouti locus, Cell 71 (1992) 1195 – 1204. S.E. Millar, M.W. Miller, M.E. Stevens, G.S. Barsh, Expression and transgenic studies of the mouse agouti gene provide insight into the mechanisms by which mammalian coat color patterns are generated, Development 121 (1995) 3223 – 3232. K.L. Ligon, Y. Echelard, S. Assimacopoulos, P.S. Danielian, S. Kaing, E.A. Grove, A.P. McMahon, D.H. Rowitch, Loss of Emx2 function leads to ectopic expression of Wnt1 in the developing telencephalon and cortical dysplasia, Development 130 (2003) 2275 – 2287. J.C. Lacal, T.P. Fleming, B.S. Warren, P.M. Blumberg, S.A. Aaronson, Involvement of functional protein kinase C in the
38
W. Bordogna et al. / Experimental Cell Research 311 (2005) 27 – 38
mitogenic response to the H-ras oncogene product, Mol. Cell. Biol. 7 (1987) 4146 – 4149. [40] R. King, K.N. Weilbaecher, G. McGill, E. Cooley, M. Mihm, D.E. Fisher, Microphthalmia transcription factor. A sensitive and specific melanocyte marker for melanoma diagnosis, Am. J. Pathol. 155 (1999) 731 – 738. [41] T.C. Mayer, The migratory pathway of neural crest cells into the skin of mouse embryos, Dev. Biol. 34 (1973) 39 – 46. [42] N. Bora, S.J. Conway, H. Liang, S.B. Smith, Transient overexpression of the microphthalmia gene in the eyes of microphthalmia vitiligo mutant mice, Dev. Dyn. 213 (1998) 283 – 292.
[43] C. Cecchi, E. Boncinelli, Emx homeogenes and mouse brain development, Trends Neurosci. 23 (2000) 347 – 352. [44] K. Takeda, K. Yasumoto, R. Takada, S. Takada, K. Watanabe, T. Udono, H. Saito, K. Takahashi, S. Shibahara, Induction of melanocyte-specific microphthalmia-associated transcription factor by Wnt3a, J. Biol. Chem. 275 (2000) 14013 – 14016. [45] C.R. Goding, D.E. Fisher, Regulation of melanocyte differentiation and growth, Cell Growth Differ. 8 (1997) 935 – 940. [46] S. Brewer, W. Feng, J. Huang, S. Sullivan, T. Williams, Wnt1-Cremediated deletion of AP-2alpha causes multiple neural crest-related defects, Dev. Biol. 267 (2004) 135 – 152.