- Email: [email protected]
Enamel matrix derivative neutralized the effect of lipopolysaccharide on osteoprotegerin and receptor activator of nuclear factor kappa B ligand expression of osteoblasts
archives of oral biology 54 (2009) 306–312
available at www.sciencedirect.com
journal homepage: www.intl.elsevierhealth.com/journals/arob
Enamel matrix derivative neutralized the effect of lipopolysaccharide on osteoprotegerin and receptor activator of nuclear factor kappa B ligand expression of osteoblasts§ Yoshiyuki Wada *, Morimichi Mizuno, Masato Tamura Department of Oral Health Science, Graduate School of Dentistry, Hokkaido University, Nishi 7, Kita 13, Kita-ku, Sapporo 060-8586, Japan
article info
abstract
Article history:
Objective: In this study, we investigated the effects of enamel matrix derivative (EMD) on
Accepted 13 January 2009
osteoprotegerin (OPG) and receptor activator of nuclear factor kappa B ligand (RANKL) expression of osteoblasts in the presence of lipopolysaccharide (LPS).
Keywords:
Study design: OPG and RANKL gene expression and protein synthesis of MC3T3-E1 osteo-
Enamel matrix derivative
blastic cells were examined by reverse transcription-polymerase chain reaction and
Osteoprotegerin
enzyme-linked immunosorbent assay.
Receptor activator of nuclear factor
Results: LPS inhibited OPG gene expression and protein synthesis, and stimulated RANKL
kappa B ligand
gene expression and soluble RANKL synthesis. EMD enhanced OPG gene expression and
Lipopolysaccharide
protein synthesis, and inhibited RANKL gene expression and soluble RANKL synthesis.
Osteoblast
Furthermore, EMD neutralized the effects of LPS on OPG and RANKL expression in osteoblasts. Conclusions: EMD might regulate the function of osteoblasts by elevating the ratio of OPG/ RANKL gene expression, which is downregulated by LPS, and suppress the induction of osteoclastogenesis. Thereby, EMD might contribute to periodontal tissue regeneration. # 2009 Elsevier Ltd. All rights reserved.
1.
Introduction
Several attempts have been made to restore periodontal tissue loss induced by periodontitis. Enamel matrix derivative (EMD), which is extracted from developing porcine tooth germs, has been used widely as an effective material to regenerate periodontal tissues.1 The clinical use of EMD is based on the observation that Hertwig’s epithelial root sheath deposits an enamel-like matrix on the dentin surface of the developing root.2 Clinical studies have shown that EMD successfully promotes cementum and alveolar bone formation in periodontal tissue.2,3 In addition, other clinical studies of EMD treatment for intrabony periodontal defects have found that it leads to §
regeneration of the periodontal ligament, and markedly enhances clinical attachment and alveolar bone growth.4–6 On the other hand, it has been reported that EMD regulates the proliferation and differentiation of periodontal ligament cells,7 epithelial cells, fibroblasts,8 cementoblasts9 and osteoblasts10 in cell culture studies. These findings indicate that EMD regulates the expression of osteoblast-related genes, alkaline phosphatase (ALP) activity, mineralization, protein synthesis, and the proliferation of most kinds of cells. Although EMD shows clinical efficacy, the precise mechanism of periodontal tissue regeneration by EMD is still unclear. Recently, it has been reported that EMD modulates the expression of osteoprotegerin (OPG) and receptor activator of nuclear factor kappa B ligand (RANKL).7,11,12 RANKL is expressed
Grant-in-aid from the Ministry of Education, Culture, Sports, Science and Technology of Japan. * Corresponding author. Tel.: +81 11 706 4235; fax: +81 11 706 4235. E-mail addresses: [email protected], [email protected] (Y. Wada). 0003–9969/$ – see front matter # 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.archoralbio.2009.01.004
archives of oral biology 54 (2009) 306–312
in cells of osteoblastic lineage in membrane-bound or soluble form.13 It induces preosteoclast differentiation into mature osteoclasts by binding to a specific receptor present on cells of osteoclastic lineage, RANK.14 RANKL signaling can be blocked by OPG, which is a decoy receptor for RANKL that occupies RANKL binding sites and protects bone from resorption. OPG is produced by osteoblastic cells and prevents the binding of RANK to its ligand, followed by inhibition of the differentiation of osteoclastic cells and recruitment of osteoclasts.15 Furthermore, expression of OPG and RANKL is reported to be closely associated with bone resorption due to periodontitis.16 EMD increases OPG gene expression in MC3T3-E1 osteoblastic cells.11 Galli et al. demonstrated that EMD stimulated OPG production and reduced RANKL production in human alveolar osteoblasts, and concluded that EMD offered a favourable osteogenic microenvironment.12 Furthermore, EMD reduces the RANKL/OPG gene ratio of human periodontal ligament cells.7 These reports imply that the effects of EMD on periodontal tissue regeneration might be partly associated with expression of OPG and RANKL by osteoblasts. One of the factors that influences expression of OPG and RANKL in periodontitis is lipopolysaccharide (LPS) from periodontopathic bacteria, represented by Porphyromonas gingivalis. LPS promotes bone resorption via cytokine production by macrophages which induce RANKL expression in osteoblasts.16 Recently, it was reported that LPS directly induced RANKL expression of osteoblasts17 and reciprocally suppressed OPG expression.18 These reports suggest that OPG and RANKL gene expression of osteoblasts is directly modulated by LPS in periodontitis. However, the effects of EMD on RANKL and OPG expression in the presence of LPS have never been reported. We hypothesized that EMD regulated osteoblasts via regulation of OPG and RANKL expression which are modulated by LPS in periodontitis, and might stimulate periodontal tissue regeneration. Therefore, we investigated the effects of EMD on OPG and RANKL expression of osteoblasts in the presence of LPS.
2.
Materials and methods
2.1.
Material preparation
EMD was purchased in gel form (Emdogain, Seikagaku, Tokyo, Japan). LPS isolated from Escherichia coli (List Biological Labs, Inc., Campbell) was dissolved in water heated at 37 8C with intermittent vortexing.
2.2.
Cell culture
MC3T3-E1 osteoblastic cells that originated from mouse calvaria19 were provided by the RIKEN CELL BANK (Tsukuba, Japan). Cells were cultured in a-minimum essential medium (GIBCO-BRL Life Technologies, Rockville, MD) that contained ascorbic acid (50 mg/ml), with 10% fetal calf serum. Then the cells were plated in 35-mm dishes (Corning International, Tokyo, Japan) and cultured in a humidified atmosphere of 5% CO2 (v/v) at 37 8C. The medium was changed every 2 days.
307
Cells were cultured with 10, 50 and 100 mg/ml EMD. The materials were added after the cells reached confluence. EMD was added to the medium after treating cells with LPS to investigate the effects of EMD on OPG and RANKL gene levels in the presence of LPS.
2.3.
Enzyme-linked immunosorbent assay (ELISA)
The OPG and soluble RANKL (sRANKL) contents in the medium were examined using a commercial enzyme-linked immunosorbent assay (ELISA) kit (R and D Systems, Minneapolis, MN). The culture medium was used for the analysis of OPG and sRANKL contents. A 96-well plate was used for ELISA. Measurement was done using a microplate reader set to 450 nm. The measurement was done 3 days after adding the materials.
2.4. Reverse transcription-polymerase chain reaction (RT-PCR) The mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), OPG and RANKL were measured by RT-PCR. The gene-specific primers used were forward CACCATGGAGAAGGCCGGGG, reverse GACGGACACATTGGGGGTAG, for GAPDH; forward ATGCCGAGAGTGTAGAGAGAGGAT, reverse AAACAGCCCAGTGGACCATTCCT for OPG; and forward CTCTTGGTACCACGATCGAG, reverse AAGCCCCAAAGTACGTCGCA for RANKL. Total RNA was isolated using the acid guanidine thiocyanate–phenol–chloroform method. mRNA was converted to cDNA using avian myeloblastosis virus-reverse transcriptase (Promega, Tokyo, Japan). The reaction mixture consisted of PCR buffer, 2.5 mM MgCl2, 1 mM deoxynucleotide triphosphate (dNTP) mixture, each primer at 0.2 mM, and Taq polymerase (2.5 U/100 ml) (Applied Biosystems, Tokyo, Japan). PCR amplification of cDNA was conducted using gene-specific primers in a PCR thermocycler. Thermal cycling was performed with 1 cycle of 94 8C for 12 min, and 25–28 cycles of 95 8C for 30 s, 60 8C for 30 s, and 72 8C for 90 s. We tried several cycle numbers to attain adequate conditions for the RT-PCR experiment, and we used 25 cycles for GAPDH, 28 cycles for OPG, 28 cycles for RANKL. The reaction products were analysed by electrophoresis of 10-ml samples in 2.5% agarose gels. The amplified DNA fragments were stained with ethidium bromide and photographed under ultraviolet illumination. GAPDH mRNA was used as an internal control. The densities of the bands were converted to relative values (NIH Image, National Institutes of Health, Bethesda, MD) and the level of each gene was normalized by dividing it by the amount of GAPDH mRNA. The measurement was done 3 days after adding the materials. To investigate the effect of EMD on LPS-affected osteoblasts, cells were cultured with the medium containing 1 mg/ ml of LPS after reaching confluence, and then 10, 50 and 100 mg/ml EMD was immediately added to the medium. Cells were then cultured for 72 h in the medium containing the materials.
308
archives of oral biology 54 (2009) 306–312
Fig. 1 – Effect of EMD on OPG and RANKL gene expression MC3T3-E1 osteoblastic cells were cultured with the medium containing 10, 50 or 100 mg/ml EMD after reaching confluence. The measurement was done 3 days after adding the materials. (A) OPG gene level was elevated at day 3 with every concentration of EMD. On the other hand, RANKL the gene level was suppressed by EMD. (B and C) The level of each gene was normalized by dividing it by the amount of GAPDH mRNA (*p < 0.05). CT = control. Each column shows the mean W S.D. (N = 3).
Fig. 2 – Effect of EMD on OPG and RANKL protein synthesis. (A) OPG protein synthesis was significantly and dosedependingly increased at day 3 after adding EMD (*p < 0.05). (B) On the other hand, sRANKL protein synthesis was significantly decreased by 100 mg/ml EMD (*p < 0.05).
2.5.
Statistical analysis
3.
Results
Next, we investigated OPG and sRANKL protein synthesis to confirm that EMD also regulated OPG and RANKL protein levels. OPG protein synthesis was significantly and dosedependingly increased at day 3 after adding EMD (Fig. 2A). On the other hand, sRANKL protein synthesis was significantly decreased by 100 mg/ml EMD (Fig. 2B). These results indicated that EMD modulated OPG and RANKL expression not only at the gene level but also at the protein level.
3.1.
Effects of EMD on expression of OPG and RANKL
3.2.
Assays were run in triplicate and the data were analysed using Student’s t-test. The experimental groups and control groups were compared.
The OPG gene levels were elevated at day 3 with every concentration of EMD. On the other hand, the RANKL gene expression was suppressed by EMD (Fig. 1A–C).
Effects of LPS on OPG and RANKL expression
Next, we investigated the effect of LPS on osteoblasts to evaluate the effects of EMD on expression of OPG and RANKL in pathological conditions.
archives of oral biology 54 (2009) 306–312
309
Fig. 3 – Effect of LPS on OPG and RANKL gene expression. Cells were cultured with medium containing 1, 5 or 10 mg/ml of LPS after reaching confluence. (A) OPG gene expression was decreased at day 3 after adding LPS. On the other hand, RANKL gene expression was increased by LPS. (B and C) The level of each gene was normalized by dividing it by the amount of GAPDH mRNA (*p < 0.05).
First, we studied whether LPS affected OPG and RANKL mRNA levels. OPG gene expression was decreased at day 3 after adding LPS. On the other hand, RANKL gene expression was increased by LPS (Fig. 3A–C). Next, we measured OPG and sRANKL protein contents to confirm that LPS also regulated OPG and RANKL protein levels. OPG protein content was significantly, dose-dependingly decreased at day 3 after adding LPS (Fig. 4A). In contrast, sRANKL protein synthesis was significantly increased by 10 mg/ml LPS (Fig. 4B). These results indicated that LPS modulated expression of OPG and RANKL not only at the gene level but at the protein level as well.
3.3. Effects of EMD on OPG and RANKL gene levels in the presence of LPS Next, we investigated whether EMD could modulate the effect of LPS on OPG and RANKL expression of osteoblasts. Though OPG gene expression was decreased by LPS, EMD neutralized the effect of LPS and markedly elevated the OPG gene expression level. On the other hand, RANKL gene expression was increased by LPS, but it was slightly reduced by adding EMD (Fig. 5A). To clarify the changes of OPG and RANKL gene expression, the ratio of OPG/RANKL gene expression was calculated by measuring band density. The ratio was significantly elevated
Fig. 4 – Effect of LPS on OPG and RANKL protein synthesis. (A) OPG protein content was significantly, dose-dependingly decreased at day 3 after adding LPS (*p < 0.05). (B) In contrast, sRANKL protein synthesis was significantly increased by 10 mg/ml of LPS (*p < 0.05).
310
archives of oral biology 54 (2009) 306–312
Fig. 5 – Effect of EMD on OPG and RANKL gene levels in the presence of LPS. Cells were cultured with the medium containing 1 mg/ml of LPS after reaching confluence, and then 10, 50 and 100 mg/ml EMD was added to the medium. (A) Though OPG gene expression was decreased by LPS, EMD neutralized the effect of LPS and markedly elevated the OPG gene expression level. On the other hand, RANKL gene expression was increased by LPS but it was slightly reduced by adding EMD. (B) The ratio of OPG/RANKL expression was calculated by measuring band density. The ratio was significantly elevated dependent on the concentration of EMD in the presence of 1 mg/ml LPS (*p < 0.05).
dependent on the concentration of EMD in the presence of 1 mg/ml LPS (Fig. 5B).
4.
Discussion
In this study, we demonstrated that EMD elevated OPG expression and suppressed RANKL expression in MC3T3-E1 osteoblastic cells, and that EMD neutralized the effect of LPS on osteoblasts. Expression of OPG and RANKL is closely associated with periodontitis.16 It has been reported that RANKL-expressing sites have deep periodontal pockets compared with RANKL-negative sites in periodontitis.20 In addition, high levels of RANKL protein and low levels of OPG were observed in periodontal tissue affected by periodontitis.21 A high concentration of RANKL and a low concentration of OPG were detected in gingival crevice fluid in periodontitis, and the ratio of the concentration of RANKL to that of OPG in the fluid was significantly increased by periodontal disease.22 These previous reports indicated that expression of RANKL and OPG was closely associated with bone resorption in periodontitis. EMD has been reported to increase the OPG mRNA level of MC3T3-E1 osteoblastic cells.11 Furthermore, EMD stimulates OPG production and reduces soluble RANKL production of human osteoblasts.12 Our findings that EMD modulated OPG and RANKL gene and protein levels agreed with those reports. Although the mRNA level did not coincide with the protein concentration in this study, this might have been because the mRNA and proteins were examined at the same time point, but mRNA expression usually occurs sooner than protein production. Furthermore, it was reported that EMD reduced the ratio of RANKL mRNA/OPG mRNA in the culture of human periodontal ligament cells.7 Therefore, EMD might regulate expression of OPG and RANKL in osteoblasts and contribute to periodontal tissue regeneration via the suppression of osteoclastogenesis,
which induces bone resorption, providing a favourable osteogenic microenvironment. Expression of OPG and RANKL is influenced by periodontopathic bacteria in periodontitis.16 It has been reported that infection with viable P. gingivalis induces RANKL production in osteoblasts23 and reduces OPG expression.24 Therefore, we investigated whether the effects of EMD on osteoblasts could be observed in the presence of a factor derived from bacteria. LPS originating from periodontopathic bacteria is a major factor that influences expression of OPG and RANKL. It induces the production of interleukin-1, 6, prostaglandin E2 and tumour necrosis factor-alpha, and they activate RANKL expression.16 Recently, LPS was demonstrated to stimulate RANKL expression via Toll-like receptor 417 and inhibit OPG expression via prostaglandin E218 in osteoblasts. These findings are in agreement with those of our study in which LPS suppressed OPG expression and elevated RANKL expression in osteoblasts. Though 1–10 mg/ml LPS are relatively high concentrations, no change of cell shape was observed during the experimental period by microscopic observation. Many reports have shown that LPS regulates expression of OPG and RANKL in various cells. Although, some studies found various effects of LPS on OPG and RANKL expression in different conditions, they all reported that the effect of LPS on the expression of OPG and RANKL was closely associated with inflammatory factors such as PGE and cyclooxygenase-2.25–27 As shown in Fig. 5, EMD enhanced OPG gene expression and suppressed RANKL gene expression in the presence of LPS. These results indicated that EMD neutralized the effect of LPS. In this study, we used the OPG/RANKL ratio as a benchmark of osteoclastogenesis to evaluate the effect of EMD on osteoblasts. The ratio of OPG gene expression to that of RANKL reveals favourable circumstances for bone remodelling in periodontitis,21,28 as the elevation of the OPG/RANKL ratio reflects the suppression of osteoclastogenesis and bone resorption in the disease.2
archives of oral biology 54 (2009) 306–312
Sato et al. demonstrated that LPS stimulated monocytes exposed to EMD exhibited a decrease in TNF-a production and increase in PGE2 production compared to controls not treated with EMD.29 They concluded that EMD modulated the synthesis of inflammation-associated factors in addition to its published roles in inducing proliferation, migration, adhesion, mineralization and differentiation of periodontal ligament cells. EMD might regulate expression OPG and RANKL by modulating the synthesis of inflammation-associated factors. In osteoblasts, it might also modulate expression of OPG and RANKL by regulating inflammationassociated factors. In this study, we demonstrated that EMD regulated expression of OPG and RANKL, however, the factors present in EMD that affect these phenomena remain unclear. Enamel matrix proteins and growth factors are suggested candidates. Amelogenin, a typical enamel matrix protein, was reported to downregulate RANKL expression in osteoblasts, and be a negative regulator of osteoclastogenesis.30 Among growth factors, transforming growth factor-beta (TGF-b), which is expressed in tooth germ,31,32 elevates OPG mRNA expression33,34 and protein synthesis,35 and suppresses RANKL mRNA expression.36 Recently, it has been reported that EMD showed TGF-b like activity,37,38 which implies that the effects of EMD on expression of OPG and RANKL may be due to TGF-b and enamel matrix proteins. Our finding that EMD elevated the OPG/RANKL ratio of osteoblasts and neutralized the effect of LPS has some implications for clinical usage of EMD. Elevation of the OPG/ RANKL ratio by the application of EMD in the presence of LPS is an advantage, because this ratio is considered to be downregulated in periodontitis by LPS from periodontopathic bacteria. EMD may promote periodontal regeneration via the inhibition of osteoclastogenesis and the prevention of bone resorption by regulation of OPG and RANKL expression resistant to LPS, but it could not be elucidated whether EMD inhibited bone resorption only through regulation of such expression. Therefore, a coculture system and in vivo studies will be necessary to fully elucidate the effect of EMD on bone resorption.
5.
6.
7.
8.
9.
10.
11.
12.
13. 14. 15.
16.
17.
Conflict of interest We report no conflicts of interest related to this study.
18.
references 19.
1. Venezia E, Goldstein M, Boyan BD, Schwartz Z. The use of enamel matrix derivative in the treatment of periodontal defect: a literature review and meta-analysis. Crit Rev Oral Biol Med 2004;15:382–402. 2. Hammarstro¨m L. Enamel matrix, cementum development and regeneration. J Clin Periodontol 1997;24:658–68. 3. Heden G, Wennstrom J, Lindhe J. Periodontal tissue alterations following Emdogain treatment of periodontal sites with angular bone defects: a series of case reports. J Clin Periodontol 1999;26:855–60. 4. Sculean A, Reich E, Chiantella GC, Brecx M. Treatment of intrabony periodontal defects with an enamel matrix
20.
21.
22.
311
protein derivative (Emdogain): a report of 32 cases. Int J Periodontics Restorative Dent 1999;19:157–63. Mellonig JT. Enamel matrix derivative for periodontal reconstructive surgery: technique and clinical and histologic case report. Int J Periodontics Restorative Dent 1999;19:8–19. Tonetti M, Lang N, Cortellini P. Enamel matrix proteins in the regenerative therapy of deep intrabony defects. J Clin Periodontol 2002;29:317–25. Takayanagi K, Osawa G, Nakaya H, Cochran DL, Kamoi K, Oates TW. Effects of enamel matrix derivative on bonerelated mRNA expression in human periodontal ligament cells in vitro. J Periodontol 2006;77:891–8. Haase HR, Bartold PM. Enamel matrix derivative induces matrix synthesis by cultured human periodontal fibroblast cells. J Periodontal 2001;72:341–8. Tokiyasu Y, Takata T, Saygin E, Somerman M. Enamel factors regulate expression of genes associated with cementoblasts. J Periodontol 2000;71:1829–39. Hagewald S, Pischon N, Jawor P, Bernimoulin JP, Zimmermann B. Effects of enamel matrix derivative on proliferation and differentiation of primary osteoblasts. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2004;98:243–9. He J, Jiang J, Safavi KE, Spangberg LSW, Zhu Q, Conn F. Emdogain promotes osteoblast proliferation and differentiation and stimulates osteoprotegerin expression. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2004;97: 239–45. Galli C, Macaluso GM, Guizzardi S, Vescovini R, Passeri M. Osteoprotegerin and receptor activator of nuclear factorkappa B ligand modulation by enamel matrix derivative in human alveolar osteoblasts. J Periodontol 2006;77:1223–8. Kohsla S. Minireview: the OPG/RANK system. Endocrinology 2001;142:5050–5. Boyle W, Simonet W, Lacey D. Osteoclast differentiation and activation. Nature 2003;423:337–42. Yasuda H, Shima N, Nakagawa N, Yamaguchi K, Kinosaki M, Mochizuki S, et al. Osteoclast differentiation factor is a ligand for osteoprotegerin/osteoclastogenesis-inhibitory factor and is identical to TRANCE/RANKL. Proc Natl Acad Sci USA 1998;31(95(7)):3597–602. Nagasawa T, Kiji M, Yashiro R, Hormdee D, He L, Kunze M, et al. Roles of receptor activator of nuclear factor-kB ligand (RANKL) and osteoprotegerin in periodontal health and disease. Periodontology 2000 2007;43:65–84. Kikuchi T, Matsuguchi T, Tsuboi N, Mitani A, Tanaka S, Matsuoka M, et al. Gene expression of osteoclast differentiation factor is induced by lipopolysaccharide in mouse osteoblasts via toll-like receptors. J Immunol 2001;166:3574–9. Suda K, Udagawa N, Sato N, Takami M, Itoh K, Woo JT, et al. Suppression of osteoprotegerin expression by prostaglandin E2 is crucislly involved in lipopolysaccharide-induced osteoclast formation. J Immunol 2004;172:2504–10. Kodama H, Amagai Y, Sudo H, Kasai S, Yamamoto S. Establishment of a clonal osteogenic cell line from newborn mouse calvaria. Jpn J Oral Biol 1981;121:899–901. Nagasawa T, Kobayashi H, Kiji M, Aramaki M, Mahanonda R, Kojima T, et al. LPS-stimulated human gingival fibroblasts inhibit the differentiation of monocytes into osteoclasts through the production of osteoprotegerin. Clin Exp Immunol 2002;130:338–44. Crotti T, Smith MD, Hirsch R, Soukoulis S, Weedon H, Capone M, et al. Receptor activator NF kappaB ligand (RANKL) and osteoprotegerin (OPG) protein expression in periodontitis. J Periodontal Res 2003;38(August (4)):380–7. Mogi M, Otogoto J, Ota N, Togari A. Differential expression of RANKL and osteoprotegerin in gingival crevicular fluid of patients with periodontitis. J Dent Res 2004;83:166–9.
312
archives of oral biology 54 (2009) 306–312
23. Okahashi N, Inaba H, Nakagawa I, Yamamura T, Kuboniwa M, Nakayama K, et al. Porphyromonas gingivalis induces receptor activator of NF-kappaB ligand expression in osteoblasts through the activator protein 1 pathway. Infect Immun 2004;72:1706–14. 24. Kobayashi-Sakamoto M, Hirose K, Isogai E. Chiba I NFkappaB-dependent induction of osteoprotegerin by Porphyromonas gingivalis in endotherial cells. Biochem Biophys Res Commun 2004;315:107–12. 25. Tanaka H, Tanabe N, Shoji M, Suzuki N, Katono T, Sato S, et al. Nicotine and lipopolysaccharide stimulate the formation of osteoclast-like cells by increasing macrophage colony-stimulating factor and prostaglandin E2 production by osteoblasts. Life Sci 2006;78(March (15)):1733–40. 26. Coon D, Gulati A, Cowan C, He J. The role of cyclooxygenase2 (COX-2) in inflammatory bone resorption. J Endod 2007 Apr;33(4):432–6. 27. Maruyama K, Takada Y, Ray N, Kishimoto Y, Penninger JM, Yasuda H, et al. Receptor activator of NF-kappa B ligand and osteoprotegerin regulate proinflammatory cytokine production in mice. J Immunol 2006;177(September (6)):3799– 805. 28. Jin Q, Cirelli JA, Park CH, Sugai JV, Taba Jr M, Kostenuik PJ, et al. RANKL inhibition through osteoprotegerin blocks bone loss in experimental periodontitis. J Periodontol 2007;78(July (7)):1300–8. 29. Sato S, Kitagawa M, Sakamoto K, Iizuka S, Kudo Y, Ogawa I, et al. Enamel matrix derivative exhibits anti-inflammatory properties in monocytes. J Periodontol 2008;79(March (3)):535–40. 30. Nishiguchi M, Yuasa K, Saito K, Fukumoto E, Yamada A, Hasagawa T, et al. Amelogenin is a negative regulator of osteoclastogenesis via downregulation of RANKL M-CSF and fibronectin expression in osteoblasts. Arch Oral Biol 2007;52:237–43. 31. Jepsen S, Schiltz P, Strong DD, Scharla SH, Snead ML, Finkelman RD. Transforming growth factor-beta 1 mRNA in
32.
33.
34.
35.
36.
37.
38.
neonatal ovine molars visualized by in situ hybridization: potential role for the stratum intermedium. Arch Oral Biol 1992;37:645–53. D‘souza RN, Happonen RP, Ritter NM, Butler WT. Temporal and spacial patterns of transforming growth factor-beta 1 expression in developing rat molars. Arch Oral Biol 1990;35:957–65. Thirunavukkarasu K, Miles RR, Halladay DL, Yang X, Galvin RJ, Candrasekkar S, et al. Stimulation of osteoprotegerin (OPG) gene expression by transforming growth factor-beta (TGF-beta) mapping of the OPG promoter region that mediates TGF-beta effects. J Biol Chem 2001;276:36241–50. Murakami T, Yamamoto M, Ono K, Nishikawa M, Nagata N, Motoyoshi K, et al. Transforming growth factor-beta1 increases mRNA levels of osteoclastogenesis inhibitory factor in osteoblastic/stromal cells and inhibits the survival of murine osteoclast-like cells. Biochem Biophys Res Commun 1998;252:747–52. Takai H, Kanematsu M, Yano K, Tsuda E, Higashio K, Ikeda K, et al. Transforming growth factor-beta stimulates the production of osteoprotegerin/osteoclastogenesis inhibitory factor by bone marrow stromal cells. J Biol Chem 1998;273:27091–6. Quinn JM, Itoh K, Udagawa N, Hausler K, Yasuda H, Shima N, et al. Transforming growth factor beta affects osteoclast differentiation via direct and indirect actions. J Bone Miner Res 2001;16:1787–94. Kawase T, Okuda K, Yoshie H, Burns DM. Anti-TGF-b antibody blocks enamel matrix derivative-induced upregulation of p21WAF1/cip1 and prevents its inhibition of human oral epithelial cell proliferation. J Periodontal Res 2002;38:255–62. Wada Y, Yamamoto H, Nanbu S, Mizuno M, Tamura M. The suppressive effect of enamel matrix derivative on osteocalcin gene expression of osteoblast is neutralized by an antibody against transforming growth factor-beta. J Periodontol 2008;79:341–7.
available at www.sciencedirect.com
journal homepage: www.intl.elsevierhealth.com/journals/arob
Enamel matrix derivative neutralized the effect of lipopolysaccharide on osteoprotegerin and receptor activator of nuclear factor kappa B ligand expression of osteoblasts§ Yoshiyuki Wada *, Morimichi Mizuno, Masato Tamura Department of Oral Health Science, Graduate School of Dentistry, Hokkaido University, Nishi 7, Kita 13, Kita-ku, Sapporo 060-8586, Japan
article info
abstract
Article history:
Objective: In this study, we investigated the effects of enamel matrix derivative (EMD) on
Accepted 13 January 2009
osteoprotegerin (OPG) and receptor activator of nuclear factor kappa B ligand (RANKL) expression of osteoblasts in the presence of lipopolysaccharide (LPS).
Keywords:
Study design: OPG and RANKL gene expression and protein synthesis of MC3T3-E1 osteo-
Enamel matrix derivative
blastic cells were examined by reverse transcription-polymerase chain reaction and
Osteoprotegerin
enzyme-linked immunosorbent assay.
Receptor activator of nuclear factor
Results: LPS inhibited OPG gene expression and protein synthesis, and stimulated RANKL
kappa B ligand
gene expression and soluble RANKL synthesis. EMD enhanced OPG gene expression and
Lipopolysaccharide
protein synthesis, and inhibited RANKL gene expression and soluble RANKL synthesis.
Osteoblast
Furthermore, EMD neutralized the effects of LPS on OPG and RANKL expression in osteoblasts. Conclusions: EMD might regulate the function of osteoblasts by elevating the ratio of OPG/ RANKL gene expression, which is downregulated by LPS, and suppress the induction of osteoclastogenesis. Thereby, EMD might contribute to periodontal tissue regeneration. # 2009 Elsevier Ltd. All rights reserved.
1.
Introduction
Several attempts have been made to restore periodontal tissue loss induced by periodontitis. Enamel matrix derivative (EMD), which is extracted from developing porcine tooth germs, has been used widely as an effective material to regenerate periodontal tissues.1 The clinical use of EMD is based on the observation that Hertwig’s epithelial root sheath deposits an enamel-like matrix on the dentin surface of the developing root.2 Clinical studies have shown that EMD successfully promotes cementum and alveolar bone formation in periodontal tissue.2,3 In addition, other clinical studies of EMD treatment for intrabony periodontal defects have found that it leads to §
regeneration of the periodontal ligament, and markedly enhances clinical attachment and alveolar bone growth.4–6 On the other hand, it has been reported that EMD regulates the proliferation and differentiation of periodontal ligament cells,7 epithelial cells, fibroblasts,8 cementoblasts9 and osteoblasts10 in cell culture studies. These findings indicate that EMD regulates the expression of osteoblast-related genes, alkaline phosphatase (ALP) activity, mineralization, protein synthesis, and the proliferation of most kinds of cells. Although EMD shows clinical efficacy, the precise mechanism of periodontal tissue regeneration by EMD is still unclear. Recently, it has been reported that EMD modulates the expression of osteoprotegerin (OPG) and receptor activator of nuclear factor kappa B ligand (RANKL).7,11,12 RANKL is expressed
Grant-in-aid from the Ministry of Education, Culture, Sports, Science and Technology of Japan. * Corresponding author. Tel.: +81 11 706 4235; fax: +81 11 706 4235. E-mail addresses: [email protected], [email protected] (Y. Wada). 0003–9969/$ – see front matter # 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.archoralbio.2009.01.004
archives of oral biology 54 (2009) 306–312
in cells of osteoblastic lineage in membrane-bound or soluble form.13 It induces preosteoclast differentiation into mature osteoclasts by binding to a specific receptor present on cells of osteoclastic lineage, RANK.14 RANKL signaling can be blocked by OPG, which is a decoy receptor for RANKL that occupies RANKL binding sites and protects bone from resorption. OPG is produced by osteoblastic cells and prevents the binding of RANK to its ligand, followed by inhibition of the differentiation of osteoclastic cells and recruitment of osteoclasts.15 Furthermore, expression of OPG and RANKL is reported to be closely associated with bone resorption due to periodontitis.16 EMD increases OPG gene expression in MC3T3-E1 osteoblastic cells.11 Galli et al. demonstrated that EMD stimulated OPG production and reduced RANKL production in human alveolar osteoblasts, and concluded that EMD offered a favourable osteogenic microenvironment.12 Furthermore, EMD reduces the RANKL/OPG gene ratio of human periodontal ligament cells.7 These reports imply that the effects of EMD on periodontal tissue regeneration might be partly associated with expression of OPG and RANKL by osteoblasts. One of the factors that influences expression of OPG and RANKL in periodontitis is lipopolysaccharide (LPS) from periodontopathic bacteria, represented by Porphyromonas gingivalis. LPS promotes bone resorption via cytokine production by macrophages which induce RANKL expression in osteoblasts.16 Recently, it was reported that LPS directly induced RANKL expression of osteoblasts17 and reciprocally suppressed OPG expression.18 These reports suggest that OPG and RANKL gene expression of osteoblasts is directly modulated by LPS in periodontitis. However, the effects of EMD on RANKL and OPG expression in the presence of LPS have never been reported. We hypothesized that EMD regulated osteoblasts via regulation of OPG and RANKL expression which are modulated by LPS in periodontitis, and might stimulate periodontal tissue regeneration. Therefore, we investigated the effects of EMD on OPG and RANKL expression of osteoblasts in the presence of LPS.
2.
Materials and methods
2.1.
Material preparation
EMD was purchased in gel form (Emdogain, Seikagaku, Tokyo, Japan). LPS isolated from Escherichia coli (List Biological Labs, Inc., Campbell) was dissolved in water heated at 37 8C with intermittent vortexing.
2.2.
Cell culture
MC3T3-E1 osteoblastic cells that originated from mouse calvaria19 were provided by the RIKEN CELL BANK (Tsukuba, Japan). Cells were cultured in a-minimum essential medium (GIBCO-BRL Life Technologies, Rockville, MD) that contained ascorbic acid (50 mg/ml), with 10% fetal calf serum. Then the cells were plated in 35-mm dishes (Corning International, Tokyo, Japan) and cultured in a humidified atmosphere of 5% CO2 (v/v) at 37 8C. The medium was changed every 2 days.
307
Cells were cultured with 10, 50 and 100 mg/ml EMD. The materials were added after the cells reached confluence. EMD was added to the medium after treating cells with LPS to investigate the effects of EMD on OPG and RANKL gene levels in the presence of LPS.
2.3.
Enzyme-linked immunosorbent assay (ELISA)
The OPG and soluble RANKL (sRANKL) contents in the medium were examined using a commercial enzyme-linked immunosorbent assay (ELISA) kit (R and D Systems, Minneapolis, MN). The culture medium was used for the analysis of OPG and sRANKL contents. A 96-well plate was used for ELISA. Measurement was done using a microplate reader set to 450 nm. The measurement was done 3 days after adding the materials.
2.4. Reverse transcription-polymerase chain reaction (RT-PCR) The mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), OPG and RANKL were measured by RT-PCR. The gene-specific primers used were forward CACCATGGAGAAGGCCGGGG, reverse GACGGACACATTGGGGGTAG, for GAPDH; forward ATGCCGAGAGTGTAGAGAGAGGAT, reverse AAACAGCCCAGTGGACCATTCCT for OPG; and forward CTCTTGGTACCACGATCGAG, reverse AAGCCCCAAAGTACGTCGCA for RANKL. Total RNA was isolated using the acid guanidine thiocyanate–phenol–chloroform method. mRNA was converted to cDNA using avian myeloblastosis virus-reverse transcriptase (Promega, Tokyo, Japan). The reaction mixture consisted of PCR buffer, 2.5 mM MgCl2, 1 mM deoxynucleotide triphosphate (dNTP) mixture, each primer at 0.2 mM, and Taq polymerase (2.5 U/100 ml) (Applied Biosystems, Tokyo, Japan). PCR amplification of cDNA was conducted using gene-specific primers in a PCR thermocycler. Thermal cycling was performed with 1 cycle of 94 8C for 12 min, and 25–28 cycles of 95 8C for 30 s, 60 8C for 30 s, and 72 8C for 90 s. We tried several cycle numbers to attain adequate conditions for the RT-PCR experiment, and we used 25 cycles for GAPDH, 28 cycles for OPG, 28 cycles for RANKL. The reaction products were analysed by electrophoresis of 10-ml samples in 2.5% agarose gels. The amplified DNA fragments were stained with ethidium bromide and photographed under ultraviolet illumination. GAPDH mRNA was used as an internal control. The densities of the bands were converted to relative values (NIH Image, National Institutes of Health, Bethesda, MD) and the level of each gene was normalized by dividing it by the amount of GAPDH mRNA. The measurement was done 3 days after adding the materials. To investigate the effect of EMD on LPS-affected osteoblasts, cells were cultured with the medium containing 1 mg/ ml of LPS after reaching confluence, and then 10, 50 and 100 mg/ml EMD was immediately added to the medium. Cells were then cultured for 72 h in the medium containing the materials.
308
archives of oral biology 54 (2009) 306–312
Fig. 1 – Effect of EMD on OPG and RANKL gene expression MC3T3-E1 osteoblastic cells were cultured with the medium containing 10, 50 or 100 mg/ml EMD after reaching confluence. The measurement was done 3 days after adding the materials. (A) OPG gene level was elevated at day 3 with every concentration of EMD. On the other hand, RANKL the gene level was suppressed by EMD. (B and C) The level of each gene was normalized by dividing it by the amount of GAPDH mRNA (*p < 0.05). CT = control. Each column shows the mean W S.D. (N = 3).
Fig. 2 – Effect of EMD on OPG and RANKL protein synthesis. (A) OPG protein synthesis was significantly and dosedependingly increased at day 3 after adding EMD (*p < 0.05). (B) On the other hand, sRANKL protein synthesis was significantly decreased by 100 mg/ml EMD (*p < 0.05).
2.5.
Statistical analysis
3.
Results
Next, we investigated OPG and sRANKL protein synthesis to confirm that EMD also regulated OPG and RANKL protein levels. OPG protein synthesis was significantly and dosedependingly increased at day 3 after adding EMD (Fig. 2A). On the other hand, sRANKL protein synthesis was significantly decreased by 100 mg/ml EMD (Fig. 2B). These results indicated that EMD modulated OPG and RANKL expression not only at the gene level but also at the protein level.
3.1.
Effects of EMD on expression of OPG and RANKL
3.2.
Assays were run in triplicate and the data were analysed using Student’s t-test. The experimental groups and control groups were compared.
The OPG gene levels were elevated at day 3 with every concentration of EMD. On the other hand, the RANKL gene expression was suppressed by EMD (Fig. 1A–C).
Effects of LPS on OPG and RANKL expression
Next, we investigated the effect of LPS on osteoblasts to evaluate the effects of EMD on expression of OPG and RANKL in pathological conditions.
archives of oral biology 54 (2009) 306–312
309
Fig. 3 – Effect of LPS on OPG and RANKL gene expression. Cells were cultured with medium containing 1, 5 or 10 mg/ml of LPS after reaching confluence. (A) OPG gene expression was decreased at day 3 after adding LPS. On the other hand, RANKL gene expression was increased by LPS. (B and C) The level of each gene was normalized by dividing it by the amount of GAPDH mRNA (*p < 0.05).
First, we studied whether LPS affected OPG and RANKL mRNA levels. OPG gene expression was decreased at day 3 after adding LPS. On the other hand, RANKL gene expression was increased by LPS (Fig. 3A–C). Next, we measured OPG and sRANKL protein contents to confirm that LPS also regulated OPG and RANKL protein levels. OPG protein content was significantly, dose-dependingly decreased at day 3 after adding LPS (Fig. 4A). In contrast, sRANKL protein synthesis was significantly increased by 10 mg/ml LPS (Fig. 4B). These results indicated that LPS modulated expression of OPG and RANKL not only at the gene level but at the protein level as well.
3.3. Effects of EMD on OPG and RANKL gene levels in the presence of LPS Next, we investigated whether EMD could modulate the effect of LPS on OPG and RANKL expression of osteoblasts. Though OPG gene expression was decreased by LPS, EMD neutralized the effect of LPS and markedly elevated the OPG gene expression level. On the other hand, RANKL gene expression was increased by LPS, but it was slightly reduced by adding EMD (Fig. 5A). To clarify the changes of OPG and RANKL gene expression, the ratio of OPG/RANKL gene expression was calculated by measuring band density. The ratio was significantly elevated
Fig. 4 – Effect of LPS on OPG and RANKL protein synthesis. (A) OPG protein content was significantly, dose-dependingly decreased at day 3 after adding LPS (*p < 0.05). (B) In contrast, sRANKL protein synthesis was significantly increased by 10 mg/ml of LPS (*p < 0.05).
310
archives of oral biology 54 (2009) 306–312
Fig. 5 – Effect of EMD on OPG and RANKL gene levels in the presence of LPS. Cells were cultured with the medium containing 1 mg/ml of LPS after reaching confluence, and then 10, 50 and 100 mg/ml EMD was added to the medium. (A) Though OPG gene expression was decreased by LPS, EMD neutralized the effect of LPS and markedly elevated the OPG gene expression level. On the other hand, RANKL gene expression was increased by LPS but it was slightly reduced by adding EMD. (B) The ratio of OPG/RANKL expression was calculated by measuring band density. The ratio was significantly elevated dependent on the concentration of EMD in the presence of 1 mg/ml LPS (*p < 0.05).
dependent on the concentration of EMD in the presence of 1 mg/ml LPS (Fig. 5B).
4.
Discussion
In this study, we demonstrated that EMD elevated OPG expression and suppressed RANKL expression in MC3T3-E1 osteoblastic cells, and that EMD neutralized the effect of LPS on osteoblasts. Expression of OPG and RANKL is closely associated with periodontitis.16 It has been reported that RANKL-expressing sites have deep periodontal pockets compared with RANKL-negative sites in periodontitis.20 In addition, high levels of RANKL protein and low levels of OPG were observed in periodontal tissue affected by periodontitis.21 A high concentration of RANKL and a low concentration of OPG were detected in gingival crevice fluid in periodontitis, and the ratio of the concentration of RANKL to that of OPG in the fluid was significantly increased by periodontal disease.22 These previous reports indicated that expression of RANKL and OPG was closely associated with bone resorption in periodontitis. EMD has been reported to increase the OPG mRNA level of MC3T3-E1 osteoblastic cells.11 Furthermore, EMD stimulates OPG production and reduces soluble RANKL production of human osteoblasts.12 Our findings that EMD modulated OPG and RANKL gene and protein levels agreed with those reports. Although the mRNA level did not coincide with the protein concentration in this study, this might have been because the mRNA and proteins were examined at the same time point, but mRNA expression usually occurs sooner than protein production. Furthermore, it was reported that EMD reduced the ratio of RANKL mRNA/OPG mRNA in the culture of human periodontal ligament cells.7 Therefore, EMD might regulate expression of OPG and RANKL in osteoblasts and contribute to periodontal tissue regeneration via the suppression of osteoclastogenesis,
which induces bone resorption, providing a favourable osteogenic microenvironment. Expression of OPG and RANKL is influenced by periodontopathic bacteria in periodontitis.16 It has been reported that infection with viable P. gingivalis induces RANKL production in osteoblasts23 and reduces OPG expression.24 Therefore, we investigated whether the effects of EMD on osteoblasts could be observed in the presence of a factor derived from bacteria. LPS originating from periodontopathic bacteria is a major factor that influences expression of OPG and RANKL. It induces the production of interleukin-1, 6, prostaglandin E2 and tumour necrosis factor-alpha, and they activate RANKL expression.16 Recently, LPS was demonstrated to stimulate RANKL expression via Toll-like receptor 417 and inhibit OPG expression via prostaglandin E218 in osteoblasts. These findings are in agreement with those of our study in which LPS suppressed OPG expression and elevated RANKL expression in osteoblasts. Though 1–10 mg/ml LPS are relatively high concentrations, no change of cell shape was observed during the experimental period by microscopic observation. Many reports have shown that LPS regulates expression of OPG and RANKL in various cells. Although, some studies found various effects of LPS on OPG and RANKL expression in different conditions, they all reported that the effect of LPS on the expression of OPG and RANKL was closely associated with inflammatory factors such as PGE and cyclooxygenase-2.25–27 As shown in Fig. 5, EMD enhanced OPG gene expression and suppressed RANKL gene expression in the presence of LPS. These results indicated that EMD neutralized the effect of LPS. In this study, we used the OPG/RANKL ratio as a benchmark of osteoclastogenesis to evaluate the effect of EMD on osteoblasts. The ratio of OPG gene expression to that of RANKL reveals favourable circumstances for bone remodelling in periodontitis,21,28 as the elevation of the OPG/RANKL ratio reflects the suppression of osteoclastogenesis and bone resorption in the disease.2
archives of oral biology 54 (2009) 306–312
Sato et al. demonstrated that LPS stimulated monocytes exposed to EMD exhibited a decrease in TNF-a production and increase in PGE2 production compared to controls not treated with EMD.29 They concluded that EMD modulated the synthesis of inflammation-associated factors in addition to its published roles in inducing proliferation, migration, adhesion, mineralization and differentiation of periodontal ligament cells. EMD might regulate expression OPG and RANKL by modulating the synthesis of inflammation-associated factors. In osteoblasts, it might also modulate expression of OPG and RANKL by regulating inflammationassociated factors. In this study, we demonstrated that EMD regulated expression of OPG and RANKL, however, the factors present in EMD that affect these phenomena remain unclear. Enamel matrix proteins and growth factors are suggested candidates. Amelogenin, a typical enamel matrix protein, was reported to downregulate RANKL expression in osteoblasts, and be a negative regulator of osteoclastogenesis.30 Among growth factors, transforming growth factor-beta (TGF-b), which is expressed in tooth germ,31,32 elevates OPG mRNA expression33,34 and protein synthesis,35 and suppresses RANKL mRNA expression.36 Recently, it has been reported that EMD showed TGF-b like activity,37,38 which implies that the effects of EMD on expression of OPG and RANKL may be due to TGF-b and enamel matrix proteins. Our finding that EMD elevated the OPG/RANKL ratio of osteoblasts and neutralized the effect of LPS has some implications for clinical usage of EMD. Elevation of the OPG/ RANKL ratio by the application of EMD in the presence of LPS is an advantage, because this ratio is considered to be downregulated in periodontitis by LPS from periodontopathic bacteria. EMD may promote periodontal regeneration via the inhibition of osteoclastogenesis and the prevention of bone resorption by regulation of OPG and RANKL expression resistant to LPS, but it could not be elucidated whether EMD inhibited bone resorption only through regulation of such expression. Therefore, a coculture system and in vivo studies will be necessary to fully elucidate the effect of EMD on bone resorption.
5.
6.
7.
8.
9.
10.
11.
12.
13. 14. 15.
16.
17.
Conflict of interest We report no conflicts of interest related to this study.
18.
references 19.
1. Venezia E, Goldstein M, Boyan BD, Schwartz Z. The use of enamel matrix derivative in the treatment of periodontal defect: a literature review and meta-analysis. Crit Rev Oral Biol Med 2004;15:382–402. 2. Hammarstro¨m L. Enamel matrix, cementum development and regeneration. J Clin Periodontol 1997;24:658–68. 3. Heden G, Wennstrom J, Lindhe J. Periodontal tissue alterations following Emdogain treatment of periodontal sites with angular bone defects: a series of case reports. J Clin Periodontol 1999;26:855–60. 4. Sculean A, Reich E, Chiantella GC, Brecx M. Treatment of intrabony periodontal defects with an enamel matrix
20.
21.
22.
311
protein derivative (Emdogain): a report of 32 cases. Int J Periodontics Restorative Dent 1999;19:157–63. Mellonig JT. Enamel matrix derivative for periodontal reconstructive surgery: technique and clinical and histologic case report. Int J Periodontics Restorative Dent 1999;19:8–19. Tonetti M, Lang N, Cortellini P. Enamel matrix proteins in the regenerative therapy of deep intrabony defects. J Clin Periodontol 2002;29:317–25. Takayanagi K, Osawa G, Nakaya H, Cochran DL, Kamoi K, Oates TW. Effects of enamel matrix derivative on bonerelated mRNA expression in human periodontal ligament cells in vitro. J Periodontol 2006;77:891–8. Haase HR, Bartold PM. Enamel matrix derivative induces matrix synthesis by cultured human periodontal fibroblast cells. J Periodontal 2001;72:341–8. Tokiyasu Y, Takata T, Saygin E, Somerman M. Enamel factors regulate expression of genes associated with cementoblasts. J Periodontol 2000;71:1829–39. Hagewald S, Pischon N, Jawor P, Bernimoulin JP, Zimmermann B. Effects of enamel matrix derivative on proliferation and differentiation of primary osteoblasts. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2004;98:243–9. He J, Jiang J, Safavi KE, Spangberg LSW, Zhu Q, Conn F. Emdogain promotes osteoblast proliferation and differentiation and stimulates osteoprotegerin expression. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2004;97: 239–45. Galli C, Macaluso GM, Guizzardi S, Vescovini R, Passeri M. Osteoprotegerin and receptor activator of nuclear factorkappa B ligand modulation by enamel matrix derivative in human alveolar osteoblasts. J Periodontol 2006;77:1223–8. Kohsla S. Minireview: the OPG/RANK system. Endocrinology 2001;142:5050–5. Boyle W, Simonet W, Lacey D. Osteoclast differentiation and activation. Nature 2003;423:337–42. Yasuda H, Shima N, Nakagawa N, Yamaguchi K, Kinosaki M, Mochizuki S, et al. Osteoclast differentiation factor is a ligand for osteoprotegerin/osteoclastogenesis-inhibitory factor and is identical to TRANCE/RANKL. Proc Natl Acad Sci USA 1998;31(95(7)):3597–602. Nagasawa T, Kiji M, Yashiro R, Hormdee D, He L, Kunze M, et al. Roles of receptor activator of nuclear factor-kB ligand (RANKL) and osteoprotegerin in periodontal health and disease. Periodontology 2000 2007;43:65–84. Kikuchi T, Matsuguchi T, Tsuboi N, Mitani A, Tanaka S, Matsuoka M, et al. Gene expression of osteoclast differentiation factor is induced by lipopolysaccharide in mouse osteoblasts via toll-like receptors. J Immunol 2001;166:3574–9. Suda K, Udagawa N, Sato N, Takami M, Itoh K, Woo JT, et al. Suppression of osteoprotegerin expression by prostaglandin E2 is crucislly involved in lipopolysaccharide-induced osteoclast formation. J Immunol 2004;172:2504–10. Kodama H, Amagai Y, Sudo H, Kasai S, Yamamoto S. Establishment of a clonal osteogenic cell line from newborn mouse calvaria. Jpn J Oral Biol 1981;121:899–901. Nagasawa T, Kobayashi H, Kiji M, Aramaki M, Mahanonda R, Kojima T, et al. LPS-stimulated human gingival fibroblasts inhibit the differentiation of monocytes into osteoclasts through the production of osteoprotegerin. Clin Exp Immunol 2002;130:338–44. Crotti T, Smith MD, Hirsch R, Soukoulis S, Weedon H, Capone M, et al. Receptor activator NF kappaB ligand (RANKL) and osteoprotegerin (OPG) protein expression in periodontitis. J Periodontal Res 2003;38(August (4)):380–7. Mogi M, Otogoto J, Ota N, Togari A. Differential expression of RANKL and osteoprotegerin in gingival crevicular fluid of patients with periodontitis. J Dent Res 2004;83:166–9.
312
archives of oral biology 54 (2009) 306–312
23. Okahashi N, Inaba H, Nakagawa I, Yamamura T, Kuboniwa M, Nakayama K, et al. Porphyromonas gingivalis induces receptor activator of NF-kappaB ligand expression in osteoblasts through the activator protein 1 pathway. Infect Immun 2004;72:1706–14. 24. Kobayashi-Sakamoto M, Hirose K, Isogai E. Chiba I NFkappaB-dependent induction of osteoprotegerin by Porphyromonas gingivalis in endotherial cells. Biochem Biophys Res Commun 2004;315:107–12. 25. Tanaka H, Tanabe N, Shoji M, Suzuki N, Katono T, Sato S, et al. Nicotine and lipopolysaccharide stimulate the formation of osteoclast-like cells by increasing macrophage colony-stimulating factor and prostaglandin E2 production by osteoblasts. Life Sci 2006;78(March (15)):1733–40. 26. Coon D, Gulati A, Cowan C, He J. The role of cyclooxygenase2 (COX-2) in inflammatory bone resorption. J Endod 2007 Apr;33(4):432–6. 27. Maruyama K, Takada Y, Ray N, Kishimoto Y, Penninger JM, Yasuda H, et al. Receptor activator of NF-kappa B ligand and osteoprotegerin regulate proinflammatory cytokine production in mice. J Immunol 2006;177(September (6)):3799– 805. 28. Jin Q, Cirelli JA, Park CH, Sugai JV, Taba Jr M, Kostenuik PJ, et al. RANKL inhibition through osteoprotegerin blocks bone loss in experimental periodontitis. J Periodontol 2007;78(July (7)):1300–8. 29. Sato S, Kitagawa M, Sakamoto K, Iizuka S, Kudo Y, Ogawa I, et al. Enamel matrix derivative exhibits anti-inflammatory properties in monocytes. J Periodontol 2008;79(March (3)):535–40. 30. Nishiguchi M, Yuasa K, Saito K, Fukumoto E, Yamada A, Hasagawa T, et al. Amelogenin is a negative regulator of osteoclastogenesis via downregulation of RANKL M-CSF and fibronectin expression in osteoblasts. Arch Oral Biol 2007;52:237–43. 31. Jepsen S, Schiltz P, Strong DD, Scharla SH, Snead ML, Finkelman RD. Transforming growth factor-beta 1 mRNA in
32.
33.
34.
35.
36.
37.
38.
neonatal ovine molars visualized by in situ hybridization: potential role for the stratum intermedium. Arch Oral Biol 1992;37:645–53. D‘souza RN, Happonen RP, Ritter NM, Butler WT. Temporal and spacial patterns of transforming growth factor-beta 1 expression in developing rat molars. Arch Oral Biol 1990;35:957–65. Thirunavukkarasu K, Miles RR, Halladay DL, Yang X, Galvin RJ, Candrasekkar S, et al. Stimulation of osteoprotegerin (OPG) gene expression by transforming growth factor-beta (TGF-beta) mapping of the OPG promoter region that mediates TGF-beta effects. J Biol Chem 2001;276:36241–50. Murakami T, Yamamoto M, Ono K, Nishikawa M, Nagata N, Motoyoshi K, et al. Transforming growth factor-beta1 increases mRNA levels of osteoclastogenesis inhibitory factor in osteoblastic/stromal cells and inhibits the survival of murine osteoclast-like cells. Biochem Biophys Res Commun 1998;252:747–52. Takai H, Kanematsu M, Yano K, Tsuda E, Higashio K, Ikeda K, et al. Transforming growth factor-beta stimulates the production of osteoprotegerin/osteoclastogenesis inhibitory factor by bone marrow stromal cells. J Biol Chem 1998;273:27091–6. Quinn JM, Itoh K, Udagawa N, Hausler K, Yasuda H, Shima N, et al. Transforming growth factor beta affects osteoclast differentiation via direct and indirect actions. J Bone Miner Res 2001;16:1787–94. Kawase T, Okuda K, Yoshie H, Burns DM. Anti-TGF-b antibody blocks enamel matrix derivative-induced upregulation of p21WAF1/cip1 and prevents its inhibition of human oral epithelial cell proliferation. J Periodontal Res 2002;38:255–62. Wada Y, Yamamoto H, Nanbu S, Mizuno M, Tamura M. The suppressive effect of enamel matrix derivative on osteocalcin gene expression of osteoblast is neutralized by an antibody against transforming growth factor-beta. J Periodontol 2008;79:341–7.