- Email: [email protected]
Endocrine disruptors modulate expression of hepatic choriogenin genes in the hermaphroditic fish, Kryptolebias marmoratus
Comparative Biochemistry and Physiology, Part C 150 (2009) 170–178
Contents lists available at ScienceDirect
Comparative Biochemistry and Physiology, Part C j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / c b p c
Endocrine disruptors modulate expression of hepatic choriogenin genes in the hermaphroditic fish, Kryptolebias marmoratus Jae-Sung Rhee a, Han Seung Kang b, Sheikh Raisuddin c, Dae-Sik Hwang a, Jeonghoon Han a, Ryeo-Ok Kim b, Jung Soo Seo d, Young-Mi Lee e, Gyung Soo Park f, Su-Jae Lee b, Jae-Seong Lee b,⁎ a
Department of Molecular and Environmental Bioscience, Graduate School, Hanyang University, Seoul 133-791, South Korea Department of Chemistry, College of Natural Sciences, Hanyang University, Seoul 133-791, South Korea Ecotoxicology Laboratory, Department of Medical Elementology and Toxicology, Hamdard University, New Delhi 110 062, India d Pathology Team, National Fisheries Research & Development Institute, Busan 619-902, South Korea e Department of Life Science, College of Natural Sciences, Sangmyung University, Seoul 110-743, South Korea f Department of Marine Biotechnology, College of Liberal Arts and Sciences, Anyang University, Ganghwa 417-833, South Korea b c
a r t i c l e
i n f o
Article history: Received 18 December 2008 Received in revised form 18 April 2009 Accepted 20 April 2009 Available online 23 April 2009 Keywords: Kryptolebias marmoratus Choriogenin Endocrine disrupting chemicals Biomarker
a b s t r a c t Choriogenins (Chgs) are precursors of inner layer of egg envelope that are synthesized in fish liver in response to estrogens. Therefore, study of their expression serves as biomarker of exposure to endocrine disrupting chemicals (EDCs). The self-fertilizing fish, Kryptolebias marmoratus has been established as a model species for testing the action of EDCs. To use this fish as a model for assessing estrogenic activity of EDCs on Chg expression, two K. marmoratus choreogenin genes, Km-ChgH and Km-ChgL were cloned and their expression was analyzed in different tissues and in developmental stages by real-time RT-PCR. Expression levels of liver mRNA were compared between hermaphrodites and secondary males after exposure to EDCs. Km-ChgH and Km-ChgL genes that were predominantly expressed in liver contained zona pellucida (ZP) domains. During embryonic development, low expression of mRNA was observed at stage 1 (2 dpf) that reached highest level at stage 4 (12 dpf) or stage 5 (5 h post hatching). The expression of Km-Chg mRNAs was highly increased in liver exposed to natural estrogen, 17α-estradiol (E2) as well as EDCs such as bisphenol A and 4-n-nonylphenol in both the gender types. Another EDC, 4-tert-octylphenol, showed modulatory effect only on Km-ChgH in hermaphrodites. Tamoxifen, an antagonist of the estrogen receptor showed no effect on expression of Chg genes in either of the gender types of K. marmoratus. These findings indicate that Km-Chg genes would be associated with estrogen and measurement of their expression would serve as a surrogate biomarker of exposure to environmental EDCs. © 2009 Elsevier Inc. All rights reserved.
1. Introduction The fish egg envelope consists of two distinct layers; the outer thin layer that is formed around the oocytes during the later stage of previtellogenic development and the thick inner layer, called zona radiata that occupies most of the egg envelope (Hamazaki et al., 1989; Litscher and Wassarman, 2007). Their overall role is to protect the egg and embryo from the environmental damage. In teleost fish, choriogenins (Chgs) are egg envelop protein precursors that are synthesized in the liver in response to estrogens and then transported to the ovaries by the blood stream (Yamagami, 1996; Murata et al., 1997; Arukwe and Goksoyr, 2003). Most of the research on Chgs has been done in Japanese medaka (Oryzias latipes). The inner layer of the egg envelope of the Japanese medaka consists of two major subunit
⁎ Corresponding author. Tel.: +82 2 2220 0769; fax: +82 2 2299 9450. E-mail address: [email protected] (J.-S. Lee). 1532-0456/$ – see front matter © 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.cbpc.2009.04.006
groups, ZI-1,2 and ZI-3. The ZI-1,2 group represents three glycoproteins of a common polypeptide moiety derived from their precursor, choriogenin H (ChgH). ZI-3 is a single glycoprotein derived from the precursor, choriogenin L (ChgL) (Murata et al., 1995, 1997; Sugiyama et al., 1998). H and L denotes the relative molecular masses of high (74–76 kDa) and low (49 kDa), respectively of the respective glycoproteins. Besides medaka, Chg genes and their products have been characterized from some other fish species such as the brackish medaka (Oryzias melastigma), the masu salmon (Oncorhynchus masou) and the red lip mullet (Chelon haematocheilus) (Fujita et al., 2004, 2008; Chen et al., 2008; Hong et al., 2009). Both fish Chg proteins contain a zona pellucida (ZP) domain that is common in the egg envelope glycoproteins from different vertebrates (Monné et al., 2006). Fish Chgs genes are actively regulated by binding to the estrogen receptor (ER) complex through estrogen responsive elements (ERE) in the 5′-flanking region of Chg genes (Ueno et al., 2004). Choriogenins are regarded as sensitive biomarkers of exposure to estrogenic pollutants or endocrine disrupting chemicals (EDCs) (Lee et al., 2002a,b; Chen et al., 2008; Hong et al., 2009). Arukwe et al. (1997)
J.-S. Rhee et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 170–178
171
Table 1 Primers used. Gene
Oligo name
Sequence (5′→3′)
Remarks
Km-Choriogenin H
dg-F dg-R 5GSP1 5GSP2 5GSP3 3GSP1 3GSP2 RT-F RT-R dg-F dg-R 5GSP1 5GSP2 5GSP3 3GSP1 3GSP2 RT-F RT-R RT-F RT-R
CTTTCYTGTTACTGCCTGYGGCAC GAYTAACAAAGGTAAACATYTTG CTTACTAATGTGGTTCTC GTAGGTGATTGTATTGTTTAAGACTG CTGCAAATACTACAAATACCTACAGTG GCTCCTCGATAAGACAGATCCTGCGC CCTCGCACCCCGAGCCTCACAGTGTC TTTGGGATGAACATTTGGAACC CGCTACCCTTCGTTGTTCTGC TGCTTGRCRGCTTYTGTGATGCTCA GTTRTYAATGAAGGCATARYTGGGG CGCAGCTTCGTAAATCAA CTCTGCAATGGGGCCACAGTCAC CAGGGTGAGGTCAGCCGGACTG TCTCATCTACACCTATACTTTGAACTAC GTGTTTACTTGGACAGATGTATAGCTAC GTGGTGCACAGTGTTCCAGCAGTTG GTTTGGTACACATCACGCACTTTCC GAACTCACCGACACCAGCA ATCATCGACGCTCCTGGAC
Cloning
Km-Choriogenin L
18S rDNA
suggested that zona radiata (or Chgs) protein would be more sensitive than vitellogenin (Vg) upon exposure to estrogenic compounds, as zonagenesis occurs prior to vitellogenesis both in vivo and in vitro (Celius and Walther, 1998; Fujita et al., 2004). EDCs have emerged as environmental contaminants with great concern in human and environmental health (Jenssen, 2006; Toppari, 2008). Alkylphenolic compounds such as 4-n-nonylpenol (NP), 4-tertoctylphenol (OP), and bisphenol A (BPA) are the major groups of environmental contaminants with proven endocrine disrupting activities. They are widely used in household and industrial detergents and herbicides (White et al., 1994; Ying et al., 2002). NP and OP bind to estrogen receptors and can block or alter endogenous estrogen functions at several reproductive and developmental stages (Korach et al., 1991; Laws et al., 2000; Watanabe et al., 2004). In the natural environment, these compounds are found in sediments and waters, which suggests that they may be associated with adverse reproductive and health effects in wildlife (Kannan et al., 2003). BPA is the most widely used plasticizer worldwide found in sewage effluents and rivers (Ikezuki et al., 2002). EDCs may cause environmental disasters at the level of individuals, populations, and communities, particularly in the aquatic ecosystem (Porte et al., 2006; Yang et al., 2006). Therefore, it is necessary to develop biomarkers for the monitoring of the presence and effects of EDCs in aquatic organisms. Since fish are most likely targets of EDCs, a number of approaches have been tested to identify biomarkers of exposure in fish. Measurement of Vg and Chg either using analytical tools or gene (mRNA) expression has been applied in several fish species (Lee et al., 2002a,b; Marin and Matozzo, 2004; Prakash et al., 2007; Chen et al., 2008; Matozzo et al., 2008; Hong et al., 2009). Studies based on mRNA expression of biomarker genes in the hermaphroditic fish, Kryptolebias marmoratus (Cyprinodontiformes, Rivulidae) have demonstrated that this fish has potential possibilities as a model species for risk assessment of EDCs using molecular biomarker approach (Lee et al., 2008a). K. marmoratus is the only vertebrate reproducing by internal self-fertilization (Harrington, 1961), providing genetic homogeneity among individuals within each self-fertilizing group. For this reason, K. marmoratus has been used to study developmental processes, cancer induction, and stress gene responses (Lee et al., 2008b,c). Other advantages would be a short generation time (3–4 months), relatively small size (3–5 cm in adult), and easy rearing under laboratory conditions (Lee et al., 2008a). Earlier, we have reported on cloning and sequence analysis of the Vg gene from the K. marmoratus (Kim et al., 2004). It was observed that the promoter region of K. marmoratus Vg gene has several E2 binding sites and the estrogen response element (ERE). Both Vg and
5′ RACE
3′ RACE Real-time PCR amplification Cloning 5′ RACE
3′RACE Real-time PCR amplification 18S rDNA real-time PCR amplification
Chg have been used as biomarkers of EDC exposure in fish (Lee et al., 2002a,b; Marin and Matozzo, 2004; Navas and Segner, 2006; Chen et al., 2008; Matozzo et al., 2008; Hong et al., 2009). EDCs have also shown modulatory effect on expression of transcripts of a number of genes with biomarker potential in K. marmoratus (Lee et al., 2008a,b,c). To further enlarge scope for biomarker and to understand role of EDCs on development processes, in this paper, we report cloning and sequence analysis of Chg genes from K. marmoratus (Km-Chg) and expression of their transcripts using quantitative real time RT-PCR in fish exposed to EDCs. 2. Materials and methods 2.1. Chemicals All chemicals and reagents used in this study were of molecular biology grade purchased from Sigma-Aldrich Co. (St. Louis, MO, USA), Qiagen (Valencia, CA, USA), and Invitrogen Corp. (Carlsbad, CA, USA) unless otherwise described. The oligonucleotide synthesis and nucleotide sequencing were performed at Bionics (Seoul, South Korea). 2.2. Fish rearing conditions and total RNA extraction K. marmoratus were reared and maintained at 25 °C with 12 h/12 h light/darkness cycle and 12‰ salinity. They were fed on a diet of Artemia nauplii (b24 h after hatching) once a day. Fish were anesthetized on ice and sacrificed by decapitation. Tissues were quickly removed under sterile condition and homogenized in three volumes of TRIZOL® (Invitrogen, Paisley, Scotland) with a glass tissue grinder. Total RNA was extracted according to manufactures' instructions. 2.3. cDNA cloning of K. marmoratus ChgH and ChgL genes The first strand cDNA was synthesized by SuperScript™ III reverse transcriptase (Invitrogen) according to the manufacturer's protocol. To obtain the partial sequence of Km-Chg cDNAs, degenerative primers (Table 1) were designed from the conserved segments of the ChgH and ChgL cDNA sequences retrieved from GenBank by aligning them using Clustal X (Thompson et al., 1997). Using these primers, PCR was performed with a liver sample under the following conditions: 94 °C/ 4 min; 45 cycles of 98 °C/25 s, 48 °C/30 s, 72 °C/60 s; and 72 °C/10 min. The amplified PCR products were isolated from 1% agarose gels, cloned into pCR2.1 TA vectors, and sequence was analyzed with an ABI PRISM 3700 DNA analyzer.
172
J.-S. Rhee et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 170–178
2.4. Rapid amplification of cDNA ends of Km-Chgs cDNA To obtain the full-length of Km-Chg cDNA, GeneRacer kit (Invitrogen; Carlsbad, CA) was used. Primers used in 5′-RACE (5′-GSP1, 5′GSP2, and 5′-GSP3) are shown in Table 1. The first round of PCR amplification and nested PCR were carried out as described by Lee et al. (2006). To obtain the 3′-unknown sequence, first-strand cDNA was synthesized using oligo(dT) anchor primer (Invitrogen) and the liver mRNA of K. marmoratus. The 3′-RACE products of Km-Chg cDNA were amplified by PCR using 3′-GSP1 primer (Table 1) and 3′-RACE adaptor primer (AUAP). The reaction mixture (25 µl) consisted of 0.1 µg cDNA template (from liver), 10 µM 3′-GSP1 primer and AUAP,
10 µM of each of dNTP, and LA Taq DNA polymerase (5 U/µl, Takara Bio Inc., Shiga, Japan). A second nested amplification was conducted using 3′-GSP2 (Table 1) and 3′-RACE adaptor primer. The PCR amplification conditions were the same as described above except that annealing temperatures were 58 °C, 60 °C, or 62 °C, respectively. The final PCR products were isolated on the agarose gel and cloning and sequence analysis were performed as described above. 2.5. Phylogenetic analysis To place the identified Km-Chg proteins in the phylogenetic tree, we aligned them with other choriogenins and ZP proteins of diverse
Fig. 1. Phylogenetic tree of Kryptolebias marmoratus choriogenin genes. The sequences used in phylogenetic analysis and their GenBank accession numbers were as follows; ZPB: Carassius auratus ZP2 (Z72495.1), Cyprinus carpio (Z72491.1), Danio rerio ZP2 (NP_571405), Anguilla japonica (BAA36592.1), Oryzias latipes ZPB (AAD38905.1), Salmo salar ESP (NP_001117169), Salvelinus alpines ZPα (AAR87393.1), Oncorhynchus mykiss VEPα (NP_001117745). Oncorhynchus masou Chg-Hα (ABW17263.1), Salvelinus alpines ZPβ (AAR87394.1), Oncorhynchus mykiss VEPβ (NP_001118072), Oncorhynchus masou Chg-Hβ (ABW17264.1), Sparus aurata ZPBa (AAY21009.1), Cyprinodon variegates ZR2 (AAT51698.1), Oryzias latipes Chg-Hm (NP_001098134), Pseudopleuronectes americanus ZP (AAC59642.1), Sparus aurata ZPBb (AAY21007.1), Liparis atlanticus ZPB (AAS55643.1), Oryzias latipes Chg-H (NP_001098277), Oryzias javanicus Chg-H (AAX09342.1), Oryzias melastigma Chg-H (ABN13415.1), ZPC : Cyprinus carpio ZP3 (CAA88837.1), Carassius auratus ZP3 (AAD53946.1), Pimephales promelas ZP3 (AAG28398.1), Danio rerio ZP3 (AAD49113.1), Anguilla japonica eSRS4 (BAA36593.1), Oncorhynchus masou Chg-L (ABW17265.1), Oncorhynchus mykiss VEPγ (AAF71260.1), Salvelinus alpines ZPγ (AAR87395.1), Tetraodon nigroviridis Chg-L (CAG11366.1), Liparis atlanticus Chg-L (AAS55644.1), Sparus aurata Chg-L (CAA63709.1), Cyprinodon variegatus ZR3 (AAT51699.1), Oryzias latipes Chg-L (AAM47575.1), Oryzias sinensis Chg-L (AAV34196.1), Oryzias melastigma Chg-L (ABN13414.1), Oryzias javanicus Chg-L (AAX09343.1). eSRS, eel spermatogenesis-related substance; ESP, eggshell protein; VEP, vitelline envelope protein; ZR, zona radiata.
J.-S. Rhee et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 170–178
species at the level of deduced amino acid sequence by Clustal X 1.83. Total 37 sequences retrieved from GenBank/DDBJ/EMBL databases were aligned. Gaps and missing data matrix were excluded from the analysis. The generated data matrix was converted to nexus format and the data matrix was analyzed with Mr.Bayes v3.1.2 program using general time-reversible (GTR) model. A total of 1,000,000 generations were conducted, and the sampling frequency was assigned as every 100 generations. After analysis, the first 10,000 generations were deleted as the burn-in process, and the consensus tree was constructed and then visualized with Tree View of PHYLIP. 2.6. Tissue specific expression of Km-Chg mRNA The expression pattern of Km-Chg mRNA was studied in seven tissues (brain, eye, gonad, intestine, liver, muscle and skin) of hermaphrodites and secondary males by quantitative real-time RT-PCR using the primers as shown in Table 1. For real-time RT-PCR amplification, each reaction consisted of 1 µl of cDNA and 0.2 µM primer each of real time RT-F/R and reference gene primer 18S rDNA RT-F/R (Table 1). Reaction conditions were: 94 °C/4 min; 35cycles of 94 °C/30 s, 55 °C/30 s, 72 °C/30 s; and 72 °C/10 min. SYBR® Green (Molecular Probe Inc., Invitrogen) was used to detect specific PCR products. Amplification and detection of SYBR® Green were performed with a MyiQ cycler (Bio-Rad, Hercules, CA, USA). Data of triplicate experiments were expressed as relative to 18S rDNA, which was used to normalize any difference in reverse transcriptase efficiency. Fold change for the relative gene expression was determined by the 2− ΔΔCt method (Livak and Schmittgen, 2001).
173
2.7. Expression of Km-Chgs mRNA at different stages of development The expression pattern of Km-ChgH and ChgL mRNA was studied during various developmental stages of K. marmoratus starting from stage 1 (2 day post-fertilization, dpf) to adult (hermaphrodite and secondary male) using quantitative real-time quantitative RT-PCR as described above. 2.8. EDC exposure study To study the effect of EDC exposure on Km-Chg expression, adult hermaphrodites and secondary males (length ~3 cm; n = 6 in each treatment group) were exposed to 17β-estradiol (E2, 100 ng/L), a known natural estrogen and tamoxifen (10 µg/L), a nonsteroidal estrogen antagonist, 4-n-nonylphenol, NP (300 µg/L), 4-tert-octylphenol, OP (300 µg/L) and bisphenol A, BPA (600 µg /L) for 96 h. The exposure concentrations of EDC were based on previous expression studies on K. marmoratus (Tanaka and Grizzle, 2002; Lee et al., 2006; Seo et al., 2006). E2 and tamoxifen concentrations were selected from the previous studies involving their exposure in fish (Lerner et al., 2007; Van der Ven et al., 2007). The tank water was replaced with fresh water at every 24 h. All the EDCs, E2 and tamoxifen were obtained from Sigma, and were dissolved in dimethyl sulfoxide (DMSO; Sigma). Control fish group was exposed to equivalent concentration of DMSO. The DMSO concentration in control and treated groups was maintained at b0.001%. The fish were maintained under the conditions as described above but not fed during the exposure period. After exposure for 96 h, fish were
Fig. 2. Tissue-specific expressions of Km-ChgH and Km-ChgL mRNAs in adult hermaphrodites and secondary males of K. marmoratus. The Km-ChgH and Km-ChgL mRNAs expressions were analyzed using real-time RT-PCR. Km-18S rRNA was used as reference house keeping gene. Data are means ± S.E. Asterisks (⁎) and (⁎⁎) indicate significant difference for p b 0.05, p b 0.01, respectively.
174
J.-S. Rhee et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 170–178
dissected and different organs were used for RNA extraction. Expression of Km-ChgH and ChgL mRNA was measured by quantitative real time quantitative RT-PCR as described above. 2.9. Statistical analysis Data are expressed as means ± SE. Significant differences between the observations of control and exposed groups in EDC exposure study were analyzed using Student's paired t-test and one-way and/or multiple-comparison ANOVA followed by Tukey's test. Expression data of tissues and developmental stages were analyzed by Tukey's test. Difference showing p b 0.05 was considered significant.
The similarity of amino acid sequences between Km-ChgH and Km-ChgL was low (less than 18%). The similarity of Km-ChgL to other fishes was 70% (Japanese medaka O. latipes), 68% (Chinese medaka O. sinensis), 66% (marine medaka O. javanicus), and 65% (brackish medaka O. melastigma). To determine the placement of Km-ChgH and Km-ChgL, we performed the Bayesian analysis of those proteins with 21 and 16 other Chg amino acid sequences from fishes, respectively. An unrooted radial tree showed that Km-ChgH and Km-ChgL were separated from other taxa, and made the clustering with phylogenetically closed species such as Oryzias latipes in liver tissue for ChgH and also Sparus aurata and Cyprinodon variegatus in liver tissue for ChgL (Fig. 1). This is well concluded with the existing knowledge for Chg proteins.
3. Results and discussion 3.2. Tissue distribution of Km-Chg mRNAs 3.1. Cloning of Km-ChgH and Km-ChgL genes Full-length of Km-ChgH cDNA (2,289 bp, 549 aa) and Km-ChgL cDNA (1281 bp, 427 aa) were sequenced, and deposited to GenBank (EU867501 for Km-ChgH and EU867503 for Km-ChgL). The deduced amino acid sequence of Km-ChgH had a theoretical pI of 5.65 and a calculated molecular weight of 60.9 kDa, while the deduced amino acid sequence of Km-ChgL had a theoretical pI of 5.33 and a calculated molecular weight of 47.1 kDa. Both Km-ChgH and ChgL have a ZP domain at the position of 235– 517 aa and 85–341 aa, respectively (Supplementary Figs. 1 and 2). In teleost fish, ZP domain may play an important role in hardening the egg chorion at fertilization, and their size and composition are reported to affect the degree of chorion hardness in different species (Sugiyama et al., 1999; Kanamori et al., 2003; Fujita et al., 2008). When comparing Km-ChgH and Km-ChgL proteins to other fish, ChgH proteins are less conserved due probably to differences in the length and composition of the proline- and glutamine-rich peptide repeats at N-terminal region (Fujita et al., 2008). Most ChgL/ZPC proteins lack this repetitive domain. However, Del Giacco et al. (2000) reported that zebrafish possessed this repetitive domain in the ChgL/ZPC protein.
The Km-ChgH and Km-ChgL mRNAs were highly expressed in liver tissues, while other tissues (brain, eye, gonad, intestine, muscle, skin) showed low level of expression (Fig. 2). Between adult hermaphrodites and secondary males there was no difference of expression (Fig. 2). However, between the two genes there was a different degree of expression; ChgH showing lower expression than ChgL in both the gender types. Both Km-ChgH and Km-ChgL showed higher expression level in the liver of hermaphrodites than that of secondary males. These results suggest that Chg genes in secondary males are not active compared to hermaphrodites. As Chg proteins are synthesized in the liver in response to estrogens, their low level in secondary males, which are practically infertile is not surprising (Yamagami, 1996; Murata et al., 1997; Lee et al., 2002a,b; Arukwe and Goksoyr, 2003). 3.3. Km-Chg mRNA expression at various stages of development The relative expression of Km-Chg mRNA expression at various developmental stages is shown in Fig. 3. The expression of Km-ChgH mRNA increased at stages 3 and 4, compared to stage 1 (2 dpf)
Fig. 3. Developmental stage-specific expression of Km-ChgH and Km-ChgL mRNAs using real-time RT-PCR. Five embryonic stages represent stage 1 = 2 day post-fertilization (dpf), stage 2 = 4 dpf, stage 3 = 9 dpf, stage 4 = 12 dpf, and stage 5 = 5 h post hatching. Km-18S rRNA was used as a reference house keeping gene to normalize the expression. When none of the characters between data bars match, values were considered statistically different (p b 0.05) determined by one-way ANOVA followed by Tukey's test. Data are means ± S.E.
J.-S. Rhee et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 170–178
175
indicating that this gene would play a role in those developmental stages but significance of such an expression pattern is not clear. Additionally, Km-ChgL mRNA expression showed a dramatic upregulation between stages 1 and 2 but a down-regulation trend was evident at stage 5. The discrepancy of both genes on expression in embryogenesis would suggest that they might have a different role in relation to development. In relation to the expression of Km-Chg genes at early embryogenetic stages, we may assume that K. marmoratus embryos need to recruit the Chg proteins from early stages of embryogenesis, as the developing oocytes and fertilized eggs are surrounded by an egg envelope (chorion). 3.4. Modulatory effect of 17β-estradiol and tamoxifen on Km-Chgs mRNA expression The effect of E2 and tamoxifen on Km-Chg mRNA expression is shown in Fig. 4. E2 induced expression of both Km-ChgH and Km-ChgL mRNAs significantly in hermaphrodites (Fig. 4A). In secondary males, E2 showed the same effect but the degree of induction was lower than that in the hermaphrodites. Between Km-ChgH and Km-ChgL genes also a difference in expression level was evident (Fig. 4A). However,
Fig. 5. Effect of bisphenolA (600 µg/L for 96 h), 4-n-nonylphenol (300 µg/L for 96 h) and 4-tert-octylphenol (300 µg/L for 96 h) exposure on Km-Chg mRNA expression in the liver of adult hermaphrodite and secondary male K. marmoratus. Control fish were treated with DMSO. BPA, NP, and OP suspended in DMSO were exposed through tank water in a static renewal culture condition for 96 h. Each group of fish comprised a minimum of six fishes. The Km-Chg mRNA expression was analyzed using real-time RTPCR and shown relative to Km-18S rRNA which was used as reference house keeping gene. Data are means ± S.E. The symbols (⁎, ⁎⁎, and ⁎⁎⁎) indicate p b 0.05, p b 0.01, and p b 0.001 respectively, indicate significant difference over controls.
tamoxifen exposure caused no significant change in expression of either of the genes in the fish of both genders (Fig. 4B). The induction of Chg genes by E2 was firstly demonstrated in medaka liver by Murata et al. (1997) and subsequently Lee et al. (2002b) provided comparable results in the same species. On sensitivity of Chg genes to EDC exposure, Lee et al. (2002b) reported that medaka ChgL was more sensitive than ChgH at the same concentration of 17α-ethinylestradiol (EE2). This tendency was also shown in BPA- and NP-treated medaka. This observation suggests that Japanese medaka ChgL may be more sensitive than ChgH to estrogen exposure. However, study by Yu et al. (2006) showed that marine medaka (O. javanicus) ChgH would be more sensitive than ChgL. Similarly, Fujita et al. (2004) also showed that ChgH in blood serum is more responsive than ChgL to low doses of E2-exposed salmon (O. masou). In the red lip mullet, Hong et al. (2009) showed that ChgH, ChgL, and Vg in the serum were induced in immature forms when treated with various doses of E2 (10, 100 and 1000 µg/kg). Based on our observations in K. marmoratus, it may be concluded that there appears to be a gender specific differences in the susceptibility to E2 in this fish with Chg gene type dependency. Salam et al. (2008) showed a clear increase of green fluorescent protein (GFP) intensity at 25 ng/L E2 in transgenic medaka (5 day exposure) harboring a ChgL promoter at day 6 of exposure. Also, Chen et al. (2008) showed a dose-dependent increase of both ChgH and ChgL mRNAs at different concentrations of E2 (0 to 500 ng/L) in medaka. These findings indicate that there are species specific differences in susceptibility to E2 in fish. Furthermore, it may be concluded that medaka ChgL mRNA is more sensitive compared to ChgH mRNA to E2 exposure. However, as studies on Chg expression are limited to just few species, a firm conclusion looks elusive at this stage. 3.5. Modulatory effect of EDCs on Km-Chg mRNA expression Fig. 4. Effects of (A) 17β-estradiol (100 ng/L for 96 h) and (B) tamoxifen (10 µg/L for 96 h) on Km-ChgH and Km-ChgL mRNA expression in the liver of adult K. marmoratus (hermaphrodite and secondary male). Control fish were treated with solvent DMSO. E2 and TMX were exposed in tank water with a static renewal culture condition for 96 h. Each group of fish comprised a minimum of six fish. The Km-Chg mRNA expression was analyzed using real-time RT-PCR. Km-Chg mRNA expression is shown as relative to Km18S rRNA which was used as a reference house keeping gene. Data are means ± S.E. The symbols (⁎ and ⁎⁎) indicate p b 0.05 and p b 0.01, respectively.
Effect of EDC exposure on Km-ChgH and Km-ChgL mRNA expression in K. marmoratus is shown in Fig. 5. The increased expression of both mRNAs was observed in both genders of fish (hermaphrodites and secondary males). Although all EDCs showed significantly greater (p b 0.01 to 0.001) induction in exposed fish, significant effect (p b 0.05) of OP was observed only on ChgH in hermaphrodites.
176
J.-S. Rhee et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 170–178
Fig. 6. Effect of EDC exposure for various time durations on (A) Km-ChgH and (B) Km-ChgL mRNA expression in juvenile fish. Expression was studied at 0, 3, 6, 12, and 24 h by realtime RT-PCR. Significant difference over control values are indicated by different letters on the data bar (p b 0.05) analyzed by multiple-comparison ANOVA. Data are means ± S.E.
There is variable response of induction upon EDCs exposure in fish. Similarly, EDCs show species and gender specific differences in expression of mRNA of Chgs. For example, Lee et al. (2002b) and Chen et al. (2008) showed that NP and BPA induced expression of both ChgH and ChgL mRNAs in the O. latipes and O. melastigma male livers. Lee et al. (2002b) showed that when medaka was exposed to BPA and NP, induction of ChgL mRNA was more pronounced, compared to that for ChgH. Time course effect of EDC exposure on Chg mRNA expression is shown in Fig. 6. A significant induction (p b 0.05) over controls was observed only after 6 h of exposure to each EDC. Study of relative sensitivities of Km-ChgH and Km-ChgL mRNA expression in fish exposed to EDCs for 24 h revealed that to all the EDCs, ChgH showed significantly higher expression compared to ChgL (Fig. 7). This indicates that different modes of action of chemicals would influence the sensitivity of these genes. When compared with Vg expression, several studies demonstrated that Chgs have a higher response than Vg at a low level of estrogenic compounds in sea bream Sparus auratus (Pinto et al., 2006), Atlantic salmon Salmo salar (Celius and Walther, 1998), masu salmon (Fujita et al., 2004), Japanese medaka, (Lee et al., 2002a), and rainbow trout Oncorhynchus mykiss (Celius et al., 2000). This suggests that different species may have different sensitivities to EDC exposure. The cloning and sequence analysis of cDNA with mRNA expression study of Chg genes from K. marmoratus demonstrated biomarker
Fig. 7. Relative expression of Km-ChgH and Km-ChgL mRNA after exposure of NP, OP, and BPA to juvenile K. marmoratus. Control was set to 1 on the Y axis for the determination of the relative expression. Bars with different letters on their top indicate significant difference in expression level over the others when analyzed by Tukey's test.
J.-S. Rhee et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 170–178
potential of these genes. Earlier, Vg expression from K. marmoratus also showed such a potential. However, when expression of both the genes was compared, Chg appears to be more robust biomarker than Vg upon exposure to EDCs. Overall, these finding strengthen position of K. marmoratus as a model fish species for risk assessment of marine contaminants with endocrine disrupting potential using molecular biomarker approach. These findings also shed some light on the physiological role of Chg in K. marmoratus which has a very unique reproductive mechanism. Acknowledgements We thank Dr. Hans-Uwe Dahms for his critical comments on the first draft of the manuscript. This work was partly supported by a grant (2009-0066330) of the Korea Science and Engineering Foundation funded to Jae-Seong Lee, and also partly supported by a grant of the Fisheries Research and Development Program of the Ministry for Food, Agriculture, Forestry and Fisheries of Korea (2008) funded to Gyung Soo Park. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.cbpc.2009.04.006. References Arukwe, A., Goksoyr, A., 2003. Eggshell and egg yolk proteins in fish: hepatic proteins for the next generation: oogenetic, population, and evolutionary implications of endocrine disruption. Comp. Hepatol. 2, 4. Arukwe, A., Knudsen, F.R., Goksøyr, A., 1997. Fish zona radiata (eggshell) protein: a sensitive biomarker for environmental estrogens. Environ. Health Perspect. 105, 418–422. Celius, T., Matthews, J.B., Giesy, J.P., Zacharewski, T.R., 2000. Quantification of rainbow trout (Oncorhynchus mykiss) zona radiata and vitellogenin mRNA levels using realtime PCR after in vivo treatment with estradiol-17beta or α-zearalenol. J. Steroid Biochem. Mol. Biol. 75, 109–119. Celius, T., Walther, B.T., 1998. Oogenesis in Atlantic salmon (Salmo salar) occurs by zonagenesis preceding vitellogenesis in vivo and in vitro. J. Endocrinol. 58, 259–266. Chen, X., Li, V.W.T., Yu, R.M.K., Cheng, S.H., 2008. Choriogenin mRNA as a sensitive molecular biomarker for estrogenic chemicals in developing brackish medaka (Oryzias melastigma). Ecotoxicol. Environ. Saf. 71, 200–208. Del Giacco, L., Diani, S., Cotelli, F., 2000. Identification and spatial distribution of the mRNA encoding an egg envelope component of the cyprinid zebrafish, Danio rerio, homologous to the mammalian ZP3 (ZPC). Dev. Genes Evol. 210, 41–46. Fujita, T., Fukada, H., Shimizu, M., Hiramatsu, N., Hara, A., 2004. Quantification of serum levels of precursors to vitelline envelope proteins (choriogenins) and vitellogenin in estrogen treated masu salmon, Oncorhynchus masou. Gen. Comp. Endocrinol. 136, 49–57. Fujita, T., Fukada, H., Shimizu, M., Hiramatsu, N., Hara, A., 2008. Molecular cloning and characterization of three distinct choriogenins in masu salmon, Oncorhynchus masou. Mol. Reprod. Dev. 75, 1217–1228. Hamazaki, T.S., Nagahama, Y., Iuchi, I., Yamagami, K., 1989. A glycoprotein from the liver constitutes the inner layer of the egg envelope (zona pellucida interna) of the fish, Oryzias latipes. Dev. Biol. 133, 101–110. Harrington, R.W., 1961. Oviparous hermaphroditic fish with internal self-fertilization. Science 134, 1749–1750. Hong, L., Fujita, T., Wada, T., Amano, H., Hiramatsu, N., Zhang, X., Todo, T., Hara, A., 2009. Choriogenin and vitellogenin in red lip mullet (Chelon haematocheilus): purification, characterization, and evaluation as potential biomarkers for detecting estrogenic activity. Comp. Biochem. Physiol. 149C, 9–17. Ikezuki, Y., Tsutsumi, O., Takai, Y., Kamei, Y., Taketani, Y., 2002. Determination of bisphenol A concentrations in human biological fluids reveals significant early prenatal exposure. Hum. Reprod. 17, 2839–2841. Jenssen, B.M., 2006. Endocrine-disrupting chemicals and climate change: a worst-case combination for arctic marine mammals and seabirds? Environ. Health Perspect. 114 (Suppl 1), 76–80. Kanamori, A., Naruse, K., Mitani, H., Shima, A., Hori, H., 2003. Genomic organization of ZP domain containing egg envelope genes in medaka (Oryzias latipes). Gene 305, 35–45. Kannan, K., Keith, T.L., Naylor, C.G., Staples, C.A., Snyder, S.A., Giesy, J.P., 2003. Nonylphenol and nonylphenol ethoxylates in fish, sediment, and water from the Kalamazoo river, Michigan. Arch. Environ. Contam. Toxicol. 44, 77–82. Kim, I.-C., Chang, S.Y., Williams, T.D., Ja Kim, Y., Yoon, Y.-D., Lee, Y.-S., Park, E.-H., Lee, J.-S., 2004. Genomic cloning and expression of vitellogenin gene from the self-fertilizing fish Rivulus marmoratus (Cyprinodontiformes, Rivulidae). Mar. Environ. Res. 58, 687–691. Korach, K.S., Cae, K., Gibson, M., Curtis, S., 1991. Estrogen receptor stereochemistry: ligand binding and hormonal responsiveness. Steroids 56, 263–270.
177
Laws, S.C., Carey, S.A., Ferrell, J.M., Bodman, G.J., Cooper, R.L., 2000. Estrogenic activity of octylphenol, nonylphenol, bisphenol A and methoxychlor in rats. Toxicol. Sci. 54, 154–167. Lee, J.-S., Raisuddin, S., Schlenk, D., 2008a. Kryptolebias marmoratus (Poey, 1880): a potential model species for molecular carcinogenesis and ecotoxicogenomics. J. Fish Biol. 72, 1871–1889. Lee, C., Jeon, S.H., Na, J., Choi, Y., Park, K., 2002a. Sensitivities of mRNA expression of vitellogenin, choriogenin and estrogen receptor by estrogenic chemicals in medaka, Oryzias latipes. J. Health Sci. 48, 441–445. Lee, C., Na, J.G., Lee, K.C., Park, K., 2002b. Choriogenin mRNA induction in male medaka, Oryzias latipes as a biomarker of endocrine disruption. Aquat. Toxicol. 61, 233–241. Lee, Y.-M., Jung, S.-O., Seo, J.S., Yoon, Y.-D., Lee, J.-S., 2006. Cloning of Ki-ras and Ha-ras cDNAs from the hermaphroditic fish Rivulus marmoratus (Cyprinodontiformes, Rivulidae) and its expression after exposure to 4-nonylphenol. Mar. Environ. Res. 62, S136–S140. Lee, Y.-M., Raisuddin, S., Rhee, J.-S., Ki, J.-S., Kim, I.-C., Lee, J.-S., 2008b. Modulatory effect of environmental endocrine disruptors on N-ras oncogene expression in the hermaphroditic fish, Kryptolebias marmoratus. Comp. Biochem. Physiol. 147C, 299–305. Lee, Y.-M., Rhee, J.-S., Hwang, D.-S., Kim, I.-C., Raisuddin, S., Lee, J.-S., 2008c. p53 gene expression is modulated by endocrine disrupting chemicals in the hermaphroditic fish, Kryptolebias marmoratus. Comp. Biochem. Physiol. 147C, 150–157. Lerner, D.T., Björnsson, B.T., McCormick, S.D., 2007. Larval exposure to 4-nonylphenol and 17β-estradiol affects physiological and behavioral development of seawater adaptation in Atlantic salmon smolts. Environ. Sci. Technol. 41, 4479–4485. Litscher, E.S., Wassarman, P.M., 2007. Egg extracellular coat proteins: from fish to mammals. Histol. Histopathol. 22, 337–347. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real time quantitative PCR and the 2− ΔΔCt method. Methods 25, 402–408. Marin, M.G., Matozzo, V., 2004. Vitellogenin induction as a biomarker of exposure to estrogenic compounds in aquatic environments. Mar. Pollut. Bull. 48, 835–839. Monné, M., Han, L., Jovine, L., 2006. Tracking down the ZP domain: from the mammalian zona pellucida to the molluscan vitelline envelope. Semin. Reprod. Med. 24, 204–216. Matozzo, V., Gagné, F., Marin, M.G., Ricciardi, F., Blaise, C., 2008. Vitellogenin as a biomarker of exposure to estrogenic compounds in aquatic invertebrates: a review. Environ. Int. 34, 531–545. Murata, K., Sasaki, T., Yasumasu, S., Iuchi, I., Enami, J., Yasumasu, I., Yamagami, K., 1995. Cloning of cDNAs for the precursor protein of a low-molecular-weight subunit of the inner layer of the egg envelope (chorion) of the fish Oryzias latipes. Dev. Biol. 167, 9–17. Murata, K., Sugiyama, H., Yasumasu, S., Iuchi, I., Yasumasu, I., Yamagami, K., 1997. Cloning of cDNA and estrogen-induced hepatic gene expression for choriogenin H, a precursor protein of the fish egg envelope (chorion). Proc. Natl. Acad. Sci. U. S. A. 94, 2050–2055. Navas, J.M., Segner, H., 2006. Vitellogenin synthesis in primary cultures of fish liver cells as endpoint for in vitro screening of the (anti)estrogenic activity of chemical substances. Aquat. Toxicol. 80, 1–22. Pinto, P.I.S., Teodosio, H.R., Galay-burgos, M., Power, D.M., Sweeney, G.E., Canario, A.V.M., 2006. Identification of estrogen-responsive genes in the testis of sea bream (Sparus auratus) using suppression subtractive hybridization. Mol. Reprod. Dev. 73, 318–329. Porte, C., Janer, G., Lorusso, L.C., Ortiz-Zarragoitia, M., Cajaraville, M.P., Fossi, M.C., Canesi, L., 2006. Endocrine disruptors in marine organisms: approaches and perspectives. Comp. Biochem. Physiol. 143C, 303–315. Prakash, O., Goswami, S.V., Sehgal, N., 2007. Establishment of ELISA for murrel vitellogenin and choriogenin, as biomarkers of potential endocrine disruption. Comp. Biochem. Physiol. 146C, 540–551. Salam, M.A., Sawada, T., Ohya, T., Ninomiya, K., Hayashi, S., 2008. Detection of environmental estrogenicity using transgenic medaka hatchlings (Oryzias latipes) expressing the GFP-tagged choriogenin L gene. J. Environ. Sci. Health 43A, 272–277. Seo, J.S., Lee, Y.-M., Jung, S.-O., Kim, I.-C., Yoon, Y.-D., Lee, J.-S., 2006. Nonylphenol modulates expression of androgen receptor and estrogen receptor genes differently in gender types of the hermaphroditic fish Rivulus marmoratus. Biochem. Biophys. Res. Commun. 346, 213–223. Sugiyama, H., Murata, K., Iuchi, I., Nomura, K., Yamagami, K., 1999. Formation of mature egg envelope subunit proteins from their precursors (choriogenins) in the fish, Oryzias latipes: loss of partial C-terminal sequences of the choriogenins. J. Biochem. 125, 469–475. Sugiyama, H., Yasumasu, S., Murata, K., Iuchi, I., Yamagami, K., 1998. The third egg envelope subunit in fish: cDNA cloning and analysis, and gene expression. Dev. Growth Differ. 40, 35–45. Tanaka, J.N., Grizzle, J.M., 2002. Effects of nonylphenol on the gonadal differentiation of the hermaphroditic fish, Rivulus marmoratus. Aquat. Toxicol. 57, 117–125. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The Clustal X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 24, 4876–4882. Toppari, J., 2008. Environmental endocrine disrupters. Sex Dev. 2, 260–267. Ueno, T., Yasumasu, S., Hayashi, S., Iuchi, I., 2004. Identification of choriogenin cisregulatory elements and production of estrogen-inducible, liver-specific transgenic medaka. Mech. Dev. 121, 803–815. Van der Ven, L.T., van den Brandhof, E.J., Vos, J.H., Wester, P.W., 2007. Effects of the estrogen agonist 17β-estradiol and antagonist tamoxifen in a partial life-cycle assay with zebrafish (Danio rerio). Environ. Toxicol. Chem. 26, 92–99. Watanabe, H., Suzuki, A., Goto, M., Lubahn, D.B., Handa, H., Iguchi, T., 2004. Tissuespecific estrogenic and non-estrogenic effects of a xenoestrogen, nonylphenol. J. Mol. Endocrinol. 33, 243–252.
178
J.-S. Rhee et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 170–178
White, R., Jobling, S., Hoare, S.A., Sumpter, J.P., Parker, M.G., 1994. Environmentally persistent alkylphenolic compounds are estrogenic. Endocrinology 135, 175–182. Yamagami, K., 1996. Studies on the hatching enzyme (choriolysin) and its substrate, egg envelope, constructed of the precursors (choriogenins) in Oryzias latipes: a sequel to the information in 1991/1992. Zool. Sci. 13, 331–340. Yang, M., Park, M.S., Lee, H.S., 2006. Endocrine disrupting chemicals: human exposure and health risks. J. Environ. Sci. Health 24C, 183–224.
Ying, G.G., Williams, B., Kookana, R., 2002. Environmental fate of alkylphenols and alkylphenol ethoxylates—a review. Environ. Int. 28, 215–226. Yu, R.M., Wong, M.M., Kong, R.Y., Wu, R.S., Chen, S.H., 2006. Induction of hepatic schoriogenin mRNA expression in male marine medaka: a highly sensitive biomarker for environmental estrogens. Aquat. Toxicol. 77, 348–358.
Contents lists available at ScienceDirect
Comparative Biochemistry and Physiology, Part C j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / c b p c
Endocrine disruptors modulate expression of hepatic choriogenin genes in the hermaphroditic fish, Kryptolebias marmoratus Jae-Sung Rhee a, Han Seung Kang b, Sheikh Raisuddin c, Dae-Sik Hwang a, Jeonghoon Han a, Ryeo-Ok Kim b, Jung Soo Seo d, Young-Mi Lee e, Gyung Soo Park f, Su-Jae Lee b, Jae-Seong Lee b,⁎ a
Department of Molecular and Environmental Bioscience, Graduate School, Hanyang University, Seoul 133-791, South Korea Department of Chemistry, College of Natural Sciences, Hanyang University, Seoul 133-791, South Korea Ecotoxicology Laboratory, Department of Medical Elementology and Toxicology, Hamdard University, New Delhi 110 062, India d Pathology Team, National Fisheries Research & Development Institute, Busan 619-902, South Korea e Department of Life Science, College of Natural Sciences, Sangmyung University, Seoul 110-743, South Korea f Department of Marine Biotechnology, College of Liberal Arts and Sciences, Anyang University, Ganghwa 417-833, South Korea b c
a r t i c l e
i n f o
Article history: Received 18 December 2008 Received in revised form 18 April 2009 Accepted 20 April 2009 Available online 23 April 2009 Keywords: Kryptolebias marmoratus Choriogenin Endocrine disrupting chemicals Biomarker
a b s t r a c t Choriogenins (Chgs) are precursors of inner layer of egg envelope that are synthesized in fish liver in response to estrogens. Therefore, study of their expression serves as biomarker of exposure to endocrine disrupting chemicals (EDCs). The self-fertilizing fish, Kryptolebias marmoratus has been established as a model species for testing the action of EDCs. To use this fish as a model for assessing estrogenic activity of EDCs on Chg expression, two K. marmoratus choreogenin genes, Km-ChgH and Km-ChgL were cloned and their expression was analyzed in different tissues and in developmental stages by real-time RT-PCR. Expression levels of liver mRNA were compared between hermaphrodites and secondary males after exposure to EDCs. Km-ChgH and Km-ChgL genes that were predominantly expressed in liver contained zona pellucida (ZP) domains. During embryonic development, low expression of mRNA was observed at stage 1 (2 dpf) that reached highest level at stage 4 (12 dpf) or stage 5 (5 h post hatching). The expression of Km-Chg mRNAs was highly increased in liver exposed to natural estrogen, 17α-estradiol (E2) as well as EDCs such as bisphenol A and 4-n-nonylphenol in both the gender types. Another EDC, 4-tert-octylphenol, showed modulatory effect only on Km-ChgH in hermaphrodites. Tamoxifen, an antagonist of the estrogen receptor showed no effect on expression of Chg genes in either of the gender types of K. marmoratus. These findings indicate that Km-Chg genes would be associated with estrogen and measurement of their expression would serve as a surrogate biomarker of exposure to environmental EDCs. © 2009 Elsevier Inc. All rights reserved.
1. Introduction The fish egg envelope consists of two distinct layers; the outer thin layer that is formed around the oocytes during the later stage of previtellogenic development and the thick inner layer, called zona radiata that occupies most of the egg envelope (Hamazaki et al., 1989; Litscher and Wassarman, 2007). Their overall role is to protect the egg and embryo from the environmental damage. In teleost fish, choriogenins (Chgs) are egg envelop protein precursors that are synthesized in the liver in response to estrogens and then transported to the ovaries by the blood stream (Yamagami, 1996; Murata et al., 1997; Arukwe and Goksoyr, 2003). Most of the research on Chgs has been done in Japanese medaka (Oryzias latipes). The inner layer of the egg envelope of the Japanese medaka consists of two major subunit
⁎ Corresponding author. Tel.: +82 2 2220 0769; fax: +82 2 2299 9450. E-mail address: [email protected] (J.-S. Lee). 1532-0456/$ – see front matter © 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.cbpc.2009.04.006
groups, ZI-1,2 and ZI-3. The ZI-1,2 group represents three glycoproteins of a common polypeptide moiety derived from their precursor, choriogenin H (ChgH). ZI-3 is a single glycoprotein derived from the precursor, choriogenin L (ChgL) (Murata et al., 1995, 1997; Sugiyama et al., 1998). H and L denotes the relative molecular masses of high (74–76 kDa) and low (49 kDa), respectively of the respective glycoproteins. Besides medaka, Chg genes and their products have been characterized from some other fish species such as the brackish medaka (Oryzias melastigma), the masu salmon (Oncorhynchus masou) and the red lip mullet (Chelon haematocheilus) (Fujita et al., 2004, 2008; Chen et al., 2008; Hong et al., 2009). Both fish Chg proteins contain a zona pellucida (ZP) domain that is common in the egg envelope glycoproteins from different vertebrates (Monné et al., 2006). Fish Chgs genes are actively regulated by binding to the estrogen receptor (ER) complex through estrogen responsive elements (ERE) in the 5′-flanking region of Chg genes (Ueno et al., 2004). Choriogenins are regarded as sensitive biomarkers of exposure to estrogenic pollutants or endocrine disrupting chemicals (EDCs) (Lee et al., 2002a,b; Chen et al., 2008; Hong et al., 2009). Arukwe et al. (1997)
J.-S. Rhee et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 170–178
171
Table 1 Primers used. Gene
Oligo name
Sequence (5′→3′)
Remarks
Km-Choriogenin H
dg-F dg-R 5GSP1 5GSP2 5GSP3 3GSP1 3GSP2 RT-F RT-R dg-F dg-R 5GSP1 5GSP2 5GSP3 3GSP1 3GSP2 RT-F RT-R RT-F RT-R
CTTTCYTGTTACTGCCTGYGGCAC GAYTAACAAAGGTAAACATYTTG CTTACTAATGTGGTTCTC GTAGGTGATTGTATTGTTTAAGACTG CTGCAAATACTACAAATACCTACAGTG GCTCCTCGATAAGACAGATCCTGCGC CCTCGCACCCCGAGCCTCACAGTGTC TTTGGGATGAACATTTGGAACC CGCTACCCTTCGTTGTTCTGC TGCTTGRCRGCTTYTGTGATGCTCA GTTRTYAATGAAGGCATARYTGGGG CGCAGCTTCGTAAATCAA CTCTGCAATGGGGCCACAGTCAC CAGGGTGAGGTCAGCCGGACTG TCTCATCTACACCTATACTTTGAACTAC GTGTTTACTTGGACAGATGTATAGCTAC GTGGTGCACAGTGTTCCAGCAGTTG GTTTGGTACACATCACGCACTTTCC GAACTCACCGACACCAGCA ATCATCGACGCTCCTGGAC
Cloning
Km-Choriogenin L
18S rDNA
suggested that zona radiata (or Chgs) protein would be more sensitive than vitellogenin (Vg) upon exposure to estrogenic compounds, as zonagenesis occurs prior to vitellogenesis both in vivo and in vitro (Celius and Walther, 1998; Fujita et al., 2004). EDCs have emerged as environmental contaminants with great concern in human and environmental health (Jenssen, 2006; Toppari, 2008). Alkylphenolic compounds such as 4-n-nonylpenol (NP), 4-tertoctylphenol (OP), and bisphenol A (BPA) are the major groups of environmental contaminants with proven endocrine disrupting activities. They are widely used in household and industrial detergents and herbicides (White et al., 1994; Ying et al., 2002). NP and OP bind to estrogen receptors and can block or alter endogenous estrogen functions at several reproductive and developmental stages (Korach et al., 1991; Laws et al., 2000; Watanabe et al., 2004). In the natural environment, these compounds are found in sediments and waters, which suggests that they may be associated with adverse reproductive and health effects in wildlife (Kannan et al., 2003). BPA is the most widely used plasticizer worldwide found in sewage effluents and rivers (Ikezuki et al., 2002). EDCs may cause environmental disasters at the level of individuals, populations, and communities, particularly in the aquatic ecosystem (Porte et al., 2006; Yang et al., 2006). Therefore, it is necessary to develop biomarkers for the monitoring of the presence and effects of EDCs in aquatic organisms. Since fish are most likely targets of EDCs, a number of approaches have been tested to identify biomarkers of exposure in fish. Measurement of Vg and Chg either using analytical tools or gene (mRNA) expression has been applied in several fish species (Lee et al., 2002a,b; Marin and Matozzo, 2004; Prakash et al., 2007; Chen et al., 2008; Matozzo et al., 2008; Hong et al., 2009). Studies based on mRNA expression of biomarker genes in the hermaphroditic fish, Kryptolebias marmoratus (Cyprinodontiformes, Rivulidae) have demonstrated that this fish has potential possibilities as a model species for risk assessment of EDCs using molecular biomarker approach (Lee et al., 2008a). K. marmoratus is the only vertebrate reproducing by internal self-fertilization (Harrington, 1961), providing genetic homogeneity among individuals within each self-fertilizing group. For this reason, K. marmoratus has been used to study developmental processes, cancer induction, and stress gene responses (Lee et al., 2008b,c). Other advantages would be a short generation time (3–4 months), relatively small size (3–5 cm in adult), and easy rearing under laboratory conditions (Lee et al., 2008a). Earlier, we have reported on cloning and sequence analysis of the Vg gene from the K. marmoratus (Kim et al., 2004). It was observed that the promoter region of K. marmoratus Vg gene has several E2 binding sites and the estrogen response element (ERE). Both Vg and
5′ RACE
3′ RACE Real-time PCR amplification Cloning 5′ RACE
3′RACE Real-time PCR amplification 18S rDNA real-time PCR amplification
Chg have been used as biomarkers of EDC exposure in fish (Lee et al., 2002a,b; Marin and Matozzo, 2004; Navas and Segner, 2006; Chen et al., 2008; Matozzo et al., 2008; Hong et al., 2009). EDCs have also shown modulatory effect on expression of transcripts of a number of genes with biomarker potential in K. marmoratus (Lee et al., 2008a,b,c). To further enlarge scope for biomarker and to understand role of EDCs on development processes, in this paper, we report cloning and sequence analysis of Chg genes from K. marmoratus (Km-Chg) and expression of their transcripts using quantitative real time RT-PCR in fish exposed to EDCs. 2. Materials and methods 2.1. Chemicals All chemicals and reagents used in this study were of molecular biology grade purchased from Sigma-Aldrich Co. (St. Louis, MO, USA), Qiagen (Valencia, CA, USA), and Invitrogen Corp. (Carlsbad, CA, USA) unless otherwise described. The oligonucleotide synthesis and nucleotide sequencing were performed at Bionics (Seoul, South Korea). 2.2. Fish rearing conditions and total RNA extraction K. marmoratus were reared and maintained at 25 °C with 12 h/12 h light/darkness cycle and 12‰ salinity. They were fed on a diet of Artemia nauplii (b24 h after hatching) once a day. Fish were anesthetized on ice and sacrificed by decapitation. Tissues were quickly removed under sterile condition and homogenized in three volumes of TRIZOL® (Invitrogen, Paisley, Scotland) with a glass tissue grinder. Total RNA was extracted according to manufactures' instructions. 2.3. cDNA cloning of K. marmoratus ChgH and ChgL genes The first strand cDNA was synthesized by SuperScript™ III reverse transcriptase (Invitrogen) according to the manufacturer's protocol. To obtain the partial sequence of Km-Chg cDNAs, degenerative primers (Table 1) were designed from the conserved segments of the ChgH and ChgL cDNA sequences retrieved from GenBank by aligning them using Clustal X (Thompson et al., 1997). Using these primers, PCR was performed with a liver sample under the following conditions: 94 °C/ 4 min; 45 cycles of 98 °C/25 s, 48 °C/30 s, 72 °C/60 s; and 72 °C/10 min. The amplified PCR products were isolated from 1% agarose gels, cloned into pCR2.1 TA vectors, and sequence was analyzed with an ABI PRISM 3700 DNA analyzer.
172
J.-S. Rhee et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 170–178
2.4. Rapid amplification of cDNA ends of Km-Chgs cDNA To obtain the full-length of Km-Chg cDNA, GeneRacer kit (Invitrogen; Carlsbad, CA) was used. Primers used in 5′-RACE (5′-GSP1, 5′GSP2, and 5′-GSP3) are shown in Table 1. The first round of PCR amplification and nested PCR were carried out as described by Lee et al. (2006). To obtain the 3′-unknown sequence, first-strand cDNA was synthesized using oligo(dT) anchor primer (Invitrogen) and the liver mRNA of K. marmoratus. The 3′-RACE products of Km-Chg cDNA were amplified by PCR using 3′-GSP1 primer (Table 1) and 3′-RACE adaptor primer (AUAP). The reaction mixture (25 µl) consisted of 0.1 µg cDNA template (from liver), 10 µM 3′-GSP1 primer and AUAP,
10 µM of each of dNTP, and LA Taq DNA polymerase (5 U/µl, Takara Bio Inc., Shiga, Japan). A second nested amplification was conducted using 3′-GSP2 (Table 1) and 3′-RACE adaptor primer. The PCR amplification conditions were the same as described above except that annealing temperatures were 58 °C, 60 °C, or 62 °C, respectively. The final PCR products were isolated on the agarose gel and cloning and sequence analysis were performed as described above. 2.5. Phylogenetic analysis To place the identified Km-Chg proteins in the phylogenetic tree, we aligned them with other choriogenins and ZP proteins of diverse
Fig. 1. Phylogenetic tree of Kryptolebias marmoratus choriogenin genes. The sequences used in phylogenetic analysis and their GenBank accession numbers were as follows; ZPB: Carassius auratus ZP2 (Z72495.1), Cyprinus carpio (Z72491.1), Danio rerio ZP2 (NP_571405), Anguilla japonica (BAA36592.1), Oryzias latipes ZPB (AAD38905.1), Salmo salar ESP (NP_001117169), Salvelinus alpines ZPα (AAR87393.1), Oncorhynchus mykiss VEPα (NP_001117745). Oncorhynchus masou Chg-Hα (ABW17263.1), Salvelinus alpines ZPβ (AAR87394.1), Oncorhynchus mykiss VEPβ (NP_001118072), Oncorhynchus masou Chg-Hβ (ABW17264.1), Sparus aurata ZPBa (AAY21009.1), Cyprinodon variegates ZR2 (AAT51698.1), Oryzias latipes Chg-Hm (NP_001098134), Pseudopleuronectes americanus ZP (AAC59642.1), Sparus aurata ZPBb (AAY21007.1), Liparis atlanticus ZPB (AAS55643.1), Oryzias latipes Chg-H (NP_001098277), Oryzias javanicus Chg-H (AAX09342.1), Oryzias melastigma Chg-H (ABN13415.1), ZPC : Cyprinus carpio ZP3 (CAA88837.1), Carassius auratus ZP3 (AAD53946.1), Pimephales promelas ZP3 (AAG28398.1), Danio rerio ZP3 (AAD49113.1), Anguilla japonica eSRS4 (BAA36593.1), Oncorhynchus masou Chg-L (ABW17265.1), Oncorhynchus mykiss VEPγ (AAF71260.1), Salvelinus alpines ZPγ (AAR87395.1), Tetraodon nigroviridis Chg-L (CAG11366.1), Liparis atlanticus Chg-L (AAS55644.1), Sparus aurata Chg-L (CAA63709.1), Cyprinodon variegatus ZR3 (AAT51699.1), Oryzias latipes Chg-L (AAM47575.1), Oryzias sinensis Chg-L (AAV34196.1), Oryzias melastigma Chg-L (ABN13414.1), Oryzias javanicus Chg-L (AAX09343.1). eSRS, eel spermatogenesis-related substance; ESP, eggshell protein; VEP, vitelline envelope protein; ZR, zona radiata.
J.-S. Rhee et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 170–178
species at the level of deduced amino acid sequence by Clustal X 1.83. Total 37 sequences retrieved from GenBank/DDBJ/EMBL databases were aligned. Gaps and missing data matrix were excluded from the analysis. The generated data matrix was converted to nexus format and the data matrix was analyzed with Mr.Bayes v3.1.2 program using general time-reversible (GTR) model. A total of 1,000,000 generations were conducted, and the sampling frequency was assigned as every 100 generations. After analysis, the first 10,000 generations were deleted as the burn-in process, and the consensus tree was constructed and then visualized with Tree View of PHYLIP. 2.6. Tissue specific expression of Km-Chg mRNA The expression pattern of Km-Chg mRNA was studied in seven tissues (brain, eye, gonad, intestine, liver, muscle and skin) of hermaphrodites and secondary males by quantitative real-time RT-PCR using the primers as shown in Table 1. For real-time RT-PCR amplification, each reaction consisted of 1 µl of cDNA and 0.2 µM primer each of real time RT-F/R and reference gene primer 18S rDNA RT-F/R (Table 1). Reaction conditions were: 94 °C/4 min; 35cycles of 94 °C/30 s, 55 °C/30 s, 72 °C/30 s; and 72 °C/10 min. SYBR® Green (Molecular Probe Inc., Invitrogen) was used to detect specific PCR products. Amplification and detection of SYBR® Green were performed with a MyiQ cycler (Bio-Rad, Hercules, CA, USA). Data of triplicate experiments were expressed as relative to 18S rDNA, which was used to normalize any difference in reverse transcriptase efficiency. Fold change for the relative gene expression was determined by the 2− ΔΔCt method (Livak and Schmittgen, 2001).
173
2.7. Expression of Km-Chgs mRNA at different stages of development The expression pattern of Km-ChgH and ChgL mRNA was studied during various developmental stages of K. marmoratus starting from stage 1 (2 day post-fertilization, dpf) to adult (hermaphrodite and secondary male) using quantitative real-time quantitative RT-PCR as described above. 2.8. EDC exposure study To study the effect of EDC exposure on Km-Chg expression, adult hermaphrodites and secondary males (length ~3 cm; n = 6 in each treatment group) were exposed to 17β-estradiol (E2, 100 ng/L), a known natural estrogen and tamoxifen (10 µg/L), a nonsteroidal estrogen antagonist, 4-n-nonylphenol, NP (300 µg/L), 4-tert-octylphenol, OP (300 µg/L) and bisphenol A, BPA (600 µg /L) for 96 h. The exposure concentrations of EDC were based on previous expression studies on K. marmoratus (Tanaka and Grizzle, 2002; Lee et al., 2006; Seo et al., 2006). E2 and tamoxifen concentrations were selected from the previous studies involving their exposure in fish (Lerner et al., 2007; Van der Ven et al., 2007). The tank water was replaced with fresh water at every 24 h. All the EDCs, E2 and tamoxifen were obtained from Sigma, and were dissolved in dimethyl sulfoxide (DMSO; Sigma). Control fish group was exposed to equivalent concentration of DMSO. The DMSO concentration in control and treated groups was maintained at b0.001%. The fish were maintained under the conditions as described above but not fed during the exposure period. After exposure for 96 h, fish were
Fig. 2. Tissue-specific expressions of Km-ChgH and Km-ChgL mRNAs in adult hermaphrodites and secondary males of K. marmoratus. The Km-ChgH and Km-ChgL mRNAs expressions were analyzed using real-time RT-PCR. Km-18S rRNA was used as reference house keeping gene. Data are means ± S.E. Asterisks (⁎) and (⁎⁎) indicate significant difference for p b 0.05, p b 0.01, respectively.
174
J.-S. Rhee et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 170–178
dissected and different organs were used for RNA extraction. Expression of Km-ChgH and ChgL mRNA was measured by quantitative real time quantitative RT-PCR as described above. 2.9. Statistical analysis Data are expressed as means ± SE. Significant differences between the observations of control and exposed groups in EDC exposure study were analyzed using Student's paired t-test and one-way and/or multiple-comparison ANOVA followed by Tukey's test. Expression data of tissues and developmental stages were analyzed by Tukey's test. Difference showing p b 0.05 was considered significant.
The similarity of amino acid sequences between Km-ChgH and Km-ChgL was low (less than 18%). The similarity of Km-ChgL to other fishes was 70% (Japanese medaka O. latipes), 68% (Chinese medaka O. sinensis), 66% (marine medaka O. javanicus), and 65% (brackish medaka O. melastigma). To determine the placement of Km-ChgH and Km-ChgL, we performed the Bayesian analysis of those proteins with 21 and 16 other Chg amino acid sequences from fishes, respectively. An unrooted radial tree showed that Km-ChgH and Km-ChgL were separated from other taxa, and made the clustering with phylogenetically closed species such as Oryzias latipes in liver tissue for ChgH and also Sparus aurata and Cyprinodon variegatus in liver tissue for ChgL (Fig. 1). This is well concluded with the existing knowledge for Chg proteins.
3. Results and discussion 3.2. Tissue distribution of Km-Chg mRNAs 3.1. Cloning of Km-ChgH and Km-ChgL genes Full-length of Km-ChgH cDNA (2,289 bp, 549 aa) and Km-ChgL cDNA (1281 bp, 427 aa) were sequenced, and deposited to GenBank (EU867501 for Km-ChgH and EU867503 for Km-ChgL). The deduced amino acid sequence of Km-ChgH had a theoretical pI of 5.65 and a calculated molecular weight of 60.9 kDa, while the deduced amino acid sequence of Km-ChgL had a theoretical pI of 5.33 and a calculated molecular weight of 47.1 kDa. Both Km-ChgH and ChgL have a ZP domain at the position of 235– 517 aa and 85–341 aa, respectively (Supplementary Figs. 1 and 2). In teleost fish, ZP domain may play an important role in hardening the egg chorion at fertilization, and their size and composition are reported to affect the degree of chorion hardness in different species (Sugiyama et al., 1999; Kanamori et al., 2003; Fujita et al., 2008). When comparing Km-ChgH and Km-ChgL proteins to other fish, ChgH proteins are less conserved due probably to differences in the length and composition of the proline- and glutamine-rich peptide repeats at N-terminal region (Fujita et al., 2008). Most ChgL/ZPC proteins lack this repetitive domain. However, Del Giacco et al. (2000) reported that zebrafish possessed this repetitive domain in the ChgL/ZPC protein.
The Km-ChgH and Km-ChgL mRNAs were highly expressed in liver tissues, while other tissues (brain, eye, gonad, intestine, muscle, skin) showed low level of expression (Fig. 2). Between adult hermaphrodites and secondary males there was no difference of expression (Fig. 2). However, between the two genes there was a different degree of expression; ChgH showing lower expression than ChgL in both the gender types. Both Km-ChgH and Km-ChgL showed higher expression level in the liver of hermaphrodites than that of secondary males. These results suggest that Chg genes in secondary males are not active compared to hermaphrodites. As Chg proteins are synthesized in the liver in response to estrogens, their low level in secondary males, which are practically infertile is not surprising (Yamagami, 1996; Murata et al., 1997; Lee et al., 2002a,b; Arukwe and Goksoyr, 2003). 3.3. Km-Chg mRNA expression at various stages of development The relative expression of Km-Chg mRNA expression at various developmental stages is shown in Fig. 3. The expression of Km-ChgH mRNA increased at stages 3 and 4, compared to stage 1 (2 dpf)
Fig. 3. Developmental stage-specific expression of Km-ChgH and Km-ChgL mRNAs using real-time RT-PCR. Five embryonic stages represent stage 1 = 2 day post-fertilization (dpf), stage 2 = 4 dpf, stage 3 = 9 dpf, stage 4 = 12 dpf, and stage 5 = 5 h post hatching. Km-18S rRNA was used as a reference house keeping gene to normalize the expression. When none of the characters between data bars match, values were considered statistically different (p b 0.05) determined by one-way ANOVA followed by Tukey's test. Data are means ± S.E.
J.-S. Rhee et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 170–178
175
indicating that this gene would play a role in those developmental stages but significance of such an expression pattern is not clear. Additionally, Km-ChgL mRNA expression showed a dramatic upregulation between stages 1 and 2 but a down-regulation trend was evident at stage 5. The discrepancy of both genes on expression in embryogenesis would suggest that they might have a different role in relation to development. In relation to the expression of Km-Chg genes at early embryogenetic stages, we may assume that K. marmoratus embryos need to recruit the Chg proteins from early stages of embryogenesis, as the developing oocytes and fertilized eggs are surrounded by an egg envelope (chorion). 3.4. Modulatory effect of 17β-estradiol and tamoxifen on Km-Chgs mRNA expression The effect of E2 and tamoxifen on Km-Chg mRNA expression is shown in Fig. 4. E2 induced expression of both Km-ChgH and Km-ChgL mRNAs significantly in hermaphrodites (Fig. 4A). In secondary males, E2 showed the same effect but the degree of induction was lower than that in the hermaphrodites. Between Km-ChgH and Km-ChgL genes also a difference in expression level was evident (Fig. 4A). However,
Fig. 5. Effect of bisphenolA (600 µg/L for 96 h), 4-n-nonylphenol (300 µg/L for 96 h) and 4-tert-octylphenol (300 µg/L for 96 h) exposure on Km-Chg mRNA expression in the liver of adult hermaphrodite and secondary male K. marmoratus. Control fish were treated with DMSO. BPA, NP, and OP suspended in DMSO were exposed through tank water in a static renewal culture condition for 96 h. Each group of fish comprised a minimum of six fishes. The Km-Chg mRNA expression was analyzed using real-time RTPCR and shown relative to Km-18S rRNA which was used as reference house keeping gene. Data are means ± S.E. The symbols (⁎, ⁎⁎, and ⁎⁎⁎) indicate p b 0.05, p b 0.01, and p b 0.001 respectively, indicate significant difference over controls.
tamoxifen exposure caused no significant change in expression of either of the genes in the fish of both genders (Fig. 4B). The induction of Chg genes by E2 was firstly demonstrated in medaka liver by Murata et al. (1997) and subsequently Lee et al. (2002b) provided comparable results in the same species. On sensitivity of Chg genes to EDC exposure, Lee et al. (2002b) reported that medaka ChgL was more sensitive than ChgH at the same concentration of 17α-ethinylestradiol (EE2). This tendency was also shown in BPA- and NP-treated medaka. This observation suggests that Japanese medaka ChgL may be more sensitive than ChgH to estrogen exposure. However, study by Yu et al. (2006) showed that marine medaka (O. javanicus) ChgH would be more sensitive than ChgL. Similarly, Fujita et al. (2004) also showed that ChgH in blood serum is more responsive than ChgL to low doses of E2-exposed salmon (O. masou). In the red lip mullet, Hong et al. (2009) showed that ChgH, ChgL, and Vg in the serum were induced in immature forms when treated with various doses of E2 (10, 100 and 1000 µg/kg). Based on our observations in K. marmoratus, it may be concluded that there appears to be a gender specific differences in the susceptibility to E2 in this fish with Chg gene type dependency. Salam et al. (2008) showed a clear increase of green fluorescent protein (GFP) intensity at 25 ng/L E2 in transgenic medaka (5 day exposure) harboring a ChgL promoter at day 6 of exposure. Also, Chen et al. (2008) showed a dose-dependent increase of both ChgH and ChgL mRNAs at different concentrations of E2 (0 to 500 ng/L) in medaka. These findings indicate that there are species specific differences in susceptibility to E2 in fish. Furthermore, it may be concluded that medaka ChgL mRNA is more sensitive compared to ChgH mRNA to E2 exposure. However, as studies on Chg expression are limited to just few species, a firm conclusion looks elusive at this stage. 3.5. Modulatory effect of EDCs on Km-Chg mRNA expression Fig. 4. Effects of (A) 17β-estradiol (100 ng/L for 96 h) and (B) tamoxifen (10 µg/L for 96 h) on Km-ChgH and Km-ChgL mRNA expression in the liver of adult K. marmoratus (hermaphrodite and secondary male). Control fish were treated with solvent DMSO. E2 and TMX were exposed in tank water with a static renewal culture condition for 96 h. Each group of fish comprised a minimum of six fish. The Km-Chg mRNA expression was analyzed using real-time RT-PCR. Km-Chg mRNA expression is shown as relative to Km18S rRNA which was used as a reference house keeping gene. Data are means ± S.E. The symbols (⁎ and ⁎⁎) indicate p b 0.05 and p b 0.01, respectively.
Effect of EDC exposure on Km-ChgH and Km-ChgL mRNA expression in K. marmoratus is shown in Fig. 5. The increased expression of both mRNAs was observed in both genders of fish (hermaphrodites and secondary males). Although all EDCs showed significantly greater (p b 0.01 to 0.001) induction in exposed fish, significant effect (p b 0.05) of OP was observed only on ChgH in hermaphrodites.
176
J.-S. Rhee et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 170–178
Fig. 6. Effect of EDC exposure for various time durations on (A) Km-ChgH and (B) Km-ChgL mRNA expression in juvenile fish. Expression was studied at 0, 3, 6, 12, and 24 h by realtime RT-PCR. Significant difference over control values are indicated by different letters on the data bar (p b 0.05) analyzed by multiple-comparison ANOVA. Data are means ± S.E.
There is variable response of induction upon EDCs exposure in fish. Similarly, EDCs show species and gender specific differences in expression of mRNA of Chgs. For example, Lee et al. (2002b) and Chen et al. (2008) showed that NP and BPA induced expression of both ChgH and ChgL mRNAs in the O. latipes and O. melastigma male livers. Lee et al. (2002b) showed that when medaka was exposed to BPA and NP, induction of ChgL mRNA was more pronounced, compared to that for ChgH. Time course effect of EDC exposure on Chg mRNA expression is shown in Fig. 6. A significant induction (p b 0.05) over controls was observed only after 6 h of exposure to each EDC. Study of relative sensitivities of Km-ChgH and Km-ChgL mRNA expression in fish exposed to EDCs for 24 h revealed that to all the EDCs, ChgH showed significantly higher expression compared to ChgL (Fig. 7). This indicates that different modes of action of chemicals would influence the sensitivity of these genes. When compared with Vg expression, several studies demonstrated that Chgs have a higher response than Vg at a low level of estrogenic compounds in sea bream Sparus auratus (Pinto et al., 2006), Atlantic salmon Salmo salar (Celius and Walther, 1998), masu salmon (Fujita et al., 2004), Japanese medaka, (Lee et al., 2002a), and rainbow trout Oncorhynchus mykiss (Celius et al., 2000). This suggests that different species may have different sensitivities to EDC exposure. The cloning and sequence analysis of cDNA with mRNA expression study of Chg genes from K. marmoratus demonstrated biomarker
Fig. 7. Relative expression of Km-ChgH and Km-ChgL mRNA after exposure of NP, OP, and BPA to juvenile K. marmoratus. Control was set to 1 on the Y axis for the determination of the relative expression. Bars with different letters on their top indicate significant difference in expression level over the others when analyzed by Tukey's test.
J.-S. Rhee et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 170–178
potential of these genes. Earlier, Vg expression from K. marmoratus also showed such a potential. However, when expression of both the genes was compared, Chg appears to be more robust biomarker than Vg upon exposure to EDCs. Overall, these finding strengthen position of K. marmoratus as a model fish species for risk assessment of marine contaminants with endocrine disrupting potential using molecular biomarker approach. These findings also shed some light on the physiological role of Chg in K. marmoratus which has a very unique reproductive mechanism. Acknowledgements We thank Dr. Hans-Uwe Dahms for his critical comments on the first draft of the manuscript. This work was partly supported by a grant (2009-0066330) of the Korea Science and Engineering Foundation funded to Jae-Seong Lee, and also partly supported by a grant of the Fisheries Research and Development Program of the Ministry for Food, Agriculture, Forestry and Fisheries of Korea (2008) funded to Gyung Soo Park. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.cbpc.2009.04.006. References Arukwe, A., Goksoyr, A., 2003. Eggshell and egg yolk proteins in fish: hepatic proteins for the next generation: oogenetic, population, and evolutionary implications of endocrine disruption. Comp. Hepatol. 2, 4. Arukwe, A., Knudsen, F.R., Goksøyr, A., 1997. Fish zona radiata (eggshell) protein: a sensitive biomarker for environmental estrogens. Environ. Health Perspect. 105, 418–422. Celius, T., Matthews, J.B., Giesy, J.P., Zacharewski, T.R., 2000. Quantification of rainbow trout (Oncorhynchus mykiss) zona radiata and vitellogenin mRNA levels using realtime PCR after in vivo treatment with estradiol-17beta or α-zearalenol. J. Steroid Biochem. Mol. Biol. 75, 109–119. Celius, T., Walther, B.T., 1998. Oogenesis in Atlantic salmon (Salmo salar) occurs by zonagenesis preceding vitellogenesis in vivo and in vitro. J. Endocrinol. 58, 259–266. Chen, X., Li, V.W.T., Yu, R.M.K., Cheng, S.H., 2008. Choriogenin mRNA as a sensitive molecular biomarker for estrogenic chemicals in developing brackish medaka (Oryzias melastigma). Ecotoxicol. Environ. Saf. 71, 200–208. Del Giacco, L., Diani, S., Cotelli, F., 2000. Identification and spatial distribution of the mRNA encoding an egg envelope component of the cyprinid zebrafish, Danio rerio, homologous to the mammalian ZP3 (ZPC). Dev. Genes Evol. 210, 41–46. Fujita, T., Fukada, H., Shimizu, M., Hiramatsu, N., Hara, A., 2004. Quantification of serum levels of precursors to vitelline envelope proteins (choriogenins) and vitellogenin in estrogen treated masu salmon, Oncorhynchus masou. Gen. Comp. Endocrinol. 136, 49–57. Fujita, T., Fukada, H., Shimizu, M., Hiramatsu, N., Hara, A., 2008. Molecular cloning and characterization of three distinct choriogenins in masu salmon, Oncorhynchus masou. Mol. Reprod. Dev. 75, 1217–1228. Hamazaki, T.S., Nagahama, Y., Iuchi, I., Yamagami, K., 1989. A glycoprotein from the liver constitutes the inner layer of the egg envelope (zona pellucida interna) of the fish, Oryzias latipes. Dev. Biol. 133, 101–110. Harrington, R.W., 1961. Oviparous hermaphroditic fish with internal self-fertilization. Science 134, 1749–1750. Hong, L., Fujita, T., Wada, T., Amano, H., Hiramatsu, N., Zhang, X., Todo, T., Hara, A., 2009. Choriogenin and vitellogenin in red lip mullet (Chelon haematocheilus): purification, characterization, and evaluation as potential biomarkers for detecting estrogenic activity. Comp. Biochem. Physiol. 149C, 9–17. Ikezuki, Y., Tsutsumi, O., Takai, Y., Kamei, Y., Taketani, Y., 2002. Determination of bisphenol A concentrations in human biological fluids reveals significant early prenatal exposure. Hum. Reprod. 17, 2839–2841. Jenssen, B.M., 2006. Endocrine-disrupting chemicals and climate change: a worst-case combination for arctic marine mammals and seabirds? Environ. Health Perspect. 114 (Suppl 1), 76–80. Kanamori, A., Naruse, K., Mitani, H., Shima, A., Hori, H., 2003. Genomic organization of ZP domain containing egg envelope genes in medaka (Oryzias latipes). Gene 305, 35–45. Kannan, K., Keith, T.L., Naylor, C.G., Staples, C.A., Snyder, S.A., Giesy, J.P., 2003. Nonylphenol and nonylphenol ethoxylates in fish, sediment, and water from the Kalamazoo river, Michigan. Arch. Environ. Contam. Toxicol. 44, 77–82. Kim, I.-C., Chang, S.Y., Williams, T.D., Ja Kim, Y., Yoon, Y.-D., Lee, Y.-S., Park, E.-H., Lee, J.-S., 2004. Genomic cloning and expression of vitellogenin gene from the self-fertilizing fish Rivulus marmoratus (Cyprinodontiformes, Rivulidae). Mar. Environ. Res. 58, 687–691. Korach, K.S., Cae, K., Gibson, M., Curtis, S., 1991. Estrogen receptor stereochemistry: ligand binding and hormonal responsiveness. Steroids 56, 263–270.
177
Laws, S.C., Carey, S.A., Ferrell, J.M., Bodman, G.J., Cooper, R.L., 2000. Estrogenic activity of octylphenol, nonylphenol, bisphenol A and methoxychlor in rats. Toxicol. Sci. 54, 154–167. Lee, J.-S., Raisuddin, S., Schlenk, D., 2008a. Kryptolebias marmoratus (Poey, 1880): a potential model species for molecular carcinogenesis and ecotoxicogenomics. J. Fish Biol. 72, 1871–1889. Lee, C., Jeon, S.H., Na, J., Choi, Y., Park, K., 2002a. Sensitivities of mRNA expression of vitellogenin, choriogenin and estrogen receptor by estrogenic chemicals in medaka, Oryzias latipes. J. Health Sci. 48, 441–445. Lee, C., Na, J.G., Lee, K.C., Park, K., 2002b. Choriogenin mRNA induction in male medaka, Oryzias latipes as a biomarker of endocrine disruption. Aquat. Toxicol. 61, 233–241. Lee, Y.-M., Jung, S.-O., Seo, J.S., Yoon, Y.-D., Lee, J.-S., 2006. Cloning of Ki-ras and Ha-ras cDNAs from the hermaphroditic fish Rivulus marmoratus (Cyprinodontiformes, Rivulidae) and its expression after exposure to 4-nonylphenol. Mar. Environ. Res. 62, S136–S140. Lee, Y.-M., Raisuddin, S., Rhee, J.-S., Ki, J.-S., Kim, I.-C., Lee, J.-S., 2008b. Modulatory effect of environmental endocrine disruptors on N-ras oncogene expression in the hermaphroditic fish, Kryptolebias marmoratus. Comp. Biochem. Physiol. 147C, 299–305. Lee, Y.-M., Rhee, J.-S., Hwang, D.-S., Kim, I.-C., Raisuddin, S., Lee, J.-S., 2008c. p53 gene expression is modulated by endocrine disrupting chemicals in the hermaphroditic fish, Kryptolebias marmoratus. Comp. Biochem. Physiol. 147C, 150–157. Lerner, D.T., Björnsson, B.T., McCormick, S.D., 2007. Larval exposure to 4-nonylphenol and 17β-estradiol affects physiological and behavioral development of seawater adaptation in Atlantic salmon smolts. Environ. Sci. Technol. 41, 4479–4485. Litscher, E.S., Wassarman, P.M., 2007. Egg extracellular coat proteins: from fish to mammals. Histol. Histopathol. 22, 337–347. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real time quantitative PCR and the 2− ΔΔCt method. Methods 25, 402–408. Marin, M.G., Matozzo, V., 2004. Vitellogenin induction as a biomarker of exposure to estrogenic compounds in aquatic environments. Mar. Pollut. Bull. 48, 835–839. Monné, M., Han, L., Jovine, L., 2006. Tracking down the ZP domain: from the mammalian zona pellucida to the molluscan vitelline envelope. Semin. Reprod. Med. 24, 204–216. Matozzo, V., Gagné, F., Marin, M.G., Ricciardi, F., Blaise, C., 2008. Vitellogenin as a biomarker of exposure to estrogenic compounds in aquatic invertebrates: a review. Environ. Int. 34, 531–545. Murata, K., Sasaki, T., Yasumasu, S., Iuchi, I., Enami, J., Yasumasu, I., Yamagami, K., 1995. Cloning of cDNAs for the precursor protein of a low-molecular-weight subunit of the inner layer of the egg envelope (chorion) of the fish Oryzias latipes. Dev. Biol. 167, 9–17. Murata, K., Sugiyama, H., Yasumasu, S., Iuchi, I., Yasumasu, I., Yamagami, K., 1997. Cloning of cDNA and estrogen-induced hepatic gene expression for choriogenin H, a precursor protein of the fish egg envelope (chorion). Proc. Natl. Acad. Sci. U. S. A. 94, 2050–2055. Navas, J.M., Segner, H., 2006. Vitellogenin synthesis in primary cultures of fish liver cells as endpoint for in vitro screening of the (anti)estrogenic activity of chemical substances. Aquat. Toxicol. 80, 1–22. Pinto, P.I.S., Teodosio, H.R., Galay-burgos, M., Power, D.M., Sweeney, G.E., Canario, A.V.M., 2006. Identification of estrogen-responsive genes in the testis of sea bream (Sparus auratus) using suppression subtractive hybridization. Mol. Reprod. Dev. 73, 318–329. Porte, C., Janer, G., Lorusso, L.C., Ortiz-Zarragoitia, M., Cajaraville, M.P., Fossi, M.C., Canesi, L., 2006. Endocrine disruptors in marine organisms: approaches and perspectives. Comp. Biochem. Physiol. 143C, 303–315. Prakash, O., Goswami, S.V., Sehgal, N., 2007. Establishment of ELISA for murrel vitellogenin and choriogenin, as biomarkers of potential endocrine disruption. Comp. Biochem. Physiol. 146C, 540–551. Salam, M.A., Sawada, T., Ohya, T., Ninomiya, K., Hayashi, S., 2008. Detection of environmental estrogenicity using transgenic medaka hatchlings (Oryzias latipes) expressing the GFP-tagged choriogenin L gene. J. Environ. Sci. Health 43A, 272–277. Seo, J.S., Lee, Y.-M., Jung, S.-O., Kim, I.-C., Yoon, Y.-D., Lee, J.-S., 2006. Nonylphenol modulates expression of androgen receptor and estrogen receptor genes differently in gender types of the hermaphroditic fish Rivulus marmoratus. Biochem. Biophys. Res. Commun. 346, 213–223. Sugiyama, H., Murata, K., Iuchi, I., Nomura, K., Yamagami, K., 1999. Formation of mature egg envelope subunit proteins from their precursors (choriogenins) in the fish, Oryzias latipes: loss of partial C-terminal sequences of the choriogenins. J. Biochem. 125, 469–475. Sugiyama, H., Yasumasu, S., Murata, K., Iuchi, I., Yamagami, K., 1998. The third egg envelope subunit in fish: cDNA cloning and analysis, and gene expression. Dev. Growth Differ. 40, 35–45. Tanaka, J.N., Grizzle, J.M., 2002. Effects of nonylphenol on the gonadal differentiation of the hermaphroditic fish, Rivulus marmoratus. Aquat. Toxicol. 57, 117–125. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The Clustal X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 24, 4876–4882. Toppari, J., 2008. Environmental endocrine disrupters. Sex Dev. 2, 260–267. Ueno, T., Yasumasu, S., Hayashi, S., Iuchi, I., 2004. Identification of choriogenin cisregulatory elements and production of estrogen-inducible, liver-specific transgenic medaka. Mech. Dev. 121, 803–815. Van der Ven, L.T., van den Brandhof, E.J., Vos, J.H., Wester, P.W., 2007. Effects of the estrogen agonist 17β-estradiol and antagonist tamoxifen in a partial life-cycle assay with zebrafish (Danio rerio). Environ. Toxicol. Chem. 26, 92–99. Watanabe, H., Suzuki, A., Goto, M., Lubahn, D.B., Handa, H., Iguchi, T., 2004. Tissuespecific estrogenic and non-estrogenic effects of a xenoestrogen, nonylphenol. J. Mol. Endocrinol. 33, 243–252.
178
J.-S. Rhee et al. / Comparative Biochemistry and Physiology, Part C 150 (2009) 170–178
White, R., Jobling, S., Hoare, S.A., Sumpter, J.P., Parker, M.G., 1994. Environmentally persistent alkylphenolic compounds are estrogenic. Endocrinology 135, 175–182. Yamagami, K., 1996. Studies on the hatching enzyme (choriolysin) and its substrate, egg envelope, constructed of the precursors (choriogenins) in Oryzias latipes: a sequel to the information in 1991/1992. Zool. Sci. 13, 331–340. Yang, M., Park, M.S., Lee, H.S., 2006. Endocrine disrupting chemicals: human exposure and health risks. J. Environ. Sci. Health 24C, 183–224.
Ying, G.G., Williams, B., Kookana, R., 2002. Environmental fate of alkylphenols and alkylphenol ethoxylates—a review. Environ. Int. 28, 215–226. Yu, R.M., Wong, M.M., Kong, R.Y., Wu, R.S., Chen, S.H., 2006. Induction of hepatic schoriogenin mRNA expression in male marine medaka: a highly sensitive biomarker for environmental estrogens. Aquat. Toxicol. 77, 348–358.