- Email: [email protected]
Endonuclease-rolling circle amplification-based method for sensitive analysis of DNA-binding protein
Available online at www.sciencedirect.com
Chinese Chemical Letters 20 (2009) 1315–1318 www.elsevier.com/locate/cclet
Endonuclease-rolling circle amplification-based method for sensitive analysis of DNA-binding protein Min Li Li a, Dong Rui Zhou b, Hong Zhao a, Jin Ke Wang a, Zu Hong Lu a,b,* a
b
The State Key Laboratory of Bioelectronics, Southeast University, Nanjing 210096, China Key Laboratory of Child Development and Learning Science, Ministry of Education, Southeast University, Nanjing 210096, China Received 31 March 2009
Abstract A sensitive approach for the qualitative detection of DNA-binding protein on the microarray was developed. DNA complexes in which a partial duplex region is formed from a biotin-primer and a circle single strand DNA (ssDNA) were spotted on a microarray. The endonuclease recognition site (ERS) and the DNA-binding sites (DBS) were arranged side by side within the duplex region. The working principle of the detection system is described as follows: when the DNA-binding protein capture the DBS, the endonuclease could not attach to the ERS, and the immobilized primer in the DNA complex could be extended along the circle ssDNA by rolling circle amplification (RCA). When no protein protects the DBS, the ERS could be attacked by the endonuclease and subsequently no rolling circle amplification occurs. Thereby we can detect the sequence specific DNA-binding activity with high-sensitivity due to the signal amplification of RCA. # 2009 Zu Hong Lu. Published by Elsevier B.V. on behalf of Chinese Chemical Society. All rights reserved. Keywords: Rolling circle amplification; DNA-binding protein; Microarray
DNA-binding proteins (DBP) are involved in many important cellular processes. Several techniques have been developed to detect DNA-binding proteins, including DNA microarray [1], fluorescence resonance energy transfer [2,3] and Exo-dye-based assay [4]. However, their lack of sensitivity makes them difficult to apply in detecting trace amounts of DNA-binding proteins. Rolling circle amplification (RCA) has enabled rapid advances in the development of powerful tools for detecting DNA targets [5–7]. To extend the scope of RCA to high-sensitivity detection of proteins, the immunoRCA technique was developed [6,7]. However, the immunoRCA method is limited by the availability of suitable antibody and the antibody–DNA conjugate synthesis is laborious. In our previous studies we have successfully developed an endonuclease-based method for detecting the sequence specific DNA-binding protein on double-stranded DNA microarray [8]. In this study, we improved the microarray platform for DNA-binding protein p50 homodimer detection by combining endonuclease and rolling circle amplification methods in order to achieve high detection sensitivity. P50 is a classical member of the transcription factor NF-kB family which regulates diverse cellular functions. In this improved method, DNA complex in which a partial duplex region is formed from a biotin-primer and a circle ssDNA has been designed and spotted on the
* Corresponding author at: The State Key Laboratory of Bioelectronics, Southeast University, Nanjing 210096, China. E-mail address: [email protected] (Z.H. Lu). 1001-8417/$ – see front matter # 2009 Zu Hong Lu. Published by Elsevier B.V. on behalf of Chinese Chemical Society. All rights reserved. doi:10.1016/j.cclet.2009.06.008
1316
M.L. Li et al. / Chinese Chemical Letters 20 (2009) 1315–1318
Fig. 1. Composition of the C-probe (A) and scheme of the microarray fabrication (B and C). The C-probe contains four parts, region 1 and 4 are sequences complementary to linker. After linker annealed to the C-probe, The C-probe will form a circular ssDNA, as shown in (B); region 2 complements to the biotin-primer which will form partial duplex region that contains EcoRI recognition site (ERS) and DNA-binding site (DBS) as shown in (C); the region 3 is complementary to the sequence of cy3 reporter and will be detected after RCA.
Table 1 The sequences of all oligonucleotides used in this study. Description
Sequence
Circularizable probe
50 -P-TAGCTAGAATCAAAAATGTTG AGTACGACGGAAAGTCCCGAATTCGCGGCGTG ATGATTA TGCGTATAGAAATAATACAGA-30 50 -ACCTTTATGTCAACATTTTTGATTCTAGCTATCT GTATTATTTCACCTAGCTT-30 50 -bio-(T)10ATTAGCATGAATTC GGGACTTTCC -30 50 -Cy3-GCGGCGTGATGTATTATGCGTATAG-30
Linker Biotin-primer cy3 reporter
microarray. There are two functional sites on the duplex region: EcoRI recognition site (ERS) and DNA-binding site (DBS). They were designed side by side on the duplex region. Another short linker was fabricated to transfer the circularizable probe (C-probe) to form the circle ssDNA by DNA ligation. The C-probe contains six parts as shown in Fig. 1A. The sequences of circularizable probe (C-probe), linker, biotin-primer and cy3 reporter were shown in Table 1 and they are synthesized by Invitrogen Company (Shanghai, China). Experimental procedures of fabricating the complex microarray can be described as follows (Fig. 1B and C). Firstly, equal aliquot of the C-probe and the linker were denatured at 94 8C for 1 min and annealed at room temperature. The flanking sequence of the C-probe paired with the linker and repaired by the T4 ligase at 16 8C for 16 h, an integral circle ssDNA formed, as shown in Fig. 1B. Then the circle annealed with the biotin-primer and the complexity was dissolved in sodium carbonate buffer (0.1 mol/L, pH 9.0) at the concentration of 80 mmol/L and spotted on the streptavidin coated glass slides using an arrayer of Cartesian Technologies. The immobilized probe contains a duplex region in which the EcoRI recognition site (50 . . .GAATTC. . .30 ) arranged closely to the protein p50 consensus binding site (50 . . .GGGACTTTCC. . .30 ), as shown in Fig. 1C. The detection principle can be schematically shown in Fig. 2. We hybridized the target protein prior to EcoRI enzyme during the measurement process. Because of the space obstruction, the EcoRI endonuclease would not digest the duplex region if the target protein attached to the protein binding site. After EcoRI digestion all the proteins are eluted from the microarray. There were two kinds of DNA probes left on the microarray: one contained the intact duplex region and the other was digested by the endonuclease due to no target protein protection. Then the F29 polymerase amplification mixture was added to the microarray. The RCA reaction was carried out at 30 8C for 45 min. After washing the slide, the Cy3 reporter probe was hybridized to the slide at 42.7 8C for 2 h. All the slides were scanned by using ScanMicroarray1 Lite (Packard Biochip Technologies) in the Cy3 channel at 85% laser power, 80% PMT gain, 5 mm resolution. To test the feasibility, we first hybridized the microarray merely with C-probe but not with p50, there was no signal detected in the final scan. It can be inferred that the naked probes were degraded by EcoRI. Then we supplied four different concentrations 1 pg/mL, 2 pg/mL, 5 pg/mL and 10 pg/mL of p50 homodimer to the slides, the final signals increased with the amount of p50. The images and fluorescence intensity variations were shown in Fig. 3. As shown in
M.L. Li et al. / Chinese Chemical Letters 20 (2009) 1315–1318
1317
Fig. 2. Schematic representation of the endonuclease-RCA-based assay. (A) (1) DNA-binding protein (DBP) binds to the DNA-binding site (DBS). (2) EcoRI cannot bind to the endonuclease recognition site (ERS) because of the space obstruction. (3) The intact DNA complexes were left on the microarray when DBP were eluted. (4) RCA and cy3 reporter detection, there was high fluorescence signal. (B) (1) No DNA-binding protein (DBP) binds to the DNA-binding site (DBS). (2) EcoRI can bind to the endonuclease recognition site (ERS). (3) The digested DNA complexes were left on the microarray when EcoRI was eluted. (4) RCA and cy3 reporter detection, there was no fluorescence signal.
Fig. 3. The image and fluorescence intensity of the microarrays varied with the p50 homodimer concentrations. (A) The negative control (without p50); (B–E) the signal images of RCA product reported with Cy3 reporter probe after treatment of p50 homodimer with the concentrations of 1 pg/mL, 2 pg/mL, 5 pg/mL and 10 pg/mL, respectively. (F) The fluorescence intensity increases with p50 homodimer concentrations.
Fig. 3F, the fluorescence intensity increases along with p50 homodimer concentration. When the protein concentration was low to 1 pg/mL, we still had relatively strong fluorescence intensity (1000 37.6) which was corresponding to protein concentration of 2.4 ng/mL in previous study [8]. Obviously, the signals obtained with endonuclease-RCAbased method are much more sensitive than endonuclease-based method in detecting the sequence specific DNAbinding protein. The sensitivity of the improved method increased over three orders of magnitude compared to the previous method. It is suggested that the method based on endonuclease-rolling circle amplification is a feasible sensitive way to detect the DNA-binding protein and can efficiently amplify the signal of DNA-binding proteins. This approach can avoid the use of antibodies. Moreover, when we spot different probes on the slide, different DNA-binding proteins could be detected simultaneously in the cell lysate.
1318
M.L. Li et al. / Chinese Chemical Letters 20 (2009) 1315–1318
Acknowledgments This research is supported by the National Natural Science Foundation of China (Nos. 60501010, 60701008 and 60771024). References [1] [2] [3] [4] [5] [6] [7] [8]
S. Mukherjee, M.F. Berger, M. Snyder, et al. Nat. Genet. 36 (2004) 1331. T. Heyduk, E. Heyduk, Nat. Biotechnol. 20 (2002) 171. J.K. Wang, T.X. Li, Z.H. Lu, Nucleic Acids Res. 33 (2005) e23. Z.Z. Chen, M.J. Ji, P. Hou, Z.H. Lu, Biochem. Biophys. Res. Commun. 345 (2006) 1254. J. Jarvius, J. Melin, M. Nilsson, Nat. Methods 3 (2006) 725. B. Schweitzer, S. Wiltshire, J. Lambert, Proc. Natl. Acad. Sci. U.S.A. 97 (2000) 10113. B. Schweitzer, S. Roberts, B. Grimwade, Nat. Biotechnol. 20 (2002) 359. Y.F. Bai, Q.Y. Ge, Z.H. Lu, Chin. Chem. Lett. 16 (2006) 651.
Chinese Chemical Letters 20 (2009) 1315–1318 www.elsevier.com/locate/cclet
Endonuclease-rolling circle amplification-based method for sensitive analysis of DNA-binding protein Min Li Li a, Dong Rui Zhou b, Hong Zhao a, Jin Ke Wang a, Zu Hong Lu a,b,* a
b
The State Key Laboratory of Bioelectronics, Southeast University, Nanjing 210096, China Key Laboratory of Child Development and Learning Science, Ministry of Education, Southeast University, Nanjing 210096, China Received 31 March 2009
Abstract A sensitive approach for the qualitative detection of DNA-binding protein on the microarray was developed. DNA complexes in which a partial duplex region is formed from a biotin-primer and a circle single strand DNA (ssDNA) were spotted on a microarray. The endonuclease recognition site (ERS) and the DNA-binding sites (DBS) were arranged side by side within the duplex region. The working principle of the detection system is described as follows: when the DNA-binding protein capture the DBS, the endonuclease could not attach to the ERS, and the immobilized primer in the DNA complex could be extended along the circle ssDNA by rolling circle amplification (RCA). When no protein protects the DBS, the ERS could be attacked by the endonuclease and subsequently no rolling circle amplification occurs. Thereby we can detect the sequence specific DNA-binding activity with high-sensitivity due to the signal amplification of RCA. # 2009 Zu Hong Lu. Published by Elsevier B.V. on behalf of Chinese Chemical Society. All rights reserved. Keywords: Rolling circle amplification; DNA-binding protein; Microarray
DNA-binding proteins (DBP) are involved in many important cellular processes. Several techniques have been developed to detect DNA-binding proteins, including DNA microarray [1], fluorescence resonance energy transfer [2,3] and Exo-dye-based assay [4]. However, their lack of sensitivity makes them difficult to apply in detecting trace amounts of DNA-binding proteins. Rolling circle amplification (RCA) has enabled rapid advances in the development of powerful tools for detecting DNA targets [5–7]. To extend the scope of RCA to high-sensitivity detection of proteins, the immunoRCA technique was developed [6,7]. However, the immunoRCA method is limited by the availability of suitable antibody and the antibody–DNA conjugate synthesis is laborious. In our previous studies we have successfully developed an endonuclease-based method for detecting the sequence specific DNA-binding protein on double-stranded DNA microarray [8]. In this study, we improved the microarray platform for DNA-binding protein p50 homodimer detection by combining endonuclease and rolling circle amplification methods in order to achieve high detection sensitivity. P50 is a classical member of the transcription factor NF-kB family which regulates diverse cellular functions. In this improved method, DNA complex in which a partial duplex region is formed from a biotin-primer and a circle ssDNA has been designed and spotted on the
* Corresponding author at: The State Key Laboratory of Bioelectronics, Southeast University, Nanjing 210096, China. E-mail address: [email protected] (Z.H. Lu). 1001-8417/$ – see front matter # 2009 Zu Hong Lu. Published by Elsevier B.V. on behalf of Chinese Chemical Society. All rights reserved. doi:10.1016/j.cclet.2009.06.008
1316
M.L. Li et al. / Chinese Chemical Letters 20 (2009) 1315–1318
Fig. 1. Composition of the C-probe (A) and scheme of the microarray fabrication (B and C). The C-probe contains four parts, region 1 and 4 are sequences complementary to linker. After linker annealed to the C-probe, The C-probe will form a circular ssDNA, as shown in (B); region 2 complements to the biotin-primer which will form partial duplex region that contains EcoRI recognition site (ERS) and DNA-binding site (DBS) as shown in (C); the region 3 is complementary to the sequence of cy3 reporter and will be detected after RCA.
Table 1 The sequences of all oligonucleotides used in this study. Description
Sequence
Circularizable probe
50 -P-TAGCTAGAATCAAAAATGTTG AGTACGACGGAAAGTCCCGAATTCGCGGCGTG ATGATTA TGCGTATAGAAATAATACAGA-30 50 -ACCTTTATGTCAACATTTTTGATTCTAGCTATCT GTATTATTTCACCTAGCTT-30 50 -bio-(T)10ATTAGCATGAATTC GGGACTTTCC -30 50 -Cy3-GCGGCGTGATGTATTATGCGTATAG-30
Linker Biotin-primer cy3 reporter
microarray. There are two functional sites on the duplex region: EcoRI recognition site (ERS) and DNA-binding site (DBS). They were designed side by side on the duplex region. Another short linker was fabricated to transfer the circularizable probe (C-probe) to form the circle ssDNA by DNA ligation. The C-probe contains six parts as shown in Fig. 1A. The sequences of circularizable probe (C-probe), linker, biotin-primer and cy3 reporter were shown in Table 1 and they are synthesized by Invitrogen Company (Shanghai, China). Experimental procedures of fabricating the complex microarray can be described as follows (Fig. 1B and C). Firstly, equal aliquot of the C-probe and the linker were denatured at 94 8C for 1 min and annealed at room temperature. The flanking sequence of the C-probe paired with the linker and repaired by the T4 ligase at 16 8C for 16 h, an integral circle ssDNA formed, as shown in Fig. 1B. Then the circle annealed with the biotin-primer and the complexity was dissolved in sodium carbonate buffer (0.1 mol/L, pH 9.0) at the concentration of 80 mmol/L and spotted on the streptavidin coated glass slides using an arrayer of Cartesian Technologies. The immobilized probe contains a duplex region in which the EcoRI recognition site (50 . . .GAATTC. . .30 ) arranged closely to the protein p50 consensus binding site (50 . . .GGGACTTTCC. . .30 ), as shown in Fig. 1C. The detection principle can be schematically shown in Fig. 2. We hybridized the target protein prior to EcoRI enzyme during the measurement process. Because of the space obstruction, the EcoRI endonuclease would not digest the duplex region if the target protein attached to the protein binding site. After EcoRI digestion all the proteins are eluted from the microarray. There were two kinds of DNA probes left on the microarray: one contained the intact duplex region and the other was digested by the endonuclease due to no target protein protection. Then the F29 polymerase amplification mixture was added to the microarray. The RCA reaction was carried out at 30 8C for 45 min. After washing the slide, the Cy3 reporter probe was hybridized to the slide at 42.7 8C for 2 h. All the slides were scanned by using ScanMicroarray1 Lite (Packard Biochip Technologies) in the Cy3 channel at 85% laser power, 80% PMT gain, 5 mm resolution. To test the feasibility, we first hybridized the microarray merely with C-probe but not with p50, there was no signal detected in the final scan. It can be inferred that the naked probes were degraded by EcoRI. Then we supplied four different concentrations 1 pg/mL, 2 pg/mL, 5 pg/mL and 10 pg/mL of p50 homodimer to the slides, the final signals increased with the amount of p50. The images and fluorescence intensity variations were shown in Fig. 3. As shown in
M.L. Li et al. / Chinese Chemical Letters 20 (2009) 1315–1318
1317
Fig. 2. Schematic representation of the endonuclease-RCA-based assay. (A) (1) DNA-binding protein (DBP) binds to the DNA-binding site (DBS). (2) EcoRI cannot bind to the endonuclease recognition site (ERS) because of the space obstruction. (3) The intact DNA complexes were left on the microarray when DBP were eluted. (4) RCA and cy3 reporter detection, there was high fluorescence signal. (B) (1) No DNA-binding protein (DBP) binds to the DNA-binding site (DBS). (2) EcoRI can bind to the endonuclease recognition site (ERS). (3) The digested DNA complexes were left on the microarray when EcoRI was eluted. (4) RCA and cy3 reporter detection, there was no fluorescence signal.
Fig. 3. The image and fluorescence intensity of the microarrays varied with the p50 homodimer concentrations. (A) The negative control (without p50); (B–E) the signal images of RCA product reported with Cy3 reporter probe after treatment of p50 homodimer with the concentrations of 1 pg/mL, 2 pg/mL, 5 pg/mL and 10 pg/mL, respectively. (F) The fluorescence intensity increases with p50 homodimer concentrations.
Fig. 3F, the fluorescence intensity increases along with p50 homodimer concentration. When the protein concentration was low to 1 pg/mL, we still had relatively strong fluorescence intensity (1000 37.6) which was corresponding to protein concentration of 2.4 ng/mL in previous study [8]. Obviously, the signals obtained with endonuclease-RCAbased method are much more sensitive than endonuclease-based method in detecting the sequence specific DNAbinding protein. The sensitivity of the improved method increased over three orders of magnitude compared to the previous method. It is suggested that the method based on endonuclease-rolling circle amplification is a feasible sensitive way to detect the DNA-binding protein and can efficiently amplify the signal of DNA-binding proteins. This approach can avoid the use of antibodies. Moreover, when we spot different probes on the slide, different DNA-binding proteins could be detected simultaneously in the cell lysate.
1318
M.L. Li et al. / Chinese Chemical Letters 20 (2009) 1315–1318
Acknowledgments This research is supported by the National Natural Science Foundation of China (Nos. 60501010, 60701008 and 60771024). References [1] [2] [3] [4] [5] [6] [7] [8]
S. Mukherjee, M.F. Berger, M. Snyder, et al. Nat. Genet. 36 (2004) 1331. T. Heyduk, E. Heyduk, Nat. Biotechnol. 20 (2002) 171. J.K. Wang, T.X. Li, Z.H. Lu, Nucleic Acids Res. 33 (2005) e23. Z.Z. Chen, M.J. Ji, P. Hou, Z.H. Lu, Biochem. Biophys. Res. Commun. 345 (2006) 1254. J. Jarvius, J. Melin, M. Nilsson, Nat. Methods 3 (2006) 725. B. Schweitzer, S. Wiltshire, J. Lambert, Proc. Natl. Acad. Sci. U.S.A. 97 (2000) 10113. B. Schweitzer, S. Roberts, B. Grimwade, Nat. Biotechnol. 20 (2002) 359. Y.F. Bai, Q.Y. Ge, Z.H. Lu, Chin. Chem. Lett. 16 (2006) 651.