- Email: [email protected]
Endoplasmic Reticulum Stress in Brain Damage☆
C H A P T E R
F I F T E E N
Endoplasmic Reticulum Stress in Brain Damage☆ Ram Raghubir,* Venkata Prasuja Nakka,† and Suresh L. Mehta‡ Contents 1. Introduction 2. ER Stress and Unfolded Protein Response 2.1. The PERK pathway 2.2. The IRE1 pathway 2.3. The ATF-6 pathway 2.4. The CHOP pathway 2.5. The JNK pathway 2.6. The caspase pathway 3. Cross Talk Between ER and Mitochondria 4. Experimental Approaches for the Detection of ER Stress 4.1. Detection of IRE1 activation and splicing of XBP-1 mRNA 4.2. Detection of ATF-6 translocation from ER to the nucleus with fluorescent microscopy 4.3. mRNA and protein levels of UPR target genes 4.4. Use of transgenic animal models for monitoring ER stress Acknowledgment References
260 261 262 263 264 264 265 266 267 269 269 269 270 271 271 272
Abstract The efficient functioning of the ER is indispensable for most of the cellular activities and survival. Disturbances in the physiological functions of the ER result in the activation of a complex set of signaling pathways from the ER to the cytosol and nucleus, and these are collectively known as unfolded protein response (UPR), which is aimed to compensate damage and can eventually trigger cell death if ER stress is severe or persists for a longer period. ☆
C.D.R.I. Communication No. 8806
* Division of Pharmacology, Central Drug Research Institute, (CSIR), Chatter Manzil Palace, Lucknow, India Department of Neurological Surgery, School of Medicine & Public Health, University of Wisconsin, Madison, Wisconsin, USA { Department of Pharmaceutical Sciences/BRITE, North Carolina Central University, Durham, North Carolina, USA # 2011 Elsevier Inc. Methods in Enzymology, Volume 489 ISSN 0076-6879, DOI: 10.1016/B978-0-12-385116-1.00015-7 All rights reserved. {
259
260
Ram Raghubir et al.
The precise molecular mechanisms that facilitate this switch in brain damage have yet to be understood completely with multiple potential participants involved. The ER stress-associated cell death pathways have been recognized in the numerous pathophysiological conditions, such as diabetes, hypoxia, ischemia/reperfusion injury, and neurodegenerative disorders, including Alzheimer’s disease, Parkinson’s disease, and bipolar disorder. Hence, there is an emerging need to study the basic molecular mechanisms of ER stress-mediating multiple cell survival/death signaling pathways. These molecules that regulate the ER stress response would be potential drug targets in brain diseases.
1. Introduction The endoplasmic reticulum (ER) is a large membranous network found in all eukaryotes and is the cellular site for synthesis, folding, and maturation of most secreted and transmembrane proteins (Kaufman, 1999; Paschen and Doutheil, 1999). Under normal physiological conditions, these proteins are correctly folded, modified, and assembled by numerous chaperons and catalysts in the ER. Additionally, nearly 30% of newly synthesized proteins are rapidly degraded, possibly as a result of improper protein folding (Schubert et al., 2000). The ER lumen has a high redox potential to maintain an oxidizing environment, which, together with the high protein and Ca2þ concentration, provides the ideal milieu for folding and the posttranslational modifications of proteins. However, failure of this machinery to fold newly synthesized or misfolded proteins, which start accumulating in the ER during physiological or pathological situations, generates a unique danger to the cell in the form of ER stress. Thus, even an acute rise in the translation of secretory proteins would impose a major problem for the cell due to a potential build up of misfolded proteins. The situation becomes even more serious when ER environment is disturbed due to alterations in redox state, calcium levels, or failure to posttranslationally modify secretory proteins. These conditions compromise the overall ability of protein folding capacity of ER and result in aggregation of misfolded and/or unfolded proteins (Lai et al., 2007). To cope with this condition, cells initiate an adaptive response in the form of group of signal transduction pathways, collectively termed as unfolded protein response (UPR). The UPR initially tries to reestablish the normal ER function and prevent cellular damage but can eventually trigger cell death if the stress is severe and prolonged during the course of pathological states such as cerebral ischemia, hypoxia, and hypoglycemia/hyperglycemia. Furthermore, cytoplasmic or nuclear accumulation of insoluble or misfolded protein aggregates in the affected brain regions in various neurodegenerative disorders can cause neuronal death; otherwise, failure of UPR may implicate the onset of neurodegenerative disorders (Kaufman, 2002).
ER Stress in Brain Damage
261
Therefore, activation of UPR is necessary to restore the normal functional architecture of the cell. The adaptive UPR mechanisms once activated, may initiate transcriptional induction of genes involved in the protein folding or ER-associated protein degradation to remove misfolded proteins. The translational machinery in such situations only translates some selected mRNA during this period to reduce accumulation of new proteins into the ER, until mRNAs encoding UPR proteins are produced. However, upon failure of this process, ER stress triggers cell suicidal mechanisms usually in the form of apoptosis. Further investigations involving modulation of ER stress signaling might allow the development of therapeutic strategies for some human diseases that are caused by ER dysfunction (Salminen et al., 2009; Sokka et al., 2007).
2. ER Stress and Unfolded Protein Response The accumulated deposition of misfolded proteins leading to ER stress affects various cell signaling systems as well as neuronal connectivity and cell death during various neurodegenerative diseases (Bence et al., 2001; Soto, 2003). In addition, the threshold for complete suppression of protein synthesis during cerebral stroke indicates the association of a more comprehensive cellular response involved in deciding the fate of affected neurons and suggests that the size of an infarct after focal ischemia is not only determined by the breakdown of energy metabolism but also by the suppression of protein synthesis (Xie et al., 1989). Therefore, under such circumstances, UPR in the cells including neurons integrate signaling network in adaptation to secretory load. It is comprised by three main signaling systems initiated by three prototype ER-localized stress sensors viz: pancreatic ER kinase (PERK), inositol-requiring enzyme 1 (IRE1), and activating transcription factor 6 (ATF-6) which mediate regulation at both the transcriptional and translational levels upon ER stress (Harding and Ron, 2002; Kaufman, 1999; Mori et al., 2000). Under the normal physiological state, all the three effectors bind to the ER chaperone glucoseregulated protein (GRP78) on their luminal domains; thus, GRP78 acts to suppress their activity (Bertolotti et al., 2000; Shen et al., 2002). Further, under conditions of ER stress, when misfolded proteins accumulate in the ER lumen, GRP78 dissociates from the PERK, ATF-6, and IRE1, allowing their activation (Fig. 15.1). However, the downregulation of UPR can increase the vulnerability to ER stress as in the case of Alzheimer’s disease (familial and sporadic), where disease-linked presenilin-1 (PS1) mutation and aberrant splicing isoform (PS2V), generated by exon 5 skipping of the presenilin-2 (PS2) gene transcript affect the ER stress response by inhibiting activation of ER stress transducers such as IRE1, PERK, and ATF-6 (Katayama et al., 2004).
262
Ram Raghubir et al.
Grp78 PERK
IRE1 ATF-6
ER
P
P
P
P
P
P
P
P
CYTOSOL
Cleaved ATF-6
P Processed xbp1
eIF2
Translational block
ATF-4
Processed xbp1
NUCLEUS
ATF-4 Genes for amino acid synthesis Stress response Redox reactions CHOP/GADD153
Gene Expression for Chaperones Protein degradation P58 IPK
Cleaved ATF-6 Gene expression for Chaperones XBP1 CHOP
Figure 15.1 The proposed mechanism of unfolded protein response. Under conditions of ER stress, when misfolded proteins accumulate in the ER lumen, GRP78 dissociates from the three ER stress receptors, PERK, ATF-6, and IRE1, allowing their sequential activation. The disassociated GRP78 binds to the unfolded proteins to assist in refolding. Activated PERK blocks general protein synthesis by phosphorylating eIF2a but also leads to increased paradoxical translation of activating transcription factor 4 (ATF-4), which further induces transcription of genes required to restore ER homeostasis and proapoptotic CHOP/GADD153. ATF-6 is activated by limited proteolysis after its translocation to the Golgi apparatus. Active ATF-6 regulates the expression of ER chaperones and X box-binding protein 1 (XBP-1). Activated IRE1a (an ubiquitous isoform) cleaves XBP-1 mRNA that leads to enhanced translation of spliced XBP-1 protein, a transcription factor for ER-resident enzymes and chaperones, the cochaperone and PERK-inhibitor P58IPK, as well as genes involved in protein degradation.
2.1. The PERK pathway The primary response to ER stress in mammalian cells is a transient global translation attenuation. Dissociation of GRP78 from PERK initiates the dimerization and autophosphorylation of the kinase and generates active
ER Stress in Brain Damage
263
PERK. Once activated, PERK phosphorylates serine-51 residue of eukaryotic translation initiation factor 2 subunit a (eIF2 a), which leads to inhibition of global protein synthesis (Prostko et al., 1993; Ron, 2002). However, activated PERK phosphorylates eIF2a to avoid further accumulation of proteins by suppressing protein synthesis and also leads to the paradoxical increased translation of transcription factors ATF-4 and C/EBP homologous protein/growth arrest and DNA damage-inducible gene 153 (CHOP/ GADD153; DeGracia and Montie, 2004). ATF-4 promotes cell survival by inducing ER stress target genes involved in amino acid metabolism, redox reactions, stress response, and protein secretion (Harding et al., 2003). Translational recovery is mediated by the stress-induced phosphatase growth arrest and DNA damage-inducible gene 34 (GADD34), which is upregulated by ATF-4 and dephosphorylates eIF2a. Attenuation of translational recovery by pharmacologically inhibiting eIF2a dephosphorylation protects some cells from ER stress-induced apoptosis. Indeed, selective inhibition of eIF2a dephosphorylation by a small molecule inhibitor, salubrinal (Sal), protects cells from ER stress in a dose-dependent manner (Boyce et al., 2005). The available evidence suggests that Sal inhibits the formation of the eIF2a/GADD34/protein phosphatase 1 (PP1) complex, sustaining the phosphorylation of eIF2a, thereby suppressing protein translation for a longer period during the ER stress (Boyce et al., 2005). The efficacy of Sal against brain damage has been assessed in vivo, which proved to be neuroprotective (Nakka et al., 2010; Sokka et al., 2007). Therefore, modulation of the phosphorylated state of eIF2a can be used as a strategy to protect cells from cerebral damage.
2.2. The IRE1 pathway IRE1 is a dual-activity enzyme, having a serine–threonine kinase domain and an endoribonuclease domain. On activation, the endonuclease activity of IRE1 specifically cuts out a 26-nucleotide intron from the XBP-1 mRNA, which leads to a shift of the open reading frame of XBP-1 mRNA (Calfon et al., 2002). Processed XBP-1 mRNA is translated into a new protein of 54 kDa that functions as a transcription factor and has diverse targets specific for ER stress genes, including grp78, grp94, and HSP40 family member P58IPK (Lee et al., 2003). P58IPK binds and inhibits PERK, thereby providing a negative feedback loop that relieves the PERKmediated translational block (Yan et al., 2002). The adequate newly synthesized GRP78 protein shut down the UPR and restore ER function by inactivating PERK and IRE1, thereby refolding the accumulated unfolded proteins in the ER lumen. Although the IRE1– XBP-1 pathway seems to be prosurvival through the induction of ER chaperones and P58IPK, overexpression of IRE1 in HEK293T cells resulted in apoptotic cell death (Wang et al, 1998). How IRE1 could initiate cell death is currently one of the most interesting and unresolved questions in
264
Ram Raghubir et al.
this field? The answer might lie with the activation of kinase pathways, most notably, the c-Jun N-terminal kinase (JNK) pathway, BCL-2, and caspases. Therefore, understanding the switch between prosurvival and proapoptotic IRE1 signaling can be a useful strategy to protect cells from the degenerative brain injuries.
2.3. The ATF-6 pathway After dissociation, GRP78 facilitates ATF-6 translocation to the Golgi apparatus, where it is cleaved by site-1 and site-2 proteases to yield an active N-terminal 50-kDa domain (N-ATF-6/p50ATF-6) that translocates to the nucleus (Hong et al., 2004; Nadanaka et al., 2006). In the nucleus, it induces genes with an ER stress response element (ERSE) in their promoter (Schroder and Kaufman, 2005). So far, the recognized targets of ATF-6 include ER chaperone proteins such as GRP78, GRP94, protein disulfide isomerase, and the transcription factors CHOP and XBP-1. Although ATF-6 can induce CHOP mRNA expression, but there is no available evidence to link ATF-6 to ER stress-induced apoptosis; therefore, it seems that ATF-6-mediated signals seems to be purely prosurvival and counteract ER stress (Szegezdi et al., 2006). However, the role of ATF-6 pathway in cerebral ischemia is unclear and therefore requires extensive investigation. Signaling through PERK, IRE1, and ATF-6 can also trigger apoptosis, when the cellular protective mechanisms mediated by the UPR fail to restore folding capacity. However, they do not directly cause cell death but rather initiate the activation of downstream molecules such as CHOP, JNK, and caspases, which further execute the cell death machinery. In addition, Bcl-2 family of proteins also plays an important role in the regulation of apoptosis. However, the ER-mediated apoptotic machinery involving key regulatory molecules is less defined in cerebral ischemia, which may be delineated in future.
2.4. The CHOP pathway CHOP, also known as GADD153, is induced by ER stress more than growth arrest or DNA damage (Wang et al., 1996). CHOP is 29 kDa protein with 169 (human) or 168 (rodent) amino-acid residues. The role of CHOP in ER stress-induced apoptosis has been demonstrated in CHOP/ mice. Indeed, mouse embryonic fibroblasts lacking CHOP are partially resistant to ER stress and exhibits reduced ER stress-induced apoptosis (Oyadomari et al., 2002; Zinszner et al., 1998). Conversely, overexpression of CHOP promotes apoptosis in response to ER stress caused by thapsigargin and tunicamycin (McCullough et al., 2001). The UPR activation also leads to transcription and translation of CHOP, and both ATF-4 and XBP-1/ATF-6 can contribute to CHOP transcription (Ma et al., 2002). Induction of CHOP mRNA
ER Stress in Brain Damage
265
serves as a hallmark of ER stress and a marker of UPR activation, and its expression is usually associated with apoptosis (McCullough et al., 2001; Zinszner et al., 1998). Recent studies on cerebral ischemia have documented the involvement of CHOP in apoptosis. For instance, increased expression of CHOP mRNA was observed in the rat hippocampus subjected to transient cerebral ischemia (Paschen et al., 1998). Furthermore, mice lacking CHOP have smaller infarcts than wild-type animals subjected to bilateral common carotid arteries occlusion (Tajiri et al., 2004). Since acute neuronal cell death in the ischemic core region is mostly due to necrosis, ER stressmediated apoptosis in vulnerable neurons contributes to delayed cell death or to neurodegeneration in the penumbra of focal ischemia. Further studies which are aimed to elucidate the mechanism of CHOPinduced apoptosis, identified many target genes, including Bcl-2, GADD34, endoplasmic reticulum oxidoreductin 1 (ERO1a), and tribbles-related protein 3 (TRB3; Szegezdi et al., 2006). Although CHOP mainly induces gene expression, it downregulates the expression of Bcl2 and increases cellular ROS, which contributes to ER-associated cell death (Harding et al., 2003; McCullough et al., 2001). Further studies on ER stress-mediated apoptosis involving CHOP are expected to provide new insights into the pathogenesis of cerebral ischemia and other neurodegenerative diseases, which may prove CHOP as an important target for therapeutic intervention to prevent secondary progression of brain injuries.
2.5. The JNK pathway The activation of JNK in response to ER stress has been found to be IRE1a- and TRAF2-dependent (Urano et al., 2000). During ER stress, IRE1a recruits the adaptor protein TRAF2 to the ER membrane. This recruitment is regulated by c-Jun NH2-terminal inhibitory kinase ( JIK), which has been reported to interact with both IRE1a and TRAF2 (Urano et al., 2000; Yoneda et al., 2001). The complex of IRE1a/TRAF2 then recruits apoptosis signal regulating kinase 1 (ASK1) thereby leading to the activation of ASK1 and the downstream JNK pathway (Nishitoh et al., 1998, 2002). Overexpression of JIK promotes interaction between IRE1a and TRAF2 and JNK activation in response to tunicamycin, whereas overexpression of an inactive JIK mutant inhibits JNK activation (Yoneda et al., 2001). The importance of ASK1 in mediating ER stress-induced apoptosis has been demonstrated in ASK/ primary neurons and MEFs, which are resistant to ER stress inducers and are defective in JNK activation and apoptosis (Nishitoh et al., 2002). However, the downstream mechanism by which ASK1 and JNK lead to apoptosis is not completely understood but may involve the regulation of Bcl-2 family of proteins.
266
Ram Raghubir et al.
Activation of JNK is a common response to many forms of stress and is known to influence the cell-death machinery through the regulation of Bcl-2 family proteins (Davis, 2000). It is known that phosphorylation of Bcl-2 by JNK, which occurs primarily at the ER, suppresses the antiapoptotic activity of Bcl-2. Besides Bcl-2, JNK also phosphorylates BH3 (Bcl-2 homology domain 3)-only members of the Bcl-2 family such as Bim, which enhances their proapoptotic potential (Szegezdi et al., 2006). Systemic administration of SP600125, a small molecule JNK-specific inhibitor, results in diminished JNK activity and reduced infarct volume after ischemia in a dose-dependent manner. Moreover, inhibition of JNK prevents mitochondrial translocation of Bax and Bim, release of cytochrome c and Smac, and activation of caspase-9 and caspase-3 (Gao et al., 2005), whereas activation of JNK causes serine phosphorylation of 14-3-3, thus leading to disassociation of Bax from 14-3-3 and subsequent translocation to mitochondria (Gao et al., 2005). Thus, there is a growing evidence to substantiate the role of JNK as a critical cell death mediator involving one of the mechanisms as above in the degenerative brain injuries.
2.6. The caspase pathway ER stress-induced apoptosis is initiated by caspase-12 (Van de Craen et al., 1997), which is mainly located on the cytoplasmic side of the ER and regarded as a representative lead molecule implicated in cell death-executing mechanisms related to ER stress (Nakagawa et al., 2000). Caspase-12 is activated by ER stress stimuli, such as tunicamycin, brefeldin A, and thapsigargin, but not by death receptor or mitochondria-mediated apoptotic signals (Nakagawa and Yuan, 2000; Nakagawa et al., 2000). A preliminary report on caspase-12/ mice and MEFs showed resistance to ER stress-mediated apoptosis, suggesting involvement of the caspase-12 (Nakagawa et al., 2000). So far, several possible mechanisms have been proposed for the activation of caspase-12. It has been suggested that calpains, a family of Ca2þ-dependent cystein proteases, have been shown to play a key role to generate an active caspase-12 (Nakagawa and Yuan, 2000). Another study also reported that caspase-7 in response to ER stress translocates from the cytosol to the ER membrane to interact with caspase12, leading to its activation, as the dominant negative catalytic mutant of caspase-7 inhibited caspase-12 activation and cell death (Rao et al., 2001). In addition to the role of calpains and caspase-7 in the activation of caspase-12, TRAF2 also has been shown to play a role in the activation of caspase-12 and to transduce signals to the nucleus via IRE1a (Yoneda et al., 2001). In unstressed conditions, TRAF2 recruits procaspase-12 to promote the clustering of procaspase-12 at the ER membrane (Yoneda et al., 2001). The interaction between TRAF2 and procaspase-12 is inhibited during ER
ER Stress in Brain Damage
267
stress or by overexpression of IRE1. Therefore, it has been proposed that during ER stress, procaspase-12 is released from TRAF2 complex and gets activated by proximity-induced dimerization. The activated caspase-12 may subsequently be recruited to IRE1a (Yoneda et al., 2001). While the activation of caspase-12 has been documented in rodent models of cerebral ischemia, the question of whether or not a human isoform of caspase-12 exists remains controversial (Szegezdi et al., 2003). However, despite the controversial role of caspase-12 in humans, a recent study demonstrated that ER stress and caspase-12 activation has been implicated in neurodegeneration in Creutzfeldt–Jakobdisease-affected individuals, and the activation of caspase-12 correlates with the higher levels of ER molecular chaperones GRP58, GRP78, and GRP94 expression (Hetz et al., 2003). Moreover, human caspase-4, which plays a key role in ER stress-induced apoptosis, might functionally substitute for mouse caspase-12 in the human system (Hitomi et al., 2004). Although there is no known caspase-12 substrate and even the downstream pathway also remains to be elucidated, several possible models of caspase-12 processing have been suggested, which includes Apaf-1 and cytochrome c independent processing of caspase-9 by caspase-12 (Morishima et al., 2002; Rao et al., 2002). In contrast, recently, it has been suggested that caspase-12 is cleaved downstream of the mitochondria in an Apaf-1-dependent manner and that it cotranslocates with AIF to the nucleus (Sanges and Marigo, 2006; Shiraishi et al., 2006). Nevertheless, extensive in vivo studies are needed essentially to elucidate mechanism(s) responsible for caspase-12 activation and its downstream signaling, and also to understand the basic molecular mechanisms involved in brain injury-induced ER stress. This would further help in establishing possible ER-targeted therapeutic interventions in various neurological disorders.
3. Cross Talk Between ER and Mitochondria The ER is the main intracellular store organelle for Ca2þ, which is an important secondary messenger and is essential for numerous cellular functions. Apoptosis is a consequence of the perturbation of cellular Ca2þ homeostasis such as intracellular Ca2þ overload, ER Ca2þ depletion, and mitochondrial Ca2þ increase. The exposure of cells to apoptotic agents that disturb ER functions reveals a novel cross talk between ER and mitochondria. Furthermore, close physical contacts of ER and mitochondria provide the environment for a local and privileged communication between the two organelles. Pretreatment with tunicamycin, a drug that blocks the ER-resident protein glycosylation, also affects cytochrome c release from the mitochondria,
268
Ram Raghubir et al.
followed by caspase-3 activation and DNA fragmentation. Moreover, both cytochrome c released from the mitochondria and caspase-3 activation blockade occurs, when cells are transfected with Bcl-2 specifically targeted to the ER compartment (Putney and Ribeiro, 2000). Recently, it has been demonstrated that a caspase cleavage product B-cell-associated protein 31 (BAP31), an integral membrane protein of ER, induces mitochondrial fission through ER Ca2þ signals, enhancing cytochrome c release to the cytosol (Rutter and Rizzuto, 2000). BAP31 contains three predicted transmembrane domains, followed by a leucine zipper and a death effector domain-like (DED-L) region that associates with certain isoforms of procaspase-8 in the cytosol. The caspases cleave the cytosolic tail of BAP31 that exhibits apoptotic features, whereas overexpression of full-length BAP31 blocks the Fas-mediated apoptosis. In addition, BAP31 also binds to Bcl-2 and Bcl-xL (Xu et al., 2005). Although the role of BAP31 in cerebral ischemia remains unexplored, these observations suggest that apoptotic cross talk between the ER and the mitochondria might be associated with the pathological states of the brain. The temporal profile of ER and mitochondrial dysfunction induced by transient cerebral ischemia suggests that ER dysfunction may be a process upstream of mitochondrial dysfunction. Phosphorylation of PERK and eIF2a during the early reperfusion after transient cerebral ischemia indicates ER dysfunction to be an early pathological process. Moreover, mitochondrial cytochrome c release has not been observed before 2 h of reperfusion, implying that ER dysfunction does precede impairment of mitochondrial function (Hacki et al., 2000). However, a recent study on HeLa cell line has shown that, at early stages of apoptosis, cytochrome c translocates to the ER, where it selectively binds IP3R, resulting in a sustained increase of cytosolic Ca2þ (Boehning et al., 2003). In agreement with the above observation, inositol 1, 4, 5-trisphospate receptor 1 (IP3R1) and ryanodine receptors get activated after global cerebral ischemia by cytochrome c, resulting in Ca2þ efflux from ER (Beresewicz et al., 2006). Thus, it is possible that ER stress triggers a set of reactions leading to leakage of cytochrome c from the mitochondria that further stimulates ER receptors to release more Ca2þ, resulting in a positive feedback loop. It has been reported that ER stress inducers cause coactivation of AIF and caspase12 and their subsequent redistribution to the nucleus (Sanges and Marigo, 2006). Furthermore, reduction in the AIF or caspase-12 expression by RNA interference revealed that AIF primarily controls apoptosis caused by changes in Ca2þ homeostasis but not necessary for protein misfolding apoptosis, whereas caspase-12 seems to regulate both AIF activation and apoptosis (Sanges and Marigo, 2006). Thus, it suggests a novel cross talk between the ER and the mitochondria that might be linked to the pathogenesis of cerebral ischemia.
ER Stress in Brain Damage
269
4. Experimental Approaches for the Detection of ER Stress The proper use of various experimental approaches of UPR targets is of immense value to understand the basic molecular mechanisms of ER stress-mediated brain damage. These approaches have been depicted in a schematic manner (Fig. 15.2).
4.1. Detection of IRE1 activation and splicing of XBP-1 mRNA The UPR adaptive response up regulates the transcription of genes encoding ER-resident chaperones. The XBP1, which is one of the important factors in UPR signaling during ER stress, is processed at mRNA level by IRE1 dependant unconventional splicing. IRE1 is an ER-located type I transmembrane protein with a kinase domain and an RNase domain in the cytoplasmic region. This gets activated when IRE1 is oligomerized, allowing the transautophosphorylation of IRE1 kinase domain. The active IRE1 then removes 26-nucleotide intron from XBP-1 transcript, leading to a shift in the codon reading frame. The spliced XBP-1 mRNA is translated into a functional transcription factor for UPR, which is a more potent and stable transcription factor. The spliced product of XBP-1 mRNA can be detected by semiquantitative RT-PCR using primer such as human XBP-1 forward primer (FP)-TTACGAGAGAAAACTCATGGCC and reverse primer (RP): GGGTCCAAGTTGTCCAGAATGC; rat: FP-CTGAGTCCGCACAG and RP-GGATCTCTAAAACTAGAGGCT, and mouse: FP-GAACCAGGAGTTAAGAACACG and RP-GGCAACAGTGTCAGAGTCC that can detect both the spliced and unspliced isoforms (Nakka et al., 2010; Samali et al., 2010).
4.2. Detection of ATF-6 translocation from ER to the nucleus with fluorescent microscopy ATF-6, which is another ER transmembrane protein, is activated in response to ER stress by sequential proteolysis, resulting in the 50-kDa p50ATF-6 that translocates to the nucleus. During activation, ATF-6 is transported from the ER to Golgi body, where it is processed by site-1 and site-2 proteases. In this process, the cytoplasmic fragment of ATF-6 after releasing from the membrane is translocated to the nucleus to activate its transcriptional targets. Translocation of ATF-6 can be monitored and detected using ATF-6-specific antibodies by confocal microscopy to ascertain the role of UPR and ER stress in brain damage. However in vitro, ATF-6 activation and translocation can be monitored by using cells
270
Ram Raghubir et al.
ER stress and brain (Cerebral stroke, Alzheimer’s etc.) UPR
PERK
IRE1
ATF6
Caspase
WB, IF
Caspase-12
Total p-PERK eIF2α Total WB, IF p-eIF2α ATF4 WB, IF, t-mice CHOP
XBP-1 mRNA, WB, t-mice
WB, IF
Total Total
Cleaved Processed mRNA, WB, t-mice
GRP78 GRP94
mRNA, WB, t-mice
mRNA, WB, t-mice
Figure 15.2 Illustrates various approaches that may be used to detect and evaluate the activation of UPR and UPR-associated ER stress signaling. The use of multiple assays is important to ascertain and verify UPR activation. WB, Western blotting; IF, Immunofluorescence; t-mice, transgenic mice (/).
transfected with FLAG-tagged ATF-6 or GFP–ATF-6 fusion protein. The FLAG-tagged ATF-6 can be detected using anti-FLAG fluoisothiocynatelabeled antibodies; whereas the N-terminal-cleaved ATF-6 can be detected using anti-FLAG antibody.
4.3. mRNA and protein levels of UPR target genes ER stress has been well documented in various brain pathologies, including cerebral stroke, when stress leads to mitochondrial dysfunction, depletion of ER luminal Ca2þ, or inhibition of ER protein glycosylation. The ER stress response in such a condition autoregulates by temporarily slow accumulation of new proteins in the ER lumen and simultaneously upregulates transcription of genes for ER-resident chaperones and enzymes that abate the effects of ER stress. The target ER stress-responsive genes, such as GRP78, GRP79, and calreticulin, with ERSE consensus sequence can be
ER Stress in Brain Damage
271
detected with semiquantitative or real-time RT-PCR (Samali et al., 2010). Similarly, protein levels of UPR target genes can be detected using specific antibodies by Western blotting (WB) and immunohistochemistry. The increased phosphorylation of PERK eIF2a can be detected by WB using phospho-specific antibodies.
4.4. Use of transgenic animal models for monitoring ER stress ER stress caused by accumulation of unfolded proteins in the ER is associated with neurodegenerative diseases such as Parkinson’s disease, Alzheimer’s disease, and bipolar disorder, as well as cerebral stroke. However, in vitro approach sometimes initiates cellular damage mechanism in response to insufficient ER stress. Therefore, studies that involve monitoring the ER stress during pathology and development will precisely help to elucidate the association of ER stress to various other cellular signaling. To facilitate the monitoring and analysis of ER stress in vivo, two different transgenic mouse models have been described to exploit various issues regarding ER stress in human diseases and drug development. The first model which was developed by Miura and colleagues is referred as “ER stress-activated indicator” (ERAI; Iwawaki et al., 2004). This was constructed by fusing gene encoding venus variant of green fluorescent protein, as a reporter downstream of a partial sequence of human XBP-1, including the 26-nt ER stress-specific intron. Therefore, ER stress in the cells can be examined by monitoring the fluorescence activity of venus when fusion protein of XBP-1 and venus is produced in the cells (Iwawaki et al., 2004). This is a good model to monitor in vivo the specific effects of ER stress with high sensitivity during development, pathophysiological states, as well as for analysis of drug effects on ER function. However, this model can be only used to detect activation of IRE1 and does not reveal any information about ATF-6 and PERK activation. The second model is known as ERSE-LacZ model (Mao et al., 2006). This was constructed by using a LacZ reporter gene driven by 3 kb of the rat GRP78 promoter. The ERSE-LacZ model helps to determine the expression profile and specificity of ERSE-mediated ER stress in vivo. However, this model system does not reveal any information about the other components of UPR.
ACKNOWLEDGMENT We acknowledge the research support of Central Drug Research Institute (CSIR), Lucknow, 226001, India.
272
Ram Raghubir et al.
REFERENCES Bence, N. F., Sampat, R. M., and Kopito, R. R. (2001). Impairment of the ubiquitin proteasome system by protein aggregation. Science 292, 1552–1555. Beresewicz, M., Kowalczyk, J. E., and Zablocka, B. (2006). Cytochrome c binds to inositol (1, 4, 5) trisphosphate and ryanodine receptors in vivo after transient brain ischemia in gerbils. Neurochem. Int. 48, 568–571. Bertolotti, A., Zhang, Y., Hendershot, L. M., Harding, H. P., and Ron, D. (2000). Dynamic interaction of BiP and ER stress transducers in the unfolded-protein response. Nat. Cell Biol. 2, 326–332. Boehning, D., Patterson, R. L., Sedaghat, L., Glebova, N. O., Kurosaki, T., and Snyder, S. H. (2003). Cytochrome c binds to inositol (1, 4, 5) trisphosphate receptors, amplifying calcium-dependent apoptosis. Nat. Cell Biol. 5, 1051–1061. Boyce, M., Bryant, K. F., Jousse, C., Long, K., Harding, H. P., Scheuner, D., Kaufman, R. J., Ma, D., Coen, D. M., Ron, D., and Yuan, J. (2005). A selective inhibitor of eIF2a dephosphorylation protects cells from ER stress. Science 307, 935–939. Calfon, M., Zeng, H., Urano, F., Till, J. H., Hubbart, S. R., Harding, H. P., Clark, S. G., and Ron, D. (2002). IRE1 couples endoplasmic reticulum load to secretory capacity by processing XBP-1 mRNA. Nature 415, 92–96. Davis, R. J. (2000). Signal transduction by the JNK group of MAP kinases. Cell 103, 239–252. DeGracia, D. J., and Montie, H. L. (2004). Cerebral ischemia and the unfolded protein response. J. Neurochem. 91, 1–8. Gao, Y., Signore, A. P., Yin, W., Cao, G., Yin, X., Sun, F., Luo, Y., Graham, S. H., and Chen, J. (2005). Neuroprotection against focal ischemic brain injury by inhibition of c-Jun N-terminal kinase and attenuation of the mitochondrial apoptosis-signaling pathway. J. Cereb. Blood Flow Metab. 25, 694–712. Hacki, J., Egger, L., Monney, L., Conus, S., Rosse, T., Fellay, I., and Borner, C. (2000). Apoptotic crosstalk between the endoplasmic reticulum and mitochondria controlled by Bcl-2. Oncogene 19, 2286–2295. Harding, H. P., and Ron, D. (2002). Endoplasmic reticulum stress and the development of diabetes: A review. Diabetes 51, S455–S461. Harding, H. P., Zhang, Y., Zeng, H., Novoa, I., Lu, P. D., Calfon, M., Sadri, N., Yun, C., Popko, B., Paules, R., Stojdl, D. F., Bell, J. C., et al. (2003). An integrated stress response regulates amino acid metabolism and resistance to oxidative stress. Mol. Cell 11, 619–633. Hetz, C., Russelakis-Carneiro, M., Maundrell, K., Castilla, J., and Soto, C. (2003). Caspase12 and endoplasmic reticulum stress mediate neurotoxicity of pathological prion protein. EMBO J. 22, 5435–5445. Hitomi, J., Katayama, T., Eguchi, Y., Kudo, T., Taniguchi, M., Koyama, Y., Manabe, T., Yamagishi, S., Bando, Y., Imaizumi, K., Tsujimoto, Y., and Tohyama, M. (2004). Involvement of caspase-4 in endoplasmic reticulum stress-induced apoptosis and Ab-induced cell death. J. Cell Biol. 165, 347–356. Hong, M., Luo, S., Baumeister, P., Huang, J. M., Gogia, R. K., Li, M., and Lee, A. S. (2004). Underglycosylation of ATF6 as a novel sensing mechanism for activation of the unfolded protein response. J. Biol. Chem. 279, 11354–11363. Iwawaki, T., Akai, R., Kohno, K., and Miura, M. (2004). A transgenic mouse model for monitoring endoplasmic reticulum stress. Nat. Med. 10, 98–102. Katayama, T., Imaizumi, K., Manabe, T., Hitomi, J., Kudo, T., and Tohyama, M. (2004). Induction of neuronal death by ER stress in Alzheimer’s disease. J. Chem. Neuroanat. 28, 67–78. Kaufman, R. J. (1999). Stress signaling from the lumen of the endoplasmic reticulum: Coordination of gene transcriptional and translational controls. Genes Dev. 13, 1211–1233.
ER Stress in Brain Damage
273
Kaufman, R. J. (2002). Orchestrating the unfolded protein response in health and disease. J. Clin. Invest. 110, 1389–1398. Lai, E., Teodoro, T., and Volchuk, A. (2007). Endoplasmic reticulum stress: Signaling the unfolded protein response. Physiology 22, 193–201. Lee, A. H., Iwakoshi, N. N., and Glimcher, L. H. (2003). XBP-1 regulates a subset of endoplasmic reticulum resident chaperone genes in the unfolded protein response. Mol. Cell. Biol. 23, 7448–7459. Ma, Y., Brewer, J. W., Diehl, J. A., and Hendershot, L. M. (2002). Two distinct stress signaling pathways converge upon the CHOP promoter during the mammalian unfolded protein response. J. Mol. Biol. 318, 1351–1365. Mao, C., Tai, W. C., Bai, Y., Poizat, C., and Lee, A. S. (2006). In vivo regulation of Grp78/ BiP transcription in the embryonic heart: Role of the endoplasmic reticulum stress response element and GATA-4. J. Biol. Chem. 28, 18877–18887. McCullough, K. D., Martindale, J. L., Klotz, L. O., Aw, T. Y., and Holbrook, N. J. (2001). Gadd153 sensitizes cells to endoplasmic reticulum stress by down-regulating Bcl2 and perturbing the cellular redox state. Mol. Cell. Biol. 21, 1249–1259. Mori, K., Ogawa, N., Kawahara, T., Yanagi, H., and Yura, T. (2000). mRNA splicingmediated C-terminal replacement of transcription factor Hac1p is required for efficient activation of the unfolded protein response. Proc. Natl. Acad. Sci. USA 97, 4660–4665. Morishima, N., Nakanishi, K., Takenouchi, H., Shibata, T., and Yasuhiko, Y. (2002). An endoplasmic reticulum stress-specific caspase cascade in apoptosis. Cytochrome c-independent activation of caspase-9 by caspase-12. J. Biol. Chem. 277, 34287–34294. Nadanaka, S., Yoshida, H., and Mori, K. (2006). Reduction of disulphide bridges in the lumenal domain of ATF6 in response to glucose starvation. Cell Struct. Funct. 31, 127–134. Nakagawa, T., and Yuan, J. (2000). Cross-talk between two cysteine protease families. Activation of caspase-12 by calpain in apoptosis. J. Cell Biol. 150, 887–894. Nakagawa, T., Zhu, H., Morishima, N., Li, E., Xu, J., Yankner, B. A., and Yuan, J. (2000). Caspase-12 mediates endoplasmic-reticulum specific apoptosis and cytotoxicity by amyloid-beta. Nature 403, 98–103. Nakka, V. P., Gusain, A., and Raghubir, R. (2010). Endoplasmic reticulum stress plays critical role in brain damage after cerebral ischemia/reperfusion in rats. Neurotox. Res. 17, 189–202. Nishitoh, H., Saitoh, M., Mochida, Y., Takeda, K., Nakano, H., Rothe, M., Miyazono, K., and Ichijo, H. (1998). ASK1 is essential for JNK/SAPK activation by TRAF2. Mol. Cell 2, 389–395. Nishitoh, H., Matsuzawa, A., Tobiume, K., Saegusa, K., Takeda, K., Inoue, K., Hori, S., Kakizuka, A., and Ichijo, H. (2002). ASK1 is essential for endoplasmic reticulum stressinduced neuronal cell death triggered by expanded polyglutamine repeats. Genes Dev. 16, 1345–1355. Oyadomari, S., Koizumi, A., Takeda, K., Gotoh, T., Akira, S., Araki, E., and Mori, M. (2002). Targeted disruption of the Chop gene delays endoplasmic reticulum stress mediated diabetes. J. Clin. Invest. 109, 525–532. Paschen, W., and Doutheil, J. (1999). Disturbances of the functioning of endoplasmic reticulum: A key mechanism underlying neuronal cell injury? J. Cereb. Blood Flow Metab. 19, 1–18. Paschen, W., Gissel, C., Linden, T., Althausen, S., and Doutheil, J. (1998). Activation of gadd153 expression through transient cerebral ischemia: Evidence that ischemia causes endoplasmic reticulum dysfunction. Brain Res. Mol. Brain Res. 60, 115–122. Prostko, C. R., Brostrom, M. A., and Brostrom, C. O. (1993). Reversible phosphorylation of eukaryotic initiation factor 2 alpha in response to endoplasmic reticular signaling. Mol. Cell. Biochem. 128, 255–265.
274
Ram Raghubir et al.
Putney, J. W., Jr., and Ribeiro, C. M. (2000). Signaling pathways between the plasma membrane and endoplasmic reticulum calcium stores. Cell. Mol. Life Sci. 57, 1272–1286. Rao, R. V., Hermel, E., Castro-Obregon, S., del Rio, G., Ellerby, L. M., Ellerby, H. M., and Bredesen, D. E. (2001). Coupling endoplasmic reticulum stress to the cell death program: Mechanism of caspase activation. J. Biol. Chem. 276, 33869–33874. Rao, R. V., Castro-Obregon, S., Frankowski, H., Schuler, M., Stoka, V., del Rio, G., Bredesen, D. E., and Ellerby, H. M. (2002). Coupling endoplasmic reticulum stress to the cell death program. An Apaf-1-independent intrinsic pathway. J. Biol. Chem. 277, 21836–21842. Ron, D. (2002). Translational control in the endoplasmic reticulum stress response. J. Clin. Invest. 110, 1383–1388. Rutter, G. A., and Rizzuto, R. (2000). Regulation of mitochondrial metabolism by ER Ca2þ release: An intimate connection. Trends Biochem. Sci. 25, 215–221. Salminen, A., Kauppinen, A., Suuronen, T., Kaarniranta, K., and Ojala, J. (2009). ER stress in Alzheimer’s disease: A novel neuronal trigger for inflammation and Alzheimer’s pathology. J. Neuroinflammation 26, 41–53. Samali, A., Fitzgerald, U., Deegan, S., and Gupta, S. (2010). Methods for monitoring endoplasmic reticulum stress and the unfolded protein response. Int. J. Cell Biol. 2010, 830307. Sanges, D., and Marigo, V. (2006). Cross-talk between two apoptotic pathways activated by endoplasmic reticulum stress: Differential contribution of caspase-12 and AIF. Apoptosis 11, 1629–1641. Schroder, M., and Kaufman, R. J. (2005). The mammalian unfolded protein response. Annu. Rev. Biochem. 74, 739–789. Schubert, U., Anton, L. C., Gibbs, J., Norbury, C. C., Yewdell, J. W., and Bennink, J. R. (2000). Rapid degradation of a large fraction of newly synthesized proteins by proteasomes. Nature 404, 770–774. Shen, J., Chen, X., Hendershot, L., and Prywes, R. (2002). ER stress regulation of ATF6 localization by dissociation of BiP/GRP78 binding and unmasking of Golgi localization signals. Dev. Cell 3, 99–111. Shiraishi, H., Okamoto, H., Yoshimura, A., and Yoshida, H. (2006). ER stress-induced apoptosis and caspase-12 activation occurs downstream of mitochondrial apoptosis involving Apaf-1. J. Cell Sci. 119, 3958–3966. Sokka, A. L., Putkonen, N., Mudo, G., Pryazhnikov, E., Reijonen, S., Khiroug, L., Belluardo, N., Lindholm, D., and Korhonen, L. (2007). Endoplasmic reticulum stress inhibition protects against excitotoxic neuronal injury in the rat brain. J. Neurosci. 27, 901–908. Soto, C. (2003). Unfolding the role of protein misfolding in neurodegenerative diseases. Nat. Rev. Neurosci. 4, 49–60. Szegezdi, E., Fitzgerald, U., and Samali, A. (2003). Caspase-12 and ER stress-mediated apoptosis: The story so far. Ann. NY Acad. Sci. 1010, 186–194. Szegezdi, E., Logue, S. E., Gorman, A. M., and Samali, A. (2006). Mediators of endoplasmic reticulum stress-induced apoptosis. EMBO Rep. 7, 880–885. Tajiri, S., Oyadomari, S., Yano, S., Morioka, M., Gotoh, T., Hamada, J. I., Ushio, Y., and Mori, M. (2004). Ischemia-induced neuronal cell death is mediated by the endoplasmic reticulum stress pathway involving CHOP. Cell Death Differ. 11, 403–415. Urano, F., Wang, X., Bertolotti, A., Zhang, Y., Chung, P., Harding, H. P., and Ron, D. (2000). Coupling of stress in the ER to activation of JNK protein kinases by transmembrane protein kinase IRE1. Science 287, 664–666. Van de Craen, M., Vandenabeele, P., Declercq, W., Van den Brande, I., Van Loo, G., Molemans, F., Schotte, P., Van Criekinge, W., Beyaert, R., and Fiers, W. (1997). Characterization of seven murine caspase family members. FEBS Lett. 403, 61–69.
ER Stress in Brain Damage
275
Wang, X. Z., Lawson, B., Brewer, J. W., Zinszner, H., Sanjay, A., Mi, L. J., Boorstein, R., Kreibich, G., Hendershot, L. M., and Ron, D. (1996). Signals from the stressed endoplasmic reticulum induce C/EBP-homologous protein (CHOP/GADD153). Mol. Cell. Biol. 16, 4273–4280. Wang, X. Z., Harding, H. P., Zhang, Y., Jolicoeur, E. M., Kuroda, M., and Ron, D. (1998). Cloning of mammalian Ire1 reveals diversity in the ER stress responses. EMBO J. 17, 5708–5717. Xie, Y., Mies, G., and Hossmann, K. A. (1989). Ischemic threshold of brain protein synthesis after unilateral carotid artery occlusion in gerbils. Stroke 20, 620–626. Xu, C., Bailly-Maitre, B., and Reed, J. C. (2005). Endoplasmic reticulum stress: Cell life and death decisions. J. Clin. Invest. 115, 2656–2664. Yan, W., Frank, C. L., Korth, M. J., Sopher, B. L., Novoa, I., Ron, D., and Katze, M. G. (2002). Control of PERK eIF2a kinase activity by the endoplasmic reticulum stressinduced molecular chaperone P58IPK. Proc. Natl. Acad. Sci. USA 99, 15920–15925. Yoneda, T., Imaizumi, K., Oono, K., Yui, D., Gomi, F., Katayama, T., and Tohyama, M. (2001). Activation of caspase-12, an endoplasmic reticulum (ER) resident caspase, through tumor necrosis factor receptor-associated factor 2-dependent mechanism in response to the ER stress. J. Biol. Chem. 276, 13935–13940. Zinszner, H., Kuroda, M., Wang, X., Batchvarova, N., Lightfoot, R. T., Remotti, H., Stevens, J. L., and Ron, D. (1998). CHOP is implicated in programmed cell death in response to impaired function of the endoplasmic reticulum. Genes Dev. 12, 982–995.
F I F T E E N
Endoplasmic Reticulum Stress in Brain Damage☆ Ram Raghubir,* Venkata Prasuja Nakka,† and Suresh L. Mehta‡ Contents 1. Introduction 2. ER Stress and Unfolded Protein Response 2.1. The PERK pathway 2.2. The IRE1 pathway 2.3. The ATF-6 pathway 2.4. The CHOP pathway 2.5. The JNK pathway 2.6. The caspase pathway 3. Cross Talk Between ER and Mitochondria 4. Experimental Approaches for the Detection of ER Stress 4.1. Detection of IRE1 activation and splicing of XBP-1 mRNA 4.2. Detection of ATF-6 translocation from ER to the nucleus with fluorescent microscopy 4.3. mRNA and protein levels of UPR target genes 4.4. Use of transgenic animal models for monitoring ER stress Acknowledgment References
260 261 262 263 264 264 265 266 267 269 269 269 270 271 271 272
Abstract The efficient functioning of the ER is indispensable for most of the cellular activities and survival. Disturbances in the physiological functions of the ER result in the activation of a complex set of signaling pathways from the ER to the cytosol and nucleus, and these are collectively known as unfolded protein response (UPR), which is aimed to compensate damage and can eventually trigger cell death if ER stress is severe or persists for a longer period. ☆
C.D.R.I. Communication No. 8806
* Division of Pharmacology, Central Drug Research Institute, (CSIR), Chatter Manzil Palace, Lucknow, India Department of Neurological Surgery, School of Medicine & Public Health, University of Wisconsin, Madison, Wisconsin, USA { Department of Pharmaceutical Sciences/BRITE, North Carolina Central University, Durham, North Carolina, USA # 2011 Elsevier Inc. Methods in Enzymology, Volume 489 ISSN 0076-6879, DOI: 10.1016/B978-0-12-385116-1.00015-7 All rights reserved. {
259
260
Ram Raghubir et al.
The precise molecular mechanisms that facilitate this switch in brain damage have yet to be understood completely with multiple potential participants involved. The ER stress-associated cell death pathways have been recognized in the numerous pathophysiological conditions, such as diabetes, hypoxia, ischemia/reperfusion injury, and neurodegenerative disorders, including Alzheimer’s disease, Parkinson’s disease, and bipolar disorder. Hence, there is an emerging need to study the basic molecular mechanisms of ER stress-mediating multiple cell survival/death signaling pathways. These molecules that regulate the ER stress response would be potential drug targets in brain diseases.
1. Introduction The endoplasmic reticulum (ER) is a large membranous network found in all eukaryotes and is the cellular site for synthesis, folding, and maturation of most secreted and transmembrane proteins (Kaufman, 1999; Paschen and Doutheil, 1999). Under normal physiological conditions, these proteins are correctly folded, modified, and assembled by numerous chaperons and catalysts in the ER. Additionally, nearly 30% of newly synthesized proteins are rapidly degraded, possibly as a result of improper protein folding (Schubert et al., 2000). The ER lumen has a high redox potential to maintain an oxidizing environment, which, together with the high protein and Ca2þ concentration, provides the ideal milieu for folding and the posttranslational modifications of proteins. However, failure of this machinery to fold newly synthesized or misfolded proteins, which start accumulating in the ER during physiological or pathological situations, generates a unique danger to the cell in the form of ER stress. Thus, even an acute rise in the translation of secretory proteins would impose a major problem for the cell due to a potential build up of misfolded proteins. The situation becomes even more serious when ER environment is disturbed due to alterations in redox state, calcium levels, or failure to posttranslationally modify secretory proteins. These conditions compromise the overall ability of protein folding capacity of ER and result in aggregation of misfolded and/or unfolded proteins (Lai et al., 2007). To cope with this condition, cells initiate an adaptive response in the form of group of signal transduction pathways, collectively termed as unfolded protein response (UPR). The UPR initially tries to reestablish the normal ER function and prevent cellular damage but can eventually trigger cell death if the stress is severe and prolonged during the course of pathological states such as cerebral ischemia, hypoxia, and hypoglycemia/hyperglycemia. Furthermore, cytoplasmic or nuclear accumulation of insoluble or misfolded protein aggregates in the affected brain regions in various neurodegenerative disorders can cause neuronal death; otherwise, failure of UPR may implicate the onset of neurodegenerative disorders (Kaufman, 2002).
ER Stress in Brain Damage
261
Therefore, activation of UPR is necessary to restore the normal functional architecture of the cell. The adaptive UPR mechanisms once activated, may initiate transcriptional induction of genes involved in the protein folding or ER-associated protein degradation to remove misfolded proteins. The translational machinery in such situations only translates some selected mRNA during this period to reduce accumulation of new proteins into the ER, until mRNAs encoding UPR proteins are produced. However, upon failure of this process, ER stress triggers cell suicidal mechanisms usually in the form of apoptosis. Further investigations involving modulation of ER stress signaling might allow the development of therapeutic strategies for some human diseases that are caused by ER dysfunction (Salminen et al., 2009; Sokka et al., 2007).
2. ER Stress and Unfolded Protein Response The accumulated deposition of misfolded proteins leading to ER stress affects various cell signaling systems as well as neuronal connectivity and cell death during various neurodegenerative diseases (Bence et al., 2001; Soto, 2003). In addition, the threshold for complete suppression of protein synthesis during cerebral stroke indicates the association of a more comprehensive cellular response involved in deciding the fate of affected neurons and suggests that the size of an infarct after focal ischemia is not only determined by the breakdown of energy metabolism but also by the suppression of protein synthesis (Xie et al., 1989). Therefore, under such circumstances, UPR in the cells including neurons integrate signaling network in adaptation to secretory load. It is comprised by three main signaling systems initiated by three prototype ER-localized stress sensors viz: pancreatic ER kinase (PERK), inositol-requiring enzyme 1 (IRE1), and activating transcription factor 6 (ATF-6) which mediate regulation at both the transcriptional and translational levels upon ER stress (Harding and Ron, 2002; Kaufman, 1999; Mori et al., 2000). Under the normal physiological state, all the three effectors bind to the ER chaperone glucoseregulated protein (GRP78) on their luminal domains; thus, GRP78 acts to suppress their activity (Bertolotti et al., 2000; Shen et al., 2002). Further, under conditions of ER stress, when misfolded proteins accumulate in the ER lumen, GRP78 dissociates from the PERK, ATF-6, and IRE1, allowing their activation (Fig. 15.1). However, the downregulation of UPR can increase the vulnerability to ER stress as in the case of Alzheimer’s disease (familial and sporadic), where disease-linked presenilin-1 (PS1) mutation and aberrant splicing isoform (PS2V), generated by exon 5 skipping of the presenilin-2 (PS2) gene transcript affect the ER stress response by inhibiting activation of ER stress transducers such as IRE1, PERK, and ATF-6 (Katayama et al., 2004).
262
Ram Raghubir et al.
Grp78 PERK
IRE1 ATF-6
ER
P
P
P
P
P
P
P
P
CYTOSOL
Cleaved ATF-6
P Processed xbp1
eIF2
Translational block
ATF-4
Processed xbp1
NUCLEUS
ATF-4 Genes for amino acid synthesis Stress response Redox reactions CHOP/GADD153
Gene Expression for Chaperones Protein degradation P58 IPK
Cleaved ATF-6 Gene expression for Chaperones XBP1 CHOP
Figure 15.1 The proposed mechanism of unfolded protein response. Under conditions of ER stress, when misfolded proteins accumulate in the ER lumen, GRP78 dissociates from the three ER stress receptors, PERK, ATF-6, and IRE1, allowing their sequential activation. The disassociated GRP78 binds to the unfolded proteins to assist in refolding. Activated PERK blocks general protein synthesis by phosphorylating eIF2a but also leads to increased paradoxical translation of activating transcription factor 4 (ATF-4), which further induces transcription of genes required to restore ER homeostasis and proapoptotic CHOP/GADD153. ATF-6 is activated by limited proteolysis after its translocation to the Golgi apparatus. Active ATF-6 regulates the expression of ER chaperones and X box-binding protein 1 (XBP-1). Activated IRE1a (an ubiquitous isoform) cleaves XBP-1 mRNA that leads to enhanced translation of spliced XBP-1 protein, a transcription factor for ER-resident enzymes and chaperones, the cochaperone and PERK-inhibitor P58IPK, as well as genes involved in protein degradation.
2.1. The PERK pathway The primary response to ER stress in mammalian cells is a transient global translation attenuation. Dissociation of GRP78 from PERK initiates the dimerization and autophosphorylation of the kinase and generates active
ER Stress in Brain Damage
263
PERK. Once activated, PERK phosphorylates serine-51 residue of eukaryotic translation initiation factor 2 subunit a (eIF2 a), which leads to inhibition of global protein synthesis (Prostko et al., 1993; Ron, 2002). However, activated PERK phosphorylates eIF2a to avoid further accumulation of proteins by suppressing protein synthesis and also leads to the paradoxical increased translation of transcription factors ATF-4 and C/EBP homologous protein/growth arrest and DNA damage-inducible gene 153 (CHOP/ GADD153; DeGracia and Montie, 2004). ATF-4 promotes cell survival by inducing ER stress target genes involved in amino acid metabolism, redox reactions, stress response, and protein secretion (Harding et al., 2003). Translational recovery is mediated by the stress-induced phosphatase growth arrest and DNA damage-inducible gene 34 (GADD34), which is upregulated by ATF-4 and dephosphorylates eIF2a. Attenuation of translational recovery by pharmacologically inhibiting eIF2a dephosphorylation protects some cells from ER stress-induced apoptosis. Indeed, selective inhibition of eIF2a dephosphorylation by a small molecule inhibitor, salubrinal (Sal), protects cells from ER stress in a dose-dependent manner (Boyce et al., 2005). The available evidence suggests that Sal inhibits the formation of the eIF2a/GADD34/protein phosphatase 1 (PP1) complex, sustaining the phosphorylation of eIF2a, thereby suppressing protein translation for a longer period during the ER stress (Boyce et al., 2005). The efficacy of Sal against brain damage has been assessed in vivo, which proved to be neuroprotective (Nakka et al., 2010; Sokka et al., 2007). Therefore, modulation of the phosphorylated state of eIF2a can be used as a strategy to protect cells from cerebral damage.
2.2. The IRE1 pathway IRE1 is a dual-activity enzyme, having a serine–threonine kinase domain and an endoribonuclease domain. On activation, the endonuclease activity of IRE1 specifically cuts out a 26-nucleotide intron from the XBP-1 mRNA, which leads to a shift of the open reading frame of XBP-1 mRNA (Calfon et al., 2002). Processed XBP-1 mRNA is translated into a new protein of 54 kDa that functions as a transcription factor and has diverse targets specific for ER stress genes, including grp78, grp94, and HSP40 family member P58IPK (Lee et al., 2003). P58IPK binds and inhibits PERK, thereby providing a negative feedback loop that relieves the PERKmediated translational block (Yan et al., 2002). The adequate newly synthesized GRP78 protein shut down the UPR and restore ER function by inactivating PERK and IRE1, thereby refolding the accumulated unfolded proteins in the ER lumen. Although the IRE1– XBP-1 pathway seems to be prosurvival through the induction of ER chaperones and P58IPK, overexpression of IRE1 in HEK293T cells resulted in apoptotic cell death (Wang et al, 1998). How IRE1 could initiate cell death is currently one of the most interesting and unresolved questions in
264
Ram Raghubir et al.
this field? The answer might lie with the activation of kinase pathways, most notably, the c-Jun N-terminal kinase (JNK) pathway, BCL-2, and caspases. Therefore, understanding the switch between prosurvival and proapoptotic IRE1 signaling can be a useful strategy to protect cells from the degenerative brain injuries.
2.3. The ATF-6 pathway After dissociation, GRP78 facilitates ATF-6 translocation to the Golgi apparatus, where it is cleaved by site-1 and site-2 proteases to yield an active N-terminal 50-kDa domain (N-ATF-6/p50ATF-6) that translocates to the nucleus (Hong et al., 2004; Nadanaka et al., 2006). In the nucleus, it induces genes with an ER stress response element (ERSE) in their promoter (Schroder and Kaufman, 2005). So far, the recognized targets of ATF-6 include ER chaperone proteins such as GRP78, GRP94, protein disulfide isomerase, and the transcription factors CHOP and XBP-1. Although ATF-6 can induce CHOP mRNA expression, but there is no available evidence to link ATF-6 to ER stress-induced apoptosis; therefore, it seems that ATF-6-mediated signals seems to be purely prosurvival and counteract ER stress (Szegezdi et al., 2006). However, the role of ATF-6 pathway in cerebral ischemia is unclear and therefore requires extensive investigation. Signaling through PERK, IRE1, and ATF-6 can also trigger apoptosis, when the cellular protective mechanisms mediated by the UPR fail to restore folding capacity. However, they do not directly cause cell death but rather initiate the activation of downstream molecules such as CHOP, JNK, and caspases, which further execute the cell death machinery. In addition, Bcl-2 family of proteins also plays an important role in the regulation of apoptosis. However, the ER-mediated apoptotic machinery involving key regulatory molecules is less defined in cerebral ischemia, which may be delineated in future.
2.4. The CHOP pathway CHOP, also known as GADD153, is induced by ER stress more than growth arrest or DNA damage (Wang et al., 1996). CHOP is 29 kDa protein with 169 (human) or 168 (rodent) amino-acid residues. The role of CHOP in ER stress-induced apoptosis has been demonstrated in CHOP/ mice. Indeed, mouse embryonic fibroblasts lacking CHOP are partially resistant to ER stress and exhibits reduced ER stress-induced apoptosis (Oyadomari et al., 2002; Zinszner et al., 1998). Conversely, overexpression of CHOP promotes apoptosis in response to ER stress caused by thapsigargin and tunicamycin (McCullough et al., 2001). The UPR activation also leads to transcription and translation of CHOP, and both ATF-4 and XBP-1/ATF-6 can contribute to CHOP transcription (Ma et al., 2002). Induction of CHOP mRNA
ER Stress in Brain Damage
265
serves as a hallmark of ER stress and a marker of UPR activation, and its expression is usually associated with apoptosis (McCullough et al., 2001; Zinszner et al., 1998). Recent studies on cerebral ischemia have documented the involvement of CHOP in apoptosis. For instance, increased expression of CHOP mRNA was observed in the rat hippocampus subjected to transient cerebral ischemia (Paschen et al., 1998). Furthermore, mice lacking CHOP have smaller infarcts than wild-type animals subjected to bilateral common carotid arteries occlusion (Tajiri et al., 2004). Since acute neuronal cell death in the ischemic core region is mostly due to necrosis, ER stressmediated apoptosis in vulnerable neurons contributes to delayed cell death or to neurodegeneration in the penumbra of focal ischemia. Further studies which are aimed to elucidate the mechanism of CHOPinduced apoptosis, identified many target genes, including Bcl-2, GADD34, endoplasmic reticulum oxidoreductin 1 (ERO1a), and tribbles-related protein 3 (TRB3; Szegezdi et al., 2006). Although CHOP mainly induces gene expression, it downregulates the expression of Bcl2 and increases cellular ROS, which contributes to ER-associated cell death (Harding et al., 2003; McCullough et al., 2001). Further studies on ER stress-mediated apoptosis involving CHOP are expected to provide new insights into the pathogenesis of cerebral ischemia and other neurodegenerative diseases, which may prove CHOP as an important target for therapeutic intervention to prevent secondary progression of brain injuries.
2.5. The JNK pathway The activation of JNK in response to ER stress has been found to be IRE1a- and TRAF2-dependent (Urano et al., 2000). During ER stress, IRE1a recruits the adaptor protein TRAF2 to the ER membrane. This recruitment is regulated by c-Jun NH2-terminal inhibitory kinase ( JIK), which has been reported to interact with both IRE1a and TRAF2 (Urano et al., 2000; Yoneda et al., 2001). The complex of IRE1a/TRAF2 then recruits apoptosis signal regulating kinase 1 (ASK1) thereby leading to the activation of ASK1 and the downstream JNK pathway (Nishitoh et al., 1998, 2002). Overexpression of JIK promotes interaction between IRE1a and TRAF2 and JNK activation in response to tunicamycin, whereas overexpression of an inactive JIK mutant inhibits JNK activation (Yoneda et al., 2001). The importance of ASK1 in mediating ER stress-induced apoptosis has been demonstrated in ASK/ primary neurons and MEFs, which are resistant to ER stress inducers and are defective in JNK activation and apoptosis (Nishitoh et al., 2002). However, the downstream mechanism by which ASK1 and JNK lead to apoptosis is not completely understood but may involve the regulation of Bcl-2 family of proteins.
266
Ram Raghubir et al.
Activation of JNK is a common response to many forms of stress and is known to influence the cell-death machinery through the regulation of Bcl-2 family proteins (Davis, 2000). It is known that phosphorylation of Bcl-2 by JNK, which occurs primarily at the ER, suppresses the antiapoptotic activity of Bcl-2. Besides Bcl-2, JNK also phosphorylates BH3 (Bcl-2 homology domain 3)-only members of the Bcl-2 family such as Bim, which enhances their proapoptotic potential (Szegezdi et al., 2006). Systemic administration of SP600125, a small molecule JNK-specific inhibitor, results in diminished JNK activity and reduced infarct volume after ischemia in a dose-dependent manner. Moreover, inhibition of JNK prevents mitochondrial translocation of Bax and Bim, release of cytochrome c and Smac, and activation of caspase-9 and caspase-3 (Gao et al., 2005), whereas activation of JNK causes serine phosphorylation of 14-3-3, thus leading to disassociation of Bax from 14-3-3 and subsequent translocation to mitochondria (Gao et al., 2005). Thus, there is a growing evidence to substantiate the role of JNK as a critical cell death mediator involving one of the mechanisms as above in the degenerative brain injuries.
2.6. The caspase pathway ER stress-induced apoptosis is initiated by caspase-12 (Van de Craen et al., 1997), which is mainly located on the cytoplasmic side of the ER and regarded as a representative lead molecule implicated in cell death-executing mechanisms related to ER stress (Nakagawa et al., 2000). Caspase-12 is activated by ER stress stimuli, such as tunicamycin, brefeldin A, and thapsigargin, but not by death receptor or mitochondria-mediated apoptotic signals (Nakagawa and Yuan, 2000; Nakagawa et al., 2000). A preliminary report on caspase-12/ mice and MEFs showed resistance to ER stress-mediated apoptosis, suggesting involvement of the caspase-12 (Nakagawa et al., 2000). So far, several possible mechanisms have been proposed for the activation of caspase-12. It has been suggested that calpains, a family of Ca2þ-dependent cystein proteases, have been shown to play a key role to generate an active caspase-12 (Nakagawa and Yuan, 2000). Another study also reported that caspase-7 in response to ER stress translocates from the cytosol to the ER membrane to interact with caspase12, leading to its activation, as the dominant negative catalytic mutant of caspase-7 inhibited caspase-12 activation and cell death (Rao et al., 2001). In addition to the role of calpains and caspase-7 in the activation of caspase-12, TRAF2 also has been shown to play a role in the activation of caspase-12 and to transduce signals to the nucleus via IRE1a (Yoneda et al., 2001). In unstressed conditions, TRAF2 recruits procaspase-12 to promote the clustering of procaspase-12 at the ER membrane (Yoneda et al., 2001). The interaction between TRAF2 and procaspase-12 is inhibited during ER
ER Stress in Brain Damage
267
stress or by overexpression of IRE1. Therefore, it has been proposed that during ER stress, procaspase-12 is released from TRAF2 complex and gets activated by proximity-induced dimerization. The activated caspase-12 may subsequently be recruited to IRE1a (Yoneda et al., 2001). While the activation of caspase-12 has been documented in rodent models of cerebral ischemia, the question of whether or not a human isoform of caspase-12 exists remains controversial (Szegezdi et al., 2003). However, despite the controversial role of caspase-12 in humans, a recent study demonstrated that ER stress and caspase-12 activation has been implicated in neurodegeneration in Creutzfeldt–Jakobdisease-affected individuals, and the activation of caspase-12 correlates with the higher levels of ER molecular chaperones GRP58, GRP78, and GRP94 expression (Hetz et al., 2003). Moreover, human caspase-4, which plays a key role in ER stress-induced apoptosis, might functionally substitute for mouse caspase-12 in the human system (Hitomi et al., 2004). Although there is no known caspase-12 substrate and even the downstream pathway also remains to be elucidated, several possible models of caspase-12 processing have been suggested, which includes Apaf-1 and cytochrome c independent processing of caspase-9 by caspase-12 (Morishima et al., 2002; Rao et al., 2002). In contrast, recently, it has been suggested that caspase-12 is cleaved downstream of the mitochondria in an Apaf-1-dependent manner and that it cotranslocates with AIF to the nucleus (Sanges and Marigo, 2006; Shiraishi et al., 2006). Nevertheless, extensive in vivo studies are needed essentially to elucidate mechanism(s) responsible for caspase-12 activation and its downstream signaling, and also to understand the basic molecular mechanisms involved in brain injury-induced ER stress. This would further help in establishing possible ER-targeted therapeutic interventions in various neurological disorders.
3. Cross Talk Between ER and Mitochondria The ER is the main intracellular store organelle for Ca2þ, which is an important secondary messenger and is essential for numerous cellular functions. Apoptosis is a consequence of the perturbation of cellular Ca2þ homeostasis such as intracellular Ca2þ overload, ER Ca2þ depletion, and mitochondrial Ca2þ increase. The exposure of cells to apoptotic agents that disturb ER functions reveals a novel cross talk between ER and mitochondria. Furthermore, close physical contacts of ER and mitochondria provide the environment for a local and privileged communication between the two organelles. Pretreatment with tunicamycin, a drug that blocks the ER-resident protein glycosylation, also affects cytochrome c release from the mitochondria,
268
Ram Raghubir et al.
followed by caspase-3 activation and DNA fragmentation. Moreover, both cytochrome c released from the mitochondria and caspase-3 activation blockade occurs, when cells are transfected with Bcl-2 specifically targeted to the ER compartment (Putney and Ribeiro, 2000). Recently, it has been demonstrated that a caspase cleavage product B-cell-associated protein 31 (BAP31), an integral membrane protein of ER, induces mitochondrial fission through ER Ca2þ signals, enhancing cytochrome c release to the cytosol (Rutter and Rizzuto, 2000). BAP31 contains three predicted transmembrane domains, followed by a leucine zipper and a death effector domain-like (DED-L) region that associates with certain isoforms of procaspase-8 in the cytosol. The caspases cleave the cytosolic tail of BAP31 that exhibits apoptotic features, whereas overexpression of full-length BAP31 blocks the Fas-mediated apoptosis. In addition, BAP31 also binds to Bcl-2 and Bcl-xL (Xu et al., 2005). Although the role of BAP31 in cerebral ischemia remains unexplored, these observations suggest that apoptotic cross talk between the ER and the mitochondria might be associated with the pathological states of the brain. The temporal profile of ER and mitochondrial dysfunction induced by transient cerebral ischemia suggests that ER dysfunction may be a process upstream of mitochondrial dysfunction. Phosphorylation of PERK and eIF2a during the early reperfusion after transient cerebral ischemia indicates ER dysfunction to be an early pathological process. Moreover, mitochondrial cytochrome c release has not been observed before 2 h of reperfusion, implying that ER dysfunction does precede impairment of mitochondrial function (Hacki et al., 2000). However, a recent study on HeLa cell line has shown that, at early stages of apoptosis, cytochrome c translocates to the ER, where it selectively binds IP3R, resulting in a sustained increase of cytosolic Ca2þ (Boehning et al., 2003). In agreement with the above observation, inositol 1, 4, 5-trisphospate receptor 1 (IP3R1) and ryanodine receptors get activated after global cerebral ischemia by cytochrome c, resulting in Ca2þ efflux from ER (Beresewicz et al., 2006). Thus, it is possible that ER stress triggers a set of reactions leading to leakage of cytochrome c from the mitochondria that further stimulates ER receptors to release more Ca2þ, resulting in a positive feedback loop. It has been reported that ER stress inducers cause coactivation of AIF and caspase12 and their subsequent redistribution to the nucleus (Sanges and Marigo, 2006). Furthermore, reduction in the AIF or caspase-12 expression by RNA interference revealed that AIF primarily controls apoptosis caused by changes in Ca2þ homeostasis but not necessary for protein misfolding apoptosis, whereas caspase-12 seems to regulate both AIF activation and apoptosis (Sanges and Marigo, 2006). Thus, it suggests a novel cross talk between the ER and the mitochondria that might be linked to the pathogenesis of cerebral ischemia.
ER Stress in Brain Damage
269
4. Experimental Approaches for the Detection of ER Stress The proper use of various experimental approaches of UPR targets is of immense value to understand the basic molecular mechanisms of ER stress-mediated brain damage. These approaches have been depicted in a schematic manner (Fig. 15.2).
4.1. Detection of IRE1 activation and splicing of XBP-1 mRNA The UPR adaptive response up regulates the transcription of genes encoding ER-resident chaperones. The XBP1, which is one of the important factors in UPR signaling during ER stress, is processed at mRNA level by IRE1 dependant unconventional splicing. IRE1 is an ER-located type I transmembrane protein with a kinase domain and an RNase domain in the cytoplasmic region. This gets activated when IRE1 is oligomerized, allowing the transautophosphorylation of IRE1 kinase domain. The active IRE1 then removes 26-nucleotide intron from XBP-1 transcript, leading to a shift in the codon reading frame. The spliced XBP-1 mRNA is translated into a functional transcription factor for UPR, which is a more potent and stable transcription factor. The spliced product of XBP-1 mRNA can be detected by semiquantitative RT-PCR using primer such as human XBP-1 forward primer (FP)-TTACGAGAGAAAACTCATGGCC and reverse primer (RP): GGGTCCAAGTTGTCCAGAATGC; rat: FP-CTGAGTCCGCACAG and RP-GGATCTCTAAAACTAGAGGCT, and mouse: FP-GAACCAGGAGTTAAGAACACG and RP-GGCAACAGTGTCAGAGTCC that can detect both the spliced and unspliced isoforms (Nakka et al., 2010; Samali et al., 2010).
4.2. Detection of ATF-6 translocation from ER to the nucleus with fluorescent microscopy ATF-6, which is another ER transmembrane protein, is activated in response to ER stress by sequential proteolysis, resulting in the 50-kDa p50ATF-6 that translocates to the nucleus. During activation, ATF-6 is transported from the ER to Golgi body, where it is processed by site-1 and site-2 proteases. In this process, the cytoplasmic fragment of ATF-6 after releasing from the membrane is translocated to the nucleus to activate its transcriptional targets. Translocation of ATF-6 can be monitored and detected using ATF-6-specific antibodies by confocal microscopy to ascertain the role of UPR and ER stress in brain damage. However in vitro, ATF-6 activation and translocation can be monitored by using cells
270
Ram Raghubir et al.
ER stress and brain (Cerebral stroke, Alzheimer’s etc.) UPR
PERK
IRE1
ATF6
Caspase
WB, IF
Caspase-12
Total p-PERK eIF2α Total WB, IF p-eIF2α ATF4 WB, IF, t-mice CHOP
XBP-1 mRNA, WB, t-mice
WB, IF
Total Total
Cleaved Processed mRNA, WB, t-mice
GRP78 GRP94
mRNA, WB, t-mice
mRNA, WB, t-mice
Figure 15.2 Illustrates various approaches that may be used to detect and evaluate the activation of UPR and UPR-associated ER stress signaling. The use of multiple assays is important to ascertain and verify UPR activation. WB, Western blotting; IF, Immunofluorescence; t-mice, transgenic mice (/).
transfected with FLAG-tagged ATF-6 or GFP–ATF-6 fusion protein. The FLAG-tagged ATF-6 can be detected using anti-FLAG fluoisothiocynatelabeled antibodies; whereas the N-terminal-cleaved ATF-6 can be detected using anti-FLAG antibody.
4.3. mRNA and protein levels of UPR target genes ER stress has been well documented in various brain pathologies, including cerebral stroke, when stress leads to mitochondrial dysfunction, depletion of ER luminal Ca2þ, or inhibition of ER protein glycosylation. The ER stress response in such a condition autoregulates by temporarily slow accumulation of new proteins in the ER lumen and simultaneously upregulates transcription of genes for ER-resident chaperones and enzymes that abate the effects of ER stress. The target ER stress-responsive genes, such as GRP78, GRP79, and calreticulin, with ERSE consensus sequence can be
ER Stress in Brain Damage
271
detected with semiquantitative or real-time RT-PCR (Samali et al., 2010). Similarly, protein levels of UPR target genes can be detected using specific antibodies by Western blotting (WB) and immunohistochemistry. The increased phosphorylation of PERK eIF2a can be detected by WB using phospho-specific antibodies.
4.4. Use of transgenic animal models for monitoring ER stress ER stress caused by accumulation of unfolded proteins in the ER is associated with neurodegenerative diseases such as Parkinson’s disease, Alzheimer’s disease, and bipolar disorder, as well as cerebral stroke. However, in vitro approach sometimes initiates cellular damage mechanism in response to insufficient ER stress. Therefore, studies that involve monitoring the ER stress during pathology and development will precisely help to elucidate the association of ER stress to various other cellular signaling. To facilitate the monitoring and analysis of ER stress in vivo, two different transgenic mouse models have been described to exploit various issues regarding ER stress in human diseases and drug development. The first model which was developed by Miura and colleagues is referred as “ER stress-activated indicator” (ERAI; Iwawaki et al., 2004). This was constructed by fusing gene encoding venus variant of green fluorescent protein, as a reporter downstream of a partial sequence of human XBP-1, including the 26-nt ER stress-specific intron. Therefore, ER stress in the cells can be examined by monitoring the fluorescence activity of venus when fusion protein of XBP-1 and venus is produced in the cells (Iwawaki et al., 2004). This is a good model to monitor in vivo the specific effects of ER stress with high sensitivity during development, pathophysiological states, as well as for analysis of drug effects on ER function. However, this model can be only used to detect activation of IRE1 and does not reveal any information about ATF-6 and PERK activation. The second model is known as ERSE-LacZ model (Mao et al., 2006). This was constructed by using a LacZ reporter gene driven by 3 kb of the rat GRP78 promoter. The ERSE-LacZ model helps to determine the expression profile and specificity of ERSE-mediated ER stress in vivo. However, this model system does not reveal any information about the other components of UPR.
ACKNOWLEDGMENT We acknowledge the research support of Central Drug Research Institute (CSIR), Lucknow, 226001, India.
272
Ram Raghubir et al.
REFERENCES Bence, N. F., Sampat, R. M., and Kopito, R. R. (2001). Impairment of the ubiquitin proteasome system by protein aggregation. Science 292, 1552–1555. Beresewicz, M., Kowalczyk, J. E., and Zablocka, B. (2006). Cytochrome c binds to inositol (1, 4, 5) trisphosphate and ryanodine receptors in vivo after transient brain ischemia in gerbils. Neurochem. Int. 48, 568–571. Bertolotti, A., Zhang, Y., Hendershot, L. M., Harding, H. P., and Ron, D. (2000). Dynamic interaction of BiP and ER stress transducers in the unfolded-protein response. Nat. Cell Biol. 2, 326–332. Boehning, D., Patterson, R. L., Sedaghat, L., Glebova, N. O., Kurosaki, T., and Snyder, S. H. (2003). Cytochrome c binds to inositol (1, 4, 5) trisphosphate receptors, amplifying calcium-dependent apoptosis. Nat. Cell Biol. 5, 1051–1061. Boyce, M., Bryant, K. F., Jousse, C., Long, K., Harding, H. P., Scheuner, D., Kaufman, R. J., Ma, D., Coen, D. M., Ron, D., and Yuan, J. (2005). A selective inhibitor of eIF2a dephosphorylation protects cells from ER stress. Science 307, 935–939. Calfon, M., Zeng, H., Urano, F., Till, J. H., Hubbart, S. R., Harding, H. P., Clark, S. G., and Ron, D. (2002). IRE1 couples endoplasmic reticulum load to secretory capacity by processing XBP-1 mRNA. Nature 415, 92–96. Davis, R. J. (2000). Signal transduction by the JNK group of MAP kinases. Cell 103, 239–252. DeGracia, D. J., and Montie, H. L. (2004). Cerebral ischemia and the unfolded protein response. J. Neurochem. 91, 1–8. Gao, Y., Signore, A. P., Yin, W., Cao, G., Yin, X., Sun, F., Luo, Y., Graham, S. H., and Chen, J. (2005). Neuroprotection against focal ischemic brain injury by inhibition of c-Jun N-terminal kinase and attenuation of the mitochondrial apoptosis-signaling pathway. J. Cereb. Blood Flow Metab. 25, 694–712. Hacki, J., Egger, L., Monney, L., Conus, S., Rosse, T., Fellay, I., and Borner, C. (2000). Apoptotic crosstalk between the endoplasmic reticulum and mitochondria controlled by Bcl-2. Oncogene 19, 2286–2295. Harding, H. P., and Ron, D. (2002). Endoplasmic reticulum stress and the development of diabetes: A review. Diabetes 51, S455–S461. Harding, H. P., Zhang, Y., Zeng, H., Novoa, I., Lu, P. D., Calfon, M., Sadri, N., Yun, C., Popko, B., Paules, R., Stojdl, D. F., Bell, J. C., et al. (2003). An integrated stress response regulates amino acid metabolism and resistance to oxidative stress. Mol. Cell 11, 619–633. Hetz, C., Russelakis-Carneiro, M., Maundrell, K., Castilla, J., and Soto, C. (2003). Caspase12 and endoplasmic reticulum stress mediate neurotoxicity of pathological prion protein. EMBO J. 22, 5435–5445. Hitomi, J., Katayama, T., Eguchi, Y., Kudo, T., Taniguchi, M., Koyama, Y., Manabe, T., Yamagishi, S., Bando, Y., Imaizumi, K., Tsujimoto, Y., and Tohyama, M. (2004). Involvement of caspase-4 in endoplasmic reticulum stress-induced apoptosis and Ab-induced cell death. J. Cell Biol. 165, 347–356. Hong, M., Luo, S., Baumeister, P., Huang, J. M., Gogia, R. K., Li, M., and Lee, A. S. (2004). Underglycosylation of ATF6 as a novel sensing mechanism for activation of the unfolded protein response. J. Biol. Chem. 279, 11354–11363. Iwawaki, T., Akai, R., Kohno, K., and Miura, M. (2004). A transgenic mouse model for monitoring endoplasmic reticulum stress. Nat. Med. 10, 98–102. Katayama, T., Imaizumi, K., Manabe, T., Hitomi, J., Kudo, T., and Tohyama, M. (2004). Induction of neuronal death by ER stress in Alzheimer’s disease. J. Chem. Neuroanat. 28, 67–78. Kaufman, R. J. (1999). Stress signaling from the lumen of the endoplasmic reticulum: Coordination of gene transcriptional and translational controls. Genes Dev. 13, 1211–1233.
ER Stress in Brain Damage
273
Kaufman, R. J. (2002). Orchestrating the unfolded protein response in health and disease. J. Clin. Invest. 110, 1389–1398. Lai, E., Teodoro, T., and Volchuk, A. (2007). Endoplasmic reticulum stress: Signaling the unfolded protein response. Physiology 22, 193–201. Lee, A. H., Iwakoshi, N. N., and Glimcher, L. H. (2003). XBP-1 regulates a subset of endoplasmic reticulum resident chaperone genes in the unfolded protein response. Mol. Cell. Biol. 23, 7448–7459. Ma, Y., Brewer, J. W., Diehl, J. A., and Hendershot, L. M. (2002). Two distinct stress signaling pathways converge upon the CHOP promoter during the mammalian unfolded protein response. J. Mol. Biol. 318, 1351–1365. Mao, C., Tai, W. C., Bai, Y., Poizat, C., and Lee, A. S. (2006). In vivo regulation of Grp78/ BiP transcription in the embryonic heart: Role of the endoplasmic reticulum stress response element and GATA-4. J. Biol. Chem. 28, 18877–18887. McCullough, K. D., Martindale, J. L., Klotz, L. O., Aw, T. Y., and Holbrook, N. J. (2001). Gadd153 sensitizes cells to endoplasmic reticulum stress by down-regulating Bcl2 and perturbing the cellular redox state. Mol. Cell. Biol. 21, 1249–1259. Mori, K., Ogawa, N., Kawahara, T., Yanagi, H., and Yura, T. (2000). mRNA splicingmediated C-terminal replacement of transcription factor Hac1p is required for efficient activation of the unfolded protein response. Proc. Natl. Acad. Sci. USA 97, 4660–4665. Morishima, N., Nakanishi, K., Takenouchi, H., Shibata, T., and Yasuhiko, Y. (2002). An endoplasmic reticulum stress-specific caspase cascade in apoptosis. Cytochrome c-independent activation of caspase-9 by caspase-12. J. Biol. Chem. 277, 34287–34294. Nadanaka, S., Yoshida, H., and Mori, K. (2006). Reduction of disulphide bridges in the lumenal domain of ATF6 in response to glucose starvation. Cell Struct. Funct. 31, 127–134. Nakagawa, T., and Yuan, J. (2000). Cross-talk between two cysteine protease families. Activation of caspase-12 by calpain in apoptosis. J. Cell Biol. 150, 887–894. Nakagawa, T., Zhu, H., Morishima, N., Li, E., Xu, J., Yankner, B. A., and Yuan, J. (2000). Caspase-12 mediates endoplasmic-reticulum specific apoptosis and cytotoxicity by amyloid-beta. Nature 403, 98–103. Nakka, V. P., Gusain, A., and Raghubir, R. (2010). Endoplasmic reticulum stress plays critical role in brain damage after cerebral ischemia/reperfusion in rats. Neurotox. Res. 17, 189–202. Nishitoh, H., Saitoh, M., Mochida, Y., Takeda, K., Nakano, H., Rothe, M., Miyazono, K., and Ichijo, H. (1998). ASK1 is essential for JNK/SAPK activation by TRAF2. Mol. Cell 2, 389–395. Nishitoh, H., Matsuzawa, A., Tobiume, K., Saegusa, K., Takeda, K., Inoue, K., Hori, S., Kakizuka, A., and Ichijo, H. (2002). ASK1 is essential for endoplasmic reticulum stressinduced neuronal cell death triggered by expanded polyglutamine repeats. Genes Dev. 16, 1345–1355. Oyadomari, S., Koizumi, A., Takeda, K., Gotoh, T., Akira, S., Araki, E., and Mori, M. (2002). Targeted disruption of the Chop gene delays endoplasmic reticulum stress mediated diabetes. J. Clin. Invest. 109, 525–532. Paschen, W., and Doutheil, J. (1999). Disturbances of the functioning of endoplasmic reticulum: A key mechanism underlying neuronal cell injury? J. Cereb. Blood Flow Metab. 19, 1–18. Paschen, W., Gissel, C., Linden, T., Althausen, S., and Doutheil, J. (1998). Activation of gadd153 expression through transient cerebral ischemia: Evidence that ischemia causes endoplasmic reticulum dysfunction. Brain Res. Mol. Brain Res. 60, 115–122. Prostko, C. R., Brostrom, M. A., and Brostrom, C. O. (1993). Reversible phosphorylation of eukaryotic initiation factor 2 alpha in response to endoplasmic reticular signaling. Mol. Cell. Biochem. 128, 255–265.
274
Ram Raghubir et al.
Putney, J. W., Jr., and Ribeiro, C. M. (2000). Signaling pathways between the plasma membrane and endoplasmic reticulum calcium stores. Cell. Mol. Life Sci. 57, 1272–1286. Rao, R. V., Hermel, E., Castro-Obregon, S., del Rio, G., Ellerby, L. M., Ellerby, H. M., and Bredesen, D. E. (2001). Coupling endoplasmic reticulum stress to the cell death program: Mechanism of caspase activation. J. Biol. Chem. 276, 33869–33874. Rao, R. V., Castro-Obregon, S., Frankowski, H., Schuler, M., Stoka, V., del Rio, G., Bredesen, D. E., and Ellerby, H. M. (2002). Coupling endoplasmic reticulum stress to the cell death program. An Apaf-1-independent intrinsic pathway. J. Biol. Chem. 277, 21836–21842. Ron, D. (2002). Translational control in the endoplasmic reticulum stress response. J. Clin. Invest. 110, 1383–1388. Rutter, G. A., and Rizzuto, R. (2000). Regulation of mitochondrial metabolism by ER Ca2þ release: An intimate connection. Trends Biochem. Sci. 25, 215–221. Salminen, A., Kauppinen, A., Suuronen, T., Kaarniranta, K., and Ojala, J. (2009). ER stress in Alzheimer’s disease: A novel neuronal trigger for inflammation and Alzheimer’s pathology. J. Neuroinflammation 26, 41–53. Samali, A., Fitzgerald, U., Deegan, S., and Gupta, S. (2010). Methods for monitoring endoplasmic reticulum stress and the unfolded protein response. Int. J. Cell Biol. 2010, 830307. Sanges, D., and Marigo, V. (2006). Cross-talk between two apoptotic pathways activated by endoplasmic reticulum stress: Differential contribution of caspase-12 and AIF. Apoptosis 11, 1629–1641. Schroder, M., and Kaufman, R. J. (2005). The mammalian unfolded protein response. Annu. Rev. Biochem. 74, 739–789. Schubert, U., Anton, L. C., Gibbs, J., Norbury, C. C., Yewdell, J. W., and Bennink, J. R. (2000). Rapid degradation of a large fraction of newly synthesized proteins by proteasomes. Nature 404, 770–774. Shen, J., Chen, X., Hendershot, L., and Prywes, R. (2002). ER stress regulation of ATF6 localization by dissociation of BiP/GRP78 binding and unmasking of Golgi localization signals. Dev. Cell 3, 99–111. Shiraishi, H., Okamoto, H., Yoshimura, A., and Yoshida, H. (2006). ER stress-induced apoptosis and caspase-12 activation occurs downstream of mitochondrial apoptosis involving Apaf-1. J. Cell Sci. 119, 3958–3966. Sokka, A. L., Putkonen, N., Mudo, G., Pryazhnikov, E., Reijonen, S., Khiroug, L., Belluardo, N., Lindholm, D., and Korhonen, L. (2007). Endoplasmic reticulum stress inhibition protects against excitotoxic neuronal injury in the rat brain. J. Neurosci. 27, 901–908. Soto, C. (2003). Unfolding the role of protein misfolding in neurodegenerative diseases. Nat. Rev. Neurosci. 4, 49–60. Szegezdi, E., Fitzgerald, U., and Samali, A. (2003). Caspase-12 and ER stress-mediated apoptosis: The story so far. Ann. NY Acad. Sci. 1010, 186–194. Szegezdi, E., Logue, S. E., Gorman, A. M., and Samali, A. (2006). Mediators of endoplasmic reticulum stress-induced apoptosis. EMBO Rep. 7, 880–885. Tajiri, S., Oyadomari, S., Yano, S., Morioka, M., Gotoh, T., Hamada, J. I., Ushio, Y., and Mori, M. (2004). Ischemia-induced neuronal cell death is mediated by the endoplasmic reticulum stress pathway involving CHOP. Cell Death Differ. 11, 403–415. Urano, F., Wang, X., Bertolotti, A., Zhang, Y., Chung, P., Harding, H. P., and Ron, D. (2000). Coupling of stress in the ER to activation of JNK protein kinases by transmembrane protein kinase IRE1. Science 287, 664–666. Van de Craen, M., Vandenabeele, P., Declercq, W., Van den Brande, I., Van Loo, G., Molemans, F., Schotte, P., Van Criekinge, W., Beyaert, R., and Fiers, W. (1997). Characterization of seven murine caspase family members. FEBS Lett. 403, 61–69.
ER Stress in Brain Damage
275
Wang, X. Z., Lawson, B., Brewer, J. W., Zinszner, H., Sanjay, A., Mi, L. J., Boorstein, R., Kreibich, G., Hendershot, L. M., and Ron, D. (1996). Signals from the stressed endoplasmic reticulum induce C/EBP-homologous protein (CHOP/GADD153). Mol. Cell. Biol. 16, 4273–4280. Wang, X. Z., Harding, H. P., Zhang, Y., Jolicoeur, E. M., Kuroda, M., and Ron, D. (1998). Cloning of mammalian Ire1 reveals diversity in the ER stress responses. EMBO J. 17, 5708–5717. Xie, Y., Mies, G., and Hossmann, K. A. (1989). Ischemic threshold of brain protein synthesis after unilateral carotid artery occlusion in gerbils. Stroke 20, 620–626. Xu, C., Bailly-Maitre, B., and Reed, J. C. (2005). Endoplasmic reticulum stress: Cell life and death decisions. J. Clin. Invest. 115, 2656–2664. Yan, W., Frank, C. L., Korth, M. J., Sopher, B. L., Novoa, I., Ron, D., and Katze, M. G. (2002). Control of PERK eIF2a kinase activity by the endoplasmic reticulum stressinduced molecular chaperone P58IPK. Proc. Natl. Acad. Sci. USA 99, 15920–15925. Yoneda, T., Imaizumi, K., Oono, K., Yui, D., Gomi, F., Katayama, T., and Tohyama, M. (2001). Activation of caspase-12, an endoplasmic reticulum (ER) resident caspase, through tumor necrosis factor receptor-associated factor 2-dependent mechanism in response to the ER stress. J. Biol. Chem. 276, 13935–13940. Zinszner, H., Kuroda, M., Wang, X., Batchvarova, N., Lightfoot, R. T., Remotti, H., Stevens, J. L., and Ron, D. (1998). CHOP is implicated in programmed cell death in response to impaired function of the endoplasmic reticulum. Genes Dev. 12, 982–995.