- Email: [email protected]
Endoplasmic reticulum stress increases the expression and function of toll-like receptor-2 in epithelial cells
Biochemical and Biophysical Research Communications 402 (2010) 235–240
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Endoplasmic reticulum stress increases the expression and function of toll-like receptor-2 in epithelial cells Shogo Shimasaki a, Tomoaki Koga a, Tsuyoshi Shuto a,⇑, Mary Ann Suico a, Takashi Sato a, Kenji Watanabe a, Saori Morino-Koga a, Manabu Taura a,b, Seiji Okada b, Kazutoshi Mori c, Hirofumi Kai a,⇑ a Department of Molecular Medicine, Graduate School of Pharmaceutical Sciences, Global COE ‘‘Cell Fate Regulation Research and Education Unit”, Kumamoto University, 5-1 Oe-Honmachi, Kumamoto 862-0973, Japan b Division of Hematopoiesis, Center for AIDS Research, Kumamoto University, Kumamoto 860-0811, Japan c Department of Biophysics, Graduate School of Science, Kyoto University, Kyoto 606-8502, Japan
a r t i c l e
i n f o
Article history: Received 24 September 2010 Available online 8 October 2010 Keywords: TLR2 ER stress ATF4 Epithelial cells
a b s t r a c t Endoplasmic reticulum (ER) stress is involved in a wide range of pathological conditions including neurodegenerative disorders, diabetes mellitus, atherosclerosis, inflammation, and infection. The ability of ER stress to induce an inflammatory response is considered to play a role in the pathogenesis of these diseases. However, its role in regulating the gene expression and function of toll-like receptors (TLRs), host defense receptors that recognize invading pathogens, remains unknown. Here we showed that several well-characterized ER stress inducers (thapsigargin, tunicamycin, and dithiothreitol) increase the expression of TLR2 in epithelial cells. Ligand-responsiveness of TLR2 was also enhanced by ER stress inducers, implying a contributory role of ER stress for the regulation of TLR2-dependent inflammatory responses. Furthermore, there was significant increase of TLR2 mRNA level in the livers of tunicamycin-treated mice and high-fat diet-fed mice, suggesting an impact of ER stress in vivo on the expression of TLR2. Overexpression and knockdown experiments showed the importance of activating transcription factor 4 (ATF4), an ER stress-induced transcription factor, in the induction of TLR2 expression during ER stress. This was confirmed by the increased expression and function of TLR2 during treatment with salubrinal, an activator of ATF4 pathway. Taken together, our study provides further insights into the role of ER stress in enhancing host bacterial response or in exaggerating the inflammatory condition via up-regulating TLR2 expression. Ó 2010 Elsevier Inc. All rights reserved.
1. Introduction Endoplasmic reticulum (ER) is a dynamic membranous organelle that plays critical roles in the folding, transport, and processing of newly synthesized proteins. A number of cellular stress conditions can lead to the accumulation of unfolded proteins in the ER lumen and cause so-called ER stress [1]. Cells cope with ER stress by activating the unfolded protein response (UPR). UPR of mammalian cells consists of three branches, ATF6 pathway, IRE1-XBP1 pathway, and PERK-eIF2a-ATF4 pathway. The UPR integrates all three pathways to produce an ER stress response that uses both translational and transcriptional mechanisms [2]. Recent reports suggest that the UPR can initiate inflammation, and the coupling of these responses is now thought to be fundamental in the pathogenesis of ⇑ Corresponding authors. Address: Department of Molecular Medicine, Faculty of Life Sciences, Kumamoto University, 5-1 Oe-honmachi, Kumamoto 862-0973, Japan. Fax: +81 96 371 4407 (T. Shuto), +81 96 371 4405 (H. Kai). E-mail addresses: [email protected] (T. Shuto), [email protected] moto-u.ac.jp (H. Kai). 0006-291X/$ - see front matter Ó 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2010.09.132
inflammatory diseases [3], such as type 2 diabetes [4], atherosclerosis [5], and chronic obstructive pulmonary disease [6]. The innate immune responses are regulated by a group of receptors referred to as pathogen-recognition receptors, the best known of which are the toll-like receptors (TLRs) [7]. TLRs recognize various pathogen-associated molecular patterns (PAMPs) present in invading pathogens. Interaction of TLRs with PAMPs can activate signaling pathways that produce inflammatory cytokines and antimicrobial peptides to eliminate the pathogen [8]. Microbial products are not the only signals that activate the TLRs, as signals produced by stressed or damaged tissues have also been suggested to modulate the inflammatory responses [9–11]. Although optimal TLR signaling is required to activate the host innate immune system, excessive amount of TLR signaling and overproduction of inflammatory cytokines lead to inflammatory diseases such as sepsis [12], inflammatory bowel disease [13], and autoimmune disease [14]. Therefore, TLR signaling and expression must be kept under control during immune responses and it is crucially important to identify the factors which regulate TLR signaling and expression.
236
S. Shimasaki et al. / Biochemical and Biophysical Research Communications 402 (2010) 235–240
There is a growing body of evidence that TLR signaling is associated with ER stress response. Woo et al. demonstrated that TLR signaling is a negative regulator of the ATF4-CHOP pathway [15]. Martinon et al. showed that TLR and IRE1-XBP1 pathways are interconnected and act together to maximize innate immune responses to pathogens [16]. However, it is still unclear whether ER stress per se influences the expression of TLRs. In this study, we examined the effect of ER stress on the expression of TLRs. We show that ER stress increases TLR2 expression in human epithelial cells and in mouse liver tissue. Moreover, ER stress enhances TLR2-dependent pro-inflammatory cytokine production. We also provide evidence that ATF4 is involved in ER stress-induced TLR2 up-regulation. These data support the growing evidence of a direct link between ER stress and TLR signaling.
cleotide primers used for PCR are shown in Table 1. Quantitative real-time RT-PCR analysis for TLR2, tumor necrosis factor-a (TNFa), interleukin-8 (IL-8), IL-6, C/EBP homologous protein (CHOP), ER DnaJ homologue 4 (ERdj4), glucose related protein 78 kDa (GRP78), ATF4, and 18S ribosomal RNA (18S rRNA) were carried out using PrimeScriptÒ RT reagent Kit (TaKaRa) and SYBR Premix Ex Taq™ II (TaKaRa). PCR amplifications were performed as described previously [20]. The threshold cycle values for each gene amplification were normalized by subtracting the threshold cycle value calculated for 18S rRNA (internal control). The normalized gene expression values were expressed as the relative quantity of gene-specific mRNA (TLR2, TNF-a, IL-8, IL-6, CHOP, ERdj4, GRP78, Table 1 Sequences of oligonucleotides used as primer for semi-quantitative RT-PCR. Primer
Sequence
2. Materials and methods
TLR1
Forward 50 -GGCTGGCCTGATTCTTATAAG-30 Reverse 50 -CTCTAGGTTTGGCAATAATTCATTCTTCAC-30
2.1. Reagents, plasmids, and antibodies
TLR2
Forward 50 -GCCAAAGTCTTGATTGATTGG-30 Reverse 50 -TTGAAGTTCTCCAGCTCCTG-30
TLR3
Forward 50 -CCTGCAGCTGACTAGGAACTCCTTTG-30 Reverse 50 -TGCTGCAAATCGAGAATTTCTAG-30
TLR4
Forward 50 -GCTTCTTGCTGGCTGCATAA-30 Reverse 50 -GAAATGGAGGCACCCCTTC-30
TLR5
Forward 50 -GAAAACCGCATTGCCAATATCCAGG-30 Reverse 50 -CCTCAGGCCACCTCAAATACTG-30
TLR6
Forward 50 -CCTCAACCACATAGAAACGAC-30 Reverse 50 -CCTCAACCACATAGAAACGAC-30
TLR7
Forward 50 -ACAATGTCACAGCCGTCCCTA-30 Reverse 50 -TTTTAATTCTGTCAGCGCATC-30
TLR8
Forward 50 -ACAATCAACAAATCCGCACTTGAAACTAA-30 Reverse 50 -CCAGGGCAGCCAACATAACC-30
TLR9
Forward 50 -TCTTGCGGCTGCCATAGACCG-30 Reverse 50 -ATGCCCTGCCCTACGATGCCT-30
GAPDH
Forward 50 -CGGGAAGCTTGTGATCAATGG-30 Reverse 50 -GGCAGTGATGGCATGGACTG-30
Tunicamycin was purchased from Wako (Osaka, Japan). Thapsigargin and salubrinal was purchased from Calbiochem (San Diego, CA). Dithiothreitol (DTT) was purchased from Nacalai tesque (Kyoto, Japan). Peptidoglycan from Staphylococcus aureus was obtained from Fluka (Buchs, Switzerland). pcDNA3.1 plasmid was obtained from Invitrogen (Carlsbad, CA). The plasmids ATF4, ATF6 (1–373), which corresponds to the active form of ATF6, i.e., amino acids 1–373, and XBP1s, which encodes the XBP1 protein corresponding to the spliced mRNA were described previously [17–19]. Antibodies for TLR2 (IMG-319), normal mouse IgG (MOPC-31C) were purchased from IMGENEX (San Diego, CA). Anti-mouse Alexa Fluor 488-conjugated antibody was purchased from Molecular Probes (Eugene, OR). 2.2. Cell culture, treatment and transfection Human cervix epithelial HeLa cells were cultured in minimum essential medium (Sigma–Aldrich, St. Louis, MO) supplemented with 10% fetal bovine serum (FBS) and antibiotics. Human embryonic kidney HEK293 and human lung epithelial A549 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Wako) supplemented with 10% FBS and antibiotics. Human colorectal cancer cell line HCT116 cells, kindly provided by Dr. B. Vogelstein of Johns Hopkins Institute, were cultured in DMEM-Ham’s F-12 (Gibco) supplemented with 10% FBS and antibiotics. Cells were maintained at 37 °C in a humidified atmosphere of 5% CO2 and 95% air. Treatment of cells with 1 lg/ml of tunicamycin or 0.1 lM of thapsigargin was carried out at the indicated time and concentration. Stimulation of cells with 10 lg/ml peptidoglycan was performed for 4 h. Transient transfections of plasmids were performed using Trans-IT LT1 (Mirus, Madison, WI) following the manufacturer’s recommendations. Specifically, Trans-IT LT1 reagent diluted with Opti-MEM (Gibco) was mixed with total DNA in a ratio of 1:4 (DNA:LT1) and applied to subconfluent cells in medium. Small interfering RNA for ATF4 (siATF4) was transfected into HeLa cells using Trans-IT TKO (Mirus) according to the manufacturer’s instructions. Twenty-five nM of siATF4 were transfected into 90% confluent cells to knock down ATF4. GL2-luciferase siRNA duplex (siGL2) was used as a control. The cells were harvested 48 h after transfection.
Table 2 Sequences of oligonucleotides used as primer for real-time quantitative RT-PCR. Primer
Sequence
TLR2
Forward 50 -GGCCAGCAAATTACCTGTGTG-30 Reverse 50 -AGGCGGACATCCTGAACCT-30
TNF-a
Forward 50 -CAGCCTCTTCTCCTTCCTGA-30 Reverse 50 -TGAGGTACAGACCCTCTGAT-30
IL-8
Forward 50 -CTGGCCGTGGCTCTCTTG-30 Reverse 50 -CCTTGGCAAAACTGCACCTT-30
IL-6
Forward 50 -GCACTGGCAGAAAACAACCT-30 Reverse 50 -CAGGGGTGGTTATTGCATCT-30
CHOP
Forward 50 -ATGGCAGCTGAGTCATTGCCTTTC-30 Reverse 50 -AGAAGCAGGGTCAAGAGTGGTGAA-30
ERdj4
Forward 50 - AGTAGACAA AGGCATCATTTCCAA -30 Reverse 50 - CTGTATGCTGATTGGTAGAGTCAA -30
GRP78
Forward 50 -ACCAATTATCAGCAAACTCTATGGAA-30 Reverse 50 -CATCTTTTTCTGCTGTATCCTCTTCA-30
ATF4
Forward 50 -AGTGGCATCTGTATGAGCCCA-30 Reverse 50 -GCTCCTATTTGGAGAGCCCCT-30
18S rRNA
Forward 50 -CGGCTACCACATCCAAGGAA-30 Reverse 50 -GCTGGAATTACCGCGGCT-30
2.3. RT-PCR analysis
mTLR2
Forward 50 -TGCTTTCCTGCTGGAGATTT-30 Reverse 50 - TGTAACGCAACAGCTTCAGG-30
Total RNA was isolated from cells with RNAiso Plus (TaKaRa, Japan) according to the manufacturer’s instructions. Semi-quantitative reverse transcription PCR (RT-PCR) was carried out with an RT-PCR kit (TaKaRa) by the recommended protocol. The oligonu-
mCHOP
Forward 50 -CTCCTGTCTGTCTCTCCGGAA-30 Reverse 50 -TACCCTCAGTCCCCTCCTCA-30
m18S rRNA
Forward 50 -CCATCCAATCGGTAGTAGCG-30 Reverse 50 -GTAACCCGTTGAACCCCATT-30
S. Shimasaki et al. / Biochemical and Biophysical Research Communications 402 (2010) 235–240
and ATF4). The oligonucleotide primers used in the real-time quantitative PCR amplifications are shown in Table 2. 2.4. Flow cytometry To determine TLR2 protein expression, cells were treated with 0.1 lM thapsigargin. Twenty-four hours after treatment, cells were detached and washed twice with cold PBS. Cells were stained with anti-TLR2 monoclonal antibody and Alexa Fluor 488-labeled secondary antibody (Molecular Probes). Fluorescence was measured on a FACSCalibur flow cytometer (BD Biosciences) using 10,000 gated cells. 2.5. Animal experiments and tissue sample analysis Male C57BL/6 J mice (Charles River Laboratories Inc., Kanagawa, Japan) were housed in a vivarium in accordance with the guidelines of the animal facility center of Kumamoto University. The mice were maintained on food (standard or high-fat diet) and water ad libitum. The composition of high-fat diet was previously described [21]. For the tunicamycin injection experiments, 6-wk-old mice were injected with tunicamycin intraperitoneally at 1 lg/g body weight for 8 h. For the high-fat diet experiments, 4-wk-old mice were fed with high-fat diet for 12 weeks. Livers were harvested and total RNA was isolated by using RNAiso Plus with Recombinant DNase I (TaKaRa) according to the manufacturer’s instructions. 2.6. Statistical analysis Data are presented as mean ± SE For statistical analysis, the data were analyzed by one-way ANOVA with either Tukey–Kramer or
237
Dunnett’s multiple comparison test or Student’s t-test (JMP software, SAS Institute, NC, USA) as indicated in each figure legends. The differences were considered statistically significant when the P value was less than 0.05. 3. Results 3.1. ER stress induces TLR2 expression in vitro and in vivo We first examined whether ER stress influences the expression of TLRs in epithelial cells. HeLa cells were treated with the ER stress inducer, thapsigargin, for 24 h. TLR1–9 mRNAs expression was measured by semi-quantitative RT-PCR. As shown in Supplementary Fig. 1A, the treatment with thapsigargin induced the TLR2 and TLR5 expression. To confirm the effect of ER stress on the regulation of TLR2 and TLR5 expression in epithelial cells, we treated several epithelial cell lines with thapsigargin and evaluated the expression level of both TLR2 and TLR5 by quantitative real-time RT-PCR. Notably, mRNA expression of TLR2, but not TLR5, was significantly increased after the treatment with thapsigargin in HEK293, A549, and HCT116 cells (Supplementary Fig. 1B and C). Thus, we hereafter focused on TLR2 up-regulation induced by ER stress. To further confirm the effect of ER stress on TLR2 gene expression, we treated HeLa cells with various ER stress inducers, such as thapsigargin, tunicamycin and DTT. Thapsigargin increased the TLR2 expression in a dose-dependent and time-dependent manner (Fig. 1A and B). Tunicamycin or DTT-induced TLR2 up-regulation was also observed at 24 h after treatment (Fig. 1C). These data suggest that ER stress induces TLR2 mRNA expression. Next, we examined whether ER stress also affects the protein expression
Fig. 1. ER stress induces TLR2 expression in vitro and in vivo. (A) HeLa cells were treated for 24 h with the indicated concentration of thapsigargin (TG). (B) HeLa cells were treated for the indicated times with TG (0.1 lM). (C) HeLa cells were treated for 24 h with TG (0.5 lM), tunicamycin (TM) (1 lg/mL), or dithiothreitol (DTT) (2 mM). Relative quantity of TLR2 mRNA was analyzed by quantitative real-time RT-PCR using 18S rRNA as internal control. Values are the mean ± SE (n = 3 for A–C). *P < 0.05, assessed by ANOVA with the Dunnett procedure. (D) HeLa cells treated with TG (0.1 lM, 24 h) were incubated with anti-TLR2 antibody, stained with secondary Alexa 488-labeled antibody and analyzed by flow cytometry. Data shown in (D, left panel) is representative of three independent experiments. Right panel, values are means ± S.E. (n = 3). *P < 0.05, assessed by ANOVA with Tukey-Kramer procedure. (E) Mice were administered intraperitoneally with TM (1 lg/g body weight), and liver tissues were harvested at 8 h after injection. (F) Mice were fed normal diet or high-fat diet (HFD) for 12 weeks. Relative quantity of mouse TLR2 or mouse CHOP mRNA was analyzed by quantitative real-time RT-PCR using mouse 18S rRNA as internal control. Values are the mean ± SE (n = 3 for E and F). *P < 0.05, assessed by Student’s t-test.
238
S. Shimasaki et al. / Biochemical and Biophysical Research Communications 402 (2010) 235–240
Fig. 2. ER stress enhances TLR2-dependent induction of pro-inflammatory cytokines. (A–F) HeLa cells pretreated with thapsigargin (TG) (A–C, 0.1 lM), or dithiothreitol (DTT) (D–F, 2 mM) for 20 h were stimulated with peptidoglycan (PGN) (10 lg/mL) for 4 h. Relative quantity of TNF-a, IL-8 and IL-6 mRNA was analyzed by quantitative real-time RT-PCR using 18S rRNA as internal control. Values are the mean ± SE (n = 3). *P < 0.05, assessed by ANOVA with Tukey–Kramer procedure.
Fig. 3. ATF4 is important for ER stress-induced TLR2 up-regulation. (A–C) HeLa cells were transfected with ATF4 (A), XBP1s (B) or ATF6a (1–373) (C) for 24 h. (D) HeLa cells transfected with ATF4 siRNA (siATF4) were treated with thapsigargin (TG) (0.1 lM) for 24 h. Relative quantity of TLR2, CHOP, ERdj4, GRP78, and ATF4 mRNA was analyzed by quantitative real-time RT-PCR using 18S rRNA as internal control. Values are the mean ± SE (n = 3 for A–C, n = 6 for D). *P < 0.05 vs. control, assessed by Student’s t-test (n.s., not significant).
S. Shimasaki et al. / Biochemical and Biophysical Research Communications 402 (2010) 235–240
of TLR2. Flow cytometric analysis showed the increased cell surface expression of TLR2 in thapsigargin-treated cells (Fig. 1D), suggesting that ER stress also up-regulates the protein expression of TLR2 in epithelial cells. To determine whether TLR2 is up-regulated by ER stress in vivo, we used two ER stress mice models, the tunicamycin-injected [15] and the high-fat diet-fed mice [21]. As shown in Fig. 1E and F, TLR2 expression was higher in the livers of tunicamycin-treated and high-fat diet-fed mice compared with control. ER stress was induced in these mice because the expression of ER stress marker, CHOP was up-regulated (Fig. 1E and F, right). Taken together, these data demonstrated that ER stress induces TLR2 expression in vitro and in vivo. 3.2. ER stress enhances TLR2-dependent induction of proinflammatory cytokines
239
TLR2. Overexpression of ATF4 significantly increased the expression of TLR2 and CHOP, a known ATF4 target gene (Fig. 3A). On the other hand, overexpression of XBP1s did not significantly affect TLR2 expression despite the up-regulation of ERdj4, a specific XBP1 target gene (Fig. 3B). Overexpression of ATF6 did not change TLR2 expression although GRP78, a specific ATF6 target gene, was upregulated (Fig. 3C). To confirm the requirement of ATF4 on ER stress-induced TLR2 up-regulation, knockdown experiment of ATF4 was performed. Transfection of siATF4 inhibited thapsigargin-induced TLR2 up-regulation, congruent with the suppression of thapsigargin-induced ATF4 expression (Fig. 3D). These data suggest that ATF4 plays a role in the induction of TLR2 expression during ER stress. 3.4. Sustained activation of ATF4 pathway by salubrinal increases the expression and function of TLR2
To determine whether ER stress also affects the function of TLR2, we analyzed the induction of pro-inflammatory cytokines after the treatment with TLR2 ligand peptidoglycan in cells that have been untreated or pretreated with thapsigargin or DTT. As shown in Fig. 2, treatment with peptidoglycan for 4 h slightly increased the expression of TNF-a, IL-8, and IL-6 in HeLa cells (Fig. 2, CON, peptidoglycan-treated). Interestingly, pretreatment with thapsigargin significantly enhanced peptidoglycan-induced up-regulation of these pro-inflammatory cytokines (Fig. 2A–C). Pretreatment with DTT also had similar effect (Fig. 2D–F). Thus, our data showed that ER stress enhances TLR2-dependent induction of pro-inflammatory cytokines.
We further confirmed the importance of ATF4 by treatment with the specific eIF2a phosphatase inhibitor, salubrinal [22]. Notably, salubrinal increased the expression of TLR2 as well as ATF4 target gene CHOP, but not that of GRP78 (Fig. 4A–C). Consistent with these data, pretreatment with salubrinal enhanced peptidoglycan-induced TNF-a, IL-8, and IL-6 up-regulation (Fig. 4D–F), suggesting that sustained activation of ATF4 pathway increases the expression and function of TLR2. Collectively, these data confirmed the importance of ATF4 pathway during ER stress for the regulation of TLR2 expression and function in epithelial cells.
3.3. ATF4 is involved in ER stress-induced TLR2 up-regulation
4. Discussion
We next determined which UPR signaling pathway is responsible for TLR2 up-regulation by ER stress. At first, we examined the effect of ATF4, XBP1s, or ATF6a (1–373) on the expression of
Although recent reports have shown that TLR signaling is associated with ER stress response [15,16], it is still unclear whether ER stress influences the expression of TLRs. The data presented here
Fig. 4. Specific activation of ATF4 pathway increases the expression and function of TLR2. (A–C) HeLa cells were treated with salubrinal (30 lM) for 24 h. (D–F) HeLa cells pretreated with salubrinal (30 lM) for 24 h were stimulated with peptidoglycan (PGN) (10 lg/mL) for 4 h. Relative quantity of the indicated genes was analyzed by quantitative real-time RT-PCR using 18S rRNA as internal control. Values are the mean ± SE (n = 3). *P < 0.05, assessed by Student’s t-test (for A–C) or ANOVA with Tukey– Kramer (for D–F).
240
S. Shimasaki et al. / Biochemical and Biophysical Research Communications 402 (2010) 235–240
are the first to show that ER stress increases TLR2 expression in vitro and in vivo. Moreover, ER stress enhances TLR2-dependent pro-inflammatory cytokine production. Our findings may have important implications for host defense and response against cellular stress. In unstimulated epithelial cells, the relatively low expression of TLR2 is an important aspect of TLR2 function because under limiting conditions cellular responses to PAMPs can be stringently regulated by controlling the amount of TLR protein produced [23]. When epithelial cells are exposed to various stimuli such as viral infection [24], high-fat diet [4] and cigarette smoke [6], the host cells induce ER stress to initiate appropriate response to existing cellular insults. Activation of TLR2 may be one of the responses triggered by ER stress. Recent reports suggested that TLR2 recognizes not only microbial components but also endogenous sources, including GRP94 [25] and high-mobility group box 1 [26], and induces the production of pro-inflammatory cytokines and apoptosis [27,28]. However, persistent ER stress may promote inflammation by regulating the intensity and duration of innate immune responses. Inflammation can also be triggered by a chronic excess of metabolic factors (such as lipids, glucose and cytokines), which can elicit UPR in physiological and pathological settings, thereby triggering a vicious cycle of inflammation and cellular stress leading to metabolic deterioration [3]. It was recently demonstrated that TLR2 and TLR4 activated ER stress-related transcription factor XBP1 [16], providing evidence that TLR signaling is intimately linked with ER stress response. Here we showed that ER stress via ATF4 could activate the TLR2 pathway, supporting the idea that a positive feedback mechanism exists between ER stress and inflammatory cytokine production. Interestingly, it was demonstrated that TLR3 and TLR4 inhibited ATF4 signaling, suggesting that host cells may have adapted this mechanism to protect cells from physiologically prolonged ER stress associated with host defense [15]. We have shown here the involvement of ATF4 in the up-regulation of TLR2 by ER stress inducers (Figs. 3 and 4) but the mechanism of how ATF4 activates TLR2 is still unclear. ATF4 may directly bind to the TLR2 promoter region and transactivate TLR2 gene expression. However, we cannot find an ATF4 binding region within the 2 kb TLR2 promoter (data not shown). Another possible mechanism is that ATF4 is indirectly involved in ER stress-induced TLR2 up-regulation. Certain ATF4 target gene/s may induce TLR2 expression. Further investigations may clarify the mechanism of ATF4 function associated with ER stress-induced TLR2 up-regulation. In summary, our findings revealed that ER stress increases TLR2 gene expression and function via ATF4 pathway in epithelial cells. This study contributes to our knowledge on how ER stress may influence inflammatory responses. Acknowledgments The HCT116 cells were donated Dr. Bert Vogelstein of Johns Hopkins Institute. This work was supported in part by grants from the Ministry of Education, Science, Sport, and Culture (MEXT) of Japan, the Nakatomi Foundation and the Global COE Program (Cell Fate Regulation Research and Education Unit), MEXT, Japan. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.bbrc.2010.09.132. References [1] M. Schroder, R.J. Kaufman, The mammalian unfolded protein response, Annu. Rev. Biochem. 74 (2005) 739–789. [2] D. Ron, P. Walter, Signal integration in the endoplasmic reticulum unfolded protein response, Nat. Rev. Mol. Cell Biol. 8 (2007) 519–529.
[3] K. Zhang, R.J. Kaufman, From endoplasmic-reticulum stress to the inflammatory response, Nature 454 (2008) 455–462. [4] U. Ozcan, E. Yilmaz, L. Ozcan, M. Furuhashi, E. Vaillancourt, R.O. Smith, C.Z. Gorgun, G.S. Hotamisligil, Chemical chaperones reduce ER stress and restore glucose homeostasis in a mouse model of type 2 diabetes, Science 313 (2006) 1137–1140. [5] Y. Li, R.F. Schwabe, T. DeVries-Seimon, P.M. Yao, M.C. Gerbod-Giannone, A.R. Tall, R.J. Davis, R. Flavell, D.A. Brenner, I. Tabas, Free cholesterol-loaded macrophages are an abundant source of tumor necrosis factor-alpha and interleukin-6: model of NF-kappaB- and map kinase-dependent inflammation in advanced atherosclerosis, J. Biol. Chem. 280 (2005) 21763–21772. [6] T.L. Adair-Kirk, J.J. Atkinson, R.M. Senior, Smoke particulates stress lung cells, Nat. Med. 14 (2008) 1024–1025. [7] O. Takeuchi, S. Akira, Pattern recognition receptors and inflammation, Cell 140 (2010) 805–820. [8] S.C. Gribar, W.M. Richardson, C.P. Sodhi, D.J. Hackam, No longer an innocent bystander: epithelial toll-like receptor signaling in the development of mucosal inflammation, Mol. Med. 14 (2008) 645–659. [9] R. Medzhitov, Origin and physiological roles of inflammation, Nature 454 (2008) 428–435. [10] P.J. Sansonetti, The innate signaling of dangers and the dangers of innate signaling, Nat. Immunol. 7 (2006) 1237–1242. [11] L. Zitvogel, O. Kepp, G. Kroemer, Decoding cell death signals in inflammation and immunity, Cell 140 (2010) 798–804. [12] R. Salomao, M.K. Brunialti, N.E. Gomes, M.E. Mendes, R.S. Diaz, S. Komninakis, F.R. Machado, I.D. da Silva, O. Rigato, Toll-like receptor pathway signaling is differently regulated in neutrophils and peripheral mononuclear cells of patients with sepsis, severe sepsis, and septic shock, Crit. Care Med. 37 (2009) 132–139. [13] B. Szebeni, G. Veres, A. Dezsofi, K. Rusai, A. Vannay, M. Mraz, E. Majorova, A. Arato, Increased expression of Toll-like receptor (TLR) 2 and TLR4 in the colonic mucosa of children with inflammatory bowel disease, Clin. Exp. Immunol. 151 (2008) 34–41. [14] A. Komatsuda, H. Wakui, K. Iwamoto, M. Ozawa, M. Togashi, R. Masai, N. Maki, T. Hatakeyama, K. Sawada, Up-regulated expression of Toll-like receptors mRNAs in peripheral blood mononuclear cells from patients with systemic lupus erythematosus, Clin. Exp. Immunol. 152 (2008) 482–487. [15] C.W. Woo, D. Cui, J. Arellano, B. Dorweiler, H. Harding, K.A. Fitzgerald, D. Ron, I. Tabas, Adaptive suppression of the ATF4-CHOP branch of the unfolded protein response by toll-like receptor signalling, Nat. Cell Biol. 11 (2009) 1473–1480. [16] F. Martinon, X. Chen, A.H. Lee, L.H. Glimcher, TLR activation of the transcription factor XBP1 regulates innate immune responses in macrophages, Nat. Immunol. 11 (2010) 411–418. [17] H. Yoshida, A. Uemura, K. Mori, pXBP1(U), a negative regulator of the unfolded protein response activator pXBP1(S), targets ATF6 but not ATF4 in proteasome-mediated degradation, Cell Struct. Funct. 34 (2009) 1–10. [18] K. Haze, H. Yoshida, H. Yanagi, T. Yura, K. Mori, Mammalian transcription factor ATF6 is synthesized as a transmembrane protein and activated by proteolysis in response to endoplasmic reticulum stress, Mol. Biol. Cell 10 (1999) 3787–3799. [19] H. Yoshida, T. Matsui, A. Yamamoto, T. Okada, K. Mori, XBP1 mRNA is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription factor, Cell 107 (2001) 881–891. [20] T. Shuto, T. Furuta, M. Oba, H. Xu, J.D. Li, J. Cheung, D.C. Gruenert, A. Uehara, M.A. Suico, T. Okiyoneda, H. Kai, Promoter hypomethylation of Toll-like receptor-2 gene is associated with increased proinflammatory response toward bacterial peptidoglycan in cystic fibrosis bronchial epithelial cells, FASEB J. 20 (2006) 782–784. [21] S. Morino, T. Kondo, K. Sasaki, H. Adachi, M.A. Suico, E. Sekimoto, T. Matsuda, T. Shuto, E. Araki, H. Kai, Mild electrical stimulation with heat shock ameliorates insulin resistance via enhanced insulin signaling, PLoS One 3 (2008) e4068. [22] M. Boyce, K.F. Bryant, C. Jousse, K. Long, H.P. Harding, D. Scheuner, R.J. Kaufman, D. Ma, D.M. Coen, D. Ron, J. Yuan, A selective inhibitor of eIF2alpha dephosphorylation protects cells from ER stress, Science 307 (2005) 935–939. [23] T. Shuto, A. Imasato, H. Jono, A. Sakai, H. Xu, T. Watanabe, D.D. Rixter, H. Kai, A. Andalibi, F. Linthicum, Y.L. Guan, J. Han, A.C. Cato, D.J. Lim, S. Akira, J.D. Li, Glucocorticoids synergistically enhance nontypeable Haemophilus influenzaeinduced Toll-like receptor 2 expression via a negative cross-talk with p38 MAP kinase, J. Biol. Chem. 277 (2002) 17263–17270. [24] B. He, Viruses, endoplasmic reticulum stress, and interferon responses, Cell Death Differ. 13 (2006) 393–403. [25] Q.Q. Huang, R. Sobkoviak, A.R. Jockheck-Clark, B. Shi, A.M. Mandelin 2nd, P.P. Tak, G.K. Haines 3rd, C.V. Nicchitta, R.M. Pope, Heat shock protein 96 is elevated in rheumatoid arthritis and activates macrophages primarily via TLR2 signaling, J. Immunol. 182 (2009) 4965–4973. [26] J.F. Curtin, N. Liu, M. Candolfi, W. Xiong, H. Assi, K. Yagiz, M.R. Edwards, K.S. Michelsen, K.M. Kroeger, C. Liu, A.K. Muhammad, M.C. Clark, M. Arditi, B. Comin-Anduix, A. Ribas, P.R. Lowenstein, M.G. Castro, HMGB1 mediates endogenous TLR2 activation and brain tumor regression, PLoS Med. 6 (2009) e10. [27] A.O. Aliprantis, R.B. Yang, D.S. Weiss, P. Godowski, A. Zychlinsky, The apoptotic signaling pathway activated by Toll-like receptor-2, EMBO J. 19 (2000) 3325– 3336. [28] Y. Li, H. Li, Y. Zhang, X. Sun, G.A. Hanley, G. LeSage, Y. Zhang, S. Sun, Y. Peng, D. Yin, Toll-like receptor 2 is required for opioids-induced neuronal apoptosis, Biochem. Biophys. Res. Commun. 391 (2010) 426–430.
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Endoplasmic reticulum stress increases the expression and function of toll-like receptor-2 in epithelial cells Shogo Shimasaki a, Tomoaki Koga a, Tsuyoshi Shuto a,⇑, Mary Ann Suico a, Takashi Sato a, Kenji Watanabe a, Saori Morino-Koga a, Manabu Taura a,b, Seiji Okada b, Kazutoshi Mori c, Hirofumi Kai a,⇑ a Department of Molecular Medicine, Graduate School of Pharmaceutical Sciences, Global COE ‘‘Cell Fate Regulation Research and Education Unit”, Kumamoto University, 5-1 Oe-Honmachi, Kumamoto 862-0973, Japan b Division of Hematopoiesis, Center for AIDS Research, Kumamoto University, Kumamoto 860-0811, Japan c Department of Biophysics, Graduate School of Science, Kyoto University, Kyoto 606-8502, Japan
a r t i c l e
i n f o
Article history: Received 24 September 2010 Available online 8 October 2010 Keywords: TLR2 ER stress ATF4 Epithelial cells
a b s t r a c t Endoplasmic reticulum (ER) stress is involved in a wide range of pathological conditions including neurodegenerative disorders, diabetes mellitus, atherosclerosis, inflammation, and infection. The ability of ER stress to induce an inflammatory response is considered to play a role in the pathogenesis of these diseases. However, its role in regulating the gene expression and function of toll-like receptors (TLRs), host defense receptors that recognize invading pathogens, remains unknown. Here we showed that several well-characterized ER stress inducers (thapsigargin, tunicamycin, and dithiothreitol) increase the expression of TLR2 in epithelial cells. Ligand-responsiveness of TLR2 was also enhanced by ER stress inducers, implying a contributory role of ER stress for the regulation of TLR2-dependent inflammatory responses. Furthermore, there was significant increase of TLR2 mRNA level in the livers of tunicamycin-treated mice and high-fat diet-fed mice, suggesting an impact of ER stress in vivo on the expression of TLR2. Overexpression and knockdown experiments showed the importance of activating transcription factor 4 (ATF4), an ER stress-induced transcription factor, in the induction of TLR2 expression during ER stress. This was confirmed by the increased expression and function of TLR2 during treatment with salubrinal, an activator of ATF4 pathway. Taken together, our study provides further insights into the role of ER stress in enhancing host bacterial response or in exaggerating the inflammatory condition via up-regulating TLR2 expression. Ó 2010 Elsevier Inc. All rights reserved.
1. Introduction Endoplasmic reticulum (ER) is a dynamic membranous organelle that plays critical roles in the folding, transport, and processing of newly synthesized proteins. A number of cellular stress conditions can lead to the accumulation of unfolded proteins in the ER lumen and cause so-called ER stress [1]. Cells cope with ER stress by activating the unfolded protein response (UPR). UPR of mammalian cells consists of three branches, ATF6 pathway, IRE1-XBP1 pathway, and PERK-eIF2a-ATF4 pathway. The UPR integrates all three pathways to produce an ER stress response that uses both translational and transcriptional mechanisms [2]. Recent reports suggest that the UPR can initiate inflammation, and the coupling of these responses is now thought to be fundamental in the pathogenesis of ⇑ Corresponding authors. Address: Department of Molecular Medicine, Faculty of Life Sciences, Kumamoto University, 5-1 Oe-honmachi, Kumamoto 862-0973, Japan. Fax: +81 96 371 4407 (T. Shuto), +81 96 371 4405 (H. Kai). E-mail addresses: [email protected] (T. Shuto), [email protected] moto-u.ac.jp (H. Kai). 0006-291X/$ - see front matter Ó 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2010.09.132
inflammatory diseases [3], such as type 2 diabetes [4], atherosclerosis [5], and chronic obstructive pulmonary disease [6]. The innate immune responses are regulated by a group of receptors referred to as pathogen-recognition receptors, the best known of which are the toll-like receptors (TLRs) [7]. TLRs recognize various pathogen-associated molecular patterns (PAMPs) present in invading pathogens. Interaction of TLRs with PAMPs can activate signaling pathways that produce inflammatory cytokines and antimicrobial peptides to eliminate the pathogen [8]. Microbial products are not the only signals that activate the TLRs, as signals produced by stressed or damaged tissues have also been suggested to modulate the inflammatory responses [9–11]. Although optimal TLR signaling is required to activate the host innate immune system, excessive amount of TLR signaling and overproduction of inflammatory cytokines lead to inflammatory diseases such as sepsis [12], inflammatory bowel disease [13], and autoimmune disease [14]. Therefore, TLR signaling and expression must be kept under control during immune responses and it is crucially important to identify the factors which regulate TLR signaling and expression.
236
S. Shimasaki et al. / Biochemical and Biophysical Research Communications 402 (2010) 235–240
There is a growing body of evidence that TLR signaling is associated with ER stress response. Woo et al. demonstrated that TLR signaling is a negative regulator of the ATF4-CHOP pathway [15]. Martinon et al. showed that TLR and IRE1-XBP1 pathways are interconnected and act together to maximize innate immune responses to pathogens [16]. However, it is still unclear whether ER stress per se influences the expression of TLRs. In this study, we examined the effect of ER stress on the expression of TLRs. We show that ER stress increases TLR2 expression in human epithelial cells and in mouse liver tissue. Moreover, ER stress enhances TLR2-dependent pro-inflammatory cytokine production. We also provide evidence that ATF4 is involved in ER stress-induced TLR2 up-regulation. These data support the growing evidence of a direct link between ER stress and TLR signaling.
cleotide primers used for PCR are shown in Table 1. Quantitative real-time RT-PCR analysis for TLR2, tumor necrosis factor-a (TNFa), interleukin-8 (IL-8), IL-6, C/EBP homologous protein (CHOP), ER DnaJ homologue 4 (ERdj4), glucose related protein 78 kDa (GRP78), ATF4, and 18S ribosomal RNA (18S rRNA) were carried out using PrimeScriptÒ RT reagent Kit (TaKaRa) and SYBR Premix Ex Taq™ II (TaKaRa). PCR amplifications were performed as described previously [20]. The threshold cycle values for each gene amplification were normalized by subtracting the threshold cycle value calculated for 18S rRNA (internal control). The normalized gene expression values were expressed as the relative quantity of gene-specific mRNA (TLR2, TNF-a, IL-8, IL-6, CHOP, ERdj4, GRP78, Table 1 Sequences of oligonucleotides used as primer for semi-quantitative RT-PCR. Primer
Sequence
2. Materials and methods
TLR1
Forward 50 -GGCTGGCCTGATTCTTATAAG-30 Reverse 50 -CTCTAGGTTTGGCAATAATTCATTCTTCAC-30
2.1. Reagents, plasmids, and antibodies
TLR2
Forward 50 -GCCAAAGTCTTGATTGATTGG-30 Reverse 50 -TTGAAGTTCTCCAGCTCCTG-30
TLR3
Forward 50 -CCTGCAGCTGACTAGGAACTCCTTTG-30 Reverse 50 -TGCTGCAAATCGAGAATTTCTAG-30
TLR4
Forward 50 -GCTTCTTGCTGGCTGCATAA-30 Reverse 50 -GAAATGGAGGCACCCCTTC-30
TLR5
Forward 50 -GAAAACCGCATTGCCAATATCCAGG-30 Reverse 50 -CCTCAGGCCACCTCAAATACTG-30
TLR6
Forward 50 -CCTCAACCACATAGAAACGAC-30 Reverse 50 -CCTCAACCACATAGAAACGAC-30
TLR7
Forward 50 -ACAATGTCACAGCCGTCCCTA-30 Reverse 50 -TTTTAATTCTGTCAGCGCATC-30
TLR8
Forward 50 -ACAATCAACAAATCCGCACTTGAAACTAA-30 Reverse 50 -CCAGGGCAGCCAACATAACC-30
TLR9
Forward 50 -TCTTGCGGCTGCCATAGACCG-30 Reverse 50 -ATGCCCTGCCCTACGATGCCT-30
GAPDH
Forward 50 -CGGGAAGCTTGTGATCAATGG-30 Reverse 50 -GGCAGTGATGGCATGGACTG-30
Tunicamycin was purchased from Wako (Osaka, Japan). Thapsigargin and salubrinal was purchased from Calbiochem (San Diego, CA). Dithiothreitol (DTT) was purchased from Nacalai tesque (Kyoto, Japan). Peptidoglycan from Staphylococcus aureus was obtained from Fluka (Buchs, Switzerland). pcDNA3.1 plasmid was obtained from Invitrogen (Carlsbad, CA). The plasmids ATF4, ATF6 (1–373), which corresponds to the active form of ATF6, i.e., amino acids 1–373, and XBP1s, which encodes the XBP1 protein corresponding to the spliced mRNA were described previously [17–19]. Antibodies for TLR2 (IMG-319), normal mouse IgG (MOPC-31C) were purchased from IMGENEX (San Diego, CA). Anti-mouse Alexa Fluor 488-conjugated antibody was purchased from Molecular Probes (Eugene, OR). 2.2. Cell culture, treatment and transfection Human cervix epithelial HeLa cells were cultured in minimum essential medium (Sigma–Aldrich, St. Louis, MO) supplemented with 10% fetal bovine serum (FBS) and antibiotics. Human embryonic kidney HEK293 and human lung epithelial A549 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Wako) supplemented with 10% FBS and antibiotics. Human colorectal cancer cell line HCT116 cells, kindly provided by Dr. B. Vogelstein of Johns Hopkins Institute, were cultured in DMEM-Ham’s F-12 (Gibco) supplemented with 10% FBS and antibiotics. Cells were maintained at 37 °C in a humidified atmosphere of 5% CO2 and 95% air. Treatment of cells with 1 lg/ml of tunicamycin or 0.1 lM of thapsigargin was carried out at the indicated time and concentration. Stimulation of cells with 10 lg/ml peptidoglycan was performed for 4 h. Transient transfections of plasmids were performed using Trans-IT LT1 (Mirus, Madison, WI) following the manufacturer’s recommendations. Specifically, Trans-IT LT1 reagent diluted with Opti-MEM (Gibco) was mixed with total DNA in a ratio of 1:4 (DNA:LT1) and applied to subconfluent cells in medium. Small interfering RNA for ATF4 (siATF4) was transfected into HeLa cells using Trans-IT TKO (Mirus) according to the manufacturer’s instructions. Twenty-five nM of siATF4 were transfected into 90% confluent cells to knock down ATF4. GL2-luciferase siRNA duplex (siGL2) was used as a control. The cells were harvested 48 h after transfection.
Table 2 Sequences of oligonucleotides used as primer for real-time quantitative RT-PCR. Primer
Sequence
TLR2
Forward 50 -GGCCAGCAAATTACCTGTGTG-30 Reverse 50 -AGGCGGACATCCTGAACCT-30
TNF-a
Forward 50 -CAGCCTCTTCTCCTTCCTGA-30 Reverse 50 -TGAGGTACAGACCCTCTGAT-30
IL-8
Forward 50 -CTGGCCGTGGCTCTCTTG-30 Reverse 50 -CCTTGGCAAAACTGCACCTT-30
IL-6
Forward 50 -GCACTGGCAGAAAACAACCT-30 Reverse 50 -CAGGGGTGGTTATTGCATCT-30
CHOP
Forward 50 -ATGGCAGCTGAGTCATTGCCTTTC-30 Reverse 50 -AGAAGCAGGGTCAAGAGTGGTGAA-30
ERdj4
Forward 50 - AGTAGACAA AGGCATCATTTCCAA -30 Reverse 50 - CTGTATGCTGATTGGTAGAGTCAA -30
GRP78
Forward 50 -ACCAATTATCAGCAAACTCTATGGAA-30 Reverse 50 -CATCTTTTTCTGCTGTATCCTCTTCA-30
ATF4
Forward 50 -AGTGGCATCTGTATGAGCCCA-30 Reverse 50 -GCTCCTATTTGGAGAGCCCCT-30
18S rRNA
Forward 50 -CGGCTACCACATCCAAGGAA-30 Reverse 50 -GCTGGAATTACCGCGGCT-30
2.3. RT-PCR analysis
mTLR2
Forward 50 -TGCTTTCCTGCTGGAGATTT-30 Reverse 50 - TGTAACGCAACAGCTTCAGG-30
Total RNA was isolated from cells with RNAiso Plus (TaKaRa, Japan) according to the manufacturer’s instructions. Semi-quantitative reverse transcription PCR (RT-PCR) was carried out with an RT-PCR kit (TaKaRa) by the recommended protocol. The oligonu-
mCHOP
Forward 50 -CTCCTGTCTGTCTCTCCGGAA-30 Reverse 50 -TACCCTCAGTCCCCTCCTCA-30
m18S rRNA
Forward 50 -CCATCCAATCGGTAGTAGCG-30 Reverse 50 -GTAACCCGTTGAACCCCATT-30
S. Shimasaki et al. / Biochemical and Biophysical Research Communications 402 (2010) 235–240
and ATF4). The oligonucleotide primers used in the real-time quantitative PCR amplifications are shown in Table 2. 2.4. Flow cytometry To determine TLR2 protein expression, cells were treated with 0.1 lM thapsigargin. Twenty-four hours after treatment, cells were detached and washed twice with cold PBS. Cells were stained with anti-TLR2 monoclonal antibody and Alexa Fluor 488-labeled secondary antibody (Molecular Probes). Fluorescence was measured on a FACSCalibur flow cytometer (BD Biosciences) using 10,000 gated cells. 2.5. Animal experiments and tissue sample analysis Male C57BL/6 J mice (Charles River Laboratories Inc., Kanagawa, Japan) were housed in a vivarium in accordance with the guidelines of the animal facility center of Kumamoto University. The mice were maintained on food (standard or high-fat diet) and water ad libitum. The composition of high-fat diet was previously described [21]. For the tunicamycin injection experiments, 6-wk-old mice were injected with tunicamycin intraperitoneally at 1 lg/g body weight for 8 h. For the high-fat diet experiments, 4-wk-old mice were fed with high-fat diet for 12 weeks. Livers were harvested and total RNA was isolated by using RNAiso Plus with Recombinant DNase I (TaKaRa) according to the manufacturer’s instructions. 2.6. Statistical analysis Data are presented as mean ± SE For statistical analysis, the data were analyzed by one-way ANOVA with either Tukey–Kramer or
237
Dunnett’s multiple comparison test or Student’s t-test (JMP software, SAS Institute, NC, USA) as indicated in each figure legends. The differences were considered statistically significant when the P value was less than 0.05. 3. Results 3.1. ER stress induces TLR2 expression in vitro and in vivo We first examined whether ER stress influences the expression of TLRs in epithelial cells. HeLa cells were treated with the ER stress inducer, thapsigargin, for 24 h. TLR1–9 mRNAs expression was measured by semi-quantitative RT-PCR. As shown in Supplementary Fig. 1A, the treatment with thapsigargin induced the TLR2 and TLR5 expression. To confirm the effect of ER stress on the regulation of TLR2 and TLR5 expression in epithelial cells, we treated several epithelial cell lines with thapsigargin and evaluated the expression level of both TLR2 and TLR5 by quantitative real-time RT-PCR. Notably, mRNA expression of TLR2, but not TLR5, was significantly increased after the treatment with thapsigargin in HEK293, A549, and HCT116 cells (Supplementary Fig. 1B and C). Thus, we hereafter focused on TLR2 up-regulation induced by ER stress. To further confirm the effect of ER stress on TLR2 gene expression, we treated HeLa cells with various ER stress inducers, such as thapsigargin, tunicamycin and DTT. Thapsigargin increased the TLR2 expression in a dose-dependent and time-dependent manner (Fig. 1A and B). Tunicamycin or DTT-induced TLR2 up-regulation was also observed at 24 h after treatment (Fig. 1C). These data suggest that ER stress induces TLR2 mRNA expression. Next, we examined whether ER stress also affects the protein expression
Fig. 1. ER stress induces TLR2 expression in vitro and in vivo. (A) HeLa cells were treated for 24 h with the indicated concentration of thapsigargin (TG). (B) HeLa cells were treated for the indicated times with TG (0.1 lM). (C) HeLa cells were treated for 24 h with TG (0.5 lM), tunicamycin (TM) (1 lg/mL), or dithiothreitol (DTT) (2 mM). Relative quantity of TLR2 mRNA was analyzed by quantitative real-time RT-PCR using 18S rRNA as internal control. Values are the mean ± SE (n = 3 for A–C). *P < 0.05, assessed by ANOVA with the Dunnett procedure. (D) HeLa cells treated with TG (0.1 lM, 24 h) were incubated with anti-TLR2 antibody, stained with secondary Alexa 488-labeled antibody and analyzed by flow cytometry. Data shown in (D, left panel) is representative of three independent experiments. Right panel, values are means ± S.E. (n = 3). *P < 0.05, assessed by ANOVA with Tukey-Kramer procedure. (E) Mice were administered intraperitoneally with TM (1 lg/g body weight), and liver tissues were harvested at 8 h after injection. (F) Mice were fed normal diet or high-fat diet (HFD) for 12 weeks. Relative quantity of mouse TLR2 or mouse CHOP mRNA was analyzed by quantitative real-time RT-PCR using mouse 18S rRNA as internal control. Values are the mean ± SE (n = 3 for E and F). *P < 0.05, assessed by Student’s t-test.
238
S. Shimasaki et al. / Biochemical and Biophysical Research Communications 402 (2010) 235–240
Fig. 2. ER stress enhances TLR2-dependent induction of pro-inflammatory cytokines. (A–F) HeLa cells pretreated with thapsigargin (TG) (A–C, 0.1 lM), or dithiothreitol (DTT) (D–F, 2 mM) for 20 h were stimulated with peptidoglycan (PGN) (10 lg/mL) for 4 h. Relative quantity of TNF-a, IL-8 and IL-6 mRNA was analyzed by quantitative real-time RT-PCR using 18S rRNA as internal control. Values are the mean ± SE (n = 3). *P < 0.05, assessed by ANOVA with Tukey–Kramer procedure.
Fig. 3. ATF4 is important for ER stress-induced TLR2 up-regulation. (A–C) HeLa cells were transfected with ATF4 (A), XBP1s (B) or ATF6a (1–373) (C) for 24 h. (D) HeLa cells transfected with ATF4 siRNA (siATF4) were treated with thapsigargin (TG) (0.1 lM) for 24 h. Relative quantity of TLR2, CHOP, ERdj4, GRP78, and ATF4 mRNA was analyzed by quantitative real-time RT-PCR using 18S rRNA as internal control. Values are the mean ± SE (n = 3 for A–C, n = 6 for D). *P < 0.05 vs. control, assessed by Student’s t-test (n.s., not significant).
S. Shimasaki et al. / Biochemical and Biophysical Research Communications 402 (2010) 235–240
of TLR2. Flow cytometric analysis showed the increased cell surface expression of TLR2 in thapsigargin-treated cells (Fig. 1D), suggesting that ER stress also up-regulates the protein expression of TLR2 in epithelial cells. To determine whether TLR2 is up-regulated by ER stress in vivo, we used two ER stress mice models, the tunicamycin-injected [15] and the high-fat diet-fed mice [21]. As shown in Fig. 1E and F, TLR2 expression was higher in the livers of tunicamycin-treated and high-fat diet-fed mice compared with control. ER stress was induced in these mice because the expression of ER stress marker, CHOP was up-regulated (Fig. 1E and F, right). Taken together, these data demonstrated that ER stress induces TLR2 expression in vitro and in vivo. 3.2. ER stress enhances TLR2-dependent induction of proinflammatory cytokines
239
TLR2. Overexpression of ATF4 significantly increased the expression of TLR2 and CHOP, a known ATF4 target gene (Fig. 3A). On the other hand, overexpression of XBP1s did not significantly affect TLR2 expression despite the up-regulation of ERdj4, a specific XBP1 target gene (Fig. 3B). Overexpression of ATF6 did not change TLR2 expression although GRP78, a specific ATF6 target gene, was upregulated (Fig. 3C). To confirm the requirement of ATF4 on ER stress-induced TLR2 up-regulation, knockdown experiment of ATF4 was performed. Transfection of siATF4 inhibited thapsigargin-induced TLR2 up-regulation, congruent with the suppression of thapsigargin-induced ATF4 expression (Fig. 3D). These data suggest that ATF4 plays a role in the induction of TLR2 expression during ER stress. 3.4. Sustained activation of ATF4 pathway by salubrinal increases the expression and function of TLR2
To determine whether ER stress also affects the function of TLR2, we analyzed the induction of pro-inflammatory cytokines after the treatment with TLR2 ligand peptidoglycan in cells that have been untreated or pretreated with thapsigargin or DTT. As shown in Fig. 2, treatment with peptidoglycan for 4 h slightly increased the expression of TNF-a, IL-8, and IL-6 in HeLa cells (Fig. 2, CON, peptidoglycan-treated). Interestingly, pretreatment with thapsigargin significantly enhanced peptidoglycan-induced up-regulation of these pro-inflammatory cytokines (Fig. 2A–C). Pretreatment with DTT also had similar effect (Fig. 2D–F). Thus, our data showed that ER stress enhances TLR2-dependent induction of pro-inflammatory cytokines.
We further confirmed the importance of ATF4 by treatment with the specific eIF2a phosphatase inhibitor, salubrinal [22]. Notably, salubrinal increased the expression of TLR2 as well as ATF4 target gene CHOP, but not that of GRP78 (Fig. 4A–C). Consistent with these data, pretreatment with salubrinal enhanced peptidoglycan-induced TNF-a, IL-8, and IL-6 up-regulation (Fig. 4D–F), suggesting that sustained activation of ATF4 pathway increases the expression and function of TLR2. Collectively, these data confirmed the importance of ATF4 pathway during ER stress for the regulation of TLR2 expression and function in epithelial cells.
3.3. ATF4 is involved in ER stress-induced TLR2 up-regulation
4. Discussion
We next determined which UPR signaling pathway is responsible for TLR2 up-regulation by ER stress. At first, we examined the effect of ATF4, XBP1s, or ATF6a (1–373) on the expression of
Although recent reports have shown that TLR signaling is associated with ER stress response [15,16], it is still unclear whether ER stress influences the expression of TLRs. The data presented here
Fig. 4. Specific activation of ATF4 pathway increases the expression and function of TLR2. (A–C) HeLa cells were treated with salubrinal (30 lM) for 24 h. (D–F) HeLa cells pretreated with salubrinal (30 lM) for 24 h were stimulated with peptidoglycan (PGN) (10 lg/mL) for 4 h. Relative quantity of the indicated genes was analyzed by quantitative real-time RT-PCR using 18S rRNA as internal control. Values are the mean ± SE (n = 3). *P < 0.05, assessed by Student’s t-test (for A–C) or ANOVA with Tukey– Kramer (for D–F).
240
S. Shimasaki et al. / Biochemical and Biophysical Research Communications 402 (2010) 235–240
are the first to show that ER stress increases TLR2 expression in vitro and in vivo. Moreover, ER stress enhances TLR2-dependent pro-inflammatory cytokine production. Our findings may have important implications for host defense and response against cellular stress. In unstimulated epithelial cells, the relatively low expression of TLR2 is an important aspect of TLR2 function because under limiting conditions cellular responses to PAMPs can be stringently regulated by controlling the amount of TLR protein produced [23]. When epithelial cells are exposed to various stimuli such as viral infection [24], high-fat diet [4] and cigarette smoke [6], the host cells induce ER stress to initiate appropriate response to existing cellular insults. Activation of TLR2 may be one of the responses triggered by ER stress. Recent reports suggested that TLR2 recognizes not only microbial components but also endogenous sources, including GRP94 [25] and high-mobility group box 1 [26], and induces the production of pro-inflammatory cytokines and apoptosis [27,28]. However, persistent ER stress may promote inflammation by regulating the intensity and duration of innate immune responses. Inflammation can also be triggered by a chronic excess of metabolic factors (such as lipids, glucose and cytokines), which can elicit UPR in physiological and pathological settings, thereby triggering a vicious cycle of inflammation and cellular stress leading to metabolic deterioration [3]. It was recently demonstrated that TLR2 and TLR4 activated ER stress-related transcription factor XBP1 [16], providing evidence that TLR signaling is intimately linked with ER stress response. Here we showed that ER stress via ATF4 could activate the TLR2 pathway, supporting the idea that a positive feedback mechanism exists between ER stress and inflammatory cytokine production. Interestingly, it was demonstrated that TLR3 and TLR4 inhibited ATF4 signaling, suggesting that host cells may have adapted this mechanism to protect cells from physiologically prolonged ER stress associated with host defense [15]. We have shown here the involvement of ATF4 in the up-regulation of TLR2 by ER stress inducers (Figs. 3 and 4) but the mechanism of how ATF4 activates TLR2 is still unclear. ATF4 may directly bind to the TLR2 promoter region and transactivate TLR2 gene expression. However, we cannot find an ATF4 binding region within the 2 kb TLR2 promoter (data not shown). Another possible mechanism is that ATF4 is indirectly involved in ER stress-induced TLR2 up-regulation. Certain ATF4 target gene/s may induce TLR2 expression. Further investigations may clarify the mechanism of ATF4 function associated with ER stress-induced TLR2 up-regulation. In summary, our findings revealed that ER stress increases TLR2 gene expression and function via ATF4 pathway in epithelial cells. This study contributes to our knowledge on how ER stress may influence inflammatory responses. Acknowledgments The HCT116 cells were donated Dr. Bert Vogelstein of Johns Hopkins Institute. This work was supported in part by grants from the Ministry of Education, Science, Sport, and Culture (MEXT) of Japan, the Nakatomi Foundation and the Global COE Program (Cell Fate Regulation Research and Education Unit), MEXT, Japan. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.bbrc.2010.09.132. References [1] M. Schroder, R.J. Kaufman, The mammalian unfolded protein response, Annu. Rev. Biochem. 74 (2005) 739–789. [2] D. Ron, P. Walter, Signal integration in the endoplasmic reticulum unfolded protein response, Nat. Rev. Mol. Cell Biol. 8 (2007) 519–529.
[3] K. Zhang, R.J. Kaufman, From endoplasmic-reticulum stress to the inflammatory response, Nature 454 (2008) 455–462. [4] U. Ozcan, E. Yilmaz, L. Ozcan, M. Furuhashi, E. Vaillancourt, R.O. Smith, C.Z. Gorgun, G.S. Hotamisligil, Chemical chaperones reduce ER stress and restore glucose homeostasis in a mouse model of type 2 diabetes, Science 313 (2006) 1137–1140. [5] Y. Li, R.F. Schwabe, T. DeVries-Seimon, P.M. Yao, M.C. Gerbod-Giannone, A.R. Tall, R.J. Davis, R. Flavell, D.A. Brenner, I. Tabas, Free cholesterol-loaded macrophages are an abundant source of tumor necrosis factor-alpha and interleukin-6: model of NF-kappaB- and map kinase-dependent inflammation in advanced atherosclerosis, J. Biol. Chem. 280 (2005) 21763–21772. [6] T.L. Adair-Kirk, J.J. Atkinson, R.M. Senior, Smoke particulates stress lung cells, Nat. Med. 14 (2008) 1024–1025. [7] O. Takeuchi, S. Akira, Pattern recognition receptors and inflammation, Cell 140 (2010) 805–820. [8] S.C. Gribar, W.M. Richardson, C.P. Sodhi, D.J. Hackam, No longer an innocent bystander: epithelial toll-like receptor signaling in the development of mucosal inflammation, Mol. Med. 14 (2008) 645–659. [9] R. Medzhitov, Origin and physiological roles of inflammation, Nature 454 (2008) 428–435. [10] P.J. Sansonetti, The innate signaling of dangers and the dangers of innate signaling, Nat. Immunol. 7 (2006) 1237–1242. [11] L. Zitvogel, O. Kepp, G. Kroemer, Decoding cell death signals in inflammation and immunity, Cell 140 (2010) 798–804. [12] R. Salomao, M.K. Brunialti, N.E. Gomes, M.E. Mendes, R.S. Diaz, S. Komninakis, F.R. Machado, I.D. da Silva, O. Rigato, Toll-like receptor pathway signaling is differently regulated in neutrophils and peripheral mononuclear cells of patients with sepsis, severe sepsis, and septic shock, Crit. Care Med. 37 (2009) 132–139. [13] B. Szebeni, G. Veres, A. Dezsofi, K. Rusai, A. Vannay, M. Mraz, E. Majorova, A. Arato, Increased expression of Toll-like receptor (TLR) 2 and TLR4 in the colonic mucosa of children with inflammatory bowel disease, Clin. Exp. Immunol. 151 (2008) 34–41. [14] A. Komatsuda, H. Wakui, K. Iwamoto, M. Ozawa, M. Togashi, R. Masai, N. Maki, T. Hatakeyama, K. Sawada, Up-regulated expression of Toll-like receptors mRNAs in peripheral blood mononuclear cells from patients with systemic lupus erythematosus, Clin. Exp. Immunol. 152 (2008) 482–487. [15] C.W. Woo, D. Cui, J. Arellano, B. Dorweiler, H. Harding, K.A. Fitzgerald, D. Ron, I. Tabas, Adaptive suppression of the ATF4-CHOP branch of the unfolded protein response by toll-like receptor signalling, Nat. Cell Biol. 11 (2009) 1473–1480. [16] F. Martinon, X. Chen, A.H. Lee, L.H. Glimcher, TLR activation of the transcription factor XBP1 regulates innate immune responses in macrophages, Nat. Immunol. 11 (2010) 411–418. [17] H. Yoshida, A. Uemura, K. Mori, pXBP1(U), a negative regulator of the unfolded protein response activator pXBP1(S), targets ATF6 but not ATF4 in proteasome-mediated degradation, Cell Struct. Funct. 34 (2009) 1–10. [18] K. Haze, H. Yoshida, H. Yanagi, T. Yura, K. Mori, Mammalian transcription factor ATF6 is synthesized as a transmembrane protein and activated by proteolysis in response to endoplasmic reticulum stress, Mol. Biol. Cell 10 (1999) 3787–3799. [19] H. Yoshida, T. Matsui, A. Yamamoto, T. Okada, K. Mori, XBP1 mRNA is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription factor, Cell 107 (2001) 881–891. [20] T. Shuto, T. Furuta, M. Oba, H. Xu, J.D. Li, J. Cheung, D.C. Gruenert, A. Uehara, M.A. Suico, T. Okiyoneda, H. Kai, Promoter hypomethylation of Toll-like receptor-2 gene is associated with increased proinflammatory response toward bacterial peptidoglycan in cystic fibrosis bronchial epithelial cells, FASEB J. 20 (2006) 782–784. [21] S. Morino, T. Kondo, K. Sasaki, H. Adachi, M.A. Suico, E. Sekimoto, T. Matsuda, T. Shuto, E. Araki, H. Kai, Mild electrical stimulation with heat shock ameliorates insulin resistance via enhanced insulin signaling, PLoS One 3 (2008) e4068. [22] M. Boyce, K.F. Bryant, C. Jousse, K. Long, H.P. Harding, D. Scheuner, R.J. Kaufman, D. Ma, D.M. Coen, D. Ron, J. Yuan, A selective inhibitor of eIF2alpha dephosphorylation protects cells from ER stress, Science 307 (2005) 935–939. [23] T. Shuto, A. Imasato, H. Jono, A. Sakai, H. Xu, T. Watanabe, D.D. Rixter, H. Kai, A. Andalibi, F. Linthicum, Y.L. Guan, J. Han, A.C. Cato, D.J. Lim, S. Akira, J.D. Li, Glucocorticoids synergistically enhance nontypeable Haemophilus influenzaeinduced Toll-like receptor 2 expression via a negative cross-talk with p38 MAP kinase, J. Biol. Chem. 277 (2002) 17263–17270. [24] B. He, Viruses, endoplasmic reticulum stress, and interferon responses, Cell Death Differ. 13 (2006) 393–403. [25] Q.Q. Huang, R. Sobkoviak, A.R. Jockheck-Clark, B. Shi, A.M. Mandelin 2nd, P.P. Tak, G.K. Haines 3rd, C.V. Nicchitta, R.M. Pope, Heat shock protein 96 is elevated in rheumatoid arthritis and activates macrophages primarily via TLR2 signaling, J. Immunol. 182 (2009) 4965–4973. [26] J.F. Curtin, N. Liu, M. Candolfi, W. Xiong, H. Assi, K. Yagiz, M.R. Edwards, K.S. Michelsen, K.M. Kroeger, C. Liu, A.K. Muhammad, M.C. Clark, M. Arditi, B. Comin-Anduix, A. Ribas, P.R. Lowenstein, M.G. Castro, HMGB1 mediates endogenous TLR2 activation and brain tumor regression, PLoS Med. 6 (2009) e10. [27] A.O. Aliprantis, R.B. Yang, D.S. Weiss, P. Godowski, A. Zychlinsky, The apoptotic signaling pathway activated by Toll-like receptor-2, EMBO J. 19 (2000) 3325– 3336. [28] Y. Li, H. Li, Y. Zhang, X. Sun, G.A. Hanley, G. LeSage, Y. Zhang, S. Sun, Y. Peng, D. Yin, Toll-like receptor 2 is required for opioids-induced neuronal apoptosis, Biochem. Biophys. Res. Commun. 391 (2010) 426–430.