- Email: [email protected]
Endothelin B receptor antagonists block proliferation and induce apoptosis in glioma cells
Pharmacological Research 61 (2010) 306–315
Contents lists available at ScienceDirect
Pharmacological Research journal homepage: www.elsevier.com/locate/yphrs
Endothelin B receptor antagonists block proliferation and induce apoptosis in glioma cells Mayra Paolillo a , Marika A. Russo a , Daniela Curti b , Cristina Lanni a , Sergio Schinelli a,∗ a b
Dipartimento di Farmacologia Sperimentale ed Applicata, Università di Pavia, Viale Taramelli 14, 27100 Pavia, Italy Dipartimento di Medicina legale, Scienze Forensi e Farmaco-tossicologiche A. Fornari, Università di Pavia, 27100 Pavia, Italy
a r t i c l e
i n f o
Article history: Received 17 July 2009 Received in revised form 9 November 2009 Accepted 9 November 2009 Keywords: Endothelin BQ788 A192621 Glioma cells Apoptosis
a b s t r a c t The proliferative and antiapoptotic actions of endothelin (ET)-1 in cancer cells have been documented and ET receptor antagonists have been exploited as potential anticancer drugs. Glioblastoma cell lines express both ETA and ETB receptors and previous works have shown that ETB receptors are involved in the proliferation of different cancer cell types. In this study we have investigated the effects of two structurally unrelated ETB receptor antagonists, BQ788 and A192621, on cell survival, proliferation and apoptosis in 1321-N1, U87 and IPDDCA2 glioma cell lines. BQ788 and A192621 reduced glioma cells viability and proliferation assessed by BrdU incorporation and cell cycle analysis by flow cytometry, while in contrast the ETA receptor antagonist BQ123 had no effect on cell survival. TUNEL assay and immunocytochemical experiments showed that BQ788 and A192621 trigger apoptotic processes mainly via activation of the intrinsic mitochondrial pathway involving caspase-9 activation, AIF release and cytochrome c translocation. Furthermore, treatment with ETB antagonists downregulates ERK- and p38MAPK-dependent pathways but does not affect VEGF mRNA levels. Our findings support the hypothesis that ETB antagonists represent a new promising therapeutic strategy for the treatment of high grade gliomas. © 2009 Elsevier Ltd. All rights reserved.
1. Introduction The endothelin (ET) family of peptides (ET-1, ET-2, ET-3), originally isolated for their potent vasoconstrictive activity, are widely expressed in many anatomical regions, including the human brain [1]. ETs display a well characterized mitogenic activity that is involved not only in vascular remodeling and angiogenesis, but also in proliferative processes in a variety of cell types [2]. ETs exert their effects via the stimulation of two G-protein coupled receptor subtypes, ETA and ETB, that display overlapping tissue distribution and functional effects. However, at present, it is not clear whether these two structurally distinct receptors mediate ETs activity via common or separate signal transduction pathways. Because ETs display mitogenic and pro-angiogenic properties, the ET axis has been implicated in tumor growth and progression [3]. An increased expression of ET-1 mRNA has been demonstrated in human lung squamous cell carcinomas and adenocarcinomas [4] and immunoreactive ET-1, together with functional ET receptors, has also been detected in human ovarian [5], colon [6] and prostate cancer cell lines [7].
Abbreviation: ETs, Endothelin. ∗ Corresponding author. Tel.: +39 0382 987404; fax: +39 0382 987405. E-mail address: [email protected] (S. Schinelli). 1043-6618/$ – see front matter © 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.phrs.2009.11.003
Several studies have also demonstrated the expression of the ET axis in different types of brain tumors [8]. The ET axis is likely involved in the crosstalk between tumor cells and peritumoral elements in brain tumors because ETB receptors were detected by immunohistochemical analysis in human astrocytoma samples throughout the tumor cells as well as in endothelial cells of tumor blood vessels [9]. The expression of functional ETA and ETB receptors has been documented in oligodendroglioma and oligoastrocitoma [10]. The components of the ET axis are expressed in human glioblastoma tissue and cell lines [11] and in surgical samples of human diffuse astrocytoma [12]. In a previous study we showed that human glioblastoma cell lines release ET-1 and express functional ETB receptors, while ETA expression appears to be absent or barely detectable [13]. The mitogenic properties of ETs have prompted studies on ETA and ETB blockade in cancer. Indeed, ETA receptor antagonists, alone or in combination with other cytostatic agents, induce apoptosis or inhibit cell proliferation in ovarian, prostate, colon carcinoma cells [2]. The functional consequences of ETB blockade were mainly investigated in melanocytes in which the selective ETB receptor antagonist BQ788 causes growth inhibition and cell death [14–16]. Although the cellular effects and transduction pathways activated by ETB stimulation have been characterized in detail in cultured astrocytes [17–19], at present the molecular mechanisms underlying the cellular responses to ETB receptor blockade in human glioblastoma cells are very poorly understood.
M. Paolillo et al. / Pharmacological Research 61 (2010) 306–315
307
The present study was therefore undertaken to investigate the effects of two structurally distinct ETB antagonists on cell viability, cell proliferation and to elucidate the molecular mechanisms underlying ETB antagonist-induced apoptosis in three human glioblastoma cell lines. Our results show that ETB antagonists block human glioblastoma cell lines proliferation followed by cell death via an intrinsic caspase-dependent mechanism probably involving a dysregulation of ERK-dependent and p38MAPK-dependent pathways.
100 U/ml RNase, and 0.01% Nonidet NP40 in double distilled water). Flow cytometric measurements were taken with at least 20,000 cells contained in the gated regions used for calculations. Flow cytometric analysis was performed by a FACStar fluorescence-activated cell sorter (Becton Dickinson, San José, CA, USA) equipped with a laser excitation (power 200 mW) at 488 nm and a 610 nm long-pass filter for the red fluorescence signals.
2. Materials and methods
For the relative quantification of apoptosis a sandwich immunoassay was performed to detect the amount of nucleosomes (Cell death detection ELISA, Roche diagnostics). Cells plated in 12 multiwell were treated with 10 M BQ788 or A192621 for 72 h. At the end of the incubation time, the assay was performed following the manufacturer’s instructions and the colorimetric signal was detected by a multiwell reader at 405 nm.
2.1. Materials The ETA antagonist BQ123 and the ETB antagonist BQ788 were purchased from Bachem (Switzerland) and the ETB antagonist A192621 was obtained from Abbott. All cell culture reagents were purchased from Euroclone, Italy. Primary antibodies were purchased from the following sources: ERK/p-ERK and p38MAPK/p-p38MAPK from Biosource; AKT/p-AKT from Cell Signaling; p21, cyclin D1, AIF from Santa Cruz and cytochrome c from BD Bioscience. The HRP conjugated secondary antibodies were obtained from Jackson Lab (USA) and fluorophore conjugated secondary antibodies from Invitrogen. 2.2. Cell culture The 1321N1 and U87 human glioblastoma cell lines were purchased from Istituto Zootecnico Regione Lombardia (Brescia, Italy) while the grade II astrocytoma cell line IPDDC-A2, were purchased from the European Cell Culture Collection (UK). The cell lines were routinely split (1:5 ratio) by trypsinization and propagated in DMEM supplemented with 5% fetal bovine serum (FBS) containing 2 mM glutamine, penicillin-streptomycin (10,000 u/ml) at 37 ◦ C in controlled atmosphere (5% CO2 /95% air). All the cell lines were negative when tested for mycoplasma contamination by the Mycoplasma Species kit (Euroclone, Italy). For biochemical experiments, cells were plated in multiwell or dishes (10,000/cm2 ), serum-starved 24 h and then grown in culture medium containing 1% FBS in the presence of the ETB antagonists for the indicated time. 2.3. MTS cell viability assay Cells lines plated in 96 multiwells were treated with 10 M BQ123, 10 M BQ788 or 10 M A192621 for 48 h. At the end, 20 l of CellTiter 96 reagent (Promega) was added to each well and after 3 h the colorimetric signal was detected by a multiwell plate reader at 490 nm. 2.4. BrdU-ELISA cell proliferation assay Cells were plated in 96 multiwells and treated with 10 M BQ788 and 10 M A192621 for 48 h. At the end, 10 l of BrdU from the cell proliferation ELISA BrdU kit (Roche diagnostics) were added to each well. After a 5 h incubation, the assay was performed following the manufacturer’s instructions. The samples were read in a multiwell reader at 450 nm. 2.5. FACS analysis The effect of the two ETB antagonists on the cell cycle was determined by flow cytometry of propidium iodide-stained nuclei. The cells were plated in 100 mm Petri dishes and treated with the drugs (10 M) for 48 h. At the end of treatments, cells were collected, washed in PBS (phosphate buffered saline) and resuspended in 0.5 ml of a propidium iodide solution (50 g/ml propidium,
2.6. ELISA nucleosome apoptosis assay
2.7. Caspase-9 colorimetric assay Cells were plated in 12 multiwells and treated with 10 M BQ788 and 10 M A192621 for 72 h. At the end of treatment with ETB antagonists the cells were first pelleted and then resuspended in lysis buffer. The measurement of caspase-9 activity was assessed by the Caspase-9 colorimetric assay kit (BioVision, USA) following manufacturer’s instructions. Briefly, an aliquot of cell lysate was incubated with the caspase-9 substrate LEHD-pNA for 2 h at 37 ◦ C and at the end of incubation period the released chromophore compound pNA was quantified by a microplate reader at 405 nm. Results are expressed as fold increase of caspase-9 activity in ETBantagonists treated cell lines compared to control (untreated) cell lines. 2.8. TUNEL assay Terminal-deoxynucleotidyl transferase-mediated dUTP-nick end-labeling (TUNEL) assay was performed by the DeadEnd Fluorimetric TUNEL System (Promega) according to the manufacturer’s instructions. Briefly, after treatment with ETB antagonists for 72 h, cells were fixed in 4% formaldehyde for 30 min, washed in PBS and permeabilized for 15 min at room temperature with 0.01% Triton X-100 in PBS. Coverslips were incubated for 1 h at 37 ◦ C with TUNEL reaction mixture (enzyme solution + labeling solution) and then counterstained with Hoechst 33258 for 15 min. TUNEL-positive cells were counted and results are expressed as percentage of total cells. 2.9. Immunocytochemical analysis Cells were plated onto 12 mm polylysine coated coverslips (2500 cells/coverslip) and incubated with 10 M BQ788 and 10 M A192621 for 72 h. At the end of treatments the cells were fixed in 4% formaldehyde for 30 min, washed in PBS and permeabilized for 15 min at room temperature by 0.01% Triton X-100 in PBS. Non-specific binding was blocked by incubation for 30 min in PBS containing 1% bovine serum albumin (BSA). Cells were incubated for 1 h with specific antibodies for caspase-9 or AIF diluted 1:50 or 1:10 in a PBS/1% BSA solution. Cells were washed in PBS and then incubated for 1 h at room temperature with an anti-goat Alexa 488 conjugated antibody (Invitrogen) diluted 1:200 in PBS/1% BSA. At the end of the incubation period, cells were repeatedly washed PBS/1% BSA and stained with 1 M Hoechst 33342 (Sigma–Aldrich). For cytochrome c localization, cells were incubated for 20 min at 37 ◦ C in the presence of 300 nM Mitotracker DeepRed (Invitrogen), washed three times in PBS and fixed in 3.7% formaldehyde for 15 min at 37 ◦ C. The cells were then washed in PBS and incubated
308
M. Paolillo et al. / Pharmacological Research 61 (2010) 306–315
for 45 min in PBS containing 0.1% Triton X-100, 1% bovine serum albumin (BSA) and 10% normal goat serum. The cells were then incubated for 90 min at 37 ◦ C with mouse anti-human cytochrome c antibody diluted 1:5000 in PBS containing 0.01% Triton X-100 and 0.1% BSA. Cells were washed three times in wash solution and then incubated for 45 min at room temperature with goat anti-mouse conjugated with Alexa 488 secondary antibody diluted 1:500 in wash solution. At the end of the incubation cells were repeatedly washed with PBS and counterstained with 1 M Hoechst 33342 for 15 min at room temperature. Coverslips were mounted with mowiol reagent and images were acquired with a laser scanning confocal microscopy (TCP-SP3, Leica) equipped with 63× or 40× oil immersion objectives.
The detection of VEGF-A protein released in the extracellular medium was assessed by a sandwich ELISA immunoassay (Human VEGF-A ELISA Assay, Bender MedSystems). Cells plated in 12 multiwell were treated with 10 M BQ788 or A192621 for 72 h. At the end of the incubation time, the VEGF-A assay was performed following the manufacturer’s instructions and the colorimetric signal was detected by a multiwell reader at 405 nm. The amount of released VEGF-A protein, calculated by constructing a standard calibration curve, was quantified as fg protein/ml extracellular medium. The effect of ETB antagonists treatment was expressed as percentage fold change compared to untreated cell lines.
2.10. Western blot analysis
2.13. Statistical analysis
Cells were treated for the indicated time with the ETB antagonists BQ788 (10 M) and A192621 (10 M). To obtain total cell lysates, the cells were rinsed twice in ice-cold PBS and 200 l of cell lysis buffer were added to the dishes (composition: 50 mM Tris–HCl pH 7.4, 1% v/v NP40, 0.25% w/v sodium deoxycholate, 1 mM phenylmethylsulphonyl-fluoride (PMSF), 1 mM Na3 VO4 , 1 mM EDTA, 30 mM sodium pyrophosphate, 1 mM NaF, 1 g/ml leupeptin, 1 g/ml pepstatin A, 1 g/ml aprotinin and 1 g/ml microcystin). After scraping, the cells were sonicated for 10 s, centrifugated at 12,000 × g for 5 min at 4 ◦ C and the amount of proteins in the supernatant was measured by the BCA protein Assay Kit (Pierce). For cytochrome c and AIF analysis, separation of cytosolic from mitochondrial fractions was performed as previously described [20]. Briefly, treated cells were scraped, resuspended in lysis buffer, homogenized by potter, and then centrifugated at 900 × g for 5 min at 4 ◦ C to separate nuclei. The supernatant (cytosol) was separated by centrifugation at 17,000 × g for 10 min at 4 ◦ C and then used for western blot analysis. 30 g of proteins were separated by 10% SDS-PAGE at 150 V for 2 h and blotted onto 0.22 m nitrocellulose membranes at 50 mA for 16 h. The membranes were first blocked for 2 h in Tris buffered saline solution (TBST composition: Tris 10 mM, NaCl 150 mM, 0.1% v/v Tween 20) plus 5% low fat dry milk (TBSTM) and then incubated with the appropriate primary antibody diluted 1:1000 in TBSTM for 16 h at 4 ◦ C under gentle agitation. The membranes were rinsed three times in TBST and then incubated for 2 h at rt with a goat anti-rabbit IgG HRP-conjugate secondary antibody diluted 1:5000 in TBSTM. The membranes were rinsed three times in TTBS and the luminescent signal was detected by the ECL plus Western Blotting Detection System (Amersham). Densitometric analysis of protein bands was performed using the Scion Image software package.
Unless otherwise specified, data are expressed as mean ± SD of three different experiments run in triplicate. Statistical analysis ANOVA was performed by the Instat3 software.
2.11. Real time RT-PCR Total RNA extraction, retrotranscription to cDNA and quantitative real time RT-PCR analysis were performed as previously reported [13]. Primers were designed by using the “Primer3 input” software (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3.cgi/ primer3 www.cgi) and the specificity of each primer was controlled by the BLAST software (http://blast.ncbi.nlm.nih.gov/Blast. cgi). The primers sequences were 5 -TGTGAGTGGTTGACCTTCCTC forward and 5 -GATCCTGCCCTGTCTCTCTGT reverse for vascular endothelial growth factor (VEGF, Genebank NM 001025366) and 5 -AGATTACGGAGCAGCGCAAGATTG forward and 5 GCAAACACAGATCGCAGGTAGCCC reverse for ribosomal protein L6 (RPL6, Genebank NM 001024662). Relative transcript quantification was calculated by the (Ct) method using RPL6 as reference gene and data are expressed as fold increase of VEGF mRNA levels in treated cells compared to control cells.
2.12. VEGF-A ELISA assay
3. Results 3.1. ETB antagonists decrease cell viability A preliminary set of experiments was performed to test the effect of ETA and ETB receptor antagonists on cell viability. Cells were treated for 48 h with the ETB antagonists BQ788 (10 M), the other ETB antagonist A192621 (10 M) or the ETA antagonist BQ123 (10 M) and then cell viability was assessed by the MTS assay. Treatment with A192621 reduced cell viability by 39.2% (p < 0.001) in U87, by 31.6% (p < 0.001) in IPDDCA2 cell lines and by 33.2% in 1321-N1 cell line (p < 0.001). The ETB antagonist BQ788 showed a similar effect inducing a 33.8% decrease in U87 cell line (p < 0.001), a 29.1% decrease (p < 0.001) in IPDDCA2 cell line and a 30.9% decrease (p < 0.001) in 1321-N1 cell line. Notably, the ETA antagonist BQ123 (10 M) displayed no effect in any cell line tested (Fig. 1a). 3.2. ETB antagonists decrease cell proliferation To gain further insight into the mechanisms that underlie the ETB-induced decrease in cell viability, we measured changes in cell proliferation rate. Firstly, we measured the modified base BrdU incorporation into cells by an ELISA test. Treatment with BQ788 or A192621 resulted in a statistically significant decrease in BrdU incorporation in all the cell lines examined (Fig. 1b). Compared to BQ788, the BrdU incorporation decrease induced by A192621 was more notable because A192621 reduced BrdU by 27.1% (p < 0.001) in U87, 17.4% (p < 0.001) in IPDDCA2 cell lines and 20.2% in 1321-N1 (p < 0.01). On the other hand, BQ788 elicited its maximal effect in reducing BrdU incorporation in 1321-N1 cell lines (25.2%; p < 0.001) while it showed a more modest effect in U87 (16.2%; p < 0.05) and IPDDCA2 (10.1%; p < 0.05). To confirm these findings, we performed a flow cytometric analysis to investigate possible changes in the cell cycle phases upon treatment with ETB antagonists. Cells were treated with 10 M BQ788 and 10 M A19262 for 48 h, stained with propidium iodide and then analyzed by flow cytometry. A representative experiment performed in the three glioma cell lines is depicted in Fig. 2. Statistical analysis of the distribution of cell cycle phases, reported in Table 1, demonstrated that the two ETB antagonists exert an overlapping effect on the expression pattern of cell cycle, except for slight modifications probably due to the intrinsic heterogeneity of the cell lines examined. The most prominent effect elicited by the two ETB antagonists, compared to untreated cells, results in a statistically significant decrease in the percentage
M. Paolillo et al. / Pharmacological Research 61 (2010) 306–315
309
3.3. ETB antagonists induce apoptosis Since in malignant glioma in vitro the inhibition of cell proliferation has been shown to induce apoptosis [21], we tested whether ETB antagonists may induce apoptosis in our experimental model. Apoptotic damage in treated cells was first assessed by a bulk ELISA assay that detects the presence of fragmented DNA (nucleosomes). Preliminary time-course experiments revealed that a 24 or 48 h treatment with ETA and ETB antagonists did not significantly affect the amount of nucleosomes in treated cells compared to control untreated cells (not shown). However, a 72 h treatment with ETB antagonists elicited a statistically significant increase (p < 0.01) of nucleosome content in cells treated with BQ788 (3.4 ± 0.6 in 1321N1; 2.9 ± 0.4 in U87 and 4.1 ± 0.5 in IPDDCA2 cell lines) or with A192621 (5.8 ± 0.8 in 1321-N1; 4.9 ± 0.7 in U87 and 8.5 ± 0.9 in IPDDCA2 cell lines) compared to untreated cells. Notably, the ETA antagonist BQ123 (10 M) elicited no effect even after 72 h treatment. In addition, in order to evaluate more in detail the extent of apoptotic process, the percentage of apoptotic cells induced by the same treatment with ETB antagonists was assessed by a TUNEL assay. In good agreement with the data obtained from the nucleosome assay, the compound A192621 was more potent (range 24.0–70.8%) than BQ788 (range 15.3–30.1%) in eliciting a statistically significant increase (p < 0.01) of TUNEL-positive cells in the three cell lines examined (Fig. 4). Fig. 1. (a) ETB antagonists reduce cell viability in glioma cell lines. Cell lines were treated for 48 h with the ETA antagonist BQ123 (10 M) or the ETB antagonists BQ788 (10 M) and A192621 (10 M) and cell viability was measured by MTS assay. The results are expressed as percentage of untreated control cells. (b) ETB antagonists reduce cell proliferation in glioma cell lines. Cell lines were treated for 48 h with the ETB antagonists BQ788 (10 M) and A192621 (10 M) and at the end of treatment cell proliferation was measured by an ELISA BrdU incorporation assay. The results are expressed as percentage of untreated control cells. ***p < 0.001; **p < 0.01; *p < 0.05.
of cell in G1 and G2 phases associated with a concomitant increase in the percentage of cell in the S phase. Moreover, in U87 and IPDDCA2 cell lines, the antagonist BQ788 was more efficacious than the other antagonist A192621 in inducing a statistically significant increase in G1 phase associated with a concomitant decrease of the percentage of treated cells in S phase. These results show that the treatment of glioma cell lines with the two ETB antagonists caused a significant inhibition of cell cycle progression. To further confirm these perturbations of cell cycle in our experimental model, we next investigated the effects of the same treatment with ETB antagonists on the level of two key cell cyclerelated regulating factors, the cyclin D1 and p21 proteins. When cell lysates were analyzed by western blot, a decrease of cyclin D1 expression and a concomitant increase of p21, compared to untreated cells, was observed in 1321N-1 and U87 cell lines treated with 10 M BQ788 or 10 M A192621 for 48 h (Fig. 3).
3.4. ETB antagonists induce caspase-9 activation Recent evidence has shown that apoptosis may be induced either by a caspase-dependent or by a caspase-independent pathway [22]. Caspase-dependent apoptosis can be mainly triggered by two alternate but not mutually exclusive patterns of activation: an extrinsic pathway activated by cell-surface death receptors followed by the activation of caspase-8 and an intrinsic pathway that involves the disruption of mitochondrial membrane integrity followed by the activation of caspase-9. We first investigated the possible involvement of caspase-9 by means of fluorescence immunocytochemistry using antibodies recognizing the cleaved activated caspase-9 isoform. In U87 cell lines A192621 strongly increases the amount of cleaved caspase-9 (right picture, first row in Fig. 5) compared to untreated cells (left picture, first row in Fig. 5). The same effect, albeit to a lesser extent, is induced by the other ETB antagonist BQ788 (central picture, first row in Fig. 5). Similar results were obtained for the other two cell lines 1321-N1 and IPDDCA2 (data not shown). As a complementary approach to further evaluate the extent of caspase-9 activation in our experimental model, we performed a caspase-9 activation colorimetric assay. Treatment for 72 h with the two ETB antagonists BQ788 and A192621 induced a statistically significant increase of caspase-9 activity in the three cell lines examined (Fig. 6) confirming the results above reported by immunocytochemistry. 3.5. ETB antagonists induce cytochrome c release and AIF translocation
Table 1 Statistical analysis of the distribution of cell cycle phases (*p < 0.05; **p < 0.01). Cell line
Phase
CTR
BQ788
A192621
1321-N1
G1 S G2
59.5 ± 3.6 13.9 ± 2.8 25.4 ± 3.8
58.8 ± 4.5 20.4 ± 2.7* 16.5 ± 5.8*
61.7 ± 4.8 19.6 ± 3.3* 18.9 ± 1.4
U87
G1 S G2
54.1 ± 2.7 22.9 ± 3.2 23.1 ± 4.5
67.1 ± 10.6* 12.2 ± 4.5** 17.8 ± 1.9
62.4 ± 5.1 19.6 ± 3.4 14.1 ± 4.4*
IPDDCA2
G1 S G2
20.5 ± 5.2 31.1 ± 4.7 14.6 ± 3.7
75.8 ± 4.1** 7.9 ± 3.2** 15.5 ± 2.2
64.6 ± 7.9* 18.1 ± 7.1* 15.7 ± 2.6
The activation of caspase-9 is induced by the mitochondrial release of cytochrome c and other proteins that form the functionally active protein complex apoptosome [22]. To confirm the involvement of a mitochondria-dependent apoptotic pathway in ETB antagonists-induced apoptosis, we measured changes in the mitochondrial transmembrane potential (m) by using the mitotracker deep red dye and the mitochondrial release of cytochrome c by immunofluorescence (Fig. 7). In untreated glioma cells lines the majority of cytochrome c is retained inside the mitochondrial membranes in a characteristic punctate distribution, and mitotracker is readily taken up by mitochondria. In contrast, in U87 glioma
310
M. Paolillo et al. / Pharmacological Research 61 (2010) 306–315
Fig. 2. ETB antagonists affect cell cycle phases in glioma cell lines. Representative cell cycle profiles of glioma cell lines untreated (CTR) or treated with BQ788 (10 M) or A192621 (10 M) for 48 h. Cells were analyzed by flow cytometry to determine the percentage of cells in the G1, S and G2/M phase. (3a) 1321-N1 cell line, (3b) U87 cell line and (3c) IPDDCA2 cell line.
cells treated for 72 h with ETB antagonists, there is an increased localization of mitotrack in the cytosol. In addition, the presence of apoptotic processes elicited by the drug treatment is further supported by the diffuse staining of cytochrome c in the cytoplasm accompanied by a concomitant nuclear chromatin condensation as assessed by the Hoechst staining. Recent evidence has identified apoptosis-inducing factor (AIF) as a mitochondrial protein that mediates important pathways of apoptosis in response to some death stimuli [23]. To investigate a possible involvement of AIF in the ETB antagonists-dependent apoptosis, we evaluated translocation of AIF from the mitochondrial membranes into the nucleus by immunofluorescence (Fig. 8). In untreated U87 cells, AIF staining
localizes inside the mitochondria as evidenced by its punctate fluorescence pattern in the cytosol. However, ETB antagonists induced a marked nuclear AIF immunostaining pattern, indicating its translocation from the mitochondria into the nucleus and suggesting a prominent role of AIF in the ETB-induced apoptosis in glioma cell lines. To further investigate the extent of cytochrome c and AIF release from mitochondria, western blot analysis were performed on cytosolic fractions of cells treated with ETB antagonists. The densitometric analysis of western blots clearly showed an average double fold increase of the amount of cytochrome c and AIF proteins found in the cytosolic fraction of treated cells (Fig. 9) confirming the results obtained by immunocytochemistry.
M. Paolillo et al. / Pharmacological Research 61 (2010) 306–315
Fig. 3. ETB antagonists downregulate cyclin D1 and induce p21 expression. Glioma cell lines 1321N-1 and U87 were untreated (CTR) or treated with BQ788 (10 M) and A192621 (10 M) for 48 h. Cell lysates were processed for western blot analysis using antibody recognizing cyclin D1, p21 and ␣-tubulin for normalization.
311
Fig. 6. ETB antagonists induce caspase-9 activation. Cell lines were treated for 72 h with the ETB antagonists BQ788 (10 M) and A192621 (10 M) and caspase-9 activation was evaluated by a colorimetric assay. The results are expressed as percentage of untreated control cells. **p < 0.01; *p < 0.05.
3.6. ETB antagonists downregulate ERK- and p38MAPK-dependent signaling transduction pathways A previous study has shown that ET-1 induces ERKs and p38MAPK phosphorylation via ETB receptor stimulation in cultured rat astrocytes [17]. Therefore we decided to investigate whether long-term treatment with the two ETB antagonists affected ETBdependent signaling transduction pathways by measuring the phosphorylation degree of downstream ERKs, p38MAPK and AKT protein kinases. The treatment of cell lines with BQ788 and A192621 for 72 h elicited a sharp decrease in the amount of phosphorylated ERKs and p38MAPK without affecting phosphorylated AKT (Fig. 10, upper blots). The same treatment with ETB antagonists did not modify the phosphorylation-independent total levels of ERKs, p38MAPK and AKT kinases (Fig. 10, lower blots). Fig. 4. ETB antagonists induce apoptosis in glioma cell lines. Cell lines were untreated (CTR), treated for 72 h with the ETB antagonists BQ788 (10 M) and A192621 (10 M) and at the end of treatment the percentage of apoptotic cells was measured by a TUNEL assay. The results are expressed as percentage of apoptotic cells per total cell number. ***p < 0.001.
3.7. ETB antagonists do not affect VEGF mRNA levels and its release Previous studies performed in different types of cancer cells [15,16] have shown controversial effects of an ETB antagonist on
Fig. 5. ETB antagonists induce caspase-9 activation in glioma cell lines. U87 cells were untreated (CTR) or treated for 72 h with BQ788 (10 M) or A192621 (10 M). Cells were stained by antibody recognizing activated cleaved caspase-9 (green fluorescence) and nuclei were visualized with the nuclear dye Hoechst 33342 (blue fluorescence). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)
312
M. Paolillo et al. / Pharmacological Research 61 (2010) 306–315
Fig. 7. ETB antagonists induce cytochrome c release and change in mitochondrial membrane potential in glioma cell lines. U87 cells were untreated (CTR) or treated for 72 h with BQ788 (10 M) or A192621 (10 M). Cytochrome c was visualized by immunostaining (green fluorescence) and the mitochondrial integrity was evaluated by the mitotracker deep red dye (red fluorescence). Nuclei were visualized by the nuclear dye Hoechst 33342 (blue fluorescence). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)
mRNA levels of the angiogenic protein vascular endothelial growth factor (VEGF). To test whether this effect was also triggered by the two ETB antagonists BQ788 and A192621, we have measured the levels of VEGF mRNA by real time RT-PCR. A 72 h treatment of glioma cell lines with 10 M A192621 elicited a modest, but not
statistically significant, increase of VEGF mRNA levels compared to untreated control cells (1.24 ± 0.39 fold increase in 1321N1, 1.21 ± 0.31 in U87 and 1.15 ± 0.32 in IPDDCA2 cell lines). Similarly, the antagonist BQ788 (10 M) did not induce any appreciable change in VEGF mRNA levels (1.05 ± 0.25 fold increase in 1321N1,
Fig. 8. ETB antagonists induce AIF translocation in glioma cell lines. U87 cells were untreated (CTR) or treated for 72 h with BQ788 (10 M) or A192621 (10 M). Cells were immunostained for AIF (green fluorescence) and nuclei were visualized by the nuclear dye Hoechst 33342 (blue fluorescence). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)
M. Paolillo et al. / Pharmacological Research 61 (2010) 306–315
Fig. 9. ETB antagonists increase cytosolic cytochrome c and AIF. U87 were untreated (CTR) or treated with BQ788 (10 M) and A192621 (10 M) for 72 h. Cytoplasmic fraction of cell lysates were processed for western blot analysis using antibody recognizing cytochrome c, AIF and -tubulin for normalization. Densitometric analysis results in arbitrary units (control = 1) are reported below blots. *p < 0.05.
Fig. 10. ETB antagonists downregulate ERK- and p38MAPK-dependent signaling pathways in glioma cell lines. Glioma cell lines 1321N-1 and U87 were untreated (CTR) or treated with BQ788 (10 M) and A192621 (10 M) for 72 h. Cell lysates were processed for western blot analysis using antibody recognizing P-ERKs, P-p38MAPK and P-AKT. Blots were then stripped and reprobed with antibodies recognizing the phosphorylation-independent state of ERKs, p38MAPK and AKT for normalization.
0.93 ± 0.14 in U87 and 1.07 ± 0.30 in IPDDCA2 cell lines) compared to untreated control cells. To further investigate whether the ETB antagonists treatment might interfere with the release of VEGF-A protein in the extracellular medium, the amount of VEGF-A was assessed by a colorimetric ELISA assays. Basal release of VEGFA protein in untreated control were 86.8 ± 3.7 pg/ml in 1321-N1 cell lines, 128.1 ± 6.5 pg/ml in U87 cell line and 50.4 ± 4.8 pg/ml in IPDDCA2 cell line. In agreement with measurement of mRNA levels, neither BQ788 (98.4 ± 12.2% in 1321N1 cells, 90.5 ± 15.1% in U87 cells and 104.2 ± 8.5% in IPDDCA2 cells) nor A192621 (109.6 ± 9.5% in 1321N1 cell line, 100.1 ± 11.2% in U87 cell line and 114.8 ± 10.4% in IPDDCA2 cell line) did not induce any significant change of released VEGF-A protein in the extracellular medium. 4. Discussion The main finding of this paper deals with the mechanism by which the ETB antagonists BQ788 and A192621 induces apoptosis in three different human glioma cell lines grown in vitro. Treatment of glioma cell lines with ETB antagonists for 48 h induces modifications of cell cycle pattern with an increase in the percentage of
313
cells mainly in the G1 phase while a more prolonged treatment of cells with ETB antagonists (72 h) causes cell death by apoptosis. In our study we found ETB antagonists treatment elicits an increase in the amount of cyclin D1 together with a concomitant decrease in the p21 protein. By decreasing the CDK4 activator cyclin D1 and increasing the CDK4 inhibitor protein p21, it is very likely that in our experimental conditions ETB antagonists exert their antiproliferative effect by inhibiting CDK4 kinase activity which results in accumulation of hypophosphorylated Rb protein that in turn favors cell growth arrest. A similar mechanism may underlie a typical antiproliferative effect induced by proapoptotic agents in human glioma cell lines because it has been also proposed as the main triggering pathway responsible for the flavopiridol-induced apoptosis in glioma cell lines in vitro [24]. The detection of activated caspase-9 by immunofluorescence and ELISA assay, associated with the observed changes in mitochondrial shape and membrane potential, together with cytochrome c release from mitochondria, clearly demonstrate that the two ETB antagonists BQ788 and A192621 induce apoptosis mainly via a caspase-dependent pathway mediated by mitochondrial disruption and suggest apoptotic processes mainly mediated by an intrinsic mechanism. Although in this work we did not investigate in details a possible involvement of an extrinsic caspase-8-dependent mechanism in ETB antagonists-induced apoptosis, in some preliminary experiments not reported here we were unable to detect any caspase-8 activation by immunocytochemistry in our experimental model. A previous report found that in human glioblastoma cells, blockade of the ET-1 pathway by the mixed ETA/B antagonist bosentan sensitised tumor cells to an extrinsic apoptotic mechanism mediated by FasL ligand [11]. Further experiments are therefore warranted to better understand whether, and by means of which ET receptor, a caspase-8 mediated mechanism is involved in apoptosis processes triggered by pharmacological blockade of ET receptors in human glioma cell lines. The data reported here are in excellent agreement with previous findings describing a proapoptotic effect of BQ788 in vitro and in vivo in melanoma [14,15] and an antiproliferative effect of BQ788 and A192621 in melanoma and glioma cell lines [25]. Taken together, these findings strongly support the notion that, at least in certain cancer cell types, such as melanoma and glioma, ETB receptor blockade induce cell cycle arrest followed by apoptosis. Another interesting finding emerging from our experiments is the concomitant translocation from mitochondria into the cytosol of AIF and cytochrome c as key events in ETB antagonists-dependent apoptosis. Since cytochrome c elicits a caspase-dependent mechanism while AIF appears to be mainly involved mainly in caspaseindependent apoptotic processes [26], it is reasonable to assume that, at least in our conditions, the ETB antagonists trigger either caspase-dependent and caspase-independent apoptotic pathways as reported in other experimental models [27]. In the attempt to investigate ETB-dependent signaling pathways involved in the ETB antagonist-induced apoptosis, we found that long term (72 h) BQ788 or A192621 treatment decreases the amount of phosphorylated ERK1/2 and p38MAPK without affecting the amount of phosphorylated AKT. In preliminary experiments (not reported here) we found that acute (15 min) pretreatment of serum-starved glioma cell lines with BQ788 and A191621 inhibits ET-1 induced ERK1/2 and p38MAPK phosphorylation in agreement with data reported in cultured rat cortical astrocytes [17,28]. Whilst the effect of the p38MAPK-dependent pathway in modulating apoptosis in cancer cells is still an open debated issue, probably because the effect appear to be cell- and stimulus-dependent [29], some previous works have documented a down regulation of the ERK-dependent pathway by proapoptotic agents reinforcing the notion of a functional link between induction of apoptosis and
314
M. Paolillo et al. / Pharmacological Research 61 (2010) 306–315
the ERK-dependent pathways. In human prostatic smooth muscle cells the specific ERK inhibitor PD98059 induce apoptosis abolishing the antiapoptotic effect of ET-1 [28]. Notably, in human glioma cells the bioactive flavonoid quercetin inhibits proliferation and induces a mitochondria-dependent apoptosis via the reduction of the phosphorylation of the ERK-dependent pathway [30] and moreover in glioblastoma cells the inhibition of ERK-dependent pathway obtained by the U0126 compound was able to induce apoptosis [31]. A possible mechanistic explanation implies that a sustained inhibition of ERKs-dependent pathways, triggered by ETB antagonists, results in the induction of apoptotic processes, an hypothesis supported by the finding that the phosphorylation of caspase-9 by the ERK pathway results in the inactivation of caspase-9 [27]. Although previous works [17,28] have clearly demonstrated that ETB receptors blockade inhibits the activation of ERK- and p38MAPK-dependent pathways, a recent study proposed that ETB antagonists might decrease cell proliferation and induce apoptosis in glioma cell lines by an ETB receptor-independent mechanism [23]. The experiments reported in this work do not allow to draw any firm conclusion on this hypothesis, but the fact that two chemically and structurally unrelated ETB antagonists exert the same effect suggests that, at least in our conditions, ETB receptors are involved, maybe in addition to other receptor-independent mechanisms, in the induction of apoptosis. Due to the complexity of downstream signaling events triggered by the activation of the ERK-dependent pathways and their role in apoptosis regulation [32–34], further studies using complementary approaches, such as the use of specific kinase inhibitors or vectormediated expression of constitutively active or dominant negative kinases, are therefore required to investigate the possible causal relationships among ETB receptor blockade, ERKs and p38MAPK activation and apoptotic mechanisms in glioma cell lines. We have previously demonstrated that glioma cell lines grown in vitro synthesize and release ET-1 in the extracellular medium [13] and therefore ET-1 could affect the transcription of the angiogenic factor VEGF by an autocrine or paracrine mechanism in vivo. When we assessed the levels of VEGF mRNA by real time RT-PCR and the amount of VEGF protein released in the extracellular medium, we found that the treatment with ETB antagonists does not significantly modify the synthesis and release of VEGF, in contrast with results reported by previous studies that have addressed this issue. In fact, melanoma cells lines treated with BQ788 showed an upregulation of VEGF mRNA, together with a growth inhibitory effect on human melanoma xenograft accompanied by enhanced angiogenesis [14]. On the other hand, in different melanoma cell lines, BQ788 blocked the hypoxia-inducible factor-1␣ (HIF-1␣)-mediated VEGF upregulation by ET-1 [16]. Several factors, such as tumor cell type and heterogeneity, growth conditions, stimulating agents, relative expression of ET receptors and concentration of ETB antagonists tested may likely account for these discrepancies. In conclusion, the most important finding of this work is the discovery that in glioma cell lines ETB antagonists reduce proliferation and induce apoptosis mainly by an intrinsic caspase-9-dependent mechanism involving cytochrome c and AIF release. Future studies, such as the investigation of the effects induced by ETB antagonists on glioma cells using in vivo animal models, as well the evaluation of the efficacy of ETB antagonists in combination with other receptor tyrosine kinase inhibitors [35], are required to confirm the reliability of ETB antagonists as a promising pharmacological tool in glioma treatment. Acknowledgments We would like to thank Abbott for the compound A192621. This work was supported by a grant from Italian MIUR.
References [1] Levin ER. Endothelins. New Engl J Med 1995;333:356–63. [2] Bagnato A, Rosanò L. The endothelin axis in cancer. Int J Biochem Cell Biol 2008;40:1443–51. [3] Nelson J, Bagnato A, Battistini B, Nisen P. The endothelin axis: emerging role in cancer. Nat Rev Cancer 2003;3:110–6. [4] Ahmed SI, Thompson J, Coulson JM, Woll PJ. Studies on the expression of endothelin, its receptor subtypes, and converting enzymes in lung cancer and in human bronchial epithelium. Am J Respir Cell Mol Biol 2000;22:422–31. [5] Bagnato A, Spinella F, Rosanò L. Emerging role of the endothelin axis in ovarian tumor progression. Endocr Relat Cancer 2005;12:761–72. [6] Kusuhara M, Yamaguchi K, Nagasaki K, Hayashi C, Suzaki A, Hori S, et al. Production of endothelin in human cancer cell lines. Cancer Res 1990;50:3257– 61. [7] Godara G, Cannon GW, Cannon GM, Bies RR, Nelson JB, Pflug BR. Role of endothelin axis in progression to aggressive phenotype of prostate adenocarcinoma. Prostate 2005;65:27–34. [8] Schinelli S. Pharmacology and physiopathology of the brain endothelin system: an overview. Curr Med Chem 2006;13:627–38. [9] Naidoo V, Naidoo S, Mahabeer R, Raidoo DM. Cellular distribution of the endothelin system in the human brain. J Chem Neuroanat 2004;27:87–98. [10] Anguelova E, Beuvon F, Leonard N, Chaverot N, Varlet P, Couraud PO, et al. Functional endothelin ET B receptors are selectively expressed in human oligodendrogliomas. Brain Res Mol Brain Res 2005;137:77–88. [11] Egidy G, Eberl LP, Valdenaire O, Irmler M, Majdi R, Diserens AC, et al. The endothelin system in human glioblastoma. Lab Invest 2000;80:1681–9. [12] Naidoo V, Naidoo S, Mahabeer R, Raidoo DM. Localization of the endothelin system in human diffuse astrocytomas. Cancer 2005;104:1049–57. [13] Paolillo M, Barbieri A, Zanassi P, Schinelli S. Expression of endothelins and their receptors in glioblastoma cell lines. J Neurooncol 2006;79:1–7. [14] Lahav R, Heffner G, Patterson PH. An endothelin receptor B antagonist inhibits growth and induces cell death in human melanoma cells in vitro and in vivo. Proc Natl Acad Sci USA 1999;96:11496–500. [15] Lahav R, Suva ML, Rimoldi D, Patterson PH, Stamenkovic I. Endothelin receptor B inhibition triggers apoptosis and enhances angiogenesis in melanomas. Cancer Res 2004;64:8945–53. [16] Spinella F, Rosanò L, Di Castro V, Decandia S, Nicotra MR, Natali PG, et al. Endothelin-1 and endothelin-3 promote invasive behavior via hypoxia-inducible factor-1alpha in human melanoma cells. Cancer Res 2007;67:1725–34. [17] Schinelli S, Zanassi P, Paolillo M, Wang H, Feliciello A, Gallo V. Stimulation of endothelin B receptors in astrocytes induces cAMP response element-binding protein phosphorylation and c-fos expression via multiple mitogen-activated protein kinase signaling pathways. J Neurosci 2001;21:8842–53. [18] Lazarini F, Strosberg AD, Couraud PO, Cazaubon SM. Coupling of ETB endothelin receptor to mitogen-activated protein kinase stimulation and DNA synthesis in primary cultures of rat astrocytes. J Neurochem 1996;66:459–65. [19] Cazaubon S, Chaverot N, Romero IA, Girault JA, Adamson P, Strosberg AD, et al. Growth factor activity of endothelin-1 in primary astrocytes mediated by adhesion-dependent and -independent pathways. J Neurosci 1997;17:6203–12. [20] Frezza C, Cipolat S, Scorrano L. Organelle isolation: functional mitochondria from mouse liver, muscle and cultured fibroblasts. Nat Protoc 2007;2:287– 95. [21] Costa SL, Paillaud E, Fages C, Rochette-Egly C, Plassat JL, Jouault HA, et al. Effects of a novel synthetic retinoid on malignant glioma in vitro: inhibition of cell proliferation, induction of apoptosis and differentiation. Eur J Cancer 2001;37:520–30. [22] Broker JE, Kruyt FAE, Giaccone G. Cell death independent of caspase: a review. Clin Cancer Res 2005;11:3155–62. [23] Penninger JM, Kroemer G. Mitochondria, AIF and caspases—rivaling for cell death execution. Nat Cell Biol 2003;5:97–9. [24] Alonso M, Tamasdan C, Miller DC, Newcomb EW. Flavopiridol induces apoptosis in glioma cell lines independent of retinoblastoma and p53 tumor suppressor pathway alterations by a caspase-independent pathway. Mol Cancer Ther 2003;2:139–50. [25] Montgomery JP, Patterson PH. Endothelin receptor B antagonists decrease glioma cell viability independently of their cognate receptor. BMC Cancer 2008;8:354–86. [26] Yakovlev AG, Faden AI. Mechanisms of neural cell death: implications for development of neuroprotective treatment strategies. NeuroRx 2004;1:5–16. [27] Newcomb EW, Tamasdan C, Entzminger Y, Alonso J, Friedlander D, Crisan D, et al. Flavopiridol induces mitochondrial-mediated apoptosis in murine glioma GL261 cells via release of cytochrome c and apoptosis inducing factor. Cell Cycle 2003;2:243–50. [28] Gadea A, Schinelli S, Gallo V. Endothelin-1 regulates astrocyte proliferation and reactive gliosis via a JNK/c-Jun signaling pathway. J Neurosci 2008;5:2394–408. [29] Ono K, Han J. The p38 transduction pathway activation and function. Cell Signal 2000;12:1–13. [30] Kim EJ, Choi CH, Park JY, Kang SK, Kim YK. Underlying mechanism of quercetininduced cell death in human glioma cells. Neurochem Res 2008;33:971–9. [31] Failly M, Korur S, Egler V, Boulay JL, Lino MM, Imber R, et al. Combination of sublethal concentrations of epidermal growth factor receptor inhibitor and microtubule stabilizer induces apoptosis of glioblastoma cells. Mol Cancer Ther 2007;6:773–81.
M. Paolillo et al. / Pharmacological Research 61 (2010) 306–315 [32] Allan LA, Morrice N, Brady S, Magee G, Pathak S, Clarke PR. Inhibition of caspase-9 through phosphorylation at Thr 125 by ERK MAPK. Nat Cell Biol 2003;7:647–54. [33] Wu-Wong JR, Chiou WJ, Wang J. Extracellular signal-regulated kinases are involved in the antiapoptotic effect of endothelin-1. J Pharmacol Exp Ther 2000;293(2):514–21.
315
[34] Balmanno K, Cook SJ. Tumor cell survival by the ERK1/2 pathway. Cell Death Differ 2009;16:368–77. [35] Ziegler DS, Wright RD, Kesari S, Lemieux ME, Tran MA, Jain M, et al. Resistance of human glioblastoma multiforme cells to growth factor inhibitors is overcome by blockade of inhibitor of apoptosis proteins. J Clin Invest 2008;118: 3109–22.
Contents lists available at ScienceDirect
Pharmacological Research journal homepage: www.elsevier.com/locate/yphrs
Endothelin B receptor antagonists block proliferation and induce apoptosis in glioma cells Mayra Paolillo a , Marika A. Russo a , Daniela Curti b , Cristina Lanni a , Sergio Schinelli a,∗ a b
Dipartimento di Farmacologia Sperimentale ed Applicata, Università di Pavia, Viale Taramelli 14, 27100 Pavia, Italy Dipartimento di Medicina legale, Scienze Forensi e Farmaco-tossicologiche A. Fornari, Università di Pavia, 27100 Pavia, Italy
a r t i c l e
i n f o
Article history: Received 17 July 2009 Received in revised form 9 November 2009 Accepted 9 November 2009 Keywords: Endothelin BQ788 A192621 Glioma cells Apoptosis
a b s t r a c t The proliferative and antiapoptotic actions of endothelin (ET)-1 in cancer cells have been documented and ET receptor antagonists have been exploited as potential anticancer drugs. Glioblastoma cell lines express both ETA and ETB receptors and previous works have shown that ETB receptors are involved in the proliferation of different cancer cell types. In this study we have investigated the effects of two structurally unrelated ETB receptor antagonists, BQ788 and A192621, on cell survival, proliferation and apoptosis in 1321-N1, U87 and IPDDCA2 glioma cell lines. BQ788 and A192621 reduced glioma cells viability and proliferation assessed by BrdU incorporation and cell cycle analysis by flow cytometry, while in contrast the ETA receptor antagonist BQ123 had no effect on cell survival. TUNEL assay and immunocytochemical experiments showed that BQ788 and A192621 trigger apoptotic processes mainly via activation of the intrinsic mitochondrial pathway involving caspase-9 activation, AIF release and cytochrome c translocation. Furthermore, treatment with ETB antagonists downregulates ERK- and p38MAPK-dependent pathways but does not affect VEGF mRNA levels. Our findings support the hypothesis that ETB antagonists represent a new promising therapeutic strategy for the treatment of high grade gliomas. © 2009 Elsevier Ltd. All rights reserved.
1. Introduction The endothelin (ET) family of peptides (ET-1, ET-2, ET-3), originally isolated for their potent vasoconstrictive activity, are widely expressed in many anatomical regions, including the human brain [1]. ETs display a well characterized mitogenic activity that is involved not only in vascular remodeling and angiogenesis, but also in proliferative processes in a variety of cell types [2]. ETs exert their effects via the stimulation of two G-protein coupled receptor subtypes, ETA and ETB, that display overlapping tissue distribution and functional effects. However, at present, it is not clear whether these two structurally distinct receptors mediate ETs activity via common or separate signal transduction pathways. Because ETs display mitogenic and pro-angiogenic properties, the ET axis has been implicated in tumor growth and progression [3]. An increased expression of ET-1 mRNA has been demonstrated in human lung squamous cell carcinomas and adenocarcinomas [4] and immunoreactive ET-1, together with functional ET receptors, has also been detected in human ovarian [5], colon [6] and prostate cancer cell lines [7].
Abbreviation: ETs, Endothelin. ∗ Corresponding author. Tel.: +39 0382 987404; fax: +39 0382 987405. E-mail address: [email protected] (S. Schinelli). 1043-6618/$ – see front matter © 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.phrs.2009.11.003
Several studies have also demonstrated the expression of the ET axis in different types of brain tumors [8]. The ET axis is likely involved in the crosstalk between tumor cells and peritumoral elements in brain tumors because ETB receptors were detected by immunohistochemical analysis in human astrocytoma samples throughout the tumor cells as well as in endothelial cells of tumor blood vessels [9]. The expression of functional ETA and ETB receptors has been documented in oligodendroglioma and oligoastrocitoma [10]. The components of the ET axis are expressed in human glioblastoma tissue and cell lines [11] and in surgical samples of human diffuse astrocytoma [12]. In a previous study we showed that human glioblastoma cell lines release ET-1 and express functional ETB receptors, while ETA expression appears to be absent or barely detectable [13]. The mitogenic properties of ETs have prompted studies on ETA and ETB blockade in cancer. Indeed, ETA receptor antagonists, alone or in combination with other cytostatic agents, induce apoptosis or inhibit cell proliferation in ovarian, prostate, colon carcinoma cells [2]. The functional consequences of ETB blockade were mainly investigated in melanocytes in which the selective ETB receptor antagonist BQ788 causes growth inhibition and cell death [14–16]. Although the cellular effects and transduction pathways activated by ETB stimulation have been characterized in detail in cultured astrocytes [17–19], at present the molecular mechanisms underlying the cellular responses to ETB receptor blockade in human glioblastoma cells are very poorly understood.
M. Paolillo et al. / Pharmacological Research 61 (2010) 306–315
307
The present study was therefore undertaken to investigate the effects of two structurally distinct ETB antagonists on cell viability, cell proliferation and to elucidate the molecular mechanisms underlying ETB antagonist-induced apoptosis in three human glioblastoma cell lines. Our results show that ETB antagonists block human glioblastoma cell lines proliferation followed by cell death via an intrinsic caspase-dependent mechanism probably involving a dysregulation of ERK-dependent and p38MAPK-dependent pathways.
100 U/ml RNase, and 0.01% Nonidet NP40 in double distilled water). Flow cytometric measurements were taken with at least 20,000 cells contained in the gated regions used for calculations. Flow cytometric analysis was performed by a FACStar fluorescence-activated cell sorter (Becton Dickinson, San José, CA, USA) equipped with a laser excitation (power 200 mW) at 488 nm and a 610 nm long-pass filter for the red fluorescence signals.
2. Materials and methods
For the relative quantification of apoptosis a sandwich immunoassay was performed to detect the amount of nucleosomes (Cell death detection ELISA, Roche diagnostics). Cells plated in 12 multiwell were treated with 10 M BQ788 or A192621 for 72 h. At the end of the incubation time, the assay was performed following the manufacturer’s instructions and the colorimetric signal was detected by a multiwell reader at 405 nm.
2.1. Materials The ETA antagonist BQ123 and the ETB antagonist BQ788 were purchased from Bachem (Switzerland) and the ETB antagonist A192621 was obtained from Abbott. All cell culture reagents were purchased from Euroclone, Italy. Primary antibodies were purchased from the following sources: ERK/p-ERK and p38MAPK/p-p38MAPK from Biosource; AKT/p-AKT from Cell Signaling; p21, cyclin D1, AIF from Santa Cruz and cytochrome c from BD Bioscience. The HRP conjugated secondary antibodies were obtained from Jackson Lab (USA) and fluorophore conjugated secondary antibodies from Invitrogen. 2.2. Cell culture The 1321N1 and U87 human glioblastoma cell lines were purchased from Istituto Zootecnico Regione Lombardia (Brescia, Italy) while the grade II astrocytoma cell line IPDDC-A2, were purchased from the European Cell Culture Collection (UK). The cell lines were routinely split (1:5 ratio) by trypsinization and propagated in DMEM supplemented with 5% fetal bovine serum (FBS) containing 2 mM glutamine, penicillin-streptomycin (10,000 u/ml) at 37 ◦ C in controlled atmosphere (5% CO2 /95% air). All the cell lines were negative when tested for mycoplasma contamination by the Mycoplasma Species kit (Euroclone, Italy). For biochemical experiments, cells were plated in multiwell or dishes (10,000/cm2 ), serum-starved 24 h and then grown in culture medium containing 1% FBS in the presence of the ETB antagonists for the indicated time. 2.3. MTS cell viability assay Cells lines plated in 96 multiwells were treated with 10 M BQ123, 10 M BQ788 or 10 M A192621 for 48 h. At the end, 20 l of CellTiter 96 reagent (Promega) was added to each well and after 3 h the colorimetric signal was detected by a multiwell plate reader at 490 nm. 2.4. BrdU-ELISA cell proliferation assay Cells were plated in 96 multiwells and treated with 10 M BQ788 and 10 M A192621 for 48 h. At the end, 10 l of BrdU from the cell proliferation ELISA BrdU kit (Roche diagnostics) were added to each well. After a 5 h incubation, the assay was performed following the manufacturer’s instructions. The samples were read in a multiwell reader at 450 nm. 2.5. FACS analysis The effect of the two ETB antagonists on the cell cycle was determined by flow cytometry of propidium iodide-stained nuclei. The cells were plated in 100 mm Petri dishes and treated with the drugs (10 M) for 48 h. At the end of treatments, cells were collected, washed in PBS (phosphate buffered saline) and resuspended in 0.5 ml of a propidium iodide solution (50 g/ml propidium,
2.6. ELISA nucleosome apoptosis assay
2.7. Caspase-9 colorimetric assay Cells were plated in 12 multiwells and treated with 10 M BQ788 and 10 M A192621 for 72 h. At the end of treatment with ETB antagonists the cells were first pelleted and then resuspended in lysis buffer. The measurement of caspase-9 activity was assessed by the Caspase-9 colorimetric assay kit (BioVision, USA) following manufacturer’s instructions. Briefly, an aliquot of cell lysate was incubated with the caspase-9 substrate LEHD-pNA for 2 h at 37 ◦ C and at the end of incubation period the released chromophore compound pNA was quantified by a microplate reader at 405 nm. Results are expressed as fold increase of caspase-9 activity in ETBantagonists treated cell lines compared to control (untreated) cell lines. 2.8. TUNEL assay Terminal-deoxynucleotidyl transferase-mediated dUTP-nick end-labeling (TUNEL) assay was performed by the DeadEnd Fluorimetric TUNEL System (Promega) according to the manufacturer’s instructions. Briefly, after treatment with ETB antagonists for 72 h, cells were fixed in 4% formaldehyde for 30 min, washed in PBS and permeabilized for 15 min at room temperature with 0.01% Triton X-100 in PBS. Coverslips were incubated for 1 h at 37 ◦ C with TUNEL reaction mixture (enzyme solution + labeling solution) and then counterstained with Hoechst 33258 for 15 min. TUNEL-positive cells were counted and results are expressed as percentage of total cells. 2.9. Immunocytochemical analysis Cells were plated onto 12 mm polylysine coated coverslips (2500 cells/coverslip) and incubated with 10 M BQ788 and 10 M A192621 for 72 h. At the end of treatments the cells were fixed in 4% formaldehyde for 30 min, washed in PBS and permeabilized for 15 min at room temperature by 0.01% Triton X-100 in PBS. Non-specific binding was blocked by incubation for 30 min in PBS containing 1% bovine serum albumin (BSA). Cells were incubated for 1 h with specific antibodies for caspase-9 or AIF diluted 1:50 or 1:10 in a PBS/1% BSA solution. Cells were washed in PBS and then incubated for 1 h at room temperature with an anti-goat Alexa 488 conjugated antibody (Invitrogen) diluted 1:200 in PBS/1% BSA. At the end of the incubation period, cells were repeatedly washed PBS/1% BSA and stained with 1 M Hoechst 33342 (Sigma–Aldrich). For cytochrome c localization, cells were incubated for 20 min at 37 ◦ C in the presence of 300 nM Mitotracker DeepRed (Invitrogen), washed three times in PBS and fixed in 3.7% formaldehyde for 15 min at 37 ◦ C. The cells were then washed in PBS and incubated
308
M. Paolillo et al. / Pharmacological Research 61 (2010) 306–315
for 45 min in PBS containing 0.1% Triton X-100, 1% bovine serum albumin (BSA) and 10% normal goat serum. The cells were then incubated for 90 min at 37 ◦ C with mouse anti-human cytochrome c antibody diluted 1:5000 in PBS containing 0.01% Triton X-100 and 0.1% BSA. Cells were washed three times in wash solution and then incubated for 45 min at room temperature with goat anti-mouse conjugated with Alexa 488 secondary antibody diluted 1:500 in wash solution. At the end of the incubation cells were repeatedly washed with PBS and counterstained with 1 M Hoechst 33342 for 15 min at room temperature. Coverslips were mounted with mowiol reagent and images were acquired with a laser scanning confocal microscopy (TCP-SP3, Leica) equipped with 63× or 40× oil immersion objectives.
The detection of VEGF-A protein released in the extracellular medium was assessed by a sandwich ELISA immunoassay (Human VEGF-A ELISA Assay, Bender MedSystems). Cells plated in 12 multiwell were treated with 10 M BQ788 or A192621 for 72 h. At the end of the incubation time, the VEGF-A assay was performed following the manufacturer’s instructions and the colorimetric signal was detected by a multiwell reader at 405 nm. The amount of released VEGF-A protein, calculated by constructing a standard calibration curve, was quantified as fg protein/ml extracellular medium. The effect of ETB antagonists treatment was expressed as percentage fold change compared to untreated cell lines.
2.10. Western blot analysis
2.13. Statistical analysis
Cells were treated for the indicated time with the ETB antagonists BQ788 (10 M) and A192621 (10 M). To obtain total cell lysates, the cells were rinsed twice in ice-cold PBS and 200 l of cell lysis buffer were added to the dishes (composition: 50 mM Tris–HCl pH 7.4, 1% v/v NP40, 0.25% w/v sodium deoxycholate, 1 mM phenylmethylsulphonyl-fluoride (PMSF), 1 mM Na3 VO4 , 1 mM EDTA, 30 mM sodium pyrophosphate, 1 mM NaF, 1 g/ml leupeptin, 1 g/ml pepstatin A, 1 g/ml aprotinin and 1 g/ml microcystin). After scraping, the cells were sonicated for 10 s, centrifugated at 12,000 × g for 5 min at 4 ◦ C and the amount of proteins in the supernatant was measured by the BCA protein Assay Kit (Pierce). For cytochrome c and AIF analysis, separation of cytosolic from mitochondrial fractions was performed as previously described [20]. Briefly, treated cells were scraped, resuspended in lysis buffer, homogenized by potter, and then centrifugated at 900 × g for 5 min at 4 ◦ C to separate nuclei. The supernatant (cytosol) was separated by centrifugation at 17,000 × g for 10 min at 4 ◦ C and then used for western blot analysis. 30 g of proteins were separated by 10% SDS-PAGE at 150 V for 2 h and blotted onto 0.22 m nitrocellulose membranes at 50 mA for 16 h. The membranes were first blocked for 2 h in Tris buffered saline solution (TBST composition: Tris 10 mM, NaCl 150 mM, 0.1% v/v Tween 20) plus 5% low fat dry milk (TBSTM) and then incubated with the appropriate primary antibody diluted 1:1000 in TBSTM for 16 h at 4 ◦ C under gentle agitation. The membranes were rinsed three times in TBST and then incubated for 2 h at rt with a goat anti-rabbit IgG HRP-conjugate secondary antibody diluted 1:5000 in TBSTM. The membranes were rinsed three times in TTBS and the luminescent signal was detected by the ECL plus Western Blotting Detection System (Amersham). Densitometric analysis of protein bands was performed using the Scion Image software package.
Unless otherwise specified, data are expressed as mean ± SD of three different experiments run in triplicate. Statistical analysis ANOVA was performed by the Instat3 software.
2.11. Real time RT-PCR Total RNA extraction, retrotranscription to cDNA and quantitative real time RT-PCR analysis were performed as previously reported [13]. Primers were designed by using the “Primer3 input” software (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3.cgi/ primer3 www.cgi) and the specificity of each primer was controlled by the BLAST software (http://blast.ncbi.nlm.nih.gov/Blast. cgi). The primers sequences were 5 -TGTGAGTGGTTGACCTTCCTC forward and 5 -GATCCTGCCCTGTCTCTCTGT reverse for vascular endothelial growth factor (VEGF, Genebank NM 001025366) and 5 -AGATTACGGAGCAGCGCAAGATTG forward and 5 GCAAACACAGATCGCAGGTAGCCC reverse for ribosomal protein L6 (RPL6, Genebank NM 001024662). Relative transcript quantification was calculated by the (Ct) method using RPL6 as reference gene and data are expressed as fold increase of VEGF mRNA levels in treated cells compared to control cells.
2.12. VEGF-A ELISA assay
3. Results 3.1. ETB antagonists decrease cell viability A preliminary set of experiments was performed to test the effect of ETA and ETB receptor antagonists on cell viability. Cells were treated for 48 h with the ETB antagonists BQ788 (10 M), the other ETB antagonist A192621 (10 M) or the ETA antagonist BQ123 (10 M) and then cell viability was assessed by the MTS assay. Treatment with A192621 reduced cell viability by 39.2% (p < 0.001) in U87, by 31.6% (p < 0.001) in IPDDCA2 cell lines and by 33.2% in 1321-N1 cell line (p < 0.001). The ETB antagonist BQ788 showed a similar effect inducing a 33.8% decrease in U87 cell line (p < 0.001), a 29.1% decrease (p < 0.001) in IPDDCA2 cell line and a 30.9% decrease (p < 0.001) in 1321-N1 cell line. Notably, the ETA antagonist BQ123 (10 M) displayed no effect in any cell line tested (Fig. 1a). 3.2. ETB antagonists decrease cell proliferation To gain further insight into the mechanisms that underlie the ETB-induced decrease in cell viability, we measured changes in cell proliferation rate. Firstly, we measured the modified base BrdU incorporation into cells by an ELISA test. Treatment with BQ788 or A192621 resulted in a statistically significant decrease in BrdU incorporation in all the cell lines examined (Fig. 1b). Compared to BQ788, the BrdU incorporation decrease induced by A192621 was more notable because A192621 reduced BrdU by 27.1% (p < 0.001) in U87, 17.4% (p < 0.001) in IPDDCA2 cell lines and 20.2% in 1321-N1 (p < 0.01). On the other hand, BQ788 elicited its maximal effect in reducing BrdU incorporation in 1321-N1 cell lines (25.2%; p < 0.001) while it showed a more modest effect in U87 (16.2%; p < 0.05) and IPDDCA2 (10.1%; p < 0.05). To confirm these findings, we performed a flow cytometric analysis to investigate possible changes in the cell cycle phases upon treatment with ETB antagonists. Cells were treated with 10 M BQ788 and 10 M A19262 for 48 h, stained with propidium iodide and then analyzed by flow cytometry. A representative experiment performed in the three glioma cell lines is depicted in Fig. 2. Statistical analysis of the distribution of cell cycle phases, reported in Table 1, demonstrated that the two ETB antagonists exert an overlapping effect on the expression pattern of cell cycle, except for slight modifications probably due to the intrinsic heterogeneity of the cell lines examined. The most prominent effect elicited by the two ETB antagonists, compared to untreated cells, results in a statistically significant decrease in the percentage
M. Paolillo et al. / Pharmacological Research 61 (2010) 306–315
309
3.3. ETB antagonists induce apoptosis Since in malignant glioma in vitro the inhibition of cell proliferation has been shown to induce apoptosis [21], we tested whether ETB antagonists may induce apoptosis in our experimental model. Apoptotic damage in treated cells was first assessed by a bulk ELISA assay that detects the presence of fragmented DNA (nucleosomes). Preliminary time-course experiments revealed that a 24 or 48 h treatment with ETA and ETB antagonists did not significantly affect the amount of nucleosomes in treated cells compared to control untreated cells (not shown). However, a 72 h treatment with ETB antagonists elicited a statistically significant increase (p < 0.01) of nucleosome content in cells treated with BQ788 (3.4 ± 0.6 in 1321N1; 2.9 ± 0.4 in U87 and 4.1 ± 0.5 in IPDDCA2 cell lines) or with A192621 (5.8 ± 0.8 in 1321-N1; 4.9 ± 0.7 in U87 and 8.5 ± 0.9 in IPDDCA2 cell lines) compared to untreated cells. Notably, the ETA antagonist BQ123 (10 M) elicited no effect even after 72 h treatment. In addition, in order to evaluate more in detail the extent of apoptotic process, the percentage of apoptotic cells induced by the same treatment with ETB antagonists was assessed by a TUNEL assay. In good agreement with the data obtained from the nucleosome assay, the compound A192621 was more potent (range 24.0–70.8%) than BQ788 (range 15.3–30.1%) in eliciting a statistically significant increase (p < 0.01) of TUNEL-positive cells in the three cell lines examined (Fig. 4). Fig. 1. (a) ETB antagonists reduce cell viability in glioma cell lines. Cell lines were treated for 48 h with the ETA antagonist BQ123 (10 M) or the ETB antagonists BQ788 (10 M) and A192621 (10 M) and cell viability was measured by MTS assay. The results are expressed as percentage of untreated control cells. (b) ETB antagonists reduce cell proliferation in glioma cell lines. Cell lines were treated for 48 h with the ETB antagonists BQ788 (10 M) and A192621 (10 M) and at the end of treatment cell proliferation was measured by an ELISA BrdU incorporation assay. The results are expressed as percentage of untreated control cells. ***p < 0.001; **p < 0.01; *p < 0.05.
of cell in G1 and G2 phases associated with a concomitant increase in the percentage of cell in the S phase. Moreover, in U87 and IPDDCA2 cell lines, the antagonist BQ788 was more efficacious than the other antagonist A192621 in inducing a statistically significant increase in G1 phase associated with a concomitant decrease of the percentage of treated cells in S phase. These results show that the treatment of glioma cell lines with the two ETB antagonists caused a significant inhibition of cell cycle progression. To further confirm these perturbations of cell cycle in our experimental model, we next investigated the effects of the same treatment with ETB antagonists on the level of two key cell cyclerelated regulating factors, the cyclin D1 and p21 proteins. When cell lysates were analyzed by western blot, a decrease of cyclin D1 expression and a concomitant increase of p21, compared to untreated cells, was observed in 1321N-1 and U87 cell lines treated with 10 M BQ788 or 10 M A192621 for 48 h (Fig. 3).
3.4. ETB antagonists induce caspase-9 activation Recent evidence has shown that apoptosis may be induced either by a caspase-dependent or by a caspase-independent pathway [22]. Caspase-dependent apoptosis can be mainly triggered by two alternate but not mutually exclusive patterns of activation: an extrinsic pathway activated by cell-surface death receptors followed by the activation of caspase-8 and an intrinsic pathway that involves the disruption of mitochondrial membrane integrity followed by the activation of caspase-9. We first investigated the possible involvement of caspase-9 by means of fluorescence immunocytochemistry using antibodies recognizing the cleaved activated caspase-9 isoform. In U87 cell lines A192621 strongly increases the amount of cleaved caspase-9 (right picture, first row in Fig. 5) compared to untreated cells (left picture, first row in Fig. 5). The same effect, albeit to a lesser extent, is induced by the other ETB antagonist BQ788 (central picture, first row in Fig. 5). Similar results were obtained for the other two cell lines 1321-N1 and IPDDCA2 (data not shown). As a complementary approach to further evaluate the extent of caspase-9 activation in our experimental model, we performed a caspase-9 activation colorimetric assay. Treatment for 72 h with the two ETB antagonists BQ788 and A192621 induced a statistically significant increase of caspase-9 activity in the three cell lines examined (Fig. 6) confirming the results above reported by immunocytochemistry. 3.5. ETB antagonists induce cytochrome c release and AIF translocation
Table 1 Statistical analysis of the distribution of cell cycle phases (*p < 0.05; **p < 0.01). Cell line
Phase
CTR
BQ788
A192621
1321-N1
G1 S G2
59.5 ± 3.6 13.9 ± 2.8 25.4 ± 3.8
58.8 ± 4.5 20.4 ± 2.7* 16.5 ± 5.8*
61.7 ± 4.8 19.6 ± 3.3* 18.9 ± 1.4
U87
G1 S G2
54.1 ± 2.7 22.9 ± 3.2 23.1 ± 4.5
67.1 ± 10.6* 12.2 ± 4.5** 17.8 ± 1.9
62.4 ± 5.1 19.6 ± 3.4 14.1 ± 4.4*
IPDDCA2
G1 S G2
20.5 ± 5.2 31.1 ± 4.7 14.6 ± 3.7
75.8 ± 4.1** 7.9 ± 3.2** 15.5 ± 2.2
64.6 ± 7.9* 18.1 ± 7.1* 15.7 ± 2.6
The activation of caspase-9 is induced by the mitochondrial release of cytochrome c and other proteins that form the functionally active protein complex apoptosome [22]. To confirm the involvement of a mitochondria-dependent apoptotic pathway in ETB antagonists-induced apoptosis, we measured changes in the mitochondrial transmembrane potential (m) by using the mitotracker deep red dye and the mitochondrial release of cytochrome c by immunofluorescence (Fig. 7). In untreated glioma cells lines the majority of cytochrome c is retained inside the mitochondrial membranes in a characteristic punctate distribution, and mitotracker is readily taken up by mitochondria. In contrast, in U87 glioma
310
M. Paolillo et al. / Pharmacological Research 61 (2010) 306–315
Fig. 2. ETB antagonists affect cell cycle phases in glioma cell lines. Representative cell cycle profiles of glioma cell lines untreated (CTR) or treated with BQ788 (10 M) or A192621 (10 M) for 48 h. Cells were analyzed by flow cytometry to determine the percentage of cells in the G1, S and G2/M phase. (3a) 1321-N1 cell line, (3b) U87 cell line and (3c) IPDDCA2 cell line.
cells treated for 72 h with ETB antagonists, there is an increased localization of mitotrack in the cytosol. In addition, the presence of apoptotic processes elicited by the drug treatment is further supported by the diffuse staining of cytochrome c in the cytoplasm accompanied by a concomitant nuclear chromatin condensation as assessed by the Hoechst staining. Recent evidence has identified apoptosis-inducing factor (AIF) as a mitochondrial protein that mediates important pathways of apoptosis in response to some death stimuli [23]. To investigate a possible involvement of AIF in the ETB antagonists-dependent apoptosis, we evaluated translocation of AIF from the mitochondrial membranes into the nucleus by immunofluorescence (Fig. 8). In untreated U87 cells, AIF staining
localizes inside the mitochondria as evidenced by its punctate fluorescence pattern in the cytosol. However, ETB antagonists induced a marked nuclear AIF immunostaining pattern, indicating its translocation from the mitochondria into the nucleus and suggesting a prominent role of AIF in the ETB-induced apoptosis in glioma cell lines. To further investigate the extent of cytochrome c and AIF release from mitochondria, western blot analysis were performed on cytosolic fractions of cells treated with ETB antagonists. The densitometric analysis of western blots clearly showed an average double fold increase of the amount of cytochrome c and AIF proteins found in the cytosolic fraction of treated cells (Fig. 9) confirming the results obtained by immunocytochemistry.
M. Paolillo et al. / Pharmacological Research 61 (2010) 306–315
Fig. 3. ETB antagonists downregulate cyclin D1 and induce p21 expression. Glioma cell lines 1321N-1 and U87 were untreated (CTR) or treated with BQ788 (10 M) and A192621 (10 M) for 48 h. Cell lysates were processed for western blot analysis using antibody recognizing cyclin D1, p21 and ␣-tubulin for normalization.
311
Fig. 6. ETB antagonists induce caspase-9 activation. Cell lines were treated for 72 h with the ETB antagonists BQ788 (10 M) and A192621 (10 M) and caspase-9 activation was evaluated by a colorimetric assay. The results are expressed as percentage of untreated control cells. **p < 0.01; *p < 0.05.
3.6. ETB antagonists downregulate ERK- and p38MAPK-dependent signaling transduction pathways A previous study has shown that ET-1 induces ERKs and p38MAPK phosphorylation via ETB receptor stimulation in cultured rat astrocytes [17]. Therefore we decided to investigate whether long-term treatment with the two ETB antagonists affected ETBdependent signaling transduction pathways by measuring the phosphorylation degree of downstream ERKs, p38MAPK and AKT protein kinases. The treatment of cell lines with BQ788 and A192621 for 72 h elicited a sharp decrease in the amount of phosphorylated ERKs and p38MAPK without affecting phosphorylated AKT (Fig. 10, upper blots). The same treatment with ETB antagonists did not modify the phosphorylation-independent total levels of ERKs, p38MAPK and AKT kinases (Fig. 10, lower blots). Fig. 4. ETB antagonists induce apoptosis in glioma cell lines. Cell lines were untreated (CTR), treated for 72 h with the ETB antagonists BQ788 (10 M) and A192621 (10 M) and at the end of treatment the percentage of apoptotic cells was measured by a TUNEL assay. The results are expressed as percentage of apoptotic cells per total cell number. ***p < 0.001.
3.7. ETB antagonists do not affect VEGF mRNA levels and its release Previous studies performed in different types of cancer cells [15,16] have shown controversial effects of an ETB antagonist on
Fig. 5. ETB antagonists induce caspase-9 activation in glioma cell lines. U87 cells were untreated (CTR) or treated for 72 h with BQ788 (10 M) or A192621 (10 M). Cells were stained by antibody recognizing activated cleaved caspase-9 (green fluorescence) and nuclei were visualized with the nuclear dye Hoechst 33342 (blue fluorescence). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)
312
M. Paolillo et al. / Pharmacological Research 61 (2010) 306–315
Fig. 7. ETB antagonists induce cytochrome c release and change in mitochondrial membrane potential in glioma cell lines. U87 cells were untreated (CTR) or treated for 72 h with BQ788 (10 M) or A192621 (10 M). Cytochrome c was visualized by immunostaining (green fluorescence) and the mitochondrial integrity was evaluated by the mitotracker deep red dye (red fluorescence). Nuclei were visualized by the nuclear dye Hoechst 33342 (blue fluorescence). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)
mRNA levels of the angiogenic protein vascular endothelial growth factor (VEGF). To test whether this effect was also triggered by the two ETB antagonists BQ788 and A192621, we have measured the levels of VEGF mRNA by real time RT-PCR. A 72 h treatment of glioma cell lines with 10 M A192621 elicited a modest, but not
statistically significant, increase of VEGF mRNA levels compared to untreated control cells (1.24 ± 0.39 fold increase in 1321N1, 1.21 ± 0.31 in U87 and 1.15 ± 0.32 in IPDDCA2 cell lines). Similarly, the antagonist BQ788 (10 M) did not induce any appreciable change in VEGF mRNA levels (1.05 ± 0.25 fold increase in 1321N1,
Fig. 8. ETB antagonists induce AIF translocation in glioma cell lines. U87 cells were untreated (CTR) or treated for 72 h with BQ788 (10 M) or A192621 (10 M). Cells were immunostained for AIF (green fluorescence) and nuclei were visualized by the nuclear dye Hoechst 33342 (blue fluorescence). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)
M. Paolillo et al. / Pharmacological Research 61 (2010) 306–315
Fig. 9. ETB antagonists increase cytosolic cytochrome c and AIF. U87 were untreated (CTR) or treated with BQ788 (10 M) and A192621 (10 M) for 72 h. Cytoplasmic fraction of cell lysates were processed for western blot analysis using antibody recognizing cytochrome c, AIF and -tubulin for normalization. Densitometric analysis results in arbitrary units (control = 1) are reported below blots. *p < 0.05.
Fig. 10. ETB antagonists downregulate ERK- and p38MAPK-dependent signaling pathways in glioma cell lines. Glioma cell lines 1321N-1 and U87 were untreated (CTR) or treated with BQ788 (10 M) and A192621 (10 M) for 72 h. Cell lysates were processed for western blot analysis using antibody recognizing P-ERKs, P-p38MAPK and P-AKT. Blots were then stripped and reprobed with antibodies recognizing the phosphorylation-independent state of ERKs, p38MAPK and AKT for normalization.
0.93 ± 0.14 in U87 and 1.07 ± 0.30 in IPDDCA2 cell lines) compared to untreated control cells. To further investigate whether the ETB antagonists treatment might interfere with the release of VEGF-A protein in the extracellular medium, the amount of VEGF-A was assessed by a colorimetric ELISA assays. Basal release of VEGFA protein in untreated control were 86.8 ± 3.7 pg/ml in 1321-N1 cell lines, 128.1 ± 6.5 pg/ml in U87 cell line and 50.4 ± 4.8 pg/ml in IPDDCA2 cell line. In agreement with measurement of mRNA levels, neither BQ788 (98.4 ± 12.2% in 1321N1 cells, 90.5 ± 15.1% in U87 cells and 104.2 ± 8.5% in IPDDCA2 cells) nor A192621 (109.6 ± 9.5% in 1321N1 cell line, 100.1 ± 11.2% in U87 cell line and 114.8 ± 10.4% in IPDDCA2 cell line) did not induce any significant change of released VEGF-A protein in the extracellular medium. 4. Discussion The main finding of this paper deals with the mechanism by which the ETB antagonists BQ788 and A192621 induces apoptosis in three different human glioma cell lines grown in vitro. Treatment of glioma cell lines with ETB antagonists for 48 h induces modifications of cell cycle pattern with an increase in the percentage of
313
cells mainly in the G1 phase while a more prolonged treatment of cells with ETB antagonists (72 h) causes cell death by apoptosis. In our study we found ETB antagonists treatment elicits an increase in the amount of cyclin D1 together with a concomitant decrease in the p21 protein. By decreasing the CDK4 activator cyclin D1 and increasing the CDK4 inhibitor protein p21, it is very likely that in our experimental conditions ETB antagonists exert their antiproliferative effect by inhibiting CDK4 kinase activity which results in accumulation of hypophosphorylated Rb protein that in turn favors cell growth arrest. A similar mechanism may underlie a typical antiproliferative effect induced by proapoptotic agents in human glioma cell lines because it has been also proposed as the main triggering pathway responsible for the flavopiridol-induced apoptosis in glioma cell lines in vitro [24]. The detection of activated caspase-9 by immunofluorescence and ELISA assay, associated with the observed changes in mitochondrial shape and membrane potential, together with cytochrome c release from mitochondria, clearly demonstrate that the two ETB antagonists BQ788 and A192621 induce apoptosis mainly via a caspase-dependent pathway mediated by mitochondrial disruption and suggest apoptotic processes mainly mediated by an intrinsic mechanism. Although in this work we did not investigate in details a possible involvement of an extrinsic caspase-8-dependent mechanism in ETB antagonists-induced apoptosis, in some preliminary experiments not reported here we were unable to detect any caspase-8 activation by immunocytochemistry in our experimental model. A previous report found that in human glioblastoma cells, blockade of the ET-1 pathway by the mixed ETA/B antagonist bosentan sensitised tumor cells to an extrinsic apoptotic mechanism mediated by FasL ligand [11]. Further experiments are therefore warranted to better understand whether, and by means of which ET receptor, a caspase-8 mediated mechanism is involved in apoptosis processes triggered by pharmacological blockade of ET receptors in human glioma cell lines. The data reported here are in excellent agreement with previous findings describing a proapoptotic effect of BQ788 in vitro and in vivo in melanoma [14,15] and an antiproliferative effect of BQ788 and A192621 in melanoma and glioma cell lines [25]. Taken together, these findings strongly support the notion that, at least in certain cancer cell types, such as melanoma and glioma, ETB receptor blockade induce cell cycle arrest followed by apoptosis. Another interesting finding emerging from our experiments is the concomitant translocation from mitochondria into the cytosol of AIF and cytochrome c as key events in ETB antagonists-dependent apoptosis. Since cytochrome c elicits a caspase-dependent mechanism while AIF appears to be mainly involved mainly in caspaseindependent apoptotic processes [26], it is reasonable to assume that, at least in our conditions, the ETB antagonists trigger either caspase-dependent and caspase-independent apoptotic pathways as reported in other experimental models [27]. In the attempt to investigate ETB-dependent signaling pathways involved in the ETB antagonist-induced apoptosis, we found that long term (72 h) BQ788 or A192621 treatment decreases the amount of phosphorylated ERK1/2 and p38MAPK without affecting the amount of phosphorylated AKT. In preliminary experiments (not reported here) we found that acute (15 min) pretreatment of serum-starved glioma cell lines with BQ788 and A191621 inhibits ET-1 induced ERK1/2 and p38MAPK phosphorylation in agreement with data reported in cultured rat cortical astrocytes [17,28]. Whilst the effect of the p38MAPK-dependent pathway in modulating apoptosis in cancer cells is still an open debated issue, probably because the effect appear to be cell- and stimulus-dependent [29], some previous works have documented a down regulation of the ERK-dependent pathway by proapoptotic agents reinforcing the notion of a functional link between induction of apoptosis and
314
M. Paolillo et al. / Pharmacological Research 61 (2010) 306–315
the ERK-dependent pathways. In human prostatic smooth muscle cells the specific ERK inhibitor PD98059 induce apoptosis abolishing the antiapoptotic effect of ET-1 [28]. Notably, in human glioma cells the bioactive flavonoid quercetin inhibits proliferation and induces a mitochondria-dependent apoptosis via the reduction of the phosphorylation of the ERK-dependent pathway [30] and moreover in glioblastoma cells the inhibition of ERK-dependent pathway obtained by the U0126 compound was able to induce apoptosis [31]. A possible mechanistic explanation implies that a sustained inhibition of ERKs-dependent pathways, triggered by ETB antagonists, results in the induction of apoptotic processes, an hypothesis supported by the finding that the phosphorylation of caspase-9 by the ERK pathway results in the inactivation of caspase-9 [27]. Although previous works [17,28] have clearly demonstrated that ETB receptors blockade inhibits the activation of ERK- and p38MAPK-dependent pathways, a recent study proposed that ETB antagonists might decrease cell proliferation and induce apoptosis in glioma cell lines by an ETB receptor-independent mechanism [23]. The experiments reported in this work do not allow to draw any firm conclusion on this hypothesis, but the fact that two chemically and structurally unrelated ETB antagonists exert the same effect suggests that, at least in our conditions, ETB receptors are involved, maybe in addition to other receptor-independent mechanisms, in the induction of apoptosis. Due to the complexity of downstream signaling events triggered by the activation of the ERK-dependent pathways and their role in apoptosis regulation [32–34], further studies using complementary approaches, such as the use of specific kinase inhibitors or vectormediated expression of constitutively active or dominant negative kinases, are therefore required to investigate the possible causal relationships among ETB receptor blockade, ERKs and p38MAPK activation and apoptotic mechanisms in glioma cell lines. We have previously demonstrated that glioma cell lines grown in vitro synthesize and release ET-1 in the extracellular medium [13] and therefore ET-1 could affect the transcription of the angiogenic factor VEGF by an autocrine or paracrine mechanism in vivo. When we assessed the levels of VEGF mRNA by real time RT-PCR and the amount of VEGF protein released in the extracellular medium, we found that the treatment with ETB antagonists does not significantly modify the synthesis and release of VEGF, in contrast with results reported by previous studies that have addressed this issue. In fact, melanoma cells lines treated with BQ788 showed an upregulation of VEGF mRNA, together with a growth inhibitory effect on human melanoma xenograft accompanied by enhanced angiogenesis [14]. On the other hand, in different melanoma cell lines, BQ788 blocked the hypoxia-inducible factor-1␣ (HIF-1␣)-mediated VEGF upregulation by ET-1 [16]. Several factors, such as tumor cell type and heterogeneity, growth conditions, stimulating agents, relative expression of ET receptors and concentration of ETB antagonists tested may likely account for these discrepancies. In conclusion, the most important finding of this work is the discovery that in glioma cell lines ETB antagonists reduce proliferation and induce apoptosis mainly by an intrinsic caspase-9-dependent mechanism involving cytochrome c and AIF release. Future studies, such as the investigation of the effects induced by ETB antagonists on glioma cells using in vivo animal models, as well the evaluation of the efficacy of ETB antagonists in combination with other receptor tyrosine kinase inhibitors [35], are required to confirm the reliability of ETB antagonists as a promising pharmacological tool in glioma treatment. Acknowledgments We would like to thank Abbott for the compound A192621. This work was supported by a grant from Italian MIUR.
References [1] Levin ER. Endothelins. New Engl J Med 1995;333:356–63. [2] Bagnato A, Rosanò L. The endothelin axis in cancer. Int J Biochem Cell Biol 2008;40:1443–51. [3] Nelson J, Bagnato A, Battistini B, Nisen P. The endothelin axis: emerging role in cancer. Nat Rev Cancer 2003;3:110–6. [4] Ahmed SI, Thompson J, Coulson JM, Woll PJ. Studies on the expression of endothelin, its receptor subtypes, and converting enzymes in lung cancer and in human bronchial epithelium. Am J Respir Cell Mol Biol 2000;22:422–31. [5] Bagnato A, Spinella F, Rosanò L. Emerging role of the endothelin axis in ovarian tumor progression. Endocr Relat Cancer 2005;12:761–72. [6] Kusuhara M, Yamaguchi K, Nagasaki K, Hayashi C, Suzaki A, Hori S, et al. Production of endothelin in human cancer cell lines. Cancer Res 1990;50:3257– 61. [7] Godara G, Cannon GW, Cannon GM, Bies RR, Nelson JB, Pflug BR. Role of endothelin axis in progression to aggressive phenotype of prostate adenocarcinoma. Prostate 2005;65:27–34. [8] Schinelli S. Pharmacology and physiopathology of the brain endothelin system: an overview. Curr Med Chem 2006;13:627–38. [9] Naidoo V, Naidoo S, Mahabeer R, Raidoo DM. Cellular distribution of the endothelin system in the human brain. J Chem Neuroanat 2004;27:87–98. [10] Anguelova E, Beuvon F, Leonard N, Chaverot N, Varlet P, Couraud PO, et al. Functional endothelin ET B receptors are selectively expressed in human oligodendrogliomas. Brain Res Mol Brain Res 2005;137:77–88. [11] Egidy G, Eberl LP, Valdenaire O, Irmler M, Majdi R, Diserens AC, et al. The endothelin system in human glioblastoma. Lab Invest 2000;80:1681–9. [12] Naidoo V, Naidoo S, Mahabeer R, Raidoo DM. Localization of the endothelin system in human diffuse astrocytomas. Cancer 2005;104:1049–57. [13] Paolillo M, Barbieri A, Zanassi P, Schinelli S. Expression of endothelins and their receptors in glioblastoma cell lines. J Neurooncol 2006;79:1–7. [14] Lahav R, Heffner G, Patterson PH. An endothelin receptor B antagonist inhibits growth and induces cell death in human melanoma cells in vitro and in vivo. Proc Natl Acad Sci USA 1999;96:11496–500. [15] Lahav R, Suva ML, Rimoldi D, Patterson PH, Stamenkovic I. Endothelin receptor B inhibition triggers apoptosis and enhances angiogenesis in melanomas. Cancer Res 2004;64:8945–53. [16] Spinella F, Rosanò L, Di Castro V, Decandia S, Nicotra MR, Natali PG, et al. Endothelin-1 and endothelin-3 promote invasive behavior via hypoxia-inducible factor-1alpha in human melanoma cells. Cancer Res 2007;67:1725–34. [17] Schinelli S, Zanassi P, Paolillo M, Wang H, Feliciello A, Gallo V. Stimulation of endothelin B receptors in astrocytes induces cAMP response element-binding protein phosphorylation and c-fos expression via multiple mitogen-activated protein kinase signaling pathways. J Neurosci 2001;21:8842–53. [18] Lazarini F, Strosberg AD, Couraud PO, Cazaubon SM. Coupling of ETB endothelin receptor to mitogen-activated protein kinase stimulation and DNA synthesis in primary cultures of rat astrocytes. J Neurochem 1996;66:459–65. [19] Cazaubon S, Chaverot N, Romero IA, Girault JA, Adamson P, Strosberg AD, et al. Growth factor activity of endothelin-1 in primary astrocytes mediated by adhesion-dependent and -independent pathways. J Neurosci 1997;17:6203–12. [20] Frezza C, Cipolat S, Scorrano L. Organelle isolation: functional mitochondria from mouse liver, muscle and cultured fibroblasts. Nat Protoc 2007;2:287– 95. [21] Costa SL, Paillaud E, Fages C, Rochette-Egly C, Plassat JL, Jouault HA, et al. Effects of a novel synthetic retinoid on malignant glioma in vitro: inhibition of cell proliferation, induction of apoptosis and differentiation. Eur J Cancer 2001;37:520–30. [22] Broker JE, Kruyt FAE, Giaccone G. Cell death independent of caspase: a review. Clin Cancer Res 2005;11:3155–62. [23] Penninger JM, Kroemer G. Mitochondria, AIF and caspases—rivaling for cell death execution. Nat Cell Biol 2003;5:97–9. [24] Alonso M, Tamasdan C, Miller DC, Newcomb EW. Flavopiridol induces apoptosis in glioma cell lines independent of retinoblastoma and p53 tumor suppressor pathway alterations by a caspase-independent pathway. Mol Cancer Ther 2003;2:139–50. [25] Montgomery JP, Patterson PH. Endothelin receptor B antagonists decrease glioma cell viability independently of their cognate receptor. BMC Cancer 2008;8:354–86. [26] Yakovlev AG, Faden AI. Mechanisms of neural cell death: implications for development of neuroprotective treatment strategies. NeuroRx 2004;1:5–16. [27] Newcomb EW, Tamasdan C, Entzminger Y, Alonso J, Friedlander D, Crisan D, et al. Flavopiridol induces mitochondrial-mediated apoptosis in murine glioma GL261 cells via release of cytochrome c and apoptosis inducing factor. Cell Cycle 2003;2:243–50. [28] Gadea A, Schinelli S, Gallo V. Endothelin-1 regulates astrocyte proliferation and reactive gliosis via a JNK/c-Jun signaling pathway. J Neurosci 2008;5:2394–408. [29] Ono K, Han J. The p38 transduction pathway activation and function. Cell Signal 2000;12:1–13. [30] Kim EJ, Choi CH, Park JY, Kang SK, Kim YK. Underlying mechanism of quercetininduced cell death in human glioma cells. Neurochem Res 2008;33:971–9. [31] Failly M, Korur S, Egler V, Boulay JL, Lino MM, Imber R, et al. Combination of sublethal concentrations of epidermal growth factor receptor inhibitor and microtubule stabilizer induces apoptosis of glioblastoma cells. Mol Cancer Ther 2007;6:773–81.
M. Paolillo et al. / Pharmacological Research 61 (2010) 306–315 [32] Allan LA, Morrice N, Brady S, Magee G, Pathak S, Clarke PR. Inhibition of caspase-9 through phosphorylation at Thr 125 by ERK MAPK. Nat Cell Biol 2003;7:647–54. [33] Wu-Wong JR, Chiou WJ, Wang J. Extracellular signal-regulated kinases are involved in the antiapoptotic effect of endothelin-1. J Pharmacol Exp Ther 2000;293(2):514–21.
315
[34] Balmanno K, Cook SJ. Tumor cell survival by the ERK1/2 pathway. Cell Death Differ 2009;16:368–77. [35] Ziegler DS, Wright RD, Kesari S, Lemieux ME, Tran MA, Jain M, et al. Resistance of human glioblastoma multiforme cells to growth factor inhibitors is overcome by blockade of inhibitor of apoptosis proteins. J Clin Invest 2008;118: 3109–22.