Endotoxin Potentiation of Trichothecene-Induced Lymphocyte Apoptosis Is Mediated by Up-Regulation of Glucocorticoids

Toxicology and Applied Pharmacology 180, 43–55 (2002) doi:10.1006/taap.2002.9374, available online at http://www.idealibrary.com on

Endotoxin Potentiation of Trichothecene-Induced Lymphocyte Apoptosis Is Mediated by Up-Regulation of Glucocorticoids Zahidul Islam,* Yu Seok Moon,* ,† Hui-Ren Zhou,* Louis E. King,‡ Pamela J. Fraker,* ,‡ and James J. Pestka* ,† ,§ ,1 *Department of Food Science and Human Nutrition, †Institute for Environmental Toxicology, ‡Department of Biochemistry and Molecular Biology, and §Department of Microbiology and Molecular Genetics, Michigan State University, East Lansing, Michigan 48824 Received October 19, 2001; accepted January 14, 2002

The active component of endotoxin, lipopolysaccharide (LPS), has been extensively studied as a mediator of inflammation and is a major contributing factor to pathogenesis by Gram-negative bacteria (Hewett and Roth, 1993). Exposure to high doses of LPS initiates a chain of inflammatory events that culminate in cell death, frank injury to tissues, and functional failure of several organs that can be life threatening in humans and animals. LPS induces its marked biological effects by stimulating host cells to produce a variety of mediators, including proinflammatory cytokines [e.g., tumor necrosis factor-␣ (TNF-␣), interleukin (IL)-6, IL-1␤], glucocorticoids, bioactive lipids (e.g., prostaglandins), reactive oxygen species, and activated coagulation components (Schletter et al., 1995). As one example, LPS-induced apoptosis in mouse lymphoid organs has been shown to be regulated by adrenal hormones and TNF-␣ (Zhang et al., 1993). Although exposure to low doses of LPS initiates a modest and noninjurious inflammatory response in experimental animals, their organs may be sensitized to injury by a number of xenobiotic agents (reviewed in Roth et al., 1997). Low-dose exposure to LPS in mice can render the liver more sensitive to the trichothecene T-2 toxin, aflatoxin B 1, carbon tetrachloride, galactosamine, ethanol, and allyl alcohol. Recent reports show that LPS potentiates mercury-induced nephrotoxicity in the mouse (Rumbeiha et al., 2000). These and other examples suggest that humans exposed to low doses of LPS may experience increased susceptibility to the toxicity of certain chemicals. The trichothecenes are a diverse group of mycotoxins that are frequently encountered in foods and the environment (Bondy and Pestka, 2000). These compounds are potent inhibitors of protein synthesis and can impact actively dividing tissues, with the immune system being particularly susceptible (Ueno, 1987). Hallmarks of experimental and accidental exposure to high doses of trichothecenes include rapid diminution of lymphoid tissue via apoptosis and lymphopenia that precede death via circulatory shock-like syndrome (Bondy and Pestka, 2000). Paradoxically, low doses of trichothecenes can be immunostimulatory as evidenced by their capacity to induce expression of cytokines including IL-1␤, IL-2, IL-4, IL-6,

Endotoxin Potentiation of Trichothecene-Induced Lymphocyte Apoptosis Is Mediated by Up-Regulation of Glucocorticoids. Islam, Z., Moon, Y. S., Zhou, H.-R., King, L. E., Fraker, P. J., and Pestka, J. J. (2002). Toxicol. Appl. Pharmacol. 180, 43–55. Exposure to bacterial endotoxin (lipopolysaccharide, LPS) is quite common and may increase human susceptibility to chemicalinduced tissue injury. The purpose of this study was to identify mechanisms by which LPS potentiates lymphoid tissue depletion in B6C3F1 mice exposed to the common food-borne trichothecene mycotoxin, vomitoxin (VT). As demonstrated by DNA fragmentation and flow cytometric analysis, apoptosis in thymus, Peyer’s patches, and bone marrow was marked in mice 12 h after administering Escherichia coli LPS (0.1 mg/kg body wt ip) concurrently with VT (12.5 mg/kg body wt po), whereas apoptosis in control mice or mice treated with either toxin alone was minimal. Based on observed increases in tumor necrosis factor-␣ (TNF-␣) and interleukin (IL)-6 serum concentrations following LPS and VT cotreatment, the roles of these cytokines in apoptosis potentiation were assessed. Injection with rolipram, an inhibitor of TNF-␣ expression, or use of IL-6 knockout mice was ineffective at impairing thymic apoptosis induction by the toxin cotreatment, suggesting that these cytokines did not mediate LPS potentiation. Toxin cotreatment increased splenic cyclooxygenase-2 mRNA expression, suggesting possible involvement of prostaglandins in apoptosis. However, indomethacin, a broad spectrum inhibitor of cyclooxygenases, failed to block thymus apoptosis. Toxin cotreatment increased serum corticosterone and, furthermore, RU 486, a glucocorticoid receptor antagonist, significantly abrogated apoptosis in thymus, Peyer’s patches, and bone marrow following LPS ⴙ VT exposure. The results presented herein and the known capacity of glucocorticoids to cause apoptosis indicate that hypothalamic– pituitary–adrenal axis plays a key role in LPS potentiation of trichothecene-induced lymphocyte apoptosis. © 2002 Elsevier Science (USA) Key Words: lipopolysaccharide; deoxynivalenol; corticosterone; lymphocytes; apoptosis; vomitoxin; thymus; TNF-␣; IL-6; cyclooxygenase.

1 To whom correspondence should be addressed at 234 G. M. Trout Building, Michigan State University, East Lansing, MI 48824-1224, Fax: (517) 353-8963; E-mail: [email protected].

43

0041-008X/02 $35.00 © 2002 Elsevier Science (USA) All rights reserved.

44

ISLAM ET AL.

interferon-␥, and TNF-␣ in vivo (Azcona-Olivera et al., 1995; Zhou et al., 1998). Vomitoxin (VT or deoxynivalenol), a trichothecene mycotoxin produced by Fusarium graminearum, commonly contaminates human and animal dietary staples such as wheat, corn, and barley (Rotter et al., 1996). Since VT is recalcitrant to milling and processing, it is present at ppm levels in grain-based food products consumed by humans and thus is of considerable health concern. Trichothecene immunotoxicity is synergistically enhanced by low-dose LPS exposure in mice (Tai and Pestka, 1988; Taylor et al., 1991) with pronounced thymic and splenic lymphocyte depletion being pathologic hallmarks of these studies. Recently, we have found that coexposure to subtoxic doses of LPS and VT markedly induces apoptotic cell death in lymphoid tissues of the mouse, notably the thymus (Zhou et al., 1999, 2000). The capacity of LPS to potentiate the lymphotoxicity of a chemical is significant from the human health perspective because a seemingly insignificant LPS dose might exacerbate the effects of environmental or pharmaceutical agents in an exposed individual, leading to widespread immunosuppression. The purpose of this study was to determine the underlying mechanisms by which LPS exposure augments the immunotoxicity of VT with particular emphasis on TNF-␣, IL-6, cyclooxygenase-2 (COX-2), and corticosterone. The results suggested that highly elevated serum corticosterone levels in mice played a critical role in inducing thymic, Peyer’s patch, and bone marrow apoptosis within mice exposed to LPS ⫹ VT and that these effects were independent of concurrent increases in TNF-␣, IL-6, or COX-2 gene expression. MATERIALS AND METHODS Chemicals. LPS derived from Escherichia coli serotype O111:B4 with an activity of 1.5 ⫻ 10 6 EU/mg, LPS derived from Salmonella typhimurium with an activity of 3 ⫻ 10 6 EU/mg, VT, RU 486 (mifepristone), indomethacin, and rolipram were purchased from Sigma (St. Louis, MO). Mice. All animal handling was conducted in accordance with recommendations established by the National Institutes of Health. Experiments were designed to minimize the number of animals required to adequately test the proposed hypothesis and were approved by the Michigan State University Laboratory Animal Research Committee. Male B6C3F1 (C57B1/6J ⫻ C3H/ HeJ) mice (7 weeks) obtained from Charles River (Portage, MI) were used for most experiments. Mice were acclimated for at least 1 week, were housed three per cage under a 12-h light/dark cycle, and were provided standard rodent chow and water ad libitum For TNF-␣ receptor (TNFR) knockout studies, C57BL/6-Tnfrsf1 tm1 Mak, C57BL/6-Tnfrsf1b tm1 Mwm, and their donor strain, C57BL/6J (8 weeks), were obtained from Jackson Laboratory (Bar Harbor, ME). C57BL/6-Tnfrsf1 tm1 Mak and C57BL/6-Tnfrsf1b tm1 Mwm mice are homozygous for targeted disruption of the TNF-␣ cell surface receptors TNFR1(p55) and TNFR2(p75), respectively, whereas B6129SF2/J mice are derived from F2 (C57BL/6J ⫻ 129S1/SvImJ) breeding and served as wild-type controls (Pfeffer et al., 1993; Erickson et al., 1994). For IL-6 knockout studies, B6;129S-IL6 tm1Kopf (IL-6 KO) and its wild-type strain, B6129SF2/J (6 weeks), were obtained from Jackson Laboratory. B6; 129S-IL6 tm1Kopf mice are homozygous for a targeted disruption of the IL-6 gene, whereas B6129SF2/J mice are derived from F2 (C57BL/6J ⫻ 129S1/SvImJ) breeding and served as wild-type controls (Kopf et al., 1994).

Experimental design. Food and water were withdrawn from cages 1 h before toxin administration. In a typical experiment, mice were given vehicle (VH) ip ⫹ VH po (VH), LPS ip ⫹ VH po (LPS), VH ip ⫹ VT po (VT), or LPS ip ⫹ VT po (LPS ⫹ VT). LPS was dissolved in tissue culture grade, endotoxin-free water (Sigma), aliquoted and stored at ⫺80°C. VT was also dissolved in tissue culture grade, endotoxin-free water and stored at 4°C. LPS was injected ip (0.1 to 1.0 mg/kg body wt: 250 ␮l/mouse). VT was gavaged po (12.5 to 25 mg/kg body wt: 250 ␮l/mouse) 5 min after LPS injection. E. coli LPS was used in all experiments with the exception of the study of TNFR knockout mice, in which Salmonella typhimurium LPS was used. In some experiments, RU 486 (ⱖ20 mg/kg body wt), rolipram (30 mg/kg body wt), or indomethacin (3–50 mg/kg body wt) were dissolved in dimethyl sulfoxide (Sigma) and were injected ip (50 ␮l/mouse) 30 min before LPS ⫹ VT treatment. For apoptosis measurements, mice were euthanized by cervical dislocation under metafluorane anesthesia. Thymus, Peyer’s patches, and femurs for bone marrow cells were immediately removed for subsequent apoptosis measurements by agarose gel electrophoresis and flow cytometry. For corticosterone studies, mice were maintained under conditions of reduced noise and disturbance during the experiment period. Experiments were terminated and blood was collected at the same time of day to prevent diurnal and nocturnal variations of serum corticosterone levels. Trunk blood was obtained following decapitation within 1 min after touching the cage to minimize handling-induced increases in corticosterone levels. Blood was allowed to clot overnight at 4°C. Serum was collected and stored at ⫺80°C until needed. Cell preparation. Upon removal, thymus and Peyer’s patch were immediately submerged into ice-cold Dulbecco’s phosphate-buffered saline (Sigma). Single-cell suspensions were prepared according to the method of Islam et al., (1998). Briefly, cells were released from thymus and Peyer’s patches by gently pressing tissue through an 100-mesh screen (Collector Tissue Sieve, Bellco Glass Inc., Vineland, NJ) with a glass pestle. Bone marrow cells collected from the femur were treated with erythrocyte lysing buffer (144 mM ammonium chloride and 17 mM Tris, pH 7.2) for 5 min at room temperature to remove erythrocytes and then were washed twice with PBS. The cell suspension was passed through a 41-␮m nylon sieve (Spectrum Laboratories, Inc., Laguna Hills, CA) and the cell number was determined microscopically using a Bright-Line Hemacytometer (Sigma). DNA fragmentation analysis. DNA from thymus was extracted as described by Sellins and Cohen (1987). In brief, cells (1 ⫻ 10 7) in PBS were centrifuged for 5 min (500g) at 4°C, and the pellet was suspended in 0.1 ml hypotonic lysing buffer [10 mM Tris, pH 7.4, 10 mM EDTA, pH 8.0, 0.5% Triton X-100 (v/v)]. Cells were incubated for 10 min at 4°C. The resultant lysate was centrifuged for 30 min (13,000g) at 4°C. Supernatant containing fragmented DNA was digested for 1 h at 37°C with 0.4 ␮g/␮l of RNase A (Boehringer Mannheim, Indianapolis, IN) and then was incubated an additional hour at the same temperature with 0.4 ␮g/␮l of proteinase K (Boehringer Mannheim). DNA was precipitated in 50% (v/v) isopropanol in 0.5 M NaCl at ⫺20°C overnight. The precipitate was centrifuged at 13,000g for 30 min at 4°C. The resultant pellet was air dried and resuspended in 10 mM Tris, pH 7.4, and 1 mM EDTA, pH 8.0. An aliquot equivalent to 2 ⫻ 10 6 cells was electrophoresed at 70 V for 2 h in 2% (w/v) agarose gel in 90 mM Tris– borate buffer containing 2 mM EDTA, pH 8.0. After electrophoresis, the gel was stained with 0.5 ␮g/ml ethidium bromide, and the nucleic acids were visualized with a UV transilluminator. A 100-bp DNA ladder (GIBCO-BRL, Rockville, MD) was used for molecular sizing. Quantitation of apoptosis by flow cytometry. Apoptosis in thymus, Peyer’s patches, and bone marrow was quantified by flow cytometric cell cycle analysis as described previously (Pestka et al., 1994). Thymus, Peyer’s patch, and bone marrow cells (2 ⫻ 10 6) prepared as described above were resuspended in 0.2 ml PBS. Following the addition of 0.2 ml heat-inactivated fetal bovine serum, cells were immediately fixed by dropwise addition of 1.2 ml ice-cold 70% (v/v) ethanol with gentle mixing and then held at 4°C overnight. Cells were washed and incubated in 1 ml propidium iodide (PI) DNA staining

LPS ⫹ VT-INDUCED APOPTOSIS

45

FIG. 1. Internucleosomal DNA fragmentation in thymus following LPS ⫹ VT coadministration. Mice were treated with vehicle (ip and po), LPS ip ⫹ vehicle po, vehicle ip ⫹ VT po, or LPS ip ⫹ VT po. DNA was extracted from thymocytes 12 h later and subjected to agarose gel electrophoresis. (A) Effect of VT dose on fragmentation. (B) Effect of LPS dose on fragmentation. Molecular size markers are shown on the left (M). Data are representative of three independent experiments.

reagent [PBS containing 50 ␮g/ml PI, 50 ␮g/ml RNase A, 0.1 mM EDTA disodium, and 0.1% Triton X-100 (v/v)] at room temperature for 1 h and stored on ice until analysis. Cell cycle distribution for single cells was measured with a Becton Dickinson FACS Vantage (San Jose, CA). Data from 20,000 cells were collected in list mode. The 488 line of an argon laser was used to excite PI and fluorescence was detected at 615– 645 nm. The cell cycle of individual cells was completed using doublet discrimination gating to eliminate doublet and cell aggregate based on DNA fluorescence. The gate was drawn to include hypofluorescencent cells. Cells in the DNA histogram with hypofluorescent DNA were designated apoptotic. All other cells distributed themselves in a normal cell cycle profile. ELISA for cytokines. TNF-␣ ELISA was performed using a commercially available kit, Mouse TNF-␣ OptEIA from Pharmingen (San Diego, CA) with Immulon IV Removawell microtiter strips (Dynatech Lab, Chantilly, VA) according to the manufacturer’s procedure. IL-6 was measured by ELISA (Dong et al., 1994) using rat anti-mouse IL-6 monoclonal antibodies (Pharmingen) and streptavidin horseradish peroxidase conjugate (Sigma). Absorbances were measured at 450 nm with a Vmax Kinetic Microplate Reader (Molecular Devices Corporation, Menlo Park, CA). TNF-␣ and IL-6 concentrations were quantified from a standard curve using Softmax software (Molecular Devices). Measurement of COX-2 mRNA by competitive reverse transcriptase– polymerase chain reaction. Total RNA was extracted from spleen with Trizol reagent (Life Technologies, Gaithersburg, MD) according to the manufacturer’s instructions. RNA (100 ng) from each sample was reverse transcribed to cDNA (Riedy et al., 1995) and COX-2 cDNA was amplified competitively with a truncated COX-2 cDNA internal standard constructed by the bridging-deletion method (Hall et al., 1998). The amplification was performed in a 9600 Perkin Elmer Cycler (Perkin–Elmer Corp., Norwalk, CT) using the following parameters: 30 cycles of reactions of denaturation at 94°C for 30 s, annealing at 56°C for 45 s, and elongation at 72°C for 45 s. An aliquot of each PCR product was subjected to 1.5% agarose gel electrophoresis and visualized by staining with ethidium bromide. Primers were synthesized at Michigan State University Molecular Structure Facility. The 5⬘ forward- and 3⬘ reverse-complement PCR primers for amplification of mouse COX-2 cDNA were 5⬘ ACACTCTATCACTGGCATCC 3⬘ and 5⬘ GAAGGGACACCCTTTCACAT 3⬘. The final end product of amplified COX-2 cDNA was 584 bp and the internal standard cDNA was 500 bp. The densitometric ratio of 584 bp COX-2 cDNA/500 bp COX-2 internal standard was used to calculate the relative COX-2 cDNA concentration curve.

Corticosterone measurement. Corticosterone was quantified using a commercial radioimmunoassay kit (Rat Corticosterone- 3H kit, ICN Biomedicals, Inc., Costa Mesa, CA) according to the manufacturer’s procedure. Radioactivity was measured with a liquid scintillation counter (United Technologies Packard, Downers Grove, IL). Calculation of area under the corticosterone concentration vs time curve (AUC) (Pruett et al., 1999) was conducted using SigmaPlot version 5.0 (SPSS Inc., Chicago, IL). The values for the x-axis (time) and y-axis (corticosterone levels) were entered and the software calculated the AUC using a trapezoidal formula. AUC values were based on the difference between the toxin-treated animals and the vehicle-treated animals. Statistics. Data were analyzed using Sigma Stat for Windows (Jandel Scientific, San Rafael, CA). For comparisons of two groups of data, Student’s t test was performed. For comparisons of multiple groups of data, a Kruskal– Wallis one-way analysis of variance on ranks was performed. Data sets showing significant differences (p ⬍ 0.05) were further analyzed for synergy (Zhou et al., 2000). Values from vehicle-treated mice were randomly subtracted from LPS, VT, or LPS ⫹ VT groups. LPS and VT replicates were then randomly combined to calculate an expected mean additive response with variance. This calculated value was compared to that for actual cotreated samples using the Mann–Whitney rank sum test.

RESULTS

Coadministration of LPS and VT Induces Internucleosomal Cleavage of Thymic DNA Coexposure to LPS and VT have been previously shown to induce extensive cell death in lymphoid tissues by apoptosis (Zhou et al., 2000). To explore mechanisms by which LPS potentiates trichothecene toxicity, optimal doses for each toxin required to achieve this endpoint were determined. Mice were treated with LPS and VT at various doses for 12 h and thymic DNA was evaluated electrophoretically for fragmentation, a biological hallmark of apoptosis. When mice were treated orally with VT over a dose range of 1 to 12.5 mg/kg body wt and the LPS dose (0.1 mg/kg body wt ip) was kept constant, DNA fragmentation was found to be maximal at 12.5 mg/kg

46

ISLAM ET AL.

bone marrow. Actual experimental responses over VH control were 4.2 ⫾ 1, 4.38 ⫾ 1, and 3.36 ⫾ 0.13% for thymus, Peyer’s patch, and bone marrow, respectively, which were significantly

FIG. 2. Kinetics of DNA fragmentation in thymus of mice following LPS ⫹ VT coadministration. DNA was isolated from thymocytes of mice cotreated with LPS (0.1 mg/kg body wt ip) ⫹ VT (12.5 mg/kg body wt po) at various time intervals and visualized by agarose gel electrophoresis. The 0 h represents a naive mouse. Molecular size markers are shown on the left (M). Data are representative of two separate experiments.

VT (Fig. 1A). No fragmentation was observed in mice treated with LPS alone. In mice treated with LPS at doses ranging from 0.01 to 0.5 mg/kg body wt ip and in which the VT dose (12.5 mg/kg body wt po) was kept constant, thymic DNA fragmentation was maximal at 0.1 to 0.5 mg/kg body wt (Fig. 1B). No fragmentation of DNA was observed in mice treated with VT alone. The kinetics of DNA fragmentation were monitored in mice treated with optimal doses over a 24-h period (Fig. 2). Distinct DNA fragmentation was observed at 6 h and was maximal at 12 h. At 24 h, DNA fragmentation was minimal and likely resulted from elimination of apoptotic cells from the tissue. DNA fragmentation was not observed in the mice treated with either toxin alone or vehicle (data not shown). Based on the results of dose and time-course experiments, VT and LPS doses of 12.5 mg/kg oral and 0.1 mg/kg ip, respectively, were chosen in conjunction with a 12-h time period for most other subsequent mechanistic studies. Coadministration of LPS and VT Increases Hypofluorescent Apoptotic Cell Populations in Thymus, Peyer’s Patches, and Bone Marrow To quantify apoptosis under the optimized conditions, thymus, Peyer’s patch, and bone marrow cells were stained with PI and evaluated by flow cytometry. Distinct hypofluorescent peaks (A o) indicative of apoptosis were observed in thymus, Peyer’s patches, and bone marrow of cotreated mice but not those treated with VH or either toxin alone (Fig. 3A). The percent of apoptotic cells after exposure to VH, LPS, VT, and LPS ⫹ VT were 0.33, 0.44, 0.30, and 4.52%, respectively, in thymus and 1.92, 1.64, 1.21, and 6.30%, respectively, in Peyer’s patches, and 0.14, 1.16, 0.18, and 3.50%, respectively, for

FIG. 3. Flow cytometric quantitation of apoptotic cells in thymus, Peyer’s patch, and bone marrow of mice exposed to LPS ⫹ VT. Mice were treated with vehicle ip and po, LPS (0.1 mg/kg body wt ip) ⫹ vehicle (po), vehicle (ip) ⫹ VT (12.5 mg/kg body wt po), or LPS (0.1 mg/kg body wt ip) ⫹ VT (12.5 mg/kg body wt po). Cells from thymuses, Peyer’s patches, and bone marrow were isolated 12 h later, stained with PI, and subjected to flow cytometric analysis. (A) Flow cytograms in which A o indicates the hypodiploid peak associated with apoptosis. (B) Percentage of apoptotic cells. Data represent means ⫾ SEM (n ⫽ 4). *Significant synergistic effects of LPS ⫹ VT for thymus, p ⬍ 0.01, compared with corresponding additive expected responses. †Significant synergistic effects of LPS ⫹ VT for Peyer’s patches compared with corresponding additive expected responses, p ⬍ 0.005. ‡Significant synergistic effects of LPS ⫹ VT for bone marrow compared with corresponding additive expected responses, p ⬍ 0.0001. Data are representative of three separate experiments.

LPS ⫹ VT-INDUCED APOPTOSIS

47

Up-Regulation of TNF-␣ Does Not Mediate LPS Potentiation of VT-Induced Apoptosis in Thymus

FIG. 4. TNF-␣ up-regulation following LPS ⫹ VT coadministration. Mice were treated with vehicle (ip and po), LPS (0.1 mg/kg body wt ip) ⫹ vehicle (po), vehicle (ip) ⫹ VT (12.5 mg/kg body wt po), or LPS (0.1 mg/kg body wt ip) ⫹ VT (12.5 mg/kg body wt po). Blood was collected at intervals and TNF-␣ concentrations (mean ⫾ SEM, n ⫽ 9) were measured in serum by ELISA. TNF-␣ in LPS ⫹ VT group was significantly higher compared to vehicle, LPS, VT, or additive expected response, p ⬍ 0.0001.

higher (p ⬍ 0.01 for thymus, p ⬍ 0.005 for Peyer’s patches, and p ⬍ 0.0001 for bone marrow) than expected additive responses (Fig. 3B). These data verify that coexposure to LPS and VT synergistically increased apoptosis in thymus, Peyer’s patch, and bone marrow under the optimized exposure regimen.

TNF-␣ is a proinflammatory cytokine with pleiotropic effects, including induction of apoptosis in some leukocyte populations (Guevara Patino et al., 2000; Zhang et al., 1993). The effect of the optimized LPS ⫹ VT treatment regimen on serum TNF-␣ was assessed. Serum TNF-␣ was largely unaffected by VH, LPS, or VT; however, serum TNF-␣ was elevated up to 33 ng/ml in LPS ⫹ VT-treated mice at 3 h (Fig. 4). Rolipram, a phosphodiesterase IV inhibitor, has been previously shown to inhibit TNF-␣ production (Sekut et al., 1995) and might thus potentially inhibit LPS-induced apoptosis. The effect of rolipram on LPS ⫹ VT-induced apoptosis was assessed to determine whether TNF-␣ played a role in LPS potentiation (Fig. 5). As anticipated, rolipram inhibited thymic DNA fragmentation that was induced by a high dose of LPS (1 mg/kg body wt ip) used as a positive control. However, rolipram did not attenuate thymic DNA fragmentation induced by LPS ⫹ VT cotreatment but rather appeared to actually potentiate the response (Fig. 5A). Rolipram reduced serum TNF-␣ by more than 95% (Fig. 5B), thus confirming its efficacy. In a related study, the capacity of LPS ⫹ VT to induce thymocyte apoptosis was evaluated in mice deficient in expression of functional TNFR1 or TNFR2 (Fig. 6). Consistent with the rolipram studies, apoptosis in the knockout mice was not only uninhibited but was significantly higher than the wild-type controls. These experiments suggest that LPS potentiation of VT-induced thymic apoptosis is not related to increased TNF-␣ concentrations.

FIG. 5. Apoptosis in thymus following LPS ⫹ VT coadministration was not affected by the TNF-␣ inhibitor rolipram. (A) Mice were injected with LPS (0.1 mg/kg body wt ip) ⫹ VT (12.5 mg/kg body wt po) with or without prior treatment of rolipram (30 mg/kg body wt ip). As a positive control, an additional group of mice was injected with a high dose of LPS (1 mg/kg ip). After 12 h, DNA was electrophoresed. (B) TNF-␣ concentrations (mean ⫾ SEM, n ⫽ 6) were measured in serum by ELISA from mice treated with LPS (0.1 mg/kg body wt ip) plus VT (12.5 mg/kg body wt po) for 3 h with or without rolipram (30 mg/kg body wt) pretreatment. *Significant difference from LPS ⫹ VT-treated mice, p ⬍ 0.001.

48

ISLAM ET AL.

their corresponding vehicle controls. In both IL-6 knockout and wild-type VH groups, apoptosis was less than 1%. IL-6 levels in LPS ⫹ VT-treated IL-6 knockout mice were negligible compared to wild-type mice (Fig. 8B). These results suggest that increases in IL-6 did not contribute to LPS potentiation of VT-induced lymphocyte apoptosis. Up-Regulation of COX-2 Gene Expression Does Not Mediate LPS Potentiation of VT-Induced Apoptosis

FIG. 6. Apoptosis in thymus following LPS ⫹ VT coadministration was not affected by TNF-␣ receptor-1 or -2 deficiency. TNFR1 and TNFR2 knockout or corresponding wild-type (WT) control mice were treated with vehicle (Veh) or with LPS (1.0 mg/kg body wt ip) ⫹ VT (25 mg/kg body wt po) for 12 h and the percentage of apoptotic cells (mean ⫾ SEM, n ⫽ 3) in isolated thymocytes was measured by flow cytometry. Data are means. *Significant difference (p ⬍ 0.05) from the vehicle-treated control. †Significant difference (p ⬍ 0.05) from the corresponding LPS ⫹ VT-treated wild-type group. The percentage of apoptotic cells in LPS ⫹ VT-treated wild-type mice was significantly less than that of LPS ⫹ VT-treated TNFR1 or TNFR2 knockout mice.

Up-Regulation of IL-6 Does Not Mediate LPS Potentiation of VT-Induced Apoptosis in Thymus Interleukin-6 is another proinflammatory cytokine that may directly or indirectly mediate leukocyte apoptosis (Afford et al., 1992; Bullock et al., 1993; Morse et al., 1997). The role of IL-6 in LPS ⫹ VT-induced thymocyte apoptosis was investigated. To determine effects on IL-6 production, mice were treated with VH, LPS, VT, or LPS ⫹ VT and serum levels of IL-6 were evaluated over time (Fig. 7). After 3 h, serum IL-6 concentrations were 1, 115, 80, and 180 ng/ml in VH, LPS, VT, and LPS ⫹ VT groups, respectively. At 6 h, IL-6 concentrations returned to vehicle control levels except in the LPS ⫹ VT-treated group. IL-6 levels remained significantly elevated (p ⬍ 0.05) from 6 (105 ng/ml) to 12 h (104 ng/ml) in the cotreatment groups compared to VH, LPS, VT groups, or additive expected responses. IL-6 concentrations in LPS ⫹ VT-treated animals returned to vehicle levels at 24 h. To test the hypothesis that elevated IL-6 may mediate LPS ⫹ VT-induced apoptosis in lymphoid organs, IL-6 knockout mice and corresponding wild-type mice were employed. The mice were treated with LPS ⫹ VT or vehicles only. After 12 h, apoptosis was measured by flow cytometric cell cycle analysis (Fig. 8A). The percent of apoptotic cells in IL-6 knockout mice treated with LPS ⫹ VT was 21 compared to 8% for the LPS ⫹ VT-treated wild-type mice. The values were not significantly different but they were significantly higher (p ⬍ 0.01) than

Lymphocyte apoptosis can be induced by prostaglandins (Mastino et al., 1992; Matteucci et al., 1999; Saiagh et al., 1994), therefore, the up-regulation of COX-2 by LPS ⫹ VT might contribute to diminution of lymphoid tissues. To determine effects on COX-2 gene expression, mice were treated with VH, LPS, VT, or LPS ⫹ VT and the relative levels of COX-2 were evaluated in spleen (Fig. 9A). At 3 h, relative levels of cyclooxygenase-2 mRNA, measured as cDNA equivalents, were 0.5 ⫾ 0.09, 5.3 ⫾ 0.21, 2.8 ⫾ 0.26, and 24.3 ⫾ 0.83 pg/ml in VH, LPS, VT, and LPS ⫹ VT groups, respectively. LPS and VT acted in a synergistic fashion as evidenced by increased COX-2 in mouse compared to vehicle or mean expected additive response (p ⬍ 0.0001). A study was performed to assess whether the combined effects of LPS ⫹ VT were prostaglandin dependent. Indomethacin, a well-characterized inhibitor of COX-1 and -2 activity that blocks PGE 2 synthesis, was injected over a dose range of 3 to 50 mg/kg body wt ip at 30 min prior to treating mice with LPS ⫹ VT. Indomethacin did not abrogate thymic DNA fragmentation (Fig. 9B). These data suggested that PGE 2 or other COX-2 products were unlikely to play an essential role in the

FIG. 7. IL-6 up-regulation following LPS ⫹ VT coadministration. Mice were treated with vehicle (ip and po), LPS (0.1 mg/kg body wt ip) ⫹ vehicle (po), vehicle (ip) ⫹ VT (12.5 mg/kg body wt po), or LPS (0.1 mg/kg body wt ip) ⫹ VT (12.5 mg/kg body wt po). Blood was collected at intervals and IL-6 concentrations (mean ⫾ SEM, n ⫽ 9) were measured in serum by ELISA. *Significant difference from VH, LPS, or VT, p ⬍ 0.001. †Significant difference from additive expected response, p ⬍ 0.001.

LPS ⫹ VT-INDUCED APOPTOSIS

49

FIG. 8. Apoptosis in thymus following LPS ⫹ VT coadministration was not affected by IL-6 deficiency. (A) IL-6 knockout or corresponding wild-type control mice were treated with LPS (0.1 mg/kg body wt ip) plus VT (12.5 mg/kg body wt po) for 12 h and thymocyte apoptosis was measured by flow cytometry.*Significantly higher than corresponding vehicle groups, p ⬍ 0.01. The percentage of apoptotic cells in LPS ⫹ VT-treated wild-type mice was not significantly different from that of LPS ⫹ VT-treated IL-6 knockout mice. (B) IL-6 concentrations (mean ⫾ SEM, n ⫽ 4) were measured in serum by ELISA. *IL-6 concentration in LPS ⫹ VT-treated wild-type mice was significantly higher than its vehicle and IL-6 knockout mice, p ⬍ 0.05.

induction of thymocyte apoptosis in mice cotreated with LPS ⫹ VT. Increased Glucocorticoid Production-Mediated LPS Potentiation of VT-Induced Apoptosis in Thymus, Bone Marrow, and Peyer’s Patches Corticosterone can also mediate lymphocyte apoptosis (Gonzalo et al., 1993; Norimatsu et al., 1995; Zhang et al., 1993). The effect of LPS ⫹ VT cotreatment on serum corticicosterone was assessed over a 24-h period. Both LPS alone and LPS ⫹ VT elicited corticosterone release, with peak values ranging from 269 to 417 and 291 to 294 ng/ml, respectively,

over a 1- to 3-h time period, and concentrations were significantly different from vehicle control (Fig. 10). At 6 h, the serum corticosterone concentrations in the LPS group decreased to 156 ⫾ 43 ng/ml, which was not significantly different from VH (127 ⫾ 18 ng/ml), whereas serum corticosterone concentrations (242 ⫾ 14) in the LPS ⫹ VT group were significantly higher (p ⬍ 0.05) than the VH, LPS, and VT groups. At 12 h, the corticosterone levels measured as 63 ⫾ 6, 77 ⫾ 17, 42 ⫾ 9, and 196 ⫾ 11 ng/ml in VH, LPS, VT, and LPS ⫹ VT groups, respectively, with the LPS ⫹ VT group being significantly higher (p ⬍ 0.05) than the VH, VT, or LPS groups. At 24 h, the corticosterone level in the LPS ⫹ VT

FIG. 9. COX-2 up-regulation following LPS ⫹ VT coadministration was not involved in thymocyte apoptosis. (A) Mice were treated with vehicle (ip and po), LPS (0.1 mg/kg body wt ip) ⫹ vehicle (po), vehicle (ip) ⫹ VT (12.5 mg/kg body wt po), or LPS (0.1 mg/kg body wt ip) ⫹ VT (12.5 mg/kg body wt po). Spleen was collected 3 h after treatment. mRNA was isolated and RT– cPCR was done to quantitate mRNA (mean ⫾ SEM, n ⫽ 3). *Significant difference from vehicle, p ⬍ 0.05. †Significant difference from additive expected response, p ⬍ 0.0001. (B) Mice were injected intraperitoneally with indomethacin at 0, 3, 10, and 50 mg/kg body wt ip 30 min prior to administration of LPS (0.1 mg/kg body wt ip). ⫹ VT (12.5 mg/kg body wt po). After 12 h, thymocyte DNA was electrophoresed. Molecular size markers are shown on the left (M).

50

ISLAM ET AL.

FIG. 10. Increased serum corticosterone following LPS ⫹ VT coadministration. Mice were treated with vehicle (ip and po), LPS (0.1 mg/kg body wt ip) ⫹ vehicle (ip), vehicle (ip) ⫹ VT (12.5 mg/kg po), or LPS (0.1 mg/kg body wt ip) ⫹ VT (12.5 mg/kg body wt po). Mice were euthanized at intervals and blood was analyzed for corticosterone (mean ⫾ SEM, n ⫽ 6) by RIA. *Significantly different from vehicle, p ⬍ 0.05. †Significantly different from LPS, p ⬍ 0.05. ‡Significantly different from VT, p ⬍ 0.05.

group returned to vehicle level. The area under the curve vs time (AUC) values derived from each curve were 1817 ⫾ 91, 3102 ⫾ 495, 1552 ⫾ 220, and 4295 ⫾ 77 (ng/ml) ⫻ h for VH, LPS, VT, and LPS ⫹ VT groups, respectively (Fig. 10). After correction for vehicle control values, the AUC value for LPS ⫹ VT was significantly different (p ⬍ 0.05) from the AUC for VH, LPS, VT, or the additive expected response. Since elevated levels of corticosterone could be detected in LPS ⫹ VT-treated mice, the role of this mediator on apoptosis induction was examined using the steroid receptor antagonist RU 486. To determine the extent that this agent would block apoptosis induced by endogenous corticosterone, we initially conducted an experiment assessing the ability of this inhibitor to block DNA fragmentation in thymus. RU 486 (20 mg/kg ip) injected 30 min prior to LPS ⫹ VT markedly attenuated DNA fragmentation, whereas the antagonist alone had no effect (Fig. 11). Similar effects were observed at higher doses (data not shown). Flow cytometry was used to quantitatively confirm the effects of RU 486 (20 mg/kg ip) in thymus and other lymphoid tissues. The antagonist blocked LPS ⫹ VT-induced apoptosis in thymus, Peyer’s patch, and bone marrow (Fig. 12A). The results indicated that there was a significant decrease in total apoptotic cells (p ⬍ 0.01 for thymus, p ⬍ 0.05 for Peyer’s patch, and p ⬍ 0.0001 for bone marrow) in those treatment animals that received RU 486 compared to those that received LPS ⫹ VT only (Fig. 12B). These data indicate that the capacity of LPS to potentiate VT-induced apoptosis was mediated by the induction of corticosterone. DISCUSSION

The capacity of LPS to potentiate chemically induced lymphocyte death is of critical importance because it raises the

possibility that LPS at doses that are noninjurious alone might exacerbate the effects of an environmental or pharmaceutical agent, thereby resulting in lymphoid tissue injury and, ultimately, immune dysfunction and immunosuppression. Indeed, human LPS exposure is common and can occur through several mechanisms. While it is widely recognized that LPS exposure occurs via respiratory and systemic Gram-negative bacterial infections (Brun Buisson et al., 1995; Wenzel et al., 1996), humans are frequently exposed to the LPS of indigenous Gram-negative gut flora through gastrointestinal (GI) translocation, i.e., the passage of LPS from the GI lumen into the blood (Jacob et al., 1977). This translocation is enhanced under

FIG. 11. Abrogation of LPS ⫹ VT-induced thymic DNA fragmentation by corticosterone receptor antagonist RU 486. Mice were treated with LPS (0.1 mg/kg body wt ip) ⫹ VT (12.5 mg/kg body wt po) with or without RU 486 (20 mg/kg body wt ip). After 12 h, thymic DNA was electrophoresed. Molecular size markers are shown on the left (M). The results are representative of three separate experiments.

LPS ⫹ VT-INDUCED APOPTOSIS

51

FIG. 12. Abrogation of LPS ⫹ VT-induced apoptosis in thymus, Peyer’s patches, and bone marrow by the corticosterone receptor antagonist RU 486. Mice were treated with LPS (0.1 mg/kg body wt ip) ⫹ VT (12.5 mg/kg body wt po) with or without RU 486 (20 mg/kg body wt ip). After 12 h, cells prepared from thymuses, Peyer’s patches, and bone marrow were analyzed by PI staining and flow cytometry. (A) Representative flow cytograms. (B) Percentage of apoptotic cells (mean ⫾ SEM, n ⫽ 4). *LPS ⫹ VT ⫹ RU 486 groups were significantly different from LPS ⫹ VT-treated groups for thymus, p ⬍ 0.01. †LPS ⫹ VT ⫹ RU 486 groups were significantly different from LPS ⫹ VT-treated groups for Peyer’s patches, p ⬍ 0.05. ‡LPS ⫹ VT ⫹ RU 486 groups were significantly different from LPS ⫹ VT-treated groups for bone marrow, p ⬍ 0.0001. Results are representative of three separate experiments.

a variety of conditions, including dietary alterations (Rutenburg et al., 1957), excessive alcohol consumption (Bode et al., 1987), liver disease (Bigatello et al., 1987), GI injury (Van

Leeuwen et al., 1994), and inflammatory bowel diseases (Palmer et al., 1980). Elevated respiratory tract exposure to LPS also occurs in a variety of occupational environments.

52

ISLAM ET AL.

These include grain processing (Dosman et al., 1981; Pernis et al., 1961), waste treatment plants, machining operations (Mattsby Baltzer et al., 1989), poultry and swine industries(Donham et al., 1989), and office or household air (Flaherty et al., 1984; Peterson et al., 1964). Thus, exposure in humans is common, and the degree of exposure varies with occupation, diet, and disease state. LPS-exposed individuals represent a unique subpopulation that potentially have markedly heightened sensitivity to a wide variety of chemical agents (Roth et al., 1997). The trichothecenes represent an important class of fungal toxins to which humans can be frequently exposed via food (Rotter et al., 1996) or indoor air (Yang et al., 2000). LPS at sublethal doses markedly decreases the estimated LD50 values for the trichothecene T-2 toxin (Tai and Pestka, 1988) and VT (Zhou et al., 1999) in mice. In related work, Taylor et al. (1991) found synergy between T-2 toxin and LPS in mice relative to increased mortality, TNF-␣ production, hypothermia, and thymic atrophy. Taken together, these studies suggest that trichothecenes become more toxic in the presence of LPS, thereby causing elevated tissue injury and mortality. The present study confirmed previous findings of LPS apoptosis in lymphoid tissues of trichothecene-treated mice (Zhou et al., 2000) and identified the optimal doses of LPS (0.1 mg/kg) and VT (12.5 mg/kg) to synergistically induce apoptosis in murine thymus, Peyer’s patches, and bone marrow. The 12.5 mg/kg VT dose represents approximately 1/6th of the LD50 for VT (Forsell et al., 1987), whereas the 0.1 mg/kg LPS dose is 1/25th of the dose required for endotoxic shock in mice (Zhang et al., 1993). Under these conditions, potential apoptosis-inducing mediators such as TNF-␣, IL-6, COX-2, and corticosterone were up-regulated; however, only corticosterone appeared critical for LPS and VT interactive effects. Exposure to high doses of LPS (ⱖ2.5 mg/kg) induces thymic apoptosis in mice (Kato et al., 1995; Yu and Hu, 1999; Zhang et al., 1993). A common finding in these latter studies was that TNF-␣ and corticosteroids participate and collaborate as effector molecules. LPS-induced lymphocyte apoptosis was blocked by (1) neutralizing antibody to TNF-␣ or adrenalectomy (Zhang et al., 1993); (2) RU 486, a glucocorticoid receptor antagonist (Kato et al., 1995); or (3) Bifidobacterium bifidum peptidoglycan and lipoteichoic acid, which inhibit TNF-␣ synthesis (Yu and Hu, 1999). Many other studies have suggested TNF-␣ to be a potent apoptosis-inducing mediator in vitro and in vivo (Aggarwal et al., 2000; Guevara Patino et al., 2000; Pezzano et al., 2001), and, in some cases, elevated corticosterone may mediate the effects of TNF-␣. Rolipram, by virtue of its capacity to block phosphodiesterase IV activity in monocytic cells, elevates cAMP, which in turn suppresses TNF-␣ production (Sekut et al., 1995). The dose of rolipram (30 mg/kg) employed here has previously been shown to be effective in inhibiting TNF-␣ production in mice (Sekut et al., 1995). Similarly, in this study, the same dose of rolipram was sufficient to block the release of TNF-␣ without affecting

serum IL-6 levels. The results suggest TNF-␣ was not a critical inducer of apoptosis in mice treated with LPS ⫹ VT. The veracity of this interpretation is further indicated by the ability of both TNFR1- and TNFR2-deficient mice to yield marked apoptotic responses in thymocytes that were actually higher than that found for the wild-type counterpart (Fig. 6). LPS is a potent inducer of IL-6 production in vivo (Wang and Dunn, 1999). Several studies have indicated that administration of IL-6 stimulates corticosterone production via the hypothalamic–pituitary–adrenal axis (Wang and Dunn, 1999). Similarly, endogenously produced IL-6 increases and prolongs corticosterone production during endotoxemia (Bethin et al., 2000). Moreover, IL-6 has been reported to directly induce apoptosis in lymphocytes (Afford et al., 1992; Bullock et al., 1993). Since LPS ⫹ VT synergistically increased serum IL-6 at all time points until 12 h, it seemed possible that this cytokine induced apoptosis directly or via potentiated corticosterone production. However, IL-6 deficiency in mice did not attenuate thymic apoptosis exposure to LPS ⫹ VT. Furthermore, IL-6 deficiency had no effect on the corticosterone response (data not shown). It seemed possible that induction of COX-2 with subsequent generation of PGE 2 might possibly mediate LPS ⫹ VT-induced apoptosis in thymus. In support of this possibility, LPS can increase plasma PGE 2 within 90 min (Kozak et al., 1997) and resultant PGE 2 can induce thymocyte apoptosis in vivo and in vitro (Mastino et al., 1992; Matteucci et al., 1999; Saiagh et al., 1994). Although LPS ⫹ VT synergistically induced COX-2 mRNA in the spleen, the cyclooxygenase inhibitor indomethacin did not block LPS ⫹ VT-induced apoptosis, thus indicating that synergy involved PGE 2-independent mechanisms. Numerous studies have reported that glucocorticoids induce lymphocyte apoptosis in vitro and in vivo (Kofler, 2000). Ayala et al. (1995) found that cecal ligation and puncture (to induce sepsis) induced thymic apoptosis in mice with the generation of TNF-␣ and corticosteroids in the serum. Sepsis-induced thymic apoptosis was not observed following RU 486 treatment but was detected in polyethylene glycol-(rsTNF-R1) 2-treated mice. Therefore, sepsis-induced apoptosis does not appear to be a response to TNF-␣ but rather is controlled in vivo by corticosteroids released after the onset of sepsis. The kinetics of corticosterone appearance and inhibiting capacity of RU 486 observed here suggest that potentiation of LPS-stimulated corticosterone by VT for prolonged periods elevates thymic and Peyer’s patch apoptosis and that this apoptotic process is glucocorticoid receptor (GR) dependent. Thus, the interactive effects of LPS ⫹ VT mimic the TNF-␣-independent sepsis model rather than TNF-␣-dependent LPS model. A central question that remains to be investigated is how corticosteroids induce apoptosis in lymphoid cells. It is generally accepted that glucocorticoids exert most of their biologic effects through their cognate receptor (GR). Upon ligand binding, it translocates from the cytosol to the nucleus and binds as

LPS ⫹ VT-INDUCED APOPTOSIS

a homodimer to specific DNA sequences (glucocorticoid responsive elements) to alter gene transcription either directly or indirectly (Ashwell et al., 2000). Such a possibility was suggested in studies using GR dim mice, which carry a functionally similar GR mutation that cannot dimerize and, therefore, cannot directly transactivate gene transcription. Thymuses in these animals were refractory to corticosteroid-induced apoptosis (Reichardt et al., 1998). The mechanisms by which glucocorticoids/GR specifically cause apoptosis are still largely unknown. However, a growing number of gene products have been implicated via blocking glucocorticoid-induced apoptosis. Among these are the now classic inhibitors of mitochondrial-dependent cell death such as Bcl-2 and Bcl-x L as well as inhibitors of apoptosis. In addition to these, Notch, a transmembrane receptor, renders double-positive thymocytes relatively resistant to corticosteroid-induced apoptosis (Ashwell et al., 2000). Taken together, the results indicate that LPS and VT can interact to elevate serum corticosterone concentrations, which in turn mediate widespread apoptosis in lymphoid tissue. Corticosterone may be acting independently on a leukocyte population or its action may converge with apoptotic signals initiated by VT and/or LPS. These effects were independent of enhanced expression of the proinflammatory genes TNF-␣ and IL-6 or the enzyme COX-2, suggesting that these proteins are not prerequisites for corticosterone up-regulation. While this presentation has taken the perspective that LPS potentiates VT-induced apoptosis, it might be conversely argued that VT is potentiating LPS-induced apoptosis. Regardless of the perspective, the two agents clearly act in a synergistic fashion. Clarification of this issue will require understanding how LPS and VT interact to stimulate the hypothalamic–pituitary–adrenal axis and how apoptosis is mediated through corticosterone. Such efforts should yield general insight into how LPS and perhaps other inflammagenic stimuli may render certain populations uniquely sensitive to chemicals encountered in the environment or in routine drug therapy ACKNOWLEDGMENTS This work was supported by Public Health Services Grants ES 09521 (J.J.P.) and ES 03358 (J.J.P.) and the National Institute for Environmental Health Sciences and the Michigan State University Agricultural Experiment Station. We thank Dr. Dale Romsos, Dr. Kirk Dolan, and Rebecca Uzarski for assistance and useful advice during this project.

REFERENCES Afford, S. C., Pongracz, J., Stockley, R. A., Crocker, J., and Burnett, D. (1992). The induction by human interleukin-6 of apoptosis in the promonocytic cell line U937 and human neutrophils. J. Biol. Chem. 267, 21612–21616. Aggarwal, S., Gollapudi, S., Yel, L., Gupta, A. S., and Gupta, S. (2000). TNF-alpha-induced apoptosis in neonatal lymphocytes: TNFRp55 expression and downstream pathways of apoptosis. Genes Immun. 1, 271–279. Ashwell, J. D., Lu, F. W., and Vacchio, M. S. (2000). Glucocorticoids in T cell development and function. Annu. Rev. Immunol. 18, 309 –345.

53

Ayala, A., Herdon, C. D., Lehman, D. L., DeMaso, C. M., Ayala, C. A., and Chaudry, I. H. (1995). The induction of accelerated thymic programmed cell death during polymicrobial sepsis: Control by corticosteroids but not tumor necrosis factor. Shock 3, 259 –267. Azcona-Olivera, J. I., Ouyang, Y., Murtha, J., Chu, F. S., and Pestka, J. J. (1995). Induction of cytokine mRNAs in mice after oral exposure to the trichothecene vomitoxin (deoxynivalenol): Relationship to toxin distribution and protein synthesis inhibition. Toxicol. Appl. Pharmacol. 133, 109 –120. Bethin, K. E., Vogt, S. K., and Muglia, L. J. (2000). Interleukin-6 is an essential, corticotropin-releasing hormone-independent stimulator of the adrenal axis during immune system activation. Proc. Natl. Acad. Sci. USA 97, 9317–9322. Bigatello, L. M., Broitman, S. A., Fattori, L., Di Paoli, M., Pontello, M., Bevilacqua, G., and Nespoli, A. (1987). Endotoxemia, encephalopathy, and mortality in cirrhotic patients. Am. J. Gastroenterol. 82, 11–15. Bode, C., Kugler, V., and Bode, J. C. (1987). Endotoxemia in patients with alcoholic and non-alcoholic cirrhosis and in subjects with no evidence of chronic liver disease following acute alcohol excess. J. Hepatol. 4, 8 –14. Bondy, G. S., McCormick, S. P., Beremand, M. N., and Pestka, J. J. (1991). Murine lymphocyte proliferation impaired by substituted neosolaniols and calonectrins: Fusarium metabolites associated with trichothecene biosynthesis. Toxicon 29, 1107–1113. Bondy, G. S., and Pestka, J. J. (2000). Immunomodulation by fungal toxins. J. Toxicol. Environ. Health B Crit. Rev. 3, 109 –143. Brun Buisson, C., Doyon, F., Carlet, J., Dellamonica, P., Gouin, F., Lepoutre, A., Mercier, J. C., Offenstadt, G., and Regnier, B. (1995). Incidence, risk factors, and outcome of severe sepsis and septic shock in adults: A multicenter prospective study in intensive care units: French ICU Group for Severe Sepsis. JAMA 274, 968 –974. Bullock, G., Tang, C., Tourkina, E., Ibrado, A. M., Lutzky, J., Huang, Y., Mahoney, M. E., and Bhalla, K. (1993). Effect of combined treatment with interleukin-3 and interleukin-6 on 4-hydroperoxycyclo-phosphamide-induced programmed cell death or apoptosis in human myeloid leukemia cells. Exp. Hematol. 21, 1640 –1647. Dong, W., Azcona-Olivera, J. I., Brooks, K. H., Linz, J. E., and Pestka, J. J. (1994). Elevated gene expression and production of interleukins 2, 4, 5, and 6 during exposure to vomitoxin (deoxynivalenol) and cycloheximide in the EL-4 thymoma. Toxicol. Appl. Pharmacol. 127, 282–290. Donham, K., Haglind, P., Peterson, Y., Rylander, R., and Belin, L. (1989). Environmental and health studies of farm workers in Swedish swine confinement buildings. Br. J. Ind. Med. 46, 31–37. Dosman, J., Cotton, D., Graham, B., Li, R., Froh, F., and Barnett, G. (1981). Chronic bronchitis and decreased forced expiratory flow rates in lifetime nonsmoking grain workers. Chest 80, 33. Erickson, S. L., de Sauvage, F. J., Kikly, K., Carver-Moore, K., Pitts-Meek, S., Gillett, N., Sheehan, K. C. F., Schreiber, R. D., Goeddel, D. V., and Moore, M. W. (1994). Decreased sensitivity to tumour-necrosis factor but normal T-cell development in TNF receptor-2-deficient mice. Nature 372, 560 –563. Flaherty, D. K., Deck, F. H., Cooper, J., Bishop, K., Winzenburger, P. A., Smith, L. R., Bynum, L., and Witmer, W. B. (1984). Bacterial endotoxin isolated from a water spray air humidification system as a putative agent of occupation-related lung disease. Infect. Immun. 43, 206 –212. Forsell, J. H., Jensen, R., Tai, J. H., Witt, M., Lin, W. S., and Pestka, J. J. (1987). Comparison of acute toxicities of deoxynivalenol (vomitoxin) and 15-acetyldeoxynivalenol in the B6C3F1 mouse. Food Chem. Toxicol. 25, 155–162. Gonzalo, J. A., Gonzalez-Garcia, A., Martinez, C., and Kroemer, G. (1993).

54

ISLAM ET AL.

Glucocorticoid-mediated control of the activation and clonal deletion of peripheral T cells in vivo. J. Exp. Med. 177, 1239 –1246.

apoptosis during negative selection in thymic nurse cells. Ethn. Dis. 11, 154 –156.

Guevara Patino, J. A., Marino, M. W., Ivanov, V. N., and Nikolich-Zugich, J. (2000). Sex steroids induce apoptosis of CD8⫹CD4⫹ double-positive thymocytes via TNF-alpha. Eur. J. Immunol. 30, 2586 –2592.

Pfeffer, K., Matsuyama, T., Kundig, T. M., Wakeham, A., Kishihara, K., Shahninian, A., Wiegemann, K., Ohashi, P. S., Kronke, M., and Mak, T. W. (1993). Mice deficient for the 55 Kd tumor necrosis factor receptor are resistant to endotoxic shock yet succumb to L. monocytogenes infection. Cell 73, 457– 467.

Hall, L. L., Bicknell, G. R., Primrose, L., Pringle, J. H., Shaw, J. A., and Furness, P. N. (1998). Reproducibility in the quantification of mRNA levels by RT—PCR–ELISA and RT competitive–PCR–ELISA. Biotechniques 24, 652– 658. Hewett, J. A., and Roth, R. A. (1993). Hepatic and extrahepatic pathobiology of bacterial lipopolysaccharides. Pharmacol. Rev. 45, 382– 411. Islam, Z., Nagase, M., Yoshizawa, T., Yamauchi, K., and Sakato, N. (1998). T-2 toxin induces thymic apoptosis in vivo in mice. Toxicol. Appl. Pharmacol. 148, 205–214. Jacob, A. I., Goldberg, P. K., Bloom, N., Degenshein, G. A., and Kozinn, P. J. (1977). Endotoxin and bacteria in portal blood. Gastroenterology 72, 1268 – 1270. Kato, Y., Morikawa, A., Sugiyama, T., Koide, N., Jiang, G. Z., Takahashi, K., and Yokochi, T. (1995). Role of tumor necrosis factor-alpha and glucocorticoid on lipopolysaccharide (LPS)-induced apoptosis of thymocytes. FEMS Immunol. Med. Microbiol. 12, 195–203.

Pruett, S. B., Collier, S., Wu, W. J., and Fan, R. (1999). Quantitative relationships between the suppression of selected immunological parameters and the area under the corticosterone concentration vs time curve in B6C3F1 mice subjected to exogenous corticosterone or to restraint stress. Toxicol. Sci. 49, 272–280. Reichardt, H. M., Kaestner, K. H., Tuckermann, J., Kretz, O., Wessely, O., Bock, R., Gass, P., Schmid, W., Herrlich, P., Angel, P., and Schutz, G. (1998). DNA binding of the glucocorticoid receptor is not essential for survival. Cell 93, 531–541. Riedy, M. C., Timm, E. A., Jr., and Stewart, C. C. (1995). Quantitative RT–PCR for measuring gene expression. Biotechniques 18, 70 –74, 76. Roth, R. A., Harkema, J. R., Pestka, J. P., and Ganey, P. E. (1997). Is exposure to bacterial endotoxin a determinant of susceptibility to intoxication from xenobiotic agents? Toxicol. Appl. Pharmacol.147, 300 –311.

Kofler, R. (2000). The molecular basis of glucocorticoid-induced apoptosis of lymphoblastic leukemia cells. Histochem. Cell Biol. 114, 1–7.

Rotter, B. A., Prelusky, D. B., and Pestka, J. J. (1996). Toxicology of deoxynivalenol (vomitoxin). J. Toxicol. Environ. Health 48, 1–34.

Kopf, M., Baumann, H., Freer, G., Freudenberg, M., Lamers, M., Kishimoto, T., Zinkernagel, R., Bluethmann, H., and Kohler, G. (1994). Impaired immune and acute-phase responses in interleukin-6-deficient mice. Nature 368, 339 –342.

Rumbeiha, W. K., Fitzgerald, S. D., Braselton, W. E., Roth, R. A., Pestka, J. J., and Kaneene, J. B. (2000). Augmentation of mercury-induced nephrotoxicity by endotoxin in the mouse. Toxicology 151, 103–116.

Kozak, W., Soszynski, D., Rudolph, K., Conn, C. A., and Kluger, M. J. (1997). Dietary n-3 fatty acids differentially affect sickness behavior in mice during local and systemic inflammation. Am. J. Physiol. 272, R1298 –R1307. Mastino, A., Piacentini, M., Grelli, S., Favalli, C., Autuori, F., Tentori, L., Oliverio, S., and Garaci, E. (1992). Induction of apoptosis in thymocytes by prostaglandin E2 in vivo. Dev. Immunol. 2, 263–271. Matteucci, C., Grelli, S., De Smaele, E., Fontana, C., and Mastino, A. (1999). Identification of nuclei from apoptotic, necrotic, and viable lymphoid cells by using multiparameter flow cytometry. Cytometry 35, 145–153. Mattsby Baltzer, I., Sandin, M., Ahlstrom, B., Allenmark, S., Edebo, M., Falsen, E., Pedersen, K., Rodin, N., Thompson, R. A., and Edebo, L. (1989). Microbial growth and accumulation in industrial metal-working fluids. Appl. Environ. Microbiol. 55, 2681–2689.

Rutenburg, A. M., Sonnenblick, E., Koven, I., Aprahamian, H. A., Reiner, L., and Fine, J. (1957). The role of intestinal bacteria in the development of dietary cirrhosis in rats. J. Exp. Med. 106, 1–14. Saiagh, S., Rigal, D., and Monier, J. C. (1994). Effects of PGE2 upon differentiation and programmed cell death of suspension cultured CD4⫺CD8⫺ thymocytes. Int. J. Immunopharmacol. 16, 775–786. Schletter, J., Heine, H., Ulmer, A. J., and Rietschel, E. T. (1995). Molecular mechanisms of endotoxin activity. Arch. Microbiol. 164, 383–389. Sekut, L., Yarnall, D., Stimpson, S. A., Noel, L. S., Bateman-Fite, R., Clark, R. L., Brackeen, M. F., Menius, J. A., Jr., and Connolly, K. M. (1995). Anti-inflammatory activity of phosphodiesterase (PDE)-IV inhibitors in acute and chronic models of inflammation. Clin. Exp. Immunol. 100, 126 –132. Sellins, K. S., and Cohen, J. J. (1987). Gene induction by gammairradiation leads to DNA fragmentation in lymphocytes. J. Immunol. 139, 3199 –3206.

Morse, L., Chen, D., Franklin, D., Xiong, Y., and Chen-Kiang, S. (1997). Induction of cell cycle arrest and B cell terminal differentiation by CDK inhibitor p18(INK4c) and IL-6. Immunity 6, 47–56.

Tai, J. H., and Pestka, J. J. (1988). Synergistic interaction between the trichothecene T-2 toxin and Salmonella typhimurium lipopolysaccharide in C3H/ HeN and C3H/HeJ mice. Toxicol. Lett. 44, 191–200.

Norimatsu, M., Ono, T., Aoki, A., Ohishi, K., and Tamura, Y. (1995). In vivo induction of apoptosis in murine lymphocytes by bacterial lipopolysaccharides. J. Med. Microbiol. 43, 251–257.

Taylor, M. J., Lafarge-Frayssinet, C., Luster, M. I., and Frayssinet, C. (1991). Increased endotoxin sensitivity following T-2 toxin treatment is associated with increased absorption of endotoxin. Toxicol. Appl. Pharmacol. 109, 51–59.

Palmer, K. R., Duerden, B. I., and Holdsworth, C. D. (1980). Bacteriological and endotoxin studies in cases of ulcerative colitis submitted to surgery. Gut 21, 851– 854.

Ueno, Y. (1987). Trichothecenes in food. In Mycotoxins in Food (P. Korgh, Ed.), pp. 123–147. Academic Press, New York.

Pernis, B., Vigliani, E. C., Cavagna, C., and Finuli, M. (1961). The role of bacteria endotoxins in occupational diseases caused by inhaling vegetable dusts. Br. J. Ind. Med. 18, 120 –129.

Van Leeuwen, P. A., Boermeester, M. A., Houdijk, A. P., Ferwerda, C. C., Cuesta, M. A., Meyer, S., and Wesdorp, R. I. (1994). Clinical significance of translocation. Gut 35, S28 –S34.

Pestka, J. J., Yan, D., and King, L. E. (1994). Flow cytometric analysis of the effects of in vitro exposure to vomitoxin (deoxynivalenol) on apoptosis in murine T, B and IgA⫹ cells. Food Chem. Toxicol. 32, 1125–1136.

Wang, J., and Dunn, A. J. (1999). The role of interleukin-6 in the activation of the hypothalamo—pituitary–adrenocortical axis and brain indoleamines by endotoxin and interleukin-1 beta. Brain Res. 815, 337–348.

Peterson, R. D., Wicklund, P. E., and Good, R. A. (1964). Endotoxin activity of house dust extracts. J. Allergy 35, 134 –142.

Wenzel, R. P., Pinsky, M. R., Ulevitch, R. J., and Young, L. (1996). Current understanding of sepsis. Clin. Infect. Dis. 22, 407– 413.

Pezzano, M., Samms, M., and Guyden, J. C. (2001). TNF and Fas-induced

Yan, D., Rumbeiha, W. K., and Pestka, J. J. (1998). Experimental murine IgA

LPS ⫹ VT-INDUCED APOPTOSIS nephropathy following passive administration of vomitoxin-induced IgA monoclonal antibodies. Food Chem. Toxicol. 36, 1095–1106. Yang, G. H., Jarvis, B. B., Chung, Y. J., and Pestka, J. J. (2000). Apoptosis induction by the satratoxins and other trichothecene mycotoxins: Relationship to ERK, p38 MAPK, and SAPK/JNK activation. Toxicol. Appl. Pharmacol. 164, 149 –160. Yu, Z., and Hu, H. (1999). Regulation of Bifidobacterium bifidum surface molecules on apoptosis of murine thymocytes induced by LPS in vivo. Zhonghua Weishengwuxue He Mianyixue Zazh 19, 180 –183. Zhang, Y. H., Takahashi, K., Jiang, G. Z., Kawai, M., Fukada, M., and Yokochi, T. (1993). In vivo induction of apoptosis (programmed cell death) in mouse thymus by administration of lipopolysaccharide. Infect. Immun. 61, 5044–5048.

55

Zhou, H. R., Harkema, J. R., Hotchkiss, J. A., Yan, D., Roth, R. A., and Pestka, J. J. (2000). Lipopolysaccharide and the trichothecene vomitoxin (deoxynivalenol) synergistically induce apoptosis in murine lymphoid organs. Toxicol. Sci. 53, 253–263. Zhou, H. R., Harkema, J. R., Yan, D., and Pestka, J. J. (1999). Amplified proinflammatory cytokine expression and toxicity in mice co-exposed to lipopolysaccharide and the trichothecene vomitoxin (deoxynivalenol). J. Toxicol. Environ. Health A 57, 115–136. Zhou, H. R., Yan, D., and Pestka, J. J. (1998). Induction of cytokine gene expression in mice after repeated and subchronic oral exposure to vomitoxin (Deoxynivalenol): Differential toxin-induced hyporesponsiveness and recovery. Toxicol. Appl. Pharmacol. 151, 347–358.