Energy composition of diet affects muscle fiber recruitment, body composition, and growth trajectory in rainbow trout (Oncorhynchus mykiss)

Aquaculture 457 (2016) 1–14

Contents lists available at ScienceDirect

Aquaculture journal homepage: www.elsevier.com/locate/aquaculture

Energy composition of diet affects muscle fiber recruitment, body composition, and growth trajectory in rainbow trout (Oncorhynchus mykiss) Ken Overturf a, Frederic T. Barrows a, Ronald W. Hardy b, Andreas Brezas b, André Dumas c,⁎ a b c

USDA/ARS Hagerman Fish Culture Experiment Station, 3059-F National Fish Hatchery Road, Hagerman, ID 83332, USA University of Idaho, Aquaculture Research Institute, 3059-F National Fish Hatchery Road, Hagerman, ID 83332, USA Coastal Zones Research Institute, 232B, avenue de l'Eglise, Shippagan, New Brunswick E8S 1J2, Canada

a r t i c l e

i n f o

Article history: Received 1 December 2015 Received in revised form 30 January 2016 Accepted 1 February 2016 Available online 3 February 2016 Keywords: Fish nutrition Gene expression Modeling Muscle growth Nutrient deposition Nutrigenomics

a b s t r a c t Increasing feed efficiency and muscle growth in aquaculture are of high priority and require understanding how dietary components are interactively processed and trigger molecular, tissue and whole-body responses. A 67day trial was conducted to describe the effects of three feeds with varying dietary protein (P) to lipid (L) ratios (43P:20L, 50P:15L, 62P:6L) on growth trajectory, body composition, nutrient deposition, muscle histology, gene expression and protein degradation pathways of juvenile rainbow trout (initial weight 11.2 g). The growth trajectories of trout fed the 43P:20L and 50P:15L diets were identical and higher than trout fed the 62P:6L diet. The overall TGC was 0.261 for trout fed the 43P:20L and 50P:15L diets. Feed intake was associated with dietary protein level, not energy. Body composition differed among treatments early (at day 14) in the experiment and continued throughout. Body lipid and body protein contents varied significantly (P b 0.05) from 7.36 (62P:6L) to 12.91% (43P:20L) and 14.95 (43P:20L) to 16.24% (50P:15L) at day 67, respectively). Simple mathematical models were developed to predict body lipid content and feed intake of growing trout. Analysis of gene expression data using RT-PCR correlated with other measured parameters, provided significant information to evaluate metabolic processing of the different diets. The relative expression level of Pax7 in fish fed the 43P:20L diet was higher than in fish fed the other diets and the statistical difference was nearly significant (P = 0.058). The relative content of small muscle fibers (0–25 μm) increased significantly (P b 0.05) with time in trout fed the 43P:20L diet, whereas the opposite was observed in fish fed the other treatments. An increased proportion of small muscle fibers was associated with the highest relative expression of PAX7 over time and increased lysosomal activity in fish fed the 43P:20L dietary treatment. This is the first study in vivo using fish to show that increases in hyperplasia is linked to autophagy activity. The overall rate of protein deposition was significantly (P b 0.05) higher in trout fed the 50P:15L (16.58 ± 0.57 mg (°C-d)−1) compared to the 62P:6L (13.26 ± 0.66 mg (°C-d)−1), but there was no significant difference with trout fed the 43P:20L diet (15.05 ± 0.69 mg (°C-d)−1). This study demonstrates that macronutrients are potent regulators of muscle development and growth, and provides new opportunities in nutrigenomics to program performance and flesh quality of organisms. Statement of relevance: Nutrigenomics can foster sustainable aquaculture. © 2016 Elsevier B.V. All rights reserved.

1. Introduction The sustainable development of aquaculture of carnivorous species is contingent on successful nutritional innovations and improvement of animal metabolic performance. Volatility of raw feed material prices in world markets presents a constant challenge for feed manufacturers and fish producers to minimize production costs without compromising feed quality. Because protein-rich ingredients and oils account typically for more than 65% of feed costs, it is crucial ⁎ Corresponding author at: The Center for Aquaculture Technologies Canada, 20 Hope Street, P.O. Box 388, Souris, Prince Edward Island C0A 2B0, Canada. E-mail address: [email protected] (A. Dumas).

http://dx.doi.org/10.1016/j.aquaculture.2016.02.002 0044-8486/© 2016 Elsevier B.V. All rights reserved.

to determine the effect of these expensive nutrient sources on mechanisms responsible for growth and health at different life stages of fish. Nutrigenomics – the discipline overarching the regulation of genetic signals by nutrients – holds potential for nutritional innovations and for optimizing animal health, quality and performance, reducing feed costs and, ultimately, fostering sustainability of aquaculture. In fish, nutrients can impact expression of mRNA encoding for highly unsaturated fatty acid (HUFAs) biosynthesis (e.g. Jordal et al., 2005; Leaver et al., 2008a, 2008b), digestive enzymes (e.g. Zambonino Infante and Cahu, 2001; Geurden et al., 2007), receptors of growth hormone and thyroid hormone (e.g. Gómez-Requeni et al., 2005; Raine et al., 2007), liver transcriptome response (Xiong et al., 2014), and muscle growth (Alami-

2

K. Overturf et al. / Aquaculture 457 (2016) 1–14

Durante et al., 2014), to name a few. To obtain more examples of interactions between nutrition and gene expression, the reader is referred to the review article of Panserat and Kaushik (2010). It is not surprising that a growing body of literature points at modern molecular research to elucidate the effect of diets on underlying mechanisms of growth and efficiency of nutrient utilization to overcome current challenges in aquaculture (Millward, 1989; Valente et al., 2001; Overturf et al., 2003; Silverstein et al., 2005; Gatlin et al., 2007; Naylor et al., 2009; Welch et al., 2010; Xiong et al., 2014; Izquierdo et al., 2015). Among the genes of interest in aquaculture nutrition are those related to muscle growth (e.g. MYOD2, MSTN1) and protein degradation metabolic pathways (e.g. KLF15, FOXO3, calpain) because of their regulatory roles on weight gain and nutrient utilization. The regulation of these genes by dietary macronutrients and their correlation with growth performance, nutrient utilization and muscle growth dynamic remain relatively unknown. Besides nutrigenomics, animal metabolism deserves additional research efforts, especially regarding nutrient utilization at different life stages. Several studies have shown nutrient utilization efficiency, body composition and patterns of gene expression change throughout the lifespan of fish (Brown, 1957; Phillips et al., 1960; Shearer et al., 1994; Peragón et al., 2001; Azevedo et al., 2004a; Johansen and Overturf, 2005; Dumas et al., 2007a, 2007b). These observations suggest nutrient metabolism is regulated through dynamic processes to maintain homeostasis and achieve metabolic scopes that are age- or size-related. Yet, to date, the costs of ingredients more than metabolic scope of fish have driven the formulation of feeds and development of feeding programs. There is thus a need to reconsider current dietary protein to lipid ratios encountered in commercial feeds for juvenile rainbow trout (b 100 g). It appears timely to examine the benefits of altering feed formulas to better meet nutrient requirements of fish at specific life stages, reach production goals of interest and to increase efficiency of nutrient utilization. To our knowledge, no studies have systematically described the effect of macronutrient levels on both nutrient utilization and molecular response simultaneously in juvenile rainbow trout. This species represents the most studied carnivorous fish model and is commercially produced worldwide. Therefore, the objectives of this study were to (1) describe the relationships between dietary macronutrients, growth trajectory, changes in body composition and nutrient deposition, and gene expression associated with muscle growth dynamics in juvenile rainbow trout (10 to 100 g body weight), and (2) integrate this quantitative knowledge for application to practical diet formulation and feeding programs.

2. Materials and methods 2.1. Diets Three experimental diets were formulated to contain different levels of dietary protein and lipid (Table 1). Diet 1, 43% crude protein and 20% crude lipid (43P:20L), Diet 2, 50% crude protein and 15% crude lipid (50P:15L), and Diet 3, 62% crude protein and 6% crude lipid (62P:6L), were formulated to meet the known nutrient requirements of rainbow trout (Guillaume et al., 1999; Halver and Hardy, 2002; NRC, 2011). Diets were processed using a twin-screw cooking extruder (DNDL-44, Buhler AG, Uzwil, Switzerland) Pellets were dried in a pulse bed drier (Buhler AG, Uzwil, Switzerland) for 25 min at 102 °C with a 10 min cooling period. A topcoat of fish oil was added to the control (50P:15L) and the 43P:20L feeds using a vacuum-assisted top-coater (A.J. Mixing, Ontario, Canada). All diets were fed within 6 months of manufacture. Duplicate samples of each experimental diet were retained for proximate analysis. The three diets were randomly allocated to nine tanks (three replicates per treatment) and fed to the fish for a period of 67 days.

Table 1 Ingredients and nutrient composition of the experimental diets (% of dietary protein to lipid ratio, P:L). Experimental diets Ingredient (%) 43P:20L

50P:15L

62P:6L

L-Arginine

31.94 10.00 – 7.25 – 16.80 11.46 17.44 0.58

34.46 12.00 8.00 5.09 2.00 17.38 6.88 10.46 0.35

38.24 15.00 20.00 1.84 5.00 18.25 – – –

L-Lysine

0.35

0.21

D-Methionine

0.40

0.24

–

L-Threonine

0.50

0.30

–

Dicalcium phosphate Soy lecithin Vitamin premixi Stay-C 35%j Mineral premixk

1.48 0.50 1.00 0.20 0.10

1.04 0.30 1.00 0.20 0.10

0.37 – 1.00 0.20 0.10

3.26 50.47 15.40 9.59 22.50 1.62

2.89 61.52 6.44 9.65 21.38 1.65

a

Menhaden fishmeal Poultry by-productb Corn protein concentratec Soy protein concentrated Wheat gluten meale Wheat flourf Barley flourg Fish oilh

Analyzed nutrient composition (as-is) Moisture (%) 2.83 Crude protein (%) 43.04 Crude lipid (%) 20.40 Ash (%) 9.28 −1 23.12 Gross energy (MJ kg ) Phosphorus (%) 1.60

–

Omega Proteins Inc., Menhaden Special Select, 618 g kg−1 crude protein. IDF Inc., 712 g kg−1 protein. c Cargill, Empyreal 75, 756 g kg−1 crude protein. d Solae, Pro-Fine VF, 693 g kg−1 crude protein. e Manildra Milling, 778 g kg−1 protein. f Manildra Milling, 120 g kg−1 protein. g Circle S Feeds, 106 g kg−1 protein. h Omega Proteins Inc., Virginia Prime menhaden oil. i ARS 702; contributed, per kg diet; vitamin A 9650 IU; vitamin D 6600 IU; vitamin E 132 IU; vitamin K3 1.1 g: thiamin mononitrate 9.1 mg; riboflavin 9.6 mg; pyridoxine hydrochloride 13.7 mg; pantothenate DL-calcium 46.5 mg; cyanocobalamin 0.03 mg; nicotinic acid 21.8 mg; biotin 0.34 mg; folic acid 2.5 mg; inositol 600 mg. j DSM Nutritional Products. k Contributed in mg kg−1 of diet; manganese 13; iodine 5; copper 9; zinc 40. a

b

2.2. Fish and rearing conditions during the growth trial Rainbow trout (diploid domesticated stock of the House Creek strain maintained at the Hagerman Fish Culture Experiment Station, Hagerman, Idaho, U.S.A.) with no signs or symptoms of disease were fed a commercial diet (50P:15L) for several weeks prior to the start of experiment. The mixed sex trout (mean initial body weight ± standard deviation: 11.2 ± 0.1 g) were randomly stocked (tank numbered by using a random number generator and then stocked in descending order) into 9 150-liter self-cleaning circular fiberglass tanks (100 fish/tank to maintain stocking density suitable for rainbow trout all along the trial) supplied with constant temperature (14.5 °C) spring water at a flow rate of 8 l/min. Photoperiod was maintained at 14 h daylight:10 h dark. The fish were hand-fed to apparent satiation twice daily, 6 days per week, for 67 days. Water temperature and dissolved oxygen (N 90% saturation) were monitored daily. After sedating the fish by immersion in MS-222 (Tricaine methanesulfonate buffered with sodium bicarbonate to pH 7.3) at 75 mg L − 1 until opercular movement ceased, all fish in each tank were bulk-weighed in the morning (fasting state) every time they appeared to have doubled their body weight to estimate growth rate and feed efficiency (FE). Experimental protocols were approved in advance by the Institutional Animal Care and Use Committee of the University of Idaho (protocol #2013–98).

K. Overturf et al. / Aquaculture 457 (2016) 1–14

2.3. Biochemical composition of feed and fish whole-body Whole-body proximate composition was analyzed on a pooled sample of 50 fish at the start of experiment to serve as the baseline. At every sampling period, three fish per tank were randomly captured and euthanized using MS-222 at 250 mg L−1. Buffered tricaine methanesulfonate at 250 mg L−1 is one of the recommended methods for fish euthanasia by the American Veterinary Medical Association (2013) and EU Directive 2010/63/EU for animal experiments. Sampled fish were pooled by a tank and two aliquots from each pooled sample were analyzed for whole-body proximate composition. Fish samples were made into a puree using an industrial food processor. Samples were then dried in a convection oven at 105 °C for 12 h to determine moisture level according to AOAC (2002). Dried samples were finely ground by mortar and pestle and analyzed for crude protein (total nitrogen × 6.25) using the Dumas method with a nitrogen determinator (TruSpec N, LECO Corporation, St. Joseph, MI). Crude lipid was analyzed using an ANKOM XT15 extractor (ANKOM Technology, Macedon, NY) with petroleum ether as the extracting solvent, and ash by incineration at 550 °C in a muffle furnace. Energy content of samples was determined using a Parr adiabatic bomb calorimeter (Parr Instruments, Moline, IL). 2.4. Gene expression Muscle (upper mid-lateral with skin removed) and liver tissues were harvested and flash frozen in liquid nitrogen. RNA isolation was performed using TRIzol (Invitrogen) extraction according to the manufacturer's protocol. The data presented in the results represents RNA isolated from the muscle and liver tissues from three fish per tank (nine per diet) sampled at the end of the trial. The quantity and purity of the RNA were determined using a Thermo Scientific NanoDrop 2000 spectrophotometer. To detect the level of gene expression, realtime quantitative RT-PCR was carried out using an ABI Prism 7900HT Sequence Detection System and the TaqMan One-Step RT-PCR Master Mix Reagents kit, according to the protocol provided by ABI (Foster City, CA). The final concentration of each reaction was: Master Mix, 1× (contains AmpliTaq Gold enzyme, dNTPs including dUTP, a passive reference, and buffer components); MultiScribe reverse transcriptase, 0.25 U μl−1; RNase inhibitor mix, 0.4 U/μl; forward primer 600 nM; reverse primer 600 nM; probe, 250 nM; total RNA, 75 ng. Cycling conditions for genes tested were as follows: 30 m at 48 °C, 10 m at 95 °C, then 40 cycles of PCR consisting of 15 s at 95 °C followed by 1 m at 60 °C. For each gene, assays were run in duplicate on RNA samples isolated from individual fish. The accession numbers and probe and primer sequences of genes evaluated are provided in Table 2. Relative copy number for the expression of each gene tested was determined by serially diluting a random experimental sample 10-fold (covering at least a 6 log range) and including this in each set of realtime assays run. In addition, as a cellular mRNA control, β-actin levels (chosen after testing three different genes) were determined for each sample and used in the normalization of specific expression data (Kreuzer et al., 1999). The data are reported as a ratio of relative mRNA copy number of each gene to mRNA copy number of β-actin, and expressed as the means ± standard errors with an n = 3 for representation of sample point. 2.5. Histology of muscle tissues Muscle samples were taken from three fish per tank (15 fish per diet) during each sampling period. The muscle sample consisted of a cored 2 cm2 piece of muscle tissue taken dorsally of the radial line and slightly anterior from the dorsal fin, with the skin removed. This tissue was fixed in phosphate buffered formalin for 24 h before being transferred to 70% ethanol until further processing. Using a 5 mm disposable biopsy punch (Miltex, York, PA, USA), a white muscle plug from each of the fixed transverse slices was paraffin embedded, cut transversely into

3

5 μm sections, mounted on a glass slide and stained with hematoxylin and eosin. Muscle fiber size and frequency distribution was quantified with image recognition software (Axiovision version 4.7.2, Carl Zeiss Microimaging, Germany). The outlines for N 500 individual muscle fibers were determined (~ 1500 fibers per tank and ~ 4500 fibers per time point per dietary treatment). Muscle fibers were grouped into three size classes, b25 μm, 25–50 μm, and N50 μm. Muscle fiber frequency was expressed as the number of fibers from each size class relative to the total number of fibers measured for each treatment. 2.6. Activity of degradation pathways The enzymatic activity of ubiquitin/proteasomal and calpain degradation pathway was analyzed as described in Overturf and Gaylord (2009). The relative activity of the lysosomal pathway was measured by Western blot analysis on three fish per tank (nine per diet) sampled at the end of the trial. The relative differences in band intensity of LCBII were assessed using antibody to LC3B. Anti-β-actin antibody was used as a loading control. Protein homogenates (three fish per tank) from the muscles were prepared as described by Plagnes-Juan et al. (2008). Protein concentrations were determined with the Bradford reagent method. Forty micrograms of muscle lysate was loaded onto 4–20% SDS-PAGE gel. After electrophoresis, the gel was transferred to a nitrocellulose membrane and washed once in 1 × TBS buffer (136.9 mM NaCl, 2.7 mM KCl, 24.8 mM Tris–HCl, 3 mM NaN3, pH 7.4). The membrane was then blocked in blocking buffer (1 × TBS, 0.1% Tween-20 with 5% nonfat dry milk) for 1 h at room temperature with gentle agitation and then briefly washed in TBS-Tween. Subsequently, the membrane was incubated with primary antibody solution in TBS-Tween with gentle agitation overnight at 40 °C. The primary antibodies used for analysis were as follows: mouse monoclonal anti-β-actin (1:500, Santa Cruz Biotechnology, catalog #47778), rabbit polyclonal LC3B (1:250; Cell Signaling, catalog #2775). The membrane was then washed three times for 5 min in TBS-Tween before a 2-hour incubation in secondary antibody solution at room temperature. Secondary antibodies: anti-Mouse IgG (H&L) AP Conjugate (Catalog # S372B, Promega Corporation, Madison, WI) and anti-Rabbit IgG (Fc) AP Conjugate (Catalog # S373B, Promega) were used at 1:2500 dilution in TBS-Tween with 5% BSA. The membrane was then washed 3 × 5 min. in TBS-Tween, 3 × 5 min. in TBS and then incubated with alkaline phosphatase substrates according to the manufacturer's (Promega, Madison, WI) instruction. The reaction was stopped by washing with distilled water. Membranes were scanned by using an Epson Perfection V700 Photo flatbed scanner, band intensities were analyzed using GelAnalyzer 2010a software (www.gelanalyzer.com) and differences determined by measurement of band intensity. 2.7. Calculations and statistical analysis Growth rate was calculated using the thermal-unit growth coefficient (TGC) (Iwama and Tautz, 1981; Cho, 1992; Dumas et al., 2007a): 1 0 B 1=3 1=3 C BW f −W 0 C C  100 TGC ¼ B C BX n A @ ðT i  t i Þ i¼1

where Wf and W0 are final and initial body weight, respectively, of fish in units of g, n (=1,2,…) is the day number recorded from W0, and Ti (°C) is mean daily water temperature for day ti, the product of which results in units of degree-days. The relationships between body constituents and body weight were described according to the following simple regression model: Y i ¼ β 0 þ β 1 x1 þ ε i

4

K. Overturf et al. / Aquaculture 457 (2016) 1–14

Table 2 Probe and primer sequences and accession numbers for genes evaluated. Gene

GenBank accession no.

Primer/Probe sequence (listed 5′–3′)

β-actin

AF254414

Calpain-1

AY573919

calpastatin

CA045868

Cathepsin L

AF358668

FOXO3

CX247152

MEF2C

CA380324

MSTN1

AF273035

MSTN2

AF273036

MURF1

BX319947

MY F5

AY751283

TMYOD2

Z46924

PAX7

CB493668

PPARγ

AJ292963

Prostaglandin D synthase

AF281353

Proteasome 20S delta subunit

AF115539

Pyruvate dehydrogenase

CA355720

pyruvate kinase

AY113695

REDD-1

DQ400410

Sterol response element binding protein 2

NM001195819

TNFα

AJ401377

Ubiquitin

AB036060

Bactin_F: CCCTCTTCCAGCCCTCCTT Bactin_R: AGTTGTAGGTGGTCTCGTGGATA Bactin_MGB: 6FAM-CCGCAAGACTCCATACCGA-NFQ Calp1F: AGGCGCACGGGAACAG Calp1_R: AGGCGCACGGGAACAG Calp1_MGB: 6FAM-CCGCAGCCTGTTTGAG-NFQ Calpastat_F: GGTGTCCACTTAAGAGAAAACTCACT Calpastat_R: GCTGCTACGTTGCTGCAATAT Calpastat_MGB: 6FAM-ATCAAGATTGGACAGACATC-NFQ CathL_F: CAGTGCTGCCAACGAGACT CathL_R: GCCTTCATCATAGCATGCTCCTT CathL_PR: 6FAM-CTTTGTGGACATCCCC-NFQ Fox01_F: CGCTGGTGGCAGTGGT Fox01_R: TCCAGGTCAGTGGGAAAGC Fox01_PR: 6FAM-CCTAGCGAGCAGATTC-NFQ MEF2C_F: CCCTAGGCAACCACAACCT MEF2C_R: ACTGGGAGGTCTATGTGTGACA MEF2C_MGB: 6FAM-CCGTCCCATGACCCC-NFQ Myostatin1_F: CCGCCTTCACATATGCCAA Myostatin1_R: CAGAACCTGCGTCAGATGCA Myostatin1_MGB: 6FAM-CATATTACATTTGGGATTCAA-NFQ Myostatin2_F: AGTCCGCCTTCACGCAAA Myostatin2_R: ACCGAAAGCAACCATAAAACTCA Myostatin2_MGB: 6FAM-CGTATTCACTTTTGGATTTT-NFQ MuRF-1_F:CGCAATCCCTACCGCTTCTC MuRF-1_R:GGTCCAGGACCACCTCGAA MuRF-1_MGB:6FAMTCCGCTGCCCCACCTG-NFQ Myf5_F: CACAAGCTATGGCAACAACTACAG Myf5_R: GGCACCAGCACCTCTCT Myf5_MGB: 6FAM-TCCAGAGCTCACATTCT-NFQ MyoD_F: GCCGTCACCGACCAACT MyoD_R: CACTGTGTTCATAGCACTTGGTAGA MyoD_MGB: 6FAM-CCGTCCCATGACCCC-NFQ PAX7_F: CTATGTGGCAAAACTC PAX7_R: GTCCCAGCATGACTTCTCCAT PAX7_PR: 6FAM-CAGCCTGGAGTCCTC-NFQ PPARg_F: AGGCCATCCTCTCTGGAAAGA PPARg_R: CGTCAGAGACTTCATGTCATGGAT PPARg_PR: 6FAM-CCCACGGAAACTCAC-NFQ PDS_F: GGCTCTTGCTGGAGGATGAC PDS_R: GAAGCGGCCTGGGATGT PDS_MGB: 6FAM-CTGGCCAAGAAGACTG-NFQ Prot_F: GAGGGTCAGGATCCACCTATATCTA ProtD_R: GCGAAGACACTGGTCCTTTGT ProtD_MGB: 6FAM-ACTCCAACTACAAACCC-NFQ PdHase_F: GTAGTGAGGTCCCAATGTCATACTT PdHase_R: TGGGCACAGTATCTGAGTCTTCA PdHase_MGB: 6FAM-CTGCCACATCTCTCCC-NFQ PK_F: ACAGCGTGGGCGATACC PK_R: GCTGGAGCTGTCATAGTACTCACT PK_PR: 6FAM-TCAGCCCAGCTCCTG-NFQ REDD1_F: CTGCGAGCCCCGTCATAC REDD1_R: GCCACGTGTTGATTCCTGATAA REDD1_PR: FAM6-AGTTCTGCTGAGACAAT-NFQ SREBP_F: GCTTCATCCAGAACCCTGTCAT SREBP_R:GGAGGACTTGGAAGCTTGTAGTG SREBP_MGB: 6FAM-CTGCCACCAGAGTCC-NFQ TNF_F: TGGAGCCTCAGCTGGAGATATT TNF_R: CCGGCAATCTGCTTCAATGTATT TNF_MGB: 6FAM-CATTGGTGCAAAAGATAC-NFQ UBIQ_F: TCTTGTGCTGCGTCTTCGT UBIQ_R: TGGGCCAGCTGTCTCAAAG UBIQ_MGB: 6FAM-ATGGCTCGATAATGCC-NFQ

where Yi is ith fitted value of a particular body constituent (protein or lipid) (g), β0 is the intercept, β1 and xi are the slope and ith value of body weight (g fish−1), respectively, and ɛi is the random error. A simple model to predict the relative body lipid (BL) content was developed using multiple regression analysis: Y i ¼ β0 þ β1 x1i þ β2 x2i þ β3 x3i þ εi

Y i ¼ β0 þ β1 x1i þ β2 x2i þ β3 x3i þ β4 x4i þ εi : In both models, Yi is ith fitted value of relative BL (%), β0 is the intercept and ɛi is the random error. In the first multiple regression equation, β1, β2, and β3 are the regression coefficients for predictors x1, x2 and x3, respectively, x1i, x2i and x3i are the ith value of the predictors, which are body weight (g fish−1), dietary crude lipid (%, as fed) and dietary crude

K. Overturf et al. / Aquaculture 457 (2016) 1–14

5

protein (%, as fed), respectively. In the multiple regression equation with four predictors, β1, β2, β3 and β4 are the regression coefficients for predictors x1, x2, x3 and x4, respectively, x1i, x2i, x3i and x4i are the ith value of lipid intake (g fish− 1), body weight, dietary crude lipid and dietary crude protein, respectively. Simple regression analysis is a robust and reliable approach to predict body protein (BP) content and, for this reason, no multiple regression models were developed for this body constituent (Shearer, 1994; Dumas et al., 2007b). The results from the proximate analyses of whole fish served to estimate the rates of nutrient deposition using the equation of Dumas et al. (2007b): Dj ¼

F j −I j n X ðT i  t i Þ i¼1

where Dj is deposition rate (mg (°C · d)−1) of nutrient j, Fj and Ij are final and initial whole-body mass of nutrient j (mg fish−1) at the end and the beginning of the sampling period, respectively, and n stands for the day number covering the period from Fj to Ij. The efficiency of nutrient deposition (eDj, %) was estimated using the following equation: eD j ¼

F j −I j  100 n  X  IN j  t i i¼1

where INj (mg fish−1) is daily intake of nutrient j for day ti. Assessing efficiency of nutrient deposition, herein protein and lipid, represents a comprehensive way of examining utilization of feed components for growth. The initial and final body weights, TGC, feed efficiency (FE), proximate body composition, nutrient deposition rates and efficiency of nutrient deposition were analyzed by the GLM procedure and Tukey method (Tukey's HSD) using SAS version 9.2 (Cary, NC, USA). The Tukey test was selected because it provides the best protection against type I error, along with strong inference about magnitude of differences (Scherrer, 1984; Kuehl, 2000). Tank mean values were considered the experimental units. Differences were considered significant at P b 0.05. For gene expression analysis of normalized gene expression, values were examined by one-way analysis of variance (ANOVA) to determine significance (P b 0.05). Significant differences in number of fibers within a defined size range between time periods, measured band intensity for lysosomal activity and relative fluorescence for calpain activity was examined by two-way analysis of variance (ANOVA) to determine significance (P b 0.05). Data were further analyzed by ANOVA post-hoc multiple comparisons (Tukey's HSD; adjusted P-value b 0.05). After calculating significance, numbers were changed to percentages for graphing. All statistical analyses for gene expression analysis were computed by using SPSS (SPSS, Inc., Chicago, IL, USA). 3. Results 3.1. Growth trial The growth trajectories of rainbow trout fed 43P:20L and 50P:15L diets remained identical during the 67-d trial, but it subsided for fish fed the 62P:6L beyond 30 days (Fig. 1). Overall, the TGC and FI of fish fed the 43P:20L and 50P:15L diets were significantly higher than those of fish on the 62P:6L diet (P = 0.022 for TGC and P = 0.005 for FI; Table 3). The effects of dietary treatments on TGC and FI, but not FE, became significant beyond two weeks into the trial (Table 3). Feed intake was inversely related to dietary crude protein level (or positively correlated with dietary crude lipid) and this relationship was consistent across the experiment. Overall, the lowest FE was observed with the

Fig. 1. Growth trajectory of rainbow trout fed the three treatment diets.

43P:20L group and differences between treatments were nearly significant (P = 0.057). 3.2. Whole-body biochemical composition Significant treatment effects on whole-body composition variables appeared within the first two weeks of the trial (Table 4). At day 14, the body lipid content and BL:BP ratio of fish fed the 62P:6L diet were significantly lower than those fed the other diets, and these responses were consistent throughout the trial. Body protein was inversely related with dietary crude protein level (or positively correlated with dietary crude lipid) after 2 weeks into the trial, but this relationship faded thereafter. At day 67, the lowest body protein content was observed in trout fed the 43P:20L diet, but the maximum difference between treatments was relatively narrow at 1.3%. At day 28 and after, the content of body energy was inversely related with the dietary P:L ratio.

Table 3 Initial (IBW) and final (FBW) body weight, thermal-unit growth coefficient (TGC), feed intake (FI), and feed efficiency (FE) of rainbow trout fed the three treatment feeds at three different periods. Mean values with their standard errors (SEM) (n = 3). Different letters indicate the effect was significantly different between treatments (P b 0.05). No letter indicates there were no significant differences between treatments. Variables

Treatments 43P:20L Mean

50P:15L SEM

Mean

62P:6L SEM

Mean

SEM

Period 1 (0–14 d) IBW (g fish−1) FBW (g fish−1) TGC [g1/3(°C-d)−1] FI (g fish−1) FE (gain:feed)

11.2 20.4 0.246 6.9 1.34a

0.1 0.8 0.013 0.5 0.01

11.2 21.2 0.259 6.5 1.52b

0.1 0.2 0.003 0.2 0.05

11.3 20.3 0.240 6.0 1.50b

0.1 0.2 0.002 0.1 0.03

Period 2 (14–28 d) IBW (g fish−1) FBW (g fish−1) TGC [g1/3(°C-d)−1] FI (g fish−1) FE (gain:feed)

20.4 42.3 0.258a 17.4a 1.25

0.8 1.8 0.006 0.9 0.02

21.2 42.8 0.252a,b 15.8a,b 1.35

0.2 1.2 0.009 0.7 0.03

20.3 38.5 0.224b 13.6b 1.33

0.2 0.6 0.005 0.2 0.02

Period 3 (28–67 d) IBW (g fish−1) FBW (g fish−1) TGC [g1/3(°C-d)−1] FI (g fish−1) FE (gain:feed)

42.3 108.7a,b 0.287 42.7a 1.56

1.8 4.6 0.006 1.8 0.01

42.8 109.3a 0.285 39.3a,b 1.69

1.2 3.4 0.018 2.0 0.03

38.5 91.2b 0.250 31.9b 1.65

0.6 4.0 0.017 1.3 0.08

Overall (0–67 d) IBW (g fish−1) FBW (g fish−1) TGC [g1/3(°C-d)−1] FI (g fish−1) FE (gain:feed)

11.2 108.7a,b 0.261a 66.9a 1.46

0.1 4.6 0.006 3.2 0.01

11.2 109.3a 0.261a 61.6a 1.59

0.1 3.4 0.005 1.2 0.02

11.3 91.2b 0.232b 51.5b 1.55

0.1 4.0 0.006 1.0 0.05

6

K. Overturf et al. / Aquaculture 457 (2016) 1–14

Table 4 Whole-body composition (as-is) of rainbow trout fed the three treatment feeds at three different periods. Mean values with their standard errors (SEM) (n = 2). Samples pooled per treatment per period. Different letters indicate the effect was significantly different between treatments (P b 0.05). No letter indicates there were no significant differences between treatments. No statistical analysis were conducted on the initial sample (pooled sample). Variables

Treatments 43P:20L Mean

50P:15L SEM

Day 0 (initial) Moisture (%) Lipid (%) Protein (%) Energy (MJ kg−1) BL:BP ratio1

BL ¼ −88:973ð27:208Þ þ ð0:604ð0:043Þ  LIÞ−ð0:065ð0:004Þ  BWÞ þ ð1:981ð0:524Þ  CLÞ þ ð1:412ð0:388Þ  CPÞ:

62P:6L

Mean

SEM

73.53 10.50 14.62 7.18 0.718

0.08 0.17 0.05 0.01 0.014

Mean

SEM

Day 14 Moisture (%) Lipid (%) Protein (%) Energy (MJ kg−1) BL:BP ratio1

72.69a 11.63a 15.05a 7.32a,b 0.773a

0.49 0.12 0.35 0.18 0.010

72.47a 11.38a 13.72a,b 7.55a 0.829b

0.27 0.18 0.35 0.16 0.008

75.31b 9.27b 13.23b 6.60b 0.701c

0.48 0.08 0.03 0.08 0.008

Day 28 Moisture (%) Lipid (%) Protein (%) Energy (MJ kg−1) BL:BP ratio1

70.87a 11.46a 15.10 8.03a 0.759a

0.04 0.17 0.06 0.06 0.008

72.11b 10.15b 15.11 7.53b 0.672b

0.02 0.01 0.28 0.01 0.013

72.95c 8.13c 15.90 7.07c 0.511c

0.02 0.04 0.11 0.02 0.001

Day 67 Moisture (%) Lipid (%) Protein (%) Energy (MJ kg−1) BL:BP ratio1

69.81a 12.91a 14.95a 8.52a 0.863a

0.23 0.19 0.04 0.08 0.011

70.78a 10.32b 16.24b 7.95b 0.636b

0.22 0.00 0.12 0.01 0.005

73.00b 7.36c 15.94b 6.87c 0.462c

0.17 0.02 0.11 0.02 0.002

1

The relative BL content (%) of trout was best estimated using lipid intake (LI, g fish−1, dietary crude lipid (CL, % as fed) and protein (CP, % as fed) along with BW (g fish−1) as predictors (R2 = 0.982):

BL:BP ratio: body lipid to body protein ratio

The moisture content of trout increased with dietary P:L ratio from day 28 and onward. The negative relationship between body moisture and BL became significant only with data obtained from sampling day 28 and beyond (slope = −0.60, P = 0.004; R2 = 0.90). Body weight (BW) was a significant and reliable predictor of BP with a coefficient of determination (R2) equal to 0.997 (Fig. 2). The intercept was significantly different from 0 (P = 0.009). The relationship between BW and BL content was somewhat weaker with a R2 of 0.916, indicating predictors other than BW could explain the variation of BL content in fish. The intercept of the regression equation describing the association between BW and BL was not significantly different from 0 (P = 0.657) and could thus be removed from the model.

Fig. 2. Relationships between body protein (BP) or body lipid (BL) and body weight (BW) of growing rainbow trout.

Values in parentheses are standard errors. The coefficients for the four predictors were highly significant (maximum P was 0.0015). BL could not be estimated reliably using the multiple regression equation with three predictors (BW, CL and CP). The resulting R2 was 0.814 and none of the predictors approached the level of significance (minimum P was 0.128). LI on its own was a weak predictor of BL (R2 = 0.227). Based on correlation between LI and other predictors of BL, collinearity was relatively high between LI and BW (r = 0.832), but low between LI and CL (r = 0.519) as well as LI and CP (r = 0.519). 3.3. Gene expression 3.3.1. Muscle development and differentiation genes The muscle development genes analyzed included MEF2C, MYF5, MYOD2, PAX7, MSTN1 and MSTN2. Significant differences (P b 0.05) in expression were found for MEF2C between all the diets with the 50P:15L diet having the highest relative level of expression followed by 62P:6L, and the 43P:20L diet having the lowest level of expression (Fig. 3). MSTN1 showed a similar expression pattern with expression from the 50P:15L diet being significantly higher than for either the 43P:20L or 62P:6L diets. However, in this case there was no significant difference in expression between the experimental diets, 43P:20L and 62P:6L. No other significant differences in expression were found between the diets for the other above listed genes. 3.3.2. Metabolic regulation genes in the muscle Expression for the following metabolic related genes was measured in the muscle: FOXO3 and KLF15. No significant differences were found in the expression of these genes in fish reared on the three experimental diets. 3.3.3. Degradation genes in the muscle Expression of the following genes was tested for evaluating muscle degradation: calpain 1, proteasome 20S subunit, calpastatin, cathepsin L, ATG4B2 (data not shown) and MURF1. Cathepsin L was the only gene for which significant differences were noted. Fish fed the 50P:15L diet had the highest expression levels, which were significantly higher than fish on the 62P:6L diet. No significant difference was found between 43P:20L and the other two diets (Fig. 4). 3.3.4. Liver metabolic genes In the liver, the following genes were evaluated for expression: pyruvate dehydrogenase, prostaglandin synthase D, pyruvate kinase, PPARγ, SREBP2 (sterol-regulatory element- binding protein 2), FOXO3, KLF15, and REDD-1. Significant expression differences were noted for pyruvate kinase, SREBP2, FOXO3, KLF15, and REDD-1 (Fig. 5). For pyruvate kinase fish on the 62P:6L showed the highest expression level, which was significantly higher than in fish on the 43P:20L diet. There was no significant difference in expression of pyruvate kinase between fish on the control (i.e. 50P:15L) and the 62P:6L diet. SREBP2 and FOXO3 expression was found to be significantly higher in fish on the 62P:6L than on the 50P:15L and 43P:20L diets. No differences were detected in fish fed the 50P:15L and 43P:20L diets for either of these two genes. KLF15 also was the highest expressed in the fish fed the 62P:6L diet, and was significantly different than the expression found in fish in the other two dietary treatments. Fish fed the 50P:15L diet had significantly greater expression than fish fed the 43P:20L diet. REDD-1 expression in fish fed the 50P:15L diet was significantly higher

K. Overturf et al. / Aquaculture 457 (2016) 1–14

7

Fig. 3. Developmental muscle genes. Relative expression of muscle developmental and differentiation genes for trout on the three treatment diets. Significant differences between diets for each gene is shown (P b 0.05).

than that of fish fed the 43P:20L diet which was, in turn, significantly greater than the expression found in fish fed the 62P:6L diet. 3.4. Histology of muscle tissues The percentage of medium sized muscle fibers was statistically the same in fish fed all three diets at all-time points (Fig. 6). However, regarding the large fibers (N 50 μm in size), there was a correlative increase in their relative number as the fish grew (r = 0.680) between the 50P:15L and 62P:6L diet. The opposite was true for fish fed the 43P:20L diet between the first and last sample time points. Of further interest was the correlative decrease in small fibers (b 25 μm) in the 50P:15L and 62P:6L diet compared to the increase in small fibers seen in fish fed the 43P:20L diet. 3.5. Protein degradation assays in the muscle The activities for the calpain and proteasome/ubiquitin pathways were assessed using enzymatic assays and activity for the lysosomal pathway was evaluated by Western analysis of the LC3B protein level. In the proteasomal degradative pathway a significant increase in activity was found in the muscle of fish fed the 62P:6L diet compared to fish fed the 50P:15L or 43P:20L diets (P b 0.001) (Fig. 7). There was no significant difference between fish fed the 50P:15L and 43P:20L diets. No significant differences in calpain activity were found between fish fed any of diets. Analysis of the LC3BII band and quantification of its intensity was performed as it has been shown to correlate with

autophagosome number in regard to evaluating lysosomal activity. After normalizing well loading amounts using β-actin as the loading control, the values (relative band intensity) for each diet were as follows: 43P:20L 2781 ± 587; 50P:15L 2229 ± 1118; and 62P:6L 1716 ± 445. Statistical analysis showed that fish fed the 43P:20L had a significant increase in lysosomal activity compared to fish fed the 62P:6L diet (P b 0.05) and there was no significant differences detected between fish on the 50P:15L and the 62P:6L or 43P:20L diets (Fig. 8). 3.6. Nutrient deposition Similar to the whole-body composition responses, significant treatment effect on nutrient deposition appeared within the first two weeks of the trial (Table 5). Unlike lipid deposition (LD), there was a strong correlation between protein deposition (PD) and BW (R2 = 0.971), regardless of diet (Fig. 9). The equation to estimate PD using BW as predictor was 0.311(± 0.021) × (BW) + 1.862(± 0.870), but the intercept was not significantly different from 0 (P = 0.070) and could thus be removed from the model. The slope (0.311) was highly significant (P b 0.001). The PD and ePD were similar overall between the 43P:20L and 50P:15L diets, and significantly lower for fish fed the 62P:6L, with the exception of Period 1 (0–14 d). Because of the high correlation between PD and BW, the apparent key role of dietary protein level on feed intake, consistent ePD within typical range of dietary protein to lipid ratios (i.e. treatments 43P:20L and 50P:15L in this experiment) and ectothermic nature of fish, the following model is proposed to predict feed intake (FI) of juvenile rainbow trout: FI ¼ 2 

Fig. 4. Muscle degradation genes. Relative expression in the muscle of genes associated with protein degradation for trout on the three treatment diets. Significant differences between diets for each gene is shown (P b 0.05).

ð0:311  BW  TÞ 1000CP

where FI has units of g feed (fish·d)−1, BW and T are mean body weight (g fish−1) and water temperature (°C), respectively, and CP is the relative content (%) of dietary crude protein (÷100). This model assumes all dietary nutrient requirements are met, fish eat the amount of feed corresponding to satiety and ePD is constant at 50%, and should be applied with trout weighing between 10 and 100 g. There was an inverse relationship between LD and dietary P:L ratio starting at Period 2 (14–28 d) and onward. The LD:PD ratio was significantly higher in trout fed the 50P:15L than the other diets at Period 1, but correlated negatively with dietary P:L ratio afterwards. The eLD differed significantly between treatments and correlated positively with dietary P:L ratio during the first month (Periods 1 and 2), but differences faded overtime, especially between treatments 43P:20L and 50P:15L. The highest eLD values were observed with trout fed the 62P:6L diet and this response remained significant across time periods.

8

K. Overturf et al. / Aquaculture 457 (2016) 1–14

Fig. 5. Liver metabolic genes. Relative expression of metabolic associated genes in the liver for trout on the three treatment diets. Significant differences between diets for each gene is shown (P b 0.05).

4. Discussion 4.1. Growth trial The growth trajectory of juvenile rainbow trout was unaffected by the composition of experimental diets, except for the 62P:6L diet which contained an unusually low level of dietary lipids. This outcome suggests the dietary protein to lipid ratio and level of these macronutrients in diets 43P:20L and 50P:15L were within the range suitable to support maximum growth for this species at this particular life stage. Furthermore, it indicates the level of dietary crude protein could be lower than those found in commercial feed formulas, the latter containing typically ≥47% crude protein for juvenile rainbow trout of this size. Although it would affect feed cost, dietary supplementation with crystalline amino acids may be necessary to meet the requirements of fish and/or mimic the whole-body amino acid profile. The results showed that rainbow trout regulated their feed intake according to dietary protein level more than dietary lipid or energy. Between diets 43P:20L and 50P:15L, the trout were successful at adjusting their feed intake as a function of dietary protein content to maintain their growth trajectory and performance, albeit at the cost of feed efficiency for fish fed the diet with lower protein content (i.e. 43P:20L). If feed intake was governed by dietary energy level, it would have been

in the order 62P:6L N 50P:15L N 43P:20L. The exact opposite was observed in this study, in agreement with Azevedo et al. (2004b). However, the regulation of feed intake as a function of dietary protein level is not consistent across the fish literature, especially with marine carnivorous fish and diadromous species having a life history different from trout. Feed intake or feed efficiency appeared to be driven by dietary lipid or energy content according to studies where different levels of both dietary proteins and lipids were tested, for example, with yellowtail (Takeuchi et al., 1992; Jover et al., 1999), gilthead seabream (Lupatsch et al., 2001) and pompano (Riche, 2009). The reasons for the apparent contradictions between these reports and our study are unclear. The fish species, ranges of dietary protein or energy levels in test diets, feeding strategy, husbandry practices and life stage of fish at the time of experiment are factors, which can affect feeding responses and lead to different conclusions. There is a need to develop standardized protocols and study systematically the responses of these various species under similar conditions. The capacity of trout to modulate protein intake in an attempt to achieve their maximum growth potential failed to keep up outside the 43P:20L to 50P:15L range in this experiment. In other studies, trout fed diets with less than 40% crude protein decreased their feed intake, which penalized growth and also feed efficiency compared to fish fed high fishmeal (25–68% inclusion) diets containing ≥ 40% protein and

Fig. 6. Muscle histology. Determined percentage of muscle fibers binned to the shown size range (μm) for each of the three dietary treatments during the duration of the experiment. The time periods correspond to SP1 (initial sampling), SP2 (after 1 month), SP3 (2 months), SP4 (3 months). Significant differences for muscle fiber size between dietary treatment is shown (P b 0.05).

K. Overturf et al. / Aquaculture 457 (2016) 1–14

9

Table 5 Body protein (PD) and lipid (LD) deposition rates and efficiencies of protein (ePD) and lipid (eLD) deposition of rainbow trout fed the three treatment feeds at three different periods. Mean values with their standard errors (SEM) (n = 3). Different letters indicate the effect was significantly different between treatments (P b 0.05). No letter indicates there were no significant differences between treatments. Variables

Treatments 43P:20L Mean

Fig. 7. Protein degradation enzymatic assays in the muscle. Enzymatic activity of the protein degradation proteins, 20 S proteasome and calpain, in the muscle of fish for each of the dietary treatments. Significant differences between diets for enzyme is shown (P b 0.05).

≥7% lipid (Cho et al., 1976; Saravanan et al., 2012). Similar to this study, Cho et al. (1976) observed lower feed intake and weight gain in trout fed a 63P:7L experimental diet (dry matter basis). 4.2. Whole-body biochemical composition Unlike growth trajectory, the composition of biomass gain responded promptly and was sensitive to variations of dietary macronutrient levels. The low relative content of BL and body energy combined with the decline of growth of trout fed the 62P:6L diet suggests that even feeding diets with similar gross dietary energy levels, the source of dietary energy (protein rather than lipid) did not support true growth equivalent that growth obtained with the other two diets (Cowey et al., 1977; Renaud and Moon, 1980; Meyer-Burgdorff and Günther, 1995; Dabrowski and Guderley, 2002). The high expression levels of KLF15, a regulator of amino acid-degrading enzymes in mammals, corroborated this assertion (Gray et al., 2007; Takashima et al., 2010). Similar effects of low-lipid diets on BL and weight gain have been reported long ago in rainbow trout (e.g. Castell et al., 1972) and more recently in an experiment on trout bioenergetics (Saravanan et al., 2012). The BP content was more stable than BL which is in line with other studies and confirms that BP is determined heavily by endogenous factors and weakly by diet composition (Dumas et al., 2007b; Shearer, 1994; Weatherley and Gill, 1983; Tobin et al., 2006). As a result, the BL:BP ratio was remarkably flexible with almost 100% difference between treatments at the end of the trial. The BL:BP ratio

50P:15L

62P:6L

SEM

Mean

SEM

Mean

SEM

Period 1 (0–14 d) PD (mg (°C-d)−1) LD (mg (°C-d)−1) LD:PD ratio ePD (%) eLD (%)

7.10a 5.93a 0.84a 48.7a 85.8a

0.49 0.41 0.01 0.4 0.7

6.20a,b 6.03a 0.98b 38.5b 123.0b

0.10 0.09 0.01 1.0 3.3

5.10b 3.47b 0.67c 28.1c 180.6c

0.06 0.03 0.00 0.6 4.1

Period 2 (14–28 d) PD (mg (°C-d)−1) LD (mg (°C-d)−1) LD:PD ratio ePD (%) eLD (%)

11.37 8.50a 0.75a 44.1a 69.4a

0.55 0.40 0.00 0.5 0.8

12.33 6.70b 0.54b 44.7a 79.5b

0.56 0.36 0.01 0.6 1.5

11.87 4.33c 0.36c 41.1b 142.8c

0.27 0.14 0.01 0.5 2.5

Period 3 (28–67 d) PD (mg (°C-d)−1) LD (mg (°C-d)−1) LD:PD ratio ePD (%) eLD (%)

21.97a,b 20.43a 0.93a 53.8a 105.6a

0.98 0.89 0.00 0.2 0.2

25.10a 15.43b 0.62b 56.7a 114.3a

1.65 1.07 0.01 1.0 2.3

18.67b 7.93c 0.42c 42.7b 173.7b

1.58 0.74 0.01 2.0 9.3

Overall (0–67 d) PD (mg (°C-d)−1) LD (mg (°C-d)−1) LD:PD ratio ePD (%) eLD (%)

15.05a,b 13.23a 0.88a 50.8a 94.2a

0.69 0.59 0.00 0.2 0.3

16.58a 10.40b 0.63b 51.8a 106.5a

0.57 0.36 0.00 0.8 1.7

13.26b 5.69c 0.43c 40.7b 166.6b

0.66 0.30 0.00 1.2 5.4

thus appeared more as a variable depending upon diet composition than a rigid parameter that could serve as a partitioning rule to regulate nutrient deposition and body composition as proposed in some mechanistic growth models developed for other fish species (e.g. Machiels and Henken, 1986). Prediction of BL using the multiple regression model with four explanatory predictors was reliable, but caution is warranted if one wants to assess the effect of each predictor based on their coefficients because of the likelihood of collinearity between LI and BW (Vittinghoff et al., 2005). In spite of this, the model suggested CL and CP, not LI nor BW, are the major driving variables of BL. The weak

Fig. 8. Western of LC3B. Western blot of muscle tissue probed with an LC3B antibody, and the standardized control B-actin blot.

10

K. Overturf et al. / Aquaculture 457 (2016) 1–14

Fig. 9. Rates of protein (PD) and lipid (LD) deposition as a function of body weight (BW) in rainbow trout fed the three treatment diets.

correlations between LI and CL as well as between LI and BL were unexpected and indicated LI and BL were driven by other variables, mostly BW in the case of LI and CL and CP in the case of BL according to this study. How coefficients or effect of predictors on BL change across life stages or genotypes remains to be studied. Finally, the accuracy and robustness of the model could be improved, and perhaps other predictors of interest (e.g. fish genotype, water temperature) be discerned by creating larger datasets and establishing more adapted experimental designs. 4.3. Gene expression The dietary protein and lipid content induced whole organism responses that resulted from signals initiated at the molecular level. The expression of genes associated with the development, differentiation and turnover of the muscle have shown hypertrophy and hyperplasia can be manipulated by dietary macronutrients (Mommsen, 2001; Alami-Durante et al., 2014). Based on the expression level of MEF2C, the trout fed the 50P:15L diet were predisposed to hypertrophy of myotubes more than those fed the 62P:6L and 43P:20L diets. A correlative but nonsignificant response was noted for MYOD2 expression. The highest relative expression level of PAX7 was found in trout fed the 43P:20L diet, and hinted that muscle cell proliferation was further stimulated in juvenile fish (Zammit et al., 2006; Overturf et al., 2010). However, this interpretation deserves further scrutiny since PAX7 expression levels were not significant at the level all genes were analyzed, P b 0.05, but was close with a P value of 0.058. The decreased expression of MSTN1 in trout fed the 62P:6L and 43P:20L diets suggested muscle regulation was modulated to remove further restriction of muscle growth or prevent excess wasting of muscle tissues in these fish showing reduced feed efficiency. Similar conclusions were drawn in a study with fish during starvation (Johansen and Overturf, 2006). FOXO3 expression levels were similar to MSTN1 within these diets suggesting that regulation may be occurring via the same pathway. In support of this hypothesis it has been determined that FOXO3 can regulate

MSTN1 through PPARA and/or mTOR (Amirouche et al., 2009; Lokireddy et al., 2011). The inverse expression of REDD-1, further supports that dietary regulation of protein turnover in the muscle is modulated through TOR interaction with KLF15 and FOXO3 (Sofer et al., 2005; Qin et al., 2010; Shimizu et al., 2011). We hypothesize that the high expression of KLF15 and FOXO3 in the liver of trout fed the 62P:6L diet induced the synthesis of amino aciddegrading enzymes. This hypothesis finds support from previous studies where important enzyme activities were observed in rainbow trout fed a high protein diet, i.e. 60P:8L (Cowey et al., 1977), a phenomenon also confirmed in mammals (e.g. Eisenstein and Strack, 1971; Oishi et al., 2012). In contrast, other studies showed amino aciddegrading enzymes, although different from those measured in the present study, were not regulated by dietary protein content in rainbow trout (Walton, 1986; Kirchner et al., 2003). In these studies, however, the dietary levels of protein and lipid were lower and higher, respectively, compared to the 62P:6L diet, which may have hampered the expression of amino acid-degrading enzymes. The inducement of protein degradation may have taken place for one of two reasons in trout fed the 62P:6L diet: (1) amino acids were in excess; or (2) diet was energy-deficient and ATP synthesis from amino acids became unavoidable (Brody, 1999; Nelson and Cox, 2000; Cleveland and Weber, 2010; Seiliez et al., 2010; Gray et al., 2007; Takashima et al., 2010; NRC, 2011). The high dietary protein level in the 62P:6L diet may have entailed an oversupply of postprandial amino acids above maximum enzymatic reaction rates achievable for protein synthesis, hydrolysis and deposition, which depressed feed intake and, ultimately, available energy. To confirm this, a comparative enzyme kinetic study would be necessary. The results relative to BL and eLD in this study indicated the supply or balance of energyyielding nutrients was challenging for trout fed the 62P:6L diet. The lysosomal endopeptidase cathepsin L plays a role in muscle protein turnover and degradation (Ishidoh and Kominami, 1995; Deval et al., 2001). The relative expression levels of cathepsin L observed in trout myocytes suggested the intensity of muscle cell turnover faded as a function of diets in that fish fed the high lipid diet exhibited higher expression than fish fed the high protein: low lipid diet, in accordance to what was observed by Western blot analysis of LC3B, which was used as an indicator of lysosomal regulated protein turnover. In this assay, fish fed both higher lipid diets showed greater activity than fish fed the 62P:6L diet. The expression level of MSTN1 and rate of protein deposition (PD) followed the same pattern, demonstrating further how anabolism and catabolism of muscle proteins are coordinated, and protein turnover correlates with protein accretion (Millward, 1989; Overturf et al., 2010). The low lipid intake of trout fed the 62P:6L diet triggered the cholesterol biosynthesis pathway based on the increased expression of sterolregulatory element-binding protein (SREBP)-2, which stands as a key regulator of cholesterol synthesis (Miserez et al., 2002; Bauer et al., 2011). This observation is in agreement with other studies where expression levels of genes associated with cholesterol biosynthesis were upregulated in hepatocytes of rainbow trout and Atlantic salmon fed low cholesterol diets and in trout with low plasma cholesterol (Leaver et al., 2008b; Panserat et al., 2009; Mennigen et al., 2014). Although plasma cholesterol was not measured in trout fed the low-lipid diet, it is reasonable to assume cholesterol biosynthesis was upregulated in these fish to maintain cell membrane structure, bile acid production and steroid hormone secretion (NRC, 2011). 4.4. Histology of muscle tissues This study demonstrates dietary protein to lipid ratio stands as a factor determining muscle fiber recruitment in trout, which is in agreement with other fish experiments (Silva et al., 2009; Campos et al., 2010; Alami-Durante et al., 2014). The latter was favored in trout fed the 43P:20L diet based on the proportion (%) of small fibers that

K. Overturf et al. / Aquaculture 457 (2016) 1–14

increased over time during this study. This finding reinforced our previous interpretation which upheld PAX7 as an indicator of hyperplasia in trout muscle under the 43P:20L treatment. Studies have shown sensory characteristics such as firmness are correlated with muscle fiber diameter in fish (Hatae et al., 1984, 1990; Hurling et al., 1996; Johnston et al., 2000). It is thus hypothesized that rainbow trout fed a low protein and high fat diet for 2 months during an early life stage (body weight b 100 g) could potentially provide firmer fillets at harvest than trout fed typical commercial diet formulation. However, further study is needed to validate this hypothesis and confirm if such nutritional programming entails persistent effects until market size. A required future step would be to determine the best protein to lipid ratio responsible for inducing hyperplasia at different stages during growth. It has been suggested dietary supplementation with glutamate, a key dispensable amino acid for mitosis and synthesis of muscle protein (Millward, 1989; Souba, 1991; Brody, 1999; Petersen and Nurse, 2007), can modulate muscle cellularity of rainbow trout (Alami-Durante et al., 2010) and enhance fillet firmness of Atlantic cod (Ingebrigtsen et al., 2014). Whether the same outcome is repeatable across fish species remains to be investigated. In addition to P:L ratio, factors such as temperature during egg incubation, feed restriction and light conditions during smolt production are known to influence muscle fiber recruitment and, ultimately, fillet firmness (Johnston et al., 2004; Johnston, 2006; Macqueen et al., 2008; Johnsen et al., 2013; Salze et al., 2014). The regulation of muscle growth dynamics through simple nutritional manipulations offers innovative opportunities to improve fish product quality (organoleptic properties) and address consumer expectations. 4.5. Protein degradation assays in the muscle The dietary protein to lipid ratio determined the route for protein degradation in trout. The two major protein degradation systems are the ubiquitin/proteosomal pathway and lysosomal pathway (Sandri, 2010). Both pathways are under FOXO regulation (Masiero et al., 2009). The ubiquitin/proteosomal degradative pathway was predominant in fish fed the 62P:6L diet, whereas the lysosomal activity peaked in the 43P:20L treatment group. Taken together with the previous discussion on histology and gene expression, a recent published work by Tang and Rando (2014) highlighted a novel role of autophagy as a supporter of the increased bioenergetic demands during satellite cell activation. Our results corroborate further this novel finding, showing the increased number of small muscle fibers, increased PAX7 expression and increased lysosomal activity in fish fed the 43P:20L diet. Furthermore, we hypothesize that during induced muscle hyperplasia the ubiquitin/proteosomal pathway activity is relatively depressed. In trout that were fed the three experimental diets, the pattern of expression of the ubiquitin/proteosomal pathway in the muscle mimicked that of KLF15 in the liver. Therefore, protein catabolism relative to protein synthesis in trout fed 62P:6L diet was likely superior to that of trout fed the other diets based on the consistent pattern of highest expression of genes associated with ubiquitin/proteosomal pathway. This assertion agrees well with the reduced growth recorded in these trout where PD or protein accretion was the lowest. It has been shown that the lysosomal pathway was involved in protein catabolism intended for preservation of muscle mass and homeostasis (Masiero et al., 2009; Sandri, 2010). Our observations indicated that FOXO3 is regulated differently in the muscle and liver. This transcription factor in muscle tissue was triggered by insulin-like growth factor 1 (IGF-1) and downregulated the ubiquitin/proteosomal pathway, but had no significant effect on the lysosomal pathway in a previous study with rainbow trout (Seiliez et al., 2010). In our experiment, the high secretion of FOXO3 in liver tissue, but not in the muscle, and the poor growth performance of trout fed the 62P:6L diet, implies that FOXO3 phosphorylation by IGF-1 was not prevalent.

11

4.6. Nutrient deposition This study demonstrated juvenile rainbow trout regulated feed intake to sustain PD at a given body weight. Indeed, the highest feed intake was observed with the 43P:20L diet, which happened to contain the lowest level of dietary protein and highest content of energy. Our conclusion concurs with Millward (1989) who wrote dietary protein rather than energy was the primary stimulus for muscle growth. The adjustment of feed intake to sustain PD at a given body weight was at the expense of efficiency of protein deposition (ePD), especially outside the range suitable to maximize growth performance, i.e. with the fish fed diet 62P:6L. Although not always significant, similar responses were observed in other studies – which often had less challenging diets – designed to describe the effect of P:L or dietary protein to energy ratios on growth performance and feed utilization of several fish species, such as rainbow trout (e.g. Watanabe et al., 1979; Dias et al., 1999; Rasmussen et al., 2000; Azevedo et al., 2004b; Saravanan et al., 2012), Atlantic salmon (e.g. Einen and Roem, 1997), chinook salmon (Azevedo et al., 2004b), European sea bass (Dias et al., 1999) and haddock (Tibbets et al., 2005). The decrease of ePD resulting from feed intake adjustment to sustain PD was undetectable in certain studies with yellowtail (Jover et al., 1999), gilthead seabream and European sea bass (Company et al., 1999), likely because differences between dietary protein to lipid ratios in test diets were too narrow. Why then did high protein diets result in lower feed intake and not higher PD at a given body weight? It is hypothesized that biochemical saturation kinetics regulated feed intake. Fish fed the 62P:6L diet were not successful at channeling all amino acids toward muscle growth or PD likely because enzymatic pathways for amino acid metabolism became saturated beyond a certain level of intake. Limitation of feed intake may have led to an energy-deficient state not too dissimilar to fasting which, in turn, penalized ePD and growth rate. The slope describing the relationship between PD and BW was higher in the present study than in Dumas et al. (2007b), i.e. 0.311 vs. 0.195. In the latter, the regression equation was developed from multiple strains of rainbow trout encompassing a wider range of BW. Therefore, these different slopes indicate the model should be calibrated for each strain and within narrower ranges of BW (e.g. 0 to 10 g, 10 to 100 g, 100 to 400 g, etc.) to predict PD and FI with more accuracy. The relative consistent PD across treatments, compared to LD, indicated metabolic mechanisms in growing trout were highly oriented toward PD, which strengthened the assumption that weight gain represents the paramount goal in juvenile fish and PD drives weight gain (Dabrowski and Guderley, 2002; Dumas et al., 2007b). In complement to biochemical saturation kinetics, we hypothesize trout fed the challenging 62P:6L diet adapted their metabolic processes to continue sustaining PD. The fish had to compromise and fall away from the growth trajectory followed by the fish fed the other diets, likely for the sake of homeostasis. The low PD and ePD along with consistently high eLD reflected this shift and also suggested diet 62P:6L led to an energy-challenging state. This inference is supported by body composition results as well as high expression of genes and enzymes associated with metabolic state and protein degradation as discussed earlier. Moreover, the low ePD and high eLD indicated trout catabolized amino acids to spare fatty acids, a reaction which may occur below a certain BL or LD threshold. To our knowledge, this is the first study to report a lipid sparing effect of dietary and body protein in immature fish. 5. Conclusion This study provided examples of applications of nutrigenomics in aquaculture by demonstrating the relationships between diet composition and responses at the molecular, tissue and whole animal levels. Simple and practical changes in dietary macronutrient levels can modulate molecular signals and metabolic processes of interest in fish: the dietary protein and lipid contents had effects on the expression of

12

K. Overturf et al. / Aquaculture 457 (2016) 1–14

genes that regulate metabolic pathways of interest in fish production, development and growth of muscle tissue, protein and lipid metabolism, as well as body composition and growth trajectory. The mathematical equations presented in this study can be incorporated into mechanistic models designed to estimate nutrient requirements, achieve specific production goals (e.g. fillet characteristics, BL content), and predict feed allowance along with weight gain of juvenile rainbow trout. This is the first fish study to show the regulation of protein turnover can be linked to hyperplasia in the muscle. Further studies are needed to validate this outcome in other species and pinpoint the key amino acids or fatty acids, or their profiles, responsible for triggering genes associated with hyperplasia of muscle fiber. Finally, the effects of macronutrients on muscle growth dynamics provide new opportunities for research on dietary treatments designed to program muscle fiber recruitment, flesh quality and growth trajectory of fish. Financial support Financial support of this study was provided by the Canadian Department of Foreign Affairs through the International Trade's North American Platform Program. André Dumas is the recipient of the Talent Recruitment Funding Program of the New Brunswick Innovation Foundation. This work was in part funded by the USDA-Agricultural Research Service (CRIS project 5366-21310-004-00D) to KO. The mention of trade names or commercial products in this article is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the United States Department of Agriculture. The authors have no financial or personal conflicts of interest to declare. Acknowledgments The authors would like to thank Mr. Douglas McCracken (Consulate General of Canada) and Mr. Timothy Jackson (National Research Council of Canada) for their assistance in regard to funding programs. Special thanks also to the technical team at the Hagerman Fish Culture Experiment Station. The authors are also thankful to the reviewers whose comments improved the quality of this paper. The authors' contributions were as follows: A. D. contributed to the study design, feed formulation, data analysis, interpretation of the findings and wrote the manuscript; K.O. contributed to the study design, carried out the experiments, laboratory analysis (gene expression, muscle histology and measurements of activity of degradation pathways) and drafted the sections Materials and methods and Results relative to the laboratory analysis under his responsibility and related Discussion sections; F.T.B. contributed to the feed formulation and extruded the experimental diets; R.W.H. contributed to the laboratory analysis (biochemical composition of feed and fish), study design, scientific direction and manuscript revision; A.B. contributed to laboratory analysis and manuscript revision. All the authors read and approved the final manuscript. References Alami-Durante, H., Wrutniack-Cabello, S., Kaushik, S.J., Médale, F., 2010. Skeletal muscle cellularity and expression of myogenic regulatory factors and myosin heavy chains in rainbow trout (Oncorhynchus mykiss): effects of changes in dietary plant protein sources and amino acid profiles. Comp. Biochem. Physiol. A 156, 561–568. Alami-Durante, H., Cluzeaud, M., Duval, C., Maunas, P., Girod-David, V., Médale, F., 2014. Early decrease in dietary protein:energy ratio by fat addition and ontogenetic changes in muscle growth mechanisms of rainbow trout: short- and long-term effects. Br. J. Nutr. 112, 674–687. American Veterinary Medical Association, 2013. AVMA Guidelines for the euthanasia of animals: 2013 edition. https://www.avma.org/KB/Policies/Documents/euthanasia. pdf (accessed March 2015). Amirouche, A., Durieux, A.C., Banzet, S., Koulmann, N., Bonnefoy, R., Mouret, C., Bigard, X., Peinnequin, A., Freyssenet, D., 2009. Down-regulation of Akt/mammalian target of rapamycin signaling pathway in response to myostatin overexpression in skeletal muscle. Endocrinology 150, 286–294.

AOAC, 2002. Official Methods of Analysis of AOAC International. Seventeenth ed. AOAC International, Gaithersburg. Azevedo, P.A., Leeson, S., Cho, C.Y., Bureau, D.P., 2004a. Growth and feed utilization of large size rainbow trout (Oncorhynchus mykiss) and Atlantic salmon (Salmo salar) reared in freshwater: diet and species effects, and response over time. Aquac. Nutr. 10, 401–411. Azevedo, P.A., Leeson, S., Cho, C.Y., Bureau, D.P., 2004b. Growth, nitrogen and energy utilization of juveniles from four salmonid species: diet, species and size effects. Aquaculture 234, 393–414. Bauer, S., Wanninger, J., Schmidhofer, S., Weigert, J., Neumeier, M., Dorn, C., Hellerbrand, C., Zimara, N., Schäffler, A., Aslanidis, C., Buechler, C., 2011. Sterol regulatory elementbinding protein 2 (SREBP2) activation after excess triglyceride storage induces chemerin in hypertrophic adipocytes. Endocrinology 152, 26–35. Brody, T., 1999. Nutritional Biochemistry. second ed. Academic Press, San Diego. Brown, M.E., 1957. The physiology of fishes. Metabolism vol. 1. Academic Press, New York. Campos, C., Valente, L.P.M., Borges, P., Bizuayehu, T., Fernandes, J.M.O., 2010. Dietary lipid levels have a remarkable impact on the expression of growth-related genes in Senegalese sole (Solea senegalensis Kaup). J. Exp. Biol. 213, 200–209. Castell, J.D., Sinnhuber, R.O., Wales, J.H., Lee, D.J., 1972. Essential fatty acids in the diet of rainbow trout (Salmo gairdneri): growth, feed conversion and some gross deficiency symptoms. J. Nutr. 102, 77–86. Cho, Y.C., 1992. Feeding systems for rainbow trout and other salmonids with reference to current estimates of energy and protein requirements. Aquaculture 100, 107–123. Cho, Y.C., Slinger, S.J., Bayley, H.S., 1976. Influence of level and type of dietary protein, and of level of feeding on feed utilization by rainbow trout. J. Nutr. 106, 1547–1556. Cleveland, B.M., Weber, G.M., 2010. Effects of insulin-like growth factor-I, insulin, and leucine on protein turnover and ubiquitin ligase expression in rainbow trout primary myocytes. Am. J. Physiol. Regul. Integr. Comp. Physiol. 298, R341–R350. Company, R., Calduch-Giner, J.A., Perez-Sanchez, J., Kaushik, S.J., 1999. Protein sparing effect of dietary lipids in common dentex (Dentex dentex): A comparative study with sea bream (Sparus aurata) and sea bass (Dicentrarchus labrax). Aquat. Living Resour. 12, 23–30. Cowey, C.B., Knox, D., Walton, M.J., Adron, J.W., 1977. The regulation of gluconeogenesis by diet and insulin in rainbow trout. Br. J. Nutr. 38, 463–470. Dabrowski, K., Guderley, H., 2002. Intermediary metabolism. Fish Nutrition, 3rd ed. Academic Press, San Diego, pp. 309–365. Deval, C., Mordier, S., Obled, C., Bechet, D., Combaret, L., Attaix, D., Ferrara, M., 2001. Identification of cathepsin L as a differentially expressed message associated with skeletal muscle wasting. J. Biochem. 360, 143–150. Dias, J., Corraze, G., Arzel, J., Alvarez, M.J., Bautista, J.M., Lopoez-Bote, C., Kaushik, S.J., 1999. Effets du rapport protéine/énergie des régimes alimentaires chez la truite et le bar en élevage. Perspectives de contrôle nutritionnel des dépôts lipidiques. Cybium 23, 127–137 (Suppl.). Dumas, A., France, J., Bureau, D.P., 2007a. Evidence of three growth stanzas in rainbow trout (Oncorhynchus mykiss) across life stages and adaptation of the thermal-unit growth coefficient. Aquaculture 267, 139–146. Dumas, A., de Lange, C.F.M., France, J., Bureau, D.P., 2007b. Quantitative description of body composition and rates of nutrient deposition in rainbow trout (Oncorhynchus mykiss). Aquaculture 273, 165–181. Einen, O., Roem, A.J., 1997. Dietary protein/energy ratios for Atlantic salmon in relation to fish size: growth, feed utilization and slaughter quality. Aquac. Nutr. 3, 115–126. Eisenstein, A.B., Strack, I., 1971. Effect of high protein feeding on gluconeogenesis in rat liver. Diabetes 20, 577–585. Gatlin III, D.M., Barrows, F.T., Brown, P., Dabrowski, K., Gaylord, T.G., Hardy, R.W., Herman, E., Hu, G., Overturf, K., Rust, M., Sealey, W., Skonberg, D., Souza, E.J., Stone, D., Wilson, R., Wurtele, E., 2007. Expanding the utilization of sustainable plant products in aquafeeds: a review. Aquac. Res. 38, 551–579. Geurden, I., Aramendi, M., Zambonino-Infante, J., Panserat, S., 2007. Early feeding of carnivorous rainbow trout (Oncorhynchus mykiss) with a hyperglucidic diet during a short period: effect on dietary glucose utilization in juveniles. Am. J. Physiol. Regul. Integr. Comp. Physiol. 292, R2275–R2283. Gómez-Requeni, P., Calduch-Giner, J., Vega-Rubín de Celis, S., Medale, F., Kaushik, S.J., Perez-Sanchez, J., 2005. Regulation of the somatotropic axis by dietary factors in rainbow trout (Oncorhynchus mykiss). Br. J. Nutr. 94, 353–361. Gray, S., Wang, B., Orihuela, Y., Hong, E., Fisch, S., Haldar, S., Cline, G.W., Kim, J.K., Peroni, O.D., Kahn, B.B., Jain, M.K., 2007. Regulation of gluconeogenesis by Krüppel-like Factor 15. Cell Metab. 5, 305–312. Guillaume, J., Kaushik, S., Bergot, P., Metailler, R., 1999. Nutrition et Alimentation des Poisons et Crustacés. INRA Éditions & IFREMER, Paris. Halver, J.E., Hardy, R.W., 2002. Fish Nutrition. third ed. Academic Press, San Diego. Hatae, K., Yoshimatsu, F., Matsumoto, J.J., 1984. Discriminative characterization of different texture profiles of various cooked fish muscles. J. Food Sci. 49, 721–726. Hatae, K., Yoshimatsu, F., Matsumoto, J.J., 1990. Role of muscle fibers in contributing firmness of cooked fish. J. Food Sci. 55, 693–696. Hurling, R., Rodell, J.B., Hunt, H.D., 1996. Fiber diameter and fish texture. J. Texture Stud. 27, 679–685. Ingebrigtsen, I.A., Berge, G.M., Ruyter, B., Kjaer, M.A., Morkore, T., Sorensen, M., Gjoen, T., 2014. Growth and quality of Atlantic cod (Gadus morhua) fed with high and low fat diets supplemented with glutamate. Aquaculture 433, 367–376. Ishidoh, K., Kominami, E., 1995. Procathepsin L degrades extracellular matrix proteins in the presence of glycosaminoglycans in vitro. Biochem. Biophys. Res. Commun. 217, 624–631. Iwama, G.K., Tautz, A.F., 1981. A simple growth model for salmonids in hatcheries. Can. J. Fish. Aquat. Sci. 38, 649–656. Izquierdo, M.S., Turkmen, S., Montero, D., Zamorano, M.J., Afonso, J.M., Karalazos, V., Fernández-Palacios, H., 2015. Nutritional programming through broodstock diets to

K. Overturf et al. / Aquaculture 457 (2016) 1–14 improve utilization of very low fishmeal and fish oil diets in gilthead sea bream. Aquaculture 449, 18–26. Johansen, K.A., Overturf, K., 2005. Quantitative expression analysis of genes affecting muscle growth during development of rainbow trout (Oncorhynchus mykiss). Mar. Biotechnol. 7, 576–587. Johansen, K.A., Overturf, K., 2006. Alterations in expression of genes associated with muscle metabolism and growth during nutritional restriction and refeeding in rainbow trout. Comp. Biochem. Physiol. B 144, 119–127. Johnsen, C.A., Hagen, Ø., Solberg, C., Bjornsson, B.T.H., Jonsson, E., Johansen, S.J.S., Bendiksen, E.A., 2013. Seasonal changes in muscle structure and flesh quality of 0+ and 1+ Atlantic salmon (Salmo salar L.): impact of feeding regime and possible roles of ghrelin. Aquac. Nutr. 19, 15–34. Johnston, I.A., 2006. Environment and plasticity of myogenesis in teleost fish. J. Exp. Biol. 209, 2249–2264. Johnston, I.A., Alderson, R., Sandham, C., Dingwall, A., Mitchell, D., Selkirk, C., Nickell, D., Baker, R., Robertson, B., Whyte, D., Springate, J., 2000. Muscle fibre density in relation to the colour and texture of smoked Atlantic salmon (Salmo salar L.). Aquaculture 189, 335–349. Johnston, I.A., Manthri, S., Bickerdike, R., Dingwall, A., Luijkx, R., Campbell, P., Nickell, D., Alderson, R., 2004. Growth performance, muscle structure and flesh quality in outof-season Atlantic salmon (Salmo salar L.) smolts reared under two different photoperiod regimes. Aquaculture 237, 281–300. Jordal, A.E.O., Torstensen, B.T., Tsoi, S., Tocher, D., Lall, S.P., Douglas, S., 2005. Dietary rapeseed oil affects the expression of genes involved in hepatic lipid metabolism in Atlantic salmon (Salmo salar L.). J. Nutr. 135, 2355–2361. Jover, M., Garcıa-Gomez, A., Tomas, A., De la Gandara, F., Perez, L., 1999. Growth of Mediterranean yellowtail (Seriola dumerilii) fed extruded diets containing different levels of protein and lipid. Aquaculture 179, 25–33. Kirchner, S., Kaushik, S., Panserat, S., 2003. Low protein intake is associated with reduced hepatic gluconeogenic enzyme expression in rainbow trout (Oncorhynchus mykiss). J. Nutr. 133, 2561–2564. Kreuzer, K.A., Lass, U., Landt, O., Lass, U., Landt, O., Nitsche, A., Laser, J., Ellerbrok, H., Pauli, G., Huhn, D., Schmidt, C.A., 1999. Highly sensitive and specific fluorescence reverse transcrition-PCR assay for the pseudogene-free detection of β-actin transcripts as quantitative reference. Clin. Chem. 45, 297–300. Kuehl, R.O., 2000. Design of Experiments: Statistical Principles of Research Design and Analysis. second ed. Duxbury Press, Pacific Grove. Leaver, M.J., Bautista, J.M., Björnsson, B.T., Jonsson, E., Krey, G., Tocher, D.R., Torstensen, B.E., 2008a. Towards fish lipid nutrigenomics: current state and prospects for finfish aquaculture. Rev. Fish. Sci. 16 (S1), 73–94. Leaver, M.J., Villeneuve, L.A.N., Obach, A., Jensen, L., Bron, J.E., Tocher, D.R., Taggart, J.B., 2008b. Functional genomics reveals increases in cholesterol biosynthetic genes and highly unsaturated fatty acid biosynthesis after dietary substitution of fish oil with vegetable oils in Atlantic salmon (Salmo salar). BMC Genomics 9, 299. Lokireddy, S., McFarlane, C., Ge, X., Zhang, H., Sze, S.K., Sharma, M., Kambadur, R., 2011. Myostatin induces degradation of sarcomeric proteins through a Smad3 signaling mechanism during skeletal muscle wasting. Mol. Endocrinol. 25, 1936–1949. Lupatsch, I., Kissil, G.W.M., Sklan, D., Pfeffer, E., 2001. Effects of varying dietary protein and energy supply on growth, body composition and protein utilization in gilthead seabream (Sparus aurata L.). Aquac. Nutr. 7, 71–80. Machiels, M., Henken, A., 1986. A dynamic simulation model for growth of the African catfish, Clarias gariepinus (Burchell 1822). I. Effect of feeding level on growth and energy metabolism. Aquaculture 56, 29–52. Macqueen, D.J., Robb, D.H.F., Olsen, T., Melstveit, L., Paxton, G.M., Johnston, I.A., 2008. Temperature until the ‘eyed stage’ of embryogenesis programmes the growth trajectory and muscle phenotype of adult Atlantic salmon. Biol. Lett. 4, 294–298. Masiero, E., Agatea, L., Mammucari, C., Blaauw, B., Loro, E., Komatsu, M., Metzger, D., Reggiani, C., Schiaffino, S., Sandri, M., 2009. Autophagy is required to maintain muscle mass. Cell Metab. 10, 507–515. Mennigen, J.A., Martyniuk, C.J., Seiliez, I., Panserat, S., Skiba-Cassy, S., 2014. Metabolic consequences of microRNA-122 inhibition in rainbow trout, Oncorynchus mykiss. BMC Genomics 15, 70. Meyer-Burgdorff, K.H., Günther, K.G., 1995. N-turnover of carp in relation to protein supply. J. Appl. Ichthyol. 11, 378–381. Millward, D.J., 1989. The nutritional regulation of muscle growth and protein turnover. Aquaculture 79, 1–28. Miserez, A.R., Muller, P.Y., Barella, L., Barella, S., Staehelin, H.B., Leitersdorf, E., Kark, J.D., Friedlander, Y., 2002. Sterol-regulatory element-binding protein (SREBP)-2 contributes to polygenic hypercholesterolaemia. Atherosclerosis 164, 15–26. Mommsen, T., 2001. Paradigms of growth in fish. Comp. Biochem. Physiol. B 129, 207–219. Naylor, R.L., Hardy, R.W., Bureau, D.P., Chiu, A., Elliott, M., Farrell, A.P., Forster, I., Gatlin, D.M., Goldburg, R.J., Hua, K., Nichols, P.D., 2009. Feeding aquaculture in an era of finite resources. Proc. Natl. Acad. Sci. U. S. A. 106, 15103–15110. Nelson, D.L., Cox, M.M., 2000. Lenhinger Principles of Biochemistry. third ed. Worth Publishers, New York. NRC, 2011. Nutrient Requirements of Fish and Shrimp. National Academy Press, Washington. Oishi, K., Uchida, D., Itoh, N., 2012. Low-carbohydrate, high-protein diet affects rhythmic expression of gluconeogenic regulatory and circadian clock genes in mouse peripheral tissues. Chronobiol. Int. 29, 799–809. Overturf, K., Gaylord, T.G., 2009. Determination of relative protein degradation activity at different life stages in rainbow trout (Oncorhynchus mykiss). Comp. Biochem. Physiol. B 152, 150–160. Overturf, K., Casten, M.T., LaPatra, S.L., Rexroad III, C., Hardy, R., 2003. Comparison of growth performance, immunological response and genetic diversity of five strains of rainbow trout (Oncorhynchus mykiss). Aquaculture 217, 93–106.

13

Overturf, K., Sakhrani, D., Devlin, R.H., 2010. Expression profile for metabolic and growth-related genes in domesticated and transgenic coho salmon (Oncorhynchus kisutch) modified for increased growth hormone production. Aquaculture 307, 111–122. Panserat, S., Kaushik, S.J., 2010. Regulation of gene expression by nutritional factors in fish. Aquac. Res. 41, 751–762. Panserat, S., Hortopan, G.A., Plagnes-Juan, E., Kolditz, C., Lansard, M., Skiba-Cassy, S., Esquerre, D., Geurden, I., Medale, F., Kaushik, S., Corraze, G., 2009. Differential gene expression after total replacement of dietary fish meal and fish oil by plant products in rainbow trout (Oncorhynchus mykiss). Aquaculture 294, 123–131. Peragón, J., Barroso, J.B., García-Salguero, L., Higuera, M., Lupianez, J.A., 2001. Growth, protein-turnover rates and nucleic acid concentrations in the white muscle of rainbow trout during development. Int. J. Biochem. Cell Biol. 33, 1227–1238. Petersen, J., Nurse, P., 2007. TOR signaling regulates mitotic commitment through the stress MAP kinase pathway and the polo and Cdc2 kinases. Nat. Cell Biol. 9, 1263–1272. Phillips Jr., A.M., Livingston, D.L., Dumas, R.F., 1960. Effect of starvation and feeding on the chemical composition of brook trout. Prog. Fish Cult. 22, 147–154. Plagnes-Juan, E., Lansard, M., Seiliez, I., Medale, F., Corraze, G., Kaushik, S., Panserat, S., Skiba-Cassy, S., 2008. Insulin regulates the expression of several metabolism-related genes in the liver and primary hepatocytes of rainbow trout (Oncorhynchus mykiss). J. Exp. Biol. 211, 2510–2518. Qin, W., Pan, J., Wu, Y., Bauman, W.A., Cardozo, C., 2010. Protection against dexamethasone-induced muscle atrophy is related to modulation by testosterone of FOX01 and PGC-1α. Biochem. Biophys. Res. Commun. 403, 473–478. Raine, J.C., Hua, K., Bureau, D.P., Vijayan, M.M., Leatherland, J.F., 2007. Influence of ration level and rearing temperature on hepatic GHR1 and 2, and hepatic and intestinal TRα and TRβ gene expression in late stages of rainbow trout embryos. J. Fish Biol. 71, 148–162. Rasmussen, R.S., Ostenfeld, T.H., McLean, E., 2000. Growth and feed utilization of rainbow trout subjected to changes in feed lipid concentrations. Aquac. Int. 8, 531–542. Renaud, J.M., Moon, T.W., 1980. Characterization of gluconeogenesis in hepatocytes isolated from the American eel, Anguilla rostrata LeSueur. J. Comp. Physiol. 135, 115–125. Riche, M., 2009. Evaluation of digestible energy and protein for growth and nitrogen retention in juvenile Florida Pompano, Trachinotus carolinus. J. World Aquacult. Soc. 40, 45–57. Salze, G., Alami-Durante, H., Barbut, S., Marcone, M., Bureau, D.P., 2014. Nutrient deposition partitioning and priorities between body compartments in two size classes of rainbow trout in response to feed restriction. Br. J. Nutr. 111, 1361–1372. Sandri, M., 2010. Autophagy in skeletal muscle. FEBS Lett. 584, 1411–1416. Saravanan, S., Schrama, J.W., Figueiredo-Silva, A.C., Kaushik, S.J., Verreth, J.A.J., 2012. Constraints on energy intake in fish: the link between diet composition, energy metabolism, and energy intake in rainbow trout. PLoS One 7, e34743. http://dx.doi.org/10. 1371/journal.pone.0034743. Scherrer, B., 1984. Biostatistique. Gaëtan Morin, Québec. Seiliez, I., Gutierrez, J., Salmerón, C., Skiba-Cassy, S., Chauvin, C., Dias, K., Kaushik, S., Tesseraud, S., Panserat, S., 2010. An in vivo and in vitro assessment of autophagyrelated gene expression in muscle of rainbow trout (Oncorhynchus mykiss). Comp. Biochem. Physiol. B 157, 258–266. Shearer, K.D., 1994. Factors affecting the proximate composition of cultured fishes with emphasis on salmonids. Aquaculture 119, 63–88. Shearer, K.D., Åsgård, T., Andorsdöttir, G., Aas, G.H., 1994. Whole body elemental and proximate composition of Atlantic salmon (Salmo salar) during the life cycle. J. Fish Biol. 44, 785–797. Shimizu, N., Yoshikawa, N., Ito, N., Maruyama, T., Suzuki, Y., Takeda, S., Nakae, J., Tagata, Y., Nishitani, S., Takehana, K., Sano, M., Fukuda, K., Suematsu, M., Morimoto, C., Tanaka, H., 2011. Crosstalk between glucocorticoid receptor and nutritional sensor mTOR in skeletal muscle. Cell Metab. 13, 170–182. Silva, P., Valente, L.M.P., Galante, M.H., Andrade, C.A.P., Monteiro, R.A.F., Rocha, E., 2009. Dietary protein content influences both growth and size distribution of anterior and posterior muscle fibres in juveniles of Pagellus bogaraveo (Brunnich). J. Muscle Res. Cell Motil. 30, 29–39. Silverstein, J.T., Hostuttler, M., Blemings, K.P., 2005. Strain differences in feed efficiency measured as residual feed intake in individually reared rainbow trout, Oncorhynchus mykiss (Walbaum). Aquac. Res. 36, 704–711. Sofer, A., Lei, K., Johannessen, C.M., Ellisen, L.W., 2005. Regulation of mTOR and cell growth in response to energy stress by REDD1. Mol. Cell. Biol. 25, 5834–5845. Souba, W.W., 1991. Glutamine: a key substrate for the splanchnic bed. Annu. Rev. Nutr. 11, 285–308. Takashima, M., Ogawa, W., Hayashi, K., Inoue, H., Kinoshita, S., Okamoto, Y., Sakaue, H., Wataoka, Y., Emi, A., Senga, Y., Matsuki, Y., Watanabe, E., Hiramatsu, R., Kasuga, M., 2010. Role of KLF 15 in regulation of hepatic gluconeogenesis and metformin action. Diabetes 59, 1608–1615. Takeuchi, T., Shiina, Y., Watanabe, T., Sekiya, S., Imaizumi, K., 1992. Suitable protein and lipid levels in diet for fingerlings of Yellowtail. Nippon Suisan Gakkaishi 58, 1333–1339. Tang, H.T., Rando, A.T., 2014. Induction of autophagy supports the bioenergetic demands of quiescent muscle stem cell activation. EMBO J. 33, 2782–2797. Tibbets, S.M., Lall, S.P., Milley, J.E., 2005. Effect of dietary protein and lipid levels and DP DE−1 ratio on growth, feed utilization and hepatosomatic index of juvenile haddock, Melanogrammus aeglefinus L. Aquac. Nutr. 11, 67–75. Tobin, D., Kause, A., Mäntysaari, E.A., Martin, S.A.M., Houlihan, D., Dobly, A., Kiessling, A., Rungruangsak-Torrissen, K., Ritola, O., Ruohonen, K., 2006. Fat or lean? The quantitative genetic basis for selection strategies of muscle and body composition traits in

14

K. Overturf et al. / Aquaculture 457 (2016) 1–14

breeding schemes of rainbow trout (Oncorhynchus mykiss). Aquaculture 261, 510–521. Valente, L.M.P., Fauconneau, B., Gomes, E.F.S., Boujard, T., 2001. Feed intake and growth of fast and slow growing strains of rainbow trout (Oncorhynchus mykiss) fed by automatic feeders or by self-feeders. Aquaculture 195, 121–131. Vittinghoff, E., Glidden, D.V., Shiboski, S.C., McCulloch, C.E., 2005. Regression Methods in Biostatistics: Linear, Logistic, Survival, and Repeated Measures Models. Springer, New York. Walton, M.J., 1986. Metabolic effects of feeding a high protein/low carbohydrate diet as compared to a low protein/high carbohydrate diet to rainbow trout Salmo gairdneri. Fish Physiol. Biochem. 1, 7–15. Watanabe, T., Takeuchi, T., Ogino, C., 1979. Studies on the sparing effect of lipids on dietary protein in rainbow trout (Salmo gairdneri). Proc. World Symp. On Finfish Nutrition and Fishfeed Technology 1, Hamburg, pp. 113–125.

Weatherley, A.H., Gill, H.S., 1983. Protein, lipid, water and caloric contents of immature rainbow trout, Salmo gairdneri Richardson, growing at different rates. J. Fish Biol. 23, 653–673. Welch, A., Hoenig, R., Stieglitz, J., Benetti, D., Tacon, A., Sims, N., O'Hanlon, B., 2010. From fishing to the sustainable farming of carnivorous marine finfish. Rev. Fish. Sci. 18, 235–247. Xiong, Y., Huang, J., Li, X., Zhou, L., Dong, F., Ye, H., Gan, L., 2014. Deep sequencing of the tilapia (Oreochromis niloticus) liver transcriptome response to dietary protein to starch ratio. Aquaculture 433, 299–306. Zambonino Infante, J.L., Cahu, C.L., 2001. Ontogeny of the gastrointestinal tract of marine fish larvae. Comp. Biochem. Physiol. C 130, 477–487. Zammit, P.S., Relaix, F., Nagata, Y., Perez Ruiz, A., Collins, C.A., Partridge, T.A., Beauchamp, J.R., 2006. Pax7 and myogenic progression in skeletal muscle satellite cells. J. Cell Sci. 119, 1824–1832.