Engineering DNAzyme cyclic amplification integrated dual-signal chiral sensing system for specific recognition of histidine enantiomers

Journal Pre-proof Engineering DNAzyme cyclic amplification integrated dual-signal chiral sensing system for specific recognition of histidine enantiomers Qian Han, Fangjing Mo, Jingling Wu, Cun Wang, Min Chen, Yingzi Fu

PII:

S0925-4005(19)31390-5

DOI:

https://doi.org/10.1016/j.snb.2019.127191

Reference:

SNB 127191

To appear in:

Sensors and Actuators: B. Chemical

Received Date:

22 June 2019

Revised Date:

7 September 2019

Accepted Date:

23 September 2019

Please cite this article as: Han Q, Mo F, Wu J, Wang C, Chen M, Fu Y, Engineering DNAzyme cyclic amplification integrated dual-signal chiral sensing system for specific recognition of histidine enantiomers, Sensors and Actuators: B. Chemical (2019), doi: https://doi.org/10.1016/j.snb.2019.127191

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.

Engineering DNAzyme cyclic amplification integrated dual-signal chiral sensing system for specific recognition of histidine enantiomers

Qian Han1,2, Fangjing Mo1, Jingling Wu1, Cun Wang1, Min Chen1, Yingzi Fu1*

f

1. Key Laboratory of Luminescent and Real-Time Analytical Chemistry (Southwest

oo

University), Ministry of Education, School of Chemistry and Chemical Engineering,

pr

Southwest University, Chongqing 400715, China

2. Laboratory of Environment Change and Ecological Construction of Hebei

Pr

Shijiazhuang, Hebei 050024, China

e-

Province, College of Resources and Environment Science, Hebei Normal University,

al

Corresponding author: Yingzi Fu

ur n

Fax: +86-023-68253195

Tel: +86-023-68252360

Jo

E-mail address: [email protected]

Higlights 

A dual signal is produced towards Fe3O4 attached reduced graphene oxide nanocomposite as electroactive matrix.



A label-free “on-off-on” biosensor was designed for specific recognition of histidine enantiomers.



The proposed biosensor presented excellent selectivity,

sensitivity

and

reproducibility for the detection of L-histidine.

ABSTRACT A novel label-free dual-signal amplifying “on-off-on” electrochemical biosensor has been designed for specific recognition of histidine (His) enantiomers. The remarkable dual-signal is provided by engineering His-dependent DNAzyme and the Fe3O4

oo

f

nanoparticles attached reduced graphene oxide nanocomposite (Fe3O4@rGO) as enzymatically magnified chiral selector and electroactive indicator, respectively. In

pr

this strategy, L-histidine (L-His) cyclically catalyzes the cleavage of the substrate

sequences, leading to the release of rich G-quadruplex and enzymatic sequences. The

e-

released enzymatic sequences sequentially trigger the additional cleavage cycle, the

Pr

G-quadruplex forming sequences associate with hemin to form G-quadruplex/hemin structures, which act as label-free NADH oxidase to generate significantly amplified

al

current for sensitive detection of L-His. Whereas no obvious response is observed after the DNAzyme cascade assay reacted with D-His. And the proposed chiral

ur n

biosensor based on dual outputs “AND” logic gate has been constructed to facilitate the application. Combined the merits of His-dependent DNAzyme amplifying

Jo

electrochemical response and the dual-signal generated by the new electroactive materials, the developed assay for the detection of His enantiomers demonstrated excellent selectivity and sensitivity. This can promote the promising applications of the versatile DNAzyme-based biosensing concept in chiral recognition of other amino acids.

Keywords: Histidine enantiomers, DNAzyme, G-quadruplex/hemin, Dual-signal,

Chiral recognition 1. Introduction Amino acids play important roles in biological systems which are associated with proteins and peptides, and they are commonly found in food, feeds, body fluids and life tissues [1,2]. It is well known that L-amino acids possess biological and pharmaceutical activity, while D-forms exhibit therapeutic ineffective or even result

oo

f

in serious side effects on living organisms [3,4]. In two isomers of histidine, only Lhistidine (L-His) has great important biological functions. It not only works as a

pr

neurotransmitter or neuromodulator in human muscular and nervous system, but also

e-

controls the transmission of metal elements in biological system [5]. The quantitative detection of L-His is associated with the diagnosis of L-His metabolism disorders,

Pr

particularly “histidinemia” at elevated levels (29.5 µg·mL-1) in physiological fluids (Normal level: 0.31 to 26.35 µg·mL−1) [6]. When L-His is reduced to a low

al

concentration (0.27 µg·mL−1), normal erythropoiesis development may fail [7]. A

ur n

persistent deficiency of L-His will result in the impaired nutritional state of patients with chronic kidney disease, rheumatoid arthritis, even Friedreich ataxia, epilepsy, and Parkinson's disease [8,9]. Thus, it is necessary to develop some detection

Jo

methods of L-His with high sensitivity and precision. While D-His has no bioactivity and therapeutic effect in clinic [10]. Considering that different forms of His enantiomers have different effects in humans, the effective recognition of L- and DHis is highly crucial, and the rapid, selective, sensitive detection of L-His is essentially required in pharmaceutical research and clinical settings [11]. Until now, various analytical methods including chromatography, capillary

electrophoresis, and circular dichroism have been introduced to analyze His enantiomers [12-14]. These techniques are more or less suffered from disadvantages, such as expensive instrumentation, eco-unfriendly organic solvents, and timeconsuming procedures. Electrochemical chiral sensors have attracted much attention owing to their easy operation, low cost, high sensitivity and miniaturization for small volume samples. Multiplexed electrochemical sensors with dual-signal at different

oo

f

redox potentials can provide higher selectivity and sensitivity than single signal

sensors, which eliminate the interference of detection background or surroundings to

pr

make the detection results more convincing [15-18]. Several multiplexed sensors

e-

have been reported to detect target by utilizing two redox species as signal probes [19,20]. Few chiral sensors can be used to detect enantiomers robustly depending on

Pr

one redox specie as a dual-signal indicator. Therefore, the development of a simple, effective, multiple signal chiral sensing system continues to be a great challenge for

al

researchers.

ur n

DNA as a natural and highly selective chiral selector, is discovered to exhibit specific stereoselectivity in recognition of many molecules such as antibiotics and amino acids [21,22]. DNAzymes are single-stranded DNA oligonucleotides selected

Jo

in vitro with highly catalytic activities [23]. They possess efficient selective property and high affinity to metal ions or designated neutral molecules as cofactors [24], and have been explored in biosensors for the detection of metal ions or neutral molecules, such as Cu(II), Pb(II), L-His etc. [25,26]. Au nanocrystals modified electronic aptamer-based sensors have been used to detect L-His with a very low detection limit [27]. And a proximity-dependent surface hybridization strategy has been employed

for constructing an electrochemical DNAzyme biosensor for the detection of L-His [28]. However, these kinds of DNAzyme-based biosensors need complicated modification to realize efficient signal output, which need to further be labeled with signal molecules. Moreover, some “signal off” electrochemical sensors are more vulnerable to interference than those “signal on” sensors, and that limit their sensitivity [29,30]. Therefore, the development of label-free and “signal on”

oo

f

DNAzyme-based biosensors will enhance the specificity and sensitivity, and avoid false-positive results in electrochemical chiral recognition [31].

pr

Recently, magnetic nanoparticles have numerous applications in electronic devices,

e-

magnetic data storage, and drug delivery [32]. As one of the most commonly used magnetic metal oxides, ferroferric oxide nanoparticles (Fe3O4 NPs) with

Pr

biocompatibility, catalytic activity, low toxicity, and high adsorption ability have attracted much interest in construction of sensors [33]. And Fe3O4/carbon materials

al

hybrids are also used to improve the uneven dispersion and agglomeration of the

ur n

Fe3O4 NPs in neutral solution [34,35]. In this work, Fe3O4 NPs and reduced graphene oxide nanocomposite (Fe3O4@rGO) was successfully prepared through a simple reaction step and mild conditions. It displayed the characteristics of well dispersion,

Jo

large surface area, high stability and conductivity. It even was developed as a signal indicator in this electrochemical system. Herein, based on Fe3O4@rGO as the dual-signal probe and the formed Gquadruplex/hemin DNAzyme as recycling signal amplifying device, we constructed a novel label-free signal “on-off-on” electrochemical biosensor for the highly sensitive detection of L-His (Scheme 1). Firstly, the initial “signal-on” state ON1 was achieved

by the introduction of Fe3O4@rGO composite on glassy carbon electrode to produce strong electrochemical dual-signal. Secondly, with the thiolated hairpin-structured substrate sequence (HP) and mercaptohexanol (MCH) being loaded on the surface of gold deposited Fe3O4@rGO, the lowest dual-signal of state OFF was obtained. Finally, a robust dual-signal was recovered to the second “signal-on” state ON2 by the introduction of His enzyme sequence (S1) and L-His. S1 and L-His catalyzed the

oo

f

cleavage of the G-rich HP, a massive of G-quadruplex/hemin DNAzymes were formed in the presence of hemin with a label-free format. An effective signal

pr

recovery was obtained along with the G-quadruplex/hemin DNAzymes electro-

e-

catalyzing the oxidation of reduced nicotinamide adenine dinucleotide (NADH). Since D-His could not trigger the catalytic cleavage process, the recovery of dual-

Pr

signal was not easy again. The dual-signal DNA functionalized nanoamplification architecture has opened a new avenue for designing highly accurate chiral biosensors.

al

2. Experimental

ur n

2.1. Chemicals and materials.

L- and D-histidine (L- and D-His, >99%), L- and D-phenylalanine (L- and D-Phe, 98%), L- and D-proline (L- and D-Pro, 99%), L- and D-arginine (L- and D-Arg,

Jo

99%), L-cysteine (L-Cys, 99%), 6-mercaptohexanol (MCH), hemin, dimethyl sulfoxide (DMSO), chloroauric acid (HAuCl4·4H2O), Tris-HCl and Tris(2carbozyethyl)phosphine hydrochloride (TCEP) were supplied by Sigma (St. Louis, MO). Graphene oxide (GO) was obtained from Nan-jing xianfeng nano Co. (Nanjing, China). Ammonia solution (NH3, 25%), 3,3’,5,5’-tetramethylbenzidine (TMB) were purchased from the Chemical Reagent Co. (Chongqing, China). The HPLC-purified

oligonucleotides and N-(2-hydroxyethyl)piperazine-N′-(2-ethanesulfonic acid) (HEPES) sodium salt were obtained from TaKaRa Biotechnology Co., Ltd. (Dalian, China), and the sequences of the synthesized oligonucleotides are shown in Table 1. All the sequences of the oligonucleotides before use were annealed at 95 °C for 5 min, followed by cooling down to room temperature at a rate of 1°C min-1. All the reagents were of analytical grade and double distilled water was used throughout the

oo

f

study. Human serum samples were supported by Ninth People’s Hospital of Chongqing, China.

pr

2.2. Apparatus

e-

The morphologies of the Fe3O4@rGO nanocomposite were recorded on a JEM2100 field emission scanning electron microscopy (SEM) equipped with a field

Pr

emission gun at 200 kV on JEOL-7800F, an energy-dispersive X-ray spectroscopy (EDS, INCA X-Max 250, Japan) and transmission electron microscope (TEM, JEM-

al

2100, Japan). The X-ray photoelectron spectroscopy (XPS) analysis was carried out

ur n

by using a VG Scientific ESCALAB 250 spectrometer (Thermoelectricity Instruments, USA). The UV-Vis spectra measurements were made on a UV-2600 UV/vis spectrophotometer (Shimadzu, Japan). Cyclic voltammetry (CV) and

Jo

differential pulse voltammetry (DPV) were performed on CHI440A electrochemical workstation (Chenhua Instruments Co., Shanghai, China). A three-electrode system was used in the experiment with bare and the modified glassy carbon electrode (GCE, Φ = 4 mm) as working electrode, an Ag/AgCl electrode and a Pt wire electrode as reference and counter electrode, respectively. CV measurements were conducted in 5 mmol·L-1 [Fe(CN)6]3−/4− with the potential range from −0.2 to 0.6 V.

DPV experiments were performed by scanning potential from 0.3 to −0.6 V in HEPES buffer (20 mmol·L-1, 50 mmol·L-1 KCl, 200 mmol·L-1 NaCl, pH 7.4). 2.3. Preparation of Fe3O4@rGO nanocomposite The Fe3O4@rGO nanocomposite was prepared according to the previous literature with a slight change [35]. 8 mg GO and 20 mg L-Cys were dispersed in 4 mL distilled water under ultrasonication, then 80 μL NH3·H2O was added dropwise.

oo

f

Subsequently, 1 mg hemin was added into the mixture under vigorously stirring for 1 h. The obtained solution was heated at 95 °C in an oil bath for 12 h. After cooling to

pr

room temperature, the obtained Fe3O4@rGO was centrifuged and washed with distilled water. Finally, the product was dried at 60 °C for 8 h.

e-

2.4. Fabrication of the electrochemical biosensor

Pr

Firstly, each glassy carbon electrode (GCE) was treated with alumina powder, distilled water, and ethanol in succession. The 10 μL Fe3O4@rGO nanocomposite (1

al

mg·mL-1) was dropped on the electrode (denoted as Fe3O4@rGO/GCE). Then, a nano-Au film was formed by eletrodeposition in HAuCl4 (1%) solution at -0.2V for

ur n

30 s (Au/Fe3O4@rGO/GCE). After that, 10 μL annealed 3’-thiol-modified HP probe (1 μmol·L-1, treated with 10 mmol·L-1 TCEP for 1 h to avoid the formation of S-S

Jo

bond) in Tris-HCl buffer (20 mmol·L-1, 140 mmol·L-1 NaCl, 10 mmol·L-1 MgCl2, 5 mmol·L-1 KCl, pH 7.4) was placed onto the electrode surface for 12 h incubation at 4℃ (HP/Au/Fe3O4@rGO/GCE). Finally, HP/Au/Fe3O4@rGO/GCE was blocked with 1 mmol·L-1 MCH solution for 2 h to obstruct the non-specific sites (MCH/HP/Au/Fe3O4@rGO/GCE). The fabrication process of the proposed biosensor is shown in Scheme 1.

2.5. Electrochemical determination of His enantiomers The designed biosensor was further incubated with 10 μL S1 sequence including different concentrations of L- or D-His (S1/His) for 90 min at room temperature. Then the electrode was washed carefully with distilled water to remove the unbound reagents. Next 0.2 mmol·L-1 hemin (20 mmol·L-1 HEPEs buffer, 50 mmol·L-1 KCl, 200 mmol·L-1 NaCl, 1% DMSO) was dropped onto the electrode surface for 30 min

oo

f

to form the G-quadruplex/hemin structure. Finally, the resulted electrode was dipped in HEPES buffer containing 3 mmol·L-1 NADH to fulfill electrochemical

pr

measurements.

e-

3. Results and discussion

3.1. Morphological and structural characterization of Fe3O4@rGO

Pr

The morphology of as-prepared Fe3O4@rGO was characterized by TEM and SEM. The gossamer-like laminated structure of the rGO is clearly seen from the TEM (Fig.

al

1A), the Fe3O4 NPs are nearly spherical in shape, and the high-resolution TEM

ur n

(HRTEM) image exhibits well-resolved lattice fringes with a d-spacing of 0.83 nm (Fig. 1B). SEM image shows that the particles of Fe3O4 are uniformly grown on the graphene surfaces (Fig. 1C). Meanwhile, the EDS results of Fe3O4@rGO indicate the

Jo

presence of C, N, O, S, and Fe components in the nanocomposite (Fig. 1D). Fig. 2 exhibits the relevant elemental mapping image from EDS which further verify the elemental components of Fe3O4@rGO nanocomposite. Since the introduction of rGO, mass carbon and oxygen elements are homogeneously distributed (Fig. 2b, d). Because L-Cys is used as reactant during the synthesis process of Fe3O4@rGO, the nitrogen and sulfur elements are observed (Fig. 2c, e). Fig. 2f clearly displays the

presence of Fe throughout the whole plane. XPS measurements were performed to probe the chemical composition of the resulting product. The survey scan spectrum from the XPS analysis reveals the presence of C1s, O1s, N1s, S2p and Fe2p (Fig. 3A). The peaks at binding energies of 284.78, 531.88, 399.48, and 163.98eV refer to the C1s, O1s, N1s, and S2p spectra, respectively. The binding energies of Fe2p1/2 and Fe2p3/2 are located at 711.38 and

results are consistent with previous literature [35, 36].

oo

f

724.38 eV, indicating the presence of Fe3O4 on the thin substances (Fig. 3F). All the

pr

The electrochemical property of Fe3O4@rGO nanocomposite was investigated by DPV measurements (Fig. 4). A pair of well dual peaks is observed on Fe3O4@rGO

e-

modified electrode (Fig. 4a). The values of two peak currents to Fe3O4 (Fe2+) and

Pr

Fe3O4 (Fe3+) are 17.83 μA (I1) and 14.49 μA (I2), the peak potentials are −0.352 V and −0.044 V, respectively, indicating that Fe3O4 NPs in the nanocomposite still have

al

good electrochemical activity. The well dual-signal of Fe3O4 NPs may be attributed to

ur n

the different valence state of Fe3O4 NPs and the double layer from the Fe3O4@rGO with dissolved oxygen [37, 38]. But if the graphene and hemin were random mixed, there was only a single peak on the mixture modified electrode (Fig. 4b).

Jo

3.2. Electrochemical characterization of the stepwise modified electrode The modification process of the proposed biosensor was confirmed via CV, and the

analysis was performed in 5.0 mmol·L-1 [Fe(CN)6]3−/4− solution (pH 7.4). A pair of quasi-reversible redox peaks can be observed on the bare GCE (Fig. S1a). After modified Fe3O4@rGO and Au film in turn on the surface, the peak currents were obviously increased successively (Fig. S1b and c). After the electrode was incubated

with HP, the current was significantly dropped (Fig. S1d) due to the electrostatic repulsion between the negative charges of the phosphate skeletons and [Fe(CN)6]3−/4−. The peak current of MCH/HP/Au/Fe3O4@rGO/GCE was further decreased and dramatic peak separation (Fig. S1e), indicating the stepwise fabrication of the electrochemical biosensor was achieved. 3.3. Electrochemical specific sensing of His enantiomers

oo

f

His enantiomers were detected to illustrate the enantioselective properties of the

proposed biosensor. As depicted in Fig. 5A, the dual-signal DPV response of L-His

pr

(500 nmol·L-1) is remarkable higher than the signal of D-His in 3 mmol·L-1 NADH solution (curve a), while the dual-signal of D-His is faint (curve b) lie in the HP

e-

structure cannot be cleaved by D-His. The dual currents of L-His are 14.50 μA and

Pr

10.17 μA, respectively, they are 2.61 and 2.68 folds larger than D-His responses. The dual currents differences between L-His and D-His are 6.26 μA and 9.09 μA, which

al

meant that the specific His-dependent DNAzyme has a higher affinity with L-His

ur n

than that with D-His. The selective responses indicate that the DNAzyme does show L-His-specific and high catalyzing capability towards the substrate in our designed strategy.

Jo

In addition, without NADH, the electrochemical signals are increased slightly, and

the differences between L-and D-His are only 3.38 μA and 4.26 μA. The results show an evidence of the NADH amplification strategy (Fig. 5B). To understand the important of the Fe3O4@rGO in this system, the corresponding comparative sensor without Fe3O4@rGO was prepared (MCH/HP/Au/GCE), which was identical to the above proposed biosensor. Only a single peak is obtained on MCH/HP/Au/GCE for

the detection of His enantiomers, and a small difference between L-His and D-His is appeared (Fig. 5C). The enantioselectivity between His enantiomers and DNAzyme was further investigated by UV-vis spectroscopy (Fig. S2). All results demonstrated that the His-dependent DNAzyme had a high stereospecificity toward L-His. So the proposed biosensor was used to fully detect L-His. The probable dual-signal circle amplifcation mechanism was speculated as

oo

f

follows: the synthetic Fe3O4@rGO nanocomposite by means of its different valence state was used as the electroactive matrix to produce significant dual-signal, the

pr

initial state ON1 was realized. Following that, the G-rich HP and MCH were

e-

incubated on the electrode surface, and generated an OFF response with lowest dualsignal because of the poor electron transfer of the immobilized oligonucleotides HP

Pr

and organic molecules MCH. After the enzymatic sequence S1 and L-His were captured on the MCH/HP/Au/Fe3O4@rGO/GCE, L-His could catalyze the cleavage

al

of HP substrate at the ribonucleotide (rA) site, and further released the S1, the

ur n

released S1 would trigger the additional cycle. The short G-rich fragment from the separated duplex regions lacked thermal stability and easily formed the catalytic Gquadruplex/hemin with addition of hemin. As shown in equation (1) to (5), the G-

Jo

quadruplex/hemin was firstly serve as an NADH oxidase, assisting the oxidation of NADH to NAD+ with the concomitant formation of H2O2 in the presence of dissolved O2. Subsequently, with the electrochemically active composite Fe3O4@rGO as an electron mediator, the dual-signal was appeared. G-quadruplex/hemin simultaneously was acted as electron transfer medium and HRP-mimicking DNAzyme to electrocatalyze the reduction of produced H2O2, finally the dramatic

and amplified dual-signal ON2 state was gained.

Fe (    2 Fe     3 NADH Fe (   - OOH  H



 O 2  Fe  Fe (   - OOH  2NAD   NAD 0

 2H



 H 2 O 2  Fe( Ι  

(1 ) (2)

Fe     H 2 O 2  Fe(III    OH  OH

-

Fe (    H 2 O 2  Fe     HOO   H







(3) (4)

Fe 3 O 4  O 2  4 H  2 e  Fe (     Fe      -

-

      

oo

f

3.4. Performance of the proposed biosensor

(5 )

To evaluate the optimal performance of the proposed biosensor, the immobilization

pr

concentration of HP and the incubation time of S1/L-His were investigated (Fig. S3).

e-

Under the optimized experimental conditions, the quantitative analysis of the specific biosensor between L-His concentrations and the dual peak currents was carried out

Pr

via DPV technique (Fig. 6). The dual peak currents simultaneously increased as the L-His concentration was increased from 1 pmol·L-1 to 500 nmol·L-1. The current

al

changes of dual-signal exhibit good linear logarithmic relationship with L-His

ur n

concentration. The corresponding linear equations are I1 (μA) = 10.56+1.38 lgc (R2=0.992) and I2 (μA) = 7.388+0.956 lgc (R2=0.981) with the detection limits of 0.47 pmol·L-1 and 0.68 pmol·L-1 (S/N=3), respectively. Interestingly, if the dual

Jo

current values are summed (Idual = I1+I2) to use as the response signal for quantitative determination of L-His, a better linear relationship between the total current response and lgc is obtained. The calibration equation is Idual (μA) = 17.94+2.33 lgc (R2=0.996), the limit of detection (LOD, 0.28 pmol·L-1) is much lower than that above obtained by using I1 or I2 as the response signal alone. The present method for the detection of L-His were compared with some previous reports (Table 2), the

proposed biosensor shows a comparable linear range and low LOD. Though a few reported aptasensors have an excellent sensitivity and lower LOD of 0.1 pM in Table2, the substrate which is labeled with the ferrocene redox marker increased its cost and operational complexity [5,26]. For our designed sensing platform, the innovative advantage is the exploration for the dual-signal electrochemical biosensor with the integration of electroactive new materials and label-free modes, it avoids

oo

f

tedious and costly dual-labeling processes and improves the analytical performances. Considering the highly selectivity and sensitivity of the dual-signal biosensor, an

pr

artificial intelligence “AND” logic gate has been designed to facilitate the application of biosensor in electronic device [41,42]. In the logic bio-device, which employs the

e-

digits “0” and “1” as the basic unit of information, the L-His with different

Pr

concentration is used as data input and hairpin DNA as control input, the dualsignal are as dual outputs (Fig. 7). When the control input is inactive or absent “0”,

al

whether the data input is absent “0” or present “1”, the modified electrodes could not

ur n

further bind S1 and capture L-His due to a lack of HP linker, resulting in ineffective output results (0, 0). When the control input is active or present “1”, and the data input L-His is absent “0”, the hairpins DNA cannot be cleaved, thus the outputs dual-

Jo

signal are two low DPV currents (0, 0). When the L-His is present “1”, the DNAzyme-based cyclic amplification system can be triggered, thus the outputs are recovered DPV dual-signal (1, 1). 3.5. Selectivity and stability The selectivity of the proposed biosensor was investigated by replacing L-His (50 nmol·L-1) with similar structural amino acids enantiomers containing L- and D-Phe,

L- and D-Arg, L- and D-Pro (Fig. S4). The current response was no significant increase after incubating other amino acids, indicating that the enantioselectivity between His-dependent DNAyme and the non-cofactor amino acid enantiomers is negligible. The reproducibility of the biosensor was examined by preparing six pairs independent electrodes. The current responses were similar and the RSD was 4.1%.

oo

f

Furthermore, the stability of the biosensor was also examined by recording the

current response after a two-week storage at 4 °C, and the current has no significant

pr

change. These results illustrated that the biosensor has satisfactory reproducibility

e-

and stability. 3.6 Real sample analysis

Pr

To demonstrate the applicability of the constructed biosensor, standard addition method was adopted to determine L-His in human serum samples. The samples were

al

centrifuged to obtain the purified human serum and diluted to 10-10 mol·L-1 before

ur n

use (normal blood serum level 0.31–26.35 µg·mL-1) [5,43]. As shown in Table 3, the recovery of the L-His was in the range of 90.5-102% with the RSD of 1.5-3.8%, which confirmed that the proposed biosensor may find practical application in human

Jo

serum.

4. Conclusion A dual-signal His-dependent DNAzyme chiral biosensor has been constructed based on Fe3O4@rGO cooperated DNAzyme cyclic magnifying electrocatalytic system. Compared with the traditional single-signal-driven detection, the new fashioned dual-signal “on-off-on” electrochemical strategy not only reduces the

background signal and eliminate the invalid interference, but also shows a selective performance in chiral recognition of His enantiomers and a high sensitivity to L-His with a low LOD. Therefore, the development of nanocomposite functionalized dualsignal DNAzyme-based biosensor may offer us a more efficient and accurate detecting platform for chiral assays.

oo

f

Acknowledgments

The authors gratefully acknowledge financial support by the National Natural

Jo

ur n

al

Pr

e-

pr

Science Foundation of China (No. 21272188).

References 1. J. D. Zhang, K. M. KabirMohibul, H. E. Lee, W. A. Donald, Chiral recognition of amino acid enantiomers using high-definition differential ion mobility mass spectrometry, Int. J. Mass Spectrom. 428 (2018) 1-7. 2. S. Einarsson and B. Josefsson, Separation of amino acid enantiomers and chiral amines using precolumn derivatization with (+)-1-(9-Fluorenyl)ethylchloroformate

oo

f

and reversed-phase liquid chromatography, Anal. Cham. 59 (1987) 1191-1195.

3. L. Zhang, G.H Wang, C.Xiong, L.Zheng, J.B He, Y.S Ding, H.B Lua, G.B Zhang,

Biosens. Bioelectron. 105 (2018) 121-128.

e-

electrochemicaltransistor,

pr

K.W. Cho, L.Z. Qiu, Chirality detection of amino acid enantiomers by organic

4. H. Fu, O. Hu, Y. Fan, Y. Hu, J.H. Huang, Z. Wang, Y.B She, Rational design of an

Pr

“on-off-on” fluorescent assay for chiral amino acids based on quantum dots and nanoporphyrin, Sens. Actuators B Chem. 287 (2019) 1-8.

al

5. L.D. Li, Z.B. Chen, H.T. Zhao, L. Guo, Electrochemical real-time detection of L-

2785.

ur n

histidine via self-cleavage of DNAzymes, Biosens. Bioelectron. 26 (2011) 2781-

6. P.M. Kovach and M.E. Meyerhoff, Development and application of a histidine-

Jo

selective biomembrane electrode, Anal. Chem. 54 (1982) 217-220. 7. C. Das, B. Pakhira, A.L. Rheingold, S.K. Chattopadhyay, Turn on ESIPT based chemosensor for histidine: Application in urine analysis and live cell imaging, Inorg. Chim. Acta 482 (2018) 292-298. 8. M. Sönmezler, E. Özgür, H.Yavuz, A. Denizli, Quartz crystal microbalance based histidine sensor, Artif. cells, nanomedicine, Biotechnol. 47 (2019) 221-227.

9. B.B. Prasad, S. Srivastava, K. Tiwari, P.S. Sharma, A new zwitterionic imprinted polymer sensor using ethylenediamine tetraacetic acid and chloranil precursors for the trace analysis of L-histidine, Mater. Sci. Eng. C 29 (2009) 1781-1789. 10. L.J. Zhang, Z. Liu, C. Xiong, L. Zheng, Y.S. Ding, H.B. Lu, G.B. Zhang, L.Z. Qiu, Selective recognition of Histidine enantiomers using novel molecularly imprinted organic transistor sensor. Org. Electron. physics, Mater. Appl. 61 (2018)

oo

f

254-260.

11. J.J. Wang, R.Y. Li, X.H. Long, Z.J. Li, Synthesis of imidazole-functionalized

pr

silicon quantum dots as “off-on” fluorescence probe for highly selective and sensitive

e-

detection of l-histidine, Sens. Actuators B Chem. 237 (2016) 740-748.

12. E. Lipka, A.E. Dascalu, Y. Messara, E. Tsutsqiridze, T. Farkas, B. Chankvetadze,

Pr

Separation of enantiomers of native amino acids with polysaccharide-based chiral columns in supercritical fluid chromatography, J. Chromatogr. A 1585 (2019) 207-

al

212.

ur n

13. R. Kuhn and F. Erni, Chiral recognition and enantiomeric resolution based on host-guest complexation with crown ethers in capillary zone electrophoresis, Anal. Chem. 64 (1992) 2815-2820.

Jo

14. T. Ishigami, K. Suga, and H. Umakoshi, Chiral recognition of L-amino acids on liposomes prepared with L-phospholipid, ACS Appl. Mater. Interfaces 7 (2015) 21065-21072. 15. G.H. Zhang, Y. Yu, M.L. Guo, B.X. Lin, L. Zhang, A sensitive determination of albumin in urine by molecularly imprinted electrochemical biosensor based on dualsignal strategy, Sens. Actuators B Chem. 288 (2019) 564-570.

16. Y.H. Yi, D.P. Zhang, Y.Z. Ma, X.Y. Wu, and G.B. Zhu, Dual-signal electrochemical enantiospecific recognition system via competitive supramolecular host-guest interactions: the case of phenylalanine, Anal. Chem. 91 (2019) 2908-2915. 17. J.Y. Lu, X.X. Zhang, W.T. Huang, Q.Y. Zhu, X.Z. Ding, L.Q. Xia, H.Q. Luo, N.B. Li, Boolean logic tree of label-free dual-signal electrochemical aptasensor system for biosensing, three-state logic computation, and keypad lock security operation, Anal.

oo

f

Chem. 89 (2017) 9734−9741.

18. R.Y. Zhang, Y. Zhang, X.L. Deng, S.G. Sun, Y.C. Li, A novel dual-signal

pr

electrochemical sensor for bisphenol A determination by coupling nanoporous gold

e-

leaf and self-assembled cyclodextrin, Electrochim. Acta. 271 (2018) 417-424. 19. L.J. Bai, R. Yuan, Y.Q. Chai, Y. Zhuo, Y.L. Yuan, Y. Wang, Simultaneous

Pr

electrochemical detection of multiple analytes based on dual signal amplification of single-walled carbon nanotubes and multi-labeled graphene sheets, Biomaterials 33

al

(2012) 1090-1096.

ur n

20. X.Y. Cao, J.F. Xia, H.Z. Liu, F.F. Zhang, Z.H. Wang, L. Lu, A new dual-signalling electrochemical aptasensor with the integration of “signal on/off” and “labeling/labelfree” strategies, Sens. Actuators B Chem. 239 (2017) 166-171.

Jo

21. Y.H. Hu, F. Lin, T. Wu, Y.F. Zhou, Q.S. Li, Y. Shao, and Z.A. Xu, DNA duplex engineering for enantioselective fluorescent sensor, Anal. Chem. 89 (2017) 21812185. 22. L. Challier, F. Mavré, J. Moreau, C. Fave, B. Schöllhorn, D. Marchal, E. Peyrin, V. Noël, B. Limoges, Simple and highly enantioselective electrochemical aptamerbased binding assay for trace detection of chiral compounds, Anal. Chem. 84 (2012)

5415-5420. 23. C.E. McGhee, K.Y. Loh, Y. Lu, DNAzyme sensors for detection of metal ions in the environment and imaging them in living cells, Curr. Opin. Biotechnol. 45 (2017) 191-201. 24. J. Elbaz, B. Shlyahovsky, I. Willner, A DNAzyme cascade for the amplified detection of Pb2+ ions or L-histidine, Chem. Commun. (2008) 1569-1571.

oo

f

25. B.C. Yin, B.C. Ye, W. Tan, W. Hui, C.C. Xie, An allosteric dual-DNAzyme

unimolecular probe for colorimetric detection of copper(II), J. Am. Chem. Soc. 131

pr

(2009) 14624-14625.

e-

26. J. Liang, Z. Chen, L. Guo, L. Li, Electrochemical sensing of L-histidine based on structure-switching DNAzymes and gold nanoparticle-graphene nanosheet

Pr

composites. Chem. Commun. 47 (2011) 5476-5478.

27. Z.B. Chen, J.X. Guo, J. Li and L. Guo, An electrochemical aptasensor based on

al

the amplification of two kinds of gold nanocrystals for the assay of L-histidine with

ur n

picomolar detection limit, Nanotechnology 24 (2013) 295501. 28. R. Hu, T. Fu, X.B. Zhang, R.M. Kong, L.P. Qiu, Y.R. Liu, X.T. Liang, W.H. Tan, G.L. Shen and R.Q. Yu, A proximity-dependent surface hybridization strategy for

Jo

constructing an efficient signal-on electrochemical DNAzyme sensing system, Chem. Commun. 48 (2012) 9507-9509. 29. X.M. Miao, C. Yang, C.H. Leung, D.L. Ma, Application of iridium(III) complex in label-free and non-enzymatic electrochemical detection of hydrogen peroxide based on a novel “on-off -on” switch platform, Sci. Rep. 6 (2016) 25774-25782. 30. M. Zhao, Y. Zhuo, Y.Q. Chai, R. Yuan, Au nanoparticles decorated C60

nanoparticle-based label-free electrochemiluminesence aptasensor via a novel “onoff-on” switch system, Biomaterials 52 (2015) 476-483. 31. L.L. Wang, Y.L. Wen, L.Y. Li, X. Yang, N.Q. Jia, W. Lia, J.R. Meng, M.L. Duan, X.G. Sun, G. Liu, Sensitive and label-free electrochemical lead ion biosensor based on a DNAzyme triggered G-quadruplex/hemin conformation, Biosens. Bioelectron. 115 (2018) 91-96.

oo

f

32. Y.J. Ma, G.H. Xu, F.D. Wei, Y. Cen, X.M. Xu, M.L. Shi, X. Cheng, Y.Y. Chai, M. Sohail, and Q. Hu, Dual-emissive rhodamine B modified carbon dots in metal-

pr

organic framework for enhanced HClO sensing, ACS Appl. Mater. Interfaces 10

e-

(2018) 20801-20805.

33. L.Y. Zhang, X.J. Zhu, H.W. Sun, G.R. Chi, J.X. Xu, Y.L. Sun, Control synthesis

Pr

of magnetic Fe3O4-chitosan nanoparticles under UV irradiation in aqueous system, Curr. Appl. Phys.10 (2010) 828-833.

al

34. X.Y. Li, X. Wang, S.Y. Song, D.P. Liu, and H.J. Zhang, Selectively deposited

ur n

noble metal nanoparticles on Fe3O4/Graphene composites: stable, recyclable, and magnetically separable catalysts, Chem. Eur. J. 18 (2012) 7601-7607. 35. Q.Q. Wang, X.P. Zhang, L. Huang, Z.Q. Zhang, and S.J. Dong, One-Pot synthesis

Jo

of Fe3O4 nanoparticle loaded 3D porous graphene nanocomposites with enhanced nanozyme activity for glucose detection, ACS Appl. Mater. Interfaces 9 (2017) 7465−7471. 36. B. Shi, Y. Su, L. Zhang, M. Huang, X. Li, S. Zhao, Facilely prepared Fe3O4/nitrogen-doped graphene quantum dot hybrids as a robust nonenzymatic catalyst for visual discrimination of phenylenediamine isomers, Nanoscale 8 (2016)

10814-10822. 37. Y.H. Kim, S.J. Park, Roles of nanosized Fe3O4 on supercapacitive properties of carbon nanotubes, Curr. Appl. Phys. 11 (2011) 462-466. 38. Y. He, L. Huang, J.S. Cai, X.M. Zheng, S.G. Sun, Structure and electrochemical performance of nanostructured Fe3O4/carbon nanotube composites as anodes for lithium ion batteries, Electrochim. Acta 55 (2010) 1140-1144.

oo

f

39. S.Z. Liao, H.Z. Ding, Y. Wu, Z.Y. Wu, G.L. Shen, R.Q. Yu, Label-free liquid

crystal biosensor for L-histidine: a DNAzyme-based platform for small molecule

pr

assay, Biosens. Bioelectron. 79 (2016) 650-655.

e-

40. Z.L. Chen, Q. He, M.M. Zhao, C.Y. Lin, F. Luo, Z.Y. Lin, G.N. Chen, A fluorometric histidine biosensor based on the use of a quencher-labeled Cu(II)-

Pr

dependent DNAzyme, Microchim. Acta 184 (2017) 4015-4020. 41. F. Xia, X.L. Zuo, R.Q.Yang, R. J. White, Y.Xiao, D. Kang, X. Gong, R. A. Lubin,

al

A. Vallée-Bélisle, J. D. Yuen, B. Y. B. Hsu, and K. W. Plaxco, Label-free, dual-

ur n

analyte electrochemical biosensors: a new class of molecular-electronic logic gates, J. Am. Chem. Soc. 132 (2010) 8557-8559. 42. Z.J, Li, M.A. Rosenbaum, A. Venkataraman, T.K. Tam, E. Katz and L.T.

Jo

Angenent, Bacteria-based and logic gate: a decision-making and self-powered biosensor, Chem. Commun. 47 (2011) 3060-3062. 43. B.B.Prasad, D. Kumar, R. Madhuri, M.P. Tiwari, Metal ion mediated imprinting for electrochemical enantioselective sensing of l-histidine at trace level, Biosens. Bioelectron. 28 (2011) 117–126.

Biographies Qian Han is a doctor student in the College of Chemistry and

Chemical Engineering of Southwest University, China. She is

interested

in

developing

nanofabrication

and

electrochemical biosensors. Fangjing Mo is a postgraduate student in the College of

Chemical Engineering

of

Southwest

f

and

oo

Chemistry

University, China. She is interested in nanofabrication and

pr

phototelechemistry biosensors.

Jingling Wu is a postgraduate student in the College of

and

Chemical Engineering

e-

Chemistry

of

Southwest

Pr

University, China. She is focused on the nanofabrication and electrochemiluminescence biosensors.

al

Cun Wang is a doctor student in the College of Chemistry and

Chemical Engineering of Southwest University, China. She interested

in

ur n

is

developing electrochemiluminescence

biosensors.

Jo

Min Chen is a doctor student in the College of Chemistry

and Chemical Engineering of Southwest University, China. She is focused on immunoassay and photoelectrochemical biosensors. Yingzi Fu is a professor of chemistry in Southwest University,

China, and she has received doctoral degree in analytical

chemistry from this university in 2006. Her main research interests

are

chiral

electrochemical

and

electrochemiluminescence sensors. Also, she is focused on

Jo

ur n

al

Pr

e-

pr

oo

f

photoelectrochemical biosensors.

Figure Captions

Fig. 1. (A) TEM and (B) HRTEM images of Fe3O4@rGO, (C) SEM image and (D) EDS spectrum of Fe3O4@rGO nanocomposite (inset shows the relevant weight percentage). Fig. 2. Elemental mapping images of (a-e) Fe3O4@rGO, C, N, O, S and Fe. Fig. 3. XPS patterns of (A) the full region of Fe3O4@rGO, and (B-F) the different elements of C1s region, N1s region, O1s region, S2p region, and Fe2p region. Fig. 4. DPV responses of the (a) Fe3O4@rGO modified elelctrode, (b) GO and hemin mixture

oo

f

modified electrode in 20 mmol·L-1 HEPES solution (pH 7.4)

Fig. 5. DPV curves of the MCH/HP/Au/Fe3O4@rGO/GCE with the incubation of 500 nmol·L-1 (a) L-His or (b) D-His in (A) the presence and (B) the absence of 3 mmol·L-1 NADH in HEPES buffer

pr

(pH 7.4). (C) DPV responses of the MCH/HP/Au/GCE for the detection of (a) L-His or (b) D-His. Fig. 6. (A) DPV responses for different concentrations of L-His: (a) 1 pmol·L-1 (b) 10 pmol·L-1 (c)

e-

100 pmol·L-1 (d) 1 nmol·L-1 (e) 10 nmol·L-1 (f) 50 nmol·L-1 and (g) 500 nmol·L-1. (B) Linear

from1 pmol·L-1 to 500 nmol·L-1.

Pr

relationship between the peak currents and the logarithmic concentrations of L-His in the range

al

Fig. 7. Truth table and equivalent circuit of the L-His based “AND” logic gate.

Scheme 1. Schematic illustration of the preparation of self-cleaving DNAzyme biosensor and the

ur n

specific detection principle of His enantiomers based on recycling amplification of G-

Jo

quadruplex/hemin structure.

al

ur n

Jo

f

oo

pr

e-

Pr

Scheme 1

al

ur n

Jo

f

oo

pr

e-

Pr

Fig. 1.

e-

pr

oo

f

Fig. 2.

Jo

ur n

al

Pr

Fig. 3.

Fig. 4.

f oo ur n

al

Pr

e-

pr

Fig. 5.

25 B

15 A

I / A

Jo

9

20 g

6

I / A

12

c

15

b

10

a

a

3

5 0 -0.8 -0.6 -0.4 -0.2 E/V Fig. 6.

0.0

0.2

0.4

-3

-2

-1 0 1 2 log（ c / nmolL-1）

3

al

ur n

Jo

f

oo

pr

e-

Pr

Fig. 7.

Tables

Table 1 Sequences of the oligonucleotides used in this work Oligonucleotides

Sequences

5'CCAAGTGGATCGGGGCTGTGCGGGTAGGAAGTAAGTGAACC3' HP 5'-SH-(CH2)6GGGTTGGGCGGGATGGGTTCACTrAGGCACTTGGGTAGGGCG GGTT-3'a aThe rA in the HP denotes adenosine ribonucleotide at that position, all the others are deoxyribonucleotides.

oo

f

S1

Table 2 Comparison with other methods for L-His detection Linear range (mol·L-1)

Electrochemistry Chemiluminescence Electrochemistry Electrochemistry Liquid crystal biosensor Fluorometry Electrochemistry

1.0× 10-9-1.0×10-5 5.0 × 10-4 - 0.1 1.0× 10-11-1.0×10-5 1.0× 10-6 -5.0×10-3 5.0× 10-8-5.0× 10-7 5.0×10-8 -4.0×10-5 1.0× 10-12-5.0× 10-7

Detection limit (mol·L-1)

Ref.

1.0× 10-13 1.0× 10-13 3.0× 10-7 5.0× 10-8 2.0× 10-8 2.8× 10-13

5 24 26 28 39 40 this work

al

Pr

e-

pr

Detection methods

Table 3 Determination of L-His in health human serum samples via the constructed biosensor Added (nmol·L-1)

Founded (nmol·L-1)

Recovery (%)

RSD (%)

1

100.00

102.0

102.0

3.4

10.00

10.04

100.4

1.5

3

1.00

0.933

93.3

3.8

4

1.00×10-1

0.905×10-1

90.5

2.4

Jo

2

ur n

Sample number