- Email: [email protected]
Engineering Fibronectin-Based Binding Proteins by Yeast Surface Display
CHAPTER FOURTEEN
Engineering Fibronectin-Based Binding Proteins by Yeast Surface Display Tiffany F. Chen*,†, Seymour de Picciotto*,†, Benjamin J. Hackel‡, K. Dane Wittrup*,†,},1
*Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, Massachusetts, USA † Koch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, Cambridge, Massachusetts, USA ‡ Department of Chemical Engineering and Materials Science, University of Minnesota, Minneapolis, Minnesota, USA } Department of Chemical Engineering, Massachusetts Institute of Technology, Cambridge, Massachusetts, USA 1 Corresponding author: e-mail address: [email protected]
Contents 1. Introduction 2. Engineering and Screening Approach of Fn3s 2.1 Yeast media and plates 2.2 Naïve yeast library and culture conditions 2.3 Library screening with magnetic beads 2.4 Fn3 mutagenesis and electroporation 2.5 Library screening with FACS 3. Analysis of Individual Clones 3.1 Identification of individual clones 3.2 Clonal yeast preparation 3.3 Expression of soluble Fn3 4. Summary Acknowledgments References
304 307 309 309 310 313 320 322 322 323 323 324 325 325
Abstract Yeast surface display (YSD) presents proteins on the surface of yeast through interaction of the agglutinin subunits Aga1p and Aga2p. The human 10th type III fibronectin (Fn3) is a small, 10-kDa protein domain that maintains its native fold without disulfide bonds. A YSD library of Fn3s has been engineered with a loop amino acid composition similar to that of human antibody complementarity-determining region heavy chain loop 3
Methods in Enzymology, Volume 523 ISSN 0076-6879 http://dx.doi.org/10.1016/B978-0-12-394292-0.00014-X
#
2013 Elsevier Inc. All rights reserved.
303
304
Tiffany F. Chen et al.
(CDR-H3) and varying loop lengths, which has been shown to improve binding ability. There are many advantages of using these small, stable domains that maintain binding capabilities similar to that of antibodies. Here, we outline a YSD methodology to isolate Fn3 binders to a diverse set of target antigens.
1. INTRODUCTION Yeast surface display (YSD) is a versatile platform for engineering proteins. Display of single-chain variable fragments (scFvs) for affinity maturation of already isolated scFvs or isolation of binders from naı¨ve libraries are probably the most characterized applications of YSD (Boder, RaeeszadehSarmazdeh, & Price, 2012; Boder & Wittrup, 1997; Chao et al., 2006; Colby et al., 2004). Several other proteins including T-cell receptors, cytokines, and green fluorescent protein among others have been engineered using YSD for improved characteristics of binding affinity, expression, stability, etc. (Gai & Wittrup, 2007). Yeast display libraries, which range from 107 to 109 transformants, are typically smaller than phage or ribosome display libraries, 1011 to 1013, but have the advantage of a eukaryotic expression machinery. This allows for isolation of clones that would have been missed using other display systems, which suggests more proper display of eukaryotic proteins (Bowley, Labrijn, Zwick, & Burton, 2007). In the YSD system, the protein to be engineered is fused to the C-terminal end of the Aga2p protein, which forms a covalent linkage to the Aga1p protein on the yeast surface through two disulfide bonds (Fig. 14.1). YSD requires two main components: the yeast, EBY100, and the plasmid, pCT-CON. EBY100 is deficient in the machinery to synthesize the amino acid tryptophan and contains the Aga1 gene in the yeast genome. The pCT-CON plasmid encodes for (a) the gene TRP1, which is important for tryptophan synthesis; (b) the Aga2p protein fused to the protein of interest; and (c) ampicillin resistance, for plasmid production in Escherichia coli (Fig. 14.2). Both Aga1p- and Aga2p-mating proteins are controlled under a galactose-inducible promoter. When yeast are properly transformed with the pCT-CON plasmid, they can grow in selective media deficient in tryptophan, whereas untransformed EBY100 will not propagate. Switching the yeast from glucose-rich media to galactose-rich media will induce proper display of the protein of interest. Engineering binders from scFvs and antibodies have been the standard practice, but over the past decade, the use of alternative scaffolds has been
Engineering Fibronectin-Based Binding Proteins by Yeast Surface Display
305
Avidin
Ag
3
c-My
c
HA
Fn
Aga2p S
S
S
S
Aga1p
Yeast surface
Figure 14.1 Schematic of the Fn3 scaffold displayed on the surface of yeast. The Fn3 is a C-terminal fusion to the Aga2p protein and flanked by two detection tags: hemagglutinin (HA) epitope tag (YPYDVPDYA) at the N-terminus and c-Myc epitope (EQKLISEEDL) at the C-terminus. The Aga2p protein forms two disulfide bonds with the Aga1p protein, which is anchored to the cell wall via b-glucan linkage. Biotinylated antigen is detected with a fluorophore-conjugated streptavidin. Full display of Fn3 is detected with a primary chicken anti-c-Myc antibody and a fluorophore-conjugated secondary antibody specific for chicken antibody.
an emerging field in protein engineering (Binz, Amstutz, & Pluckthun, 2005; Skerra, 2007). Antibodies (150 kDa) are quite complex protein structures comprised of several protein domains that require disulfide bonds and glycosylation for proper function. Alternative scaffolds such as anticalins, affibodies, darpins, and fibronectin domains are small proteins that have certain surface regions that can be highly diversified to bind to a variety of proteins (Koide & Koide, 2007; Lo¨fblom et al., 2010; Skerra, 2008; Stumpp, Binz, & Amstutz, 2008). The advantage of alternative scaffolds lies in the fact that they can be quite small, single domains yet fairly stable while lacking disulfide bonds. The alternative scaffold most developed with the YSD platform is the 10th type III domain of the fibronectin (Fn3) protein; the primary domain involved in integrin binding (Hackel, Kapila, & Wittrup, 2008; Hackel & Wittrup, 2010; Lipovsek et al., 2007). This small,
306
Tiffany F. Chen et al.
Gal1-10
Start
ColE1 origin Aga2
(G4S)3 Linker
HA tag, NheI Insert
BamhI, c-myc tag, Stop MFalpha1 terminator
pCT-CON 6934 bp
bla(ampR)
f1(+) origin CEN6 ARSH4 TRP1
Figure 14.2 Vector map of pCT-CON. The Fn3 gene would be in the place of the “insert” label on the plasmid.
approximately 10 kDa, cysteine-free yet stable domain is composed of two b-sheets comprising seven b-strands connected by three solvent-exposed loops on both sides, which resemble antibody CDRs (Fig. 14.3). A library of Fn3s was previously generated that had varying loop lengths compared to that of wild-type Fn3, with an amino acid repertoire similar to that of antibody CDR-H3. This library known as G4 is the naı¨ve library used for our selection processes. The library diversity comprises 2.5 108 transformants with 60% of them being full-length Fn3s, yielding approximately 1.5 108 clones (Hackel, Ackerman, Howland, & Wittrup, 2010). The current library size undersamples the immense sequence space created by the loop length and amino acid diversities. To compensate for this, diversity is constantly introduced into enriched sublibraries by several mechanisms: high mutagenesis through error-prone PCR focused on the three loop areas (BC, DE, FG loops), low mutagenesis by error-prone PCR for the entire Fn3 gene to introduce framework mutations, and shuffling of the loops during homologous recombination (Hackel et al., 2008). This library has yielded several binders to a variety of target proteins ranging from epidermal growth factor receptor (EGFR) (Hackel et al., 2010), immunoglobulins of various species (Hackel & Wittrup, 2010), carcinoembryonic antigen (CEA) (Pirie, Hackel, Rosenblum, & Wittrup, 2011), to human Fc gamma receptors (Hackel et al., 2010). Fn3 clones with high display levels correlate with increased stability as tested with circular
Engineering Fibronectin-Based Binding Proteins by Yeast Surface Display
307
Figure 14.3 Fibronectin domain. The solution structure (PDB ID: 1TTG) of Fn3 is presented with 90 rotations. The wild-type sequence is indicated. The BC (red), DE (green), and FG (blue) loops are highlighted.
dichroism thermal denaturation (Hackel & Wittrup, 2010; Hackel et al., 2010). Fusions of the EGFR binders have been shown to downregulate EGFR expression on various cancer cell lines in vitro (Hackel, Neil, White, & Wittrup, 2012) and inhibit tumor growth in vivo when fused as a triepitopic antibody (Spangler, Manzari, Rosalia, Chen, & Wittrup, 2012). Fusions of CEA binders to gelonin have served as potent immunotoxins in vitro (Pirie et al., 2011). Ongoing work in our laboratory demonstrates the versatility of this library in producing Fn3 binders to a large panel of EGFR ligands, perfringolysin O, DEC-205, among many other targets.
2. ENGINEERING AND SCREENING APPROACH OF Fn3s The following outlines a detailed methodology of Fn3 binder selection using YSD (Fig. 14.4). The naı¨ve G4 library is first screened using magnetic bead selection. The avidity of interaction between the yeast and
308
Tiffany F. Chen et al.
Naive Fn3 Library
Enrich binders by magnetic bead selection
Is binding detectable by FACS ?
No
Construct random mutagenesis library based on selected clones
Yes Enrich magnetic bead sorted cell population using flow cytometry
Begin here to affinity mature a given clone
Construct random mutagenesis library based on flow cytometry-selected clones Repeat until desired properties are achieved Select for improved clones from mutagenesis library using flow cytometry
Characterize individual clones by sequencing and titration
Fn3 to antigen of interest with desired properties
Figure 14.4 Flow chart for the methodology of engineering Fn3s from the naïve G4 library. Fn3 binders are first enriched using magnetic bead selection and then sorted using FACS.
multivalent antigen-coated beads allows for the enrichment of weak affinity binders (Ackerman et al., 2009). After two rounds of magnetic bead enrichment, the Fn3 sublibrary is subjected to mutagenesis to introduce diversity into the population. This new library is screened again using magnetic beads. Once binding of antigen is detectable on flow cytometry, sorting is switched
Engineering Fibronectin-Based Binding Proteins by Yeast Surface Display
309
to fluorescence-activated cell sorting (FACS). The selection process of the Fn3 binders remains the same with two rounds of enrichment followed by mutagenesis. This process of directed evolution has resulted in engineering Fn3 binders with picomolar affinity to antigens of interest (Hackel et al., 2008). The G4 library, EBY100, and associated pCT-CON vectors are available upon request.
2.1. Yeast media and plates 1. SD-CAA: 20 g/L D-glucose, 6.7 g/L yeast nitrogen base, 5 g/L casamino acids, 7.4 g/L citric acid monohydrate, 10.4 g/L sodium citrate, pH 4.5 2. SD-CAA plates: 20 g/L D-glucose, 6.7 g/L yeast nitrogen base, 5 g/L casamino acids, 5.4 g/L Na2HPO4, 8.6 g/L NaH2PO4H2O, 16 g/L agar, 182 g/L sorbitol 3. SG-CAA: 18 g/L galactose, 2 g/L D-glucose, 6.7 g/L yeast nitrogen base, 5 g/L casamino acids, 5.4 g/L Na2HPO4, 8.6 g/L NaH2PO4H2O, pH 6.0 4. YPD: 20 g/L dextrose, 20 g/L peptone, 10 g/L yeast extract 5. YPD plates: 20 g/L dextrose, 20 g/L peptone, 10 g/L yeast extract, 16 g/L agar
2.2. Naïve yeast library and culture conditions 1. To prepare the G4 library, thaw a frozen aliquot with 10 diversity (2.5 109 cells) into 1 L of SD-CAA minimal media. Grow at 30 C with shaking at 250 rpm overnight to a typical OD600nm of 6–8 (OD600nm ¼ 1 is 1 107 cells/ml). Optional: If desired, cells can be passaged to a 1-L culture of fresh SD-CAA media to decrease the percentage of dead cells. Plating serial dilutions of the G4 library on SD-CAA plates can also test for viability. Frozen aliquots of the G4 library can be prepared by freezing 10 diversity in 15% glycerol in SD-CAA at 80 C for long-term storage. 2. Inducing cells for display requires switching the media from glucose- to galactose-rich media. Pellet 30 diversity (7.5 109 cells) of the G4 library at 2500 g for 5 min and resuspend the cells in 1 L of SGCAA induction media for 12–24 h at 20 C. Optimal induction occurs when cells are induced during exponential growth (OD600nm ¼ 2–7). Optional: Cells can be induced at 30 C, but cells will continue to grow, whereas induction at 20 C should allow for less than one doubling from
310
Tiffany F. Chen et al.
the initial OD600nm during the incubation. After induction, cells can be used immediately or stored at 4 C.
2.3. Library screening with magnetic beads Initial library screening is performed using Biotin Binder Dynabeads (Invitrogen). The multivalency of the Dynabeads (5 106 biotin-binding sites per bead) and the yeast (105 fibronectin per cell) allows for the isolation of weak affinity Fn3 binders through avidity interaction. The naı¨ve library is first depleted of bare bead/streptavidin binders and then enriched for binders to the antigen of interest. Antigens of interest must be biotinylated before sorting. 2.3.1 Bead preparation 1. For the initial sort from the naı¨ve library, two batches should be prepared to ensure adequate exposure of cells to the antigen of interest. Prepare 6.7–33 pmoles of biotinylated antigen for 10 mL of Dynabeads (4 105 beads/mL) in 100 mL of PBSA (1 phosphate-buffered saline, 0.1% bovine serum albumin) in 2-mL microcentrifuge tubes. Antigen at 6.7 pmoles is sufficient for enrichment, but if the antigen is not limited, then 33 pmoles should be used. 2. Tubes should be incubated at 4 C, rotating for at least 1 h. 3. Directly before the addition of cells, beads must be washed once with the addition of 1 mL of PBSA. Place the tube on a magnet for 2–5 min before removing the supernatant. After removal of supernatant, cells can be added to beads. This step is to remove any free antigen. 2.3.2 Initial cell sorting 1. Measure the cell density and pellet 15 diversity of the induced G4 library (3.75 109 cells) for sorting. 2. Pellet cells at 3000 g for 5 min and wash the cells with 1 mL of PBSA, then split into two aliquots in two 2-mL microcentrifuge tubes. Pellet cells at high speed (12,000 g) for 1 min and resuspend cells in 1 mL PBSA. 3. Negative sort: Add 10 mL of bare beads in each tube and incubate cells and beads at 4 C for at least 2 h rotating (Ackerman et al., 2009). This step serves as a negative selection by depleting yeast that display Fn3 binders to the bare beads/streptavidin. The initial library should not have many bare bead/streptavidin binders, so one depletion should be sufficient, but subsequent sorts should include at least two negative bare bead
Engineering Fibronectin-Based Binding Proteins by Yeast Surface Display
311
depletions to prevent the isolation of bare bead/streptavidin binders. If your antigen of interest possesses a tag or fusion partner, we recommend including this tag or fusion partner in your negative selection process. Prepare the beads as recommended in the previous subsection using a biotinylated tag-only construct. 4. Positive sort: After 2 h of incubation at 4 C, place the cells with beads on the magnet and transfer the unbound cells to the tubes with the washed, antigen-coated beads. Incubate at 4 C for at least 2 h rotating. 5. Wash the negative sort with 1 mL PBSA on magnet, remove supernatant, and resuspend beads and cells in 5 mL of fresh SD-CAA. Store at 4 C until all sorts are finished, only then grow up cultures at 30 C. 6. Wash the positive sort with 1 mL PBSA on magnet, remove supernatant, and resuspend beads and cells in 5 mL of fresh SD-CAA. Perform serial dilutions of negative and positive sort cultures and plate on SD-CAA plates to determine and compare numbers of isolated yeast. 2.3.3 Cell growth and induction 1. Grow up cells at 30 C with shaking at 250 rpm for at least 16 h. 2. Pellet culture and remove 4 mL of media. Resuspend cells and beads in remaining 1 mL of culture and transfer to 2-mL microcentrifuge tube. Place on magnet to remove the beads. Recover unbound cells and transfer back into original test tube. 3. Pellet at least 10 diversity of cells at high speed for 1 min. Remove supernatant and resuspend cells in 5 mL of fresh SG-CAA media. Yeast double approximately every 4 h in SD-CAA minimal media; therefore, back-calculations of the hours of growth can determine volume of cells needed for 10 diversity. 4. Incubate at 20 C at 250 rpm for 8–24 h for the induction of protein expression. 2.3.4 Intermediate cell sorting The newly induced population of yeast should be enriched in antigen binders and depleted of bare bead/streptavidin binders. To ensure that specific binders are isolated as opposed to nonspecific yeast, the stringency of negative sorts and washes is increased. 1. Measure the cell density and pellet 20 diversity of the induced population for sorting. 2. Wash the cells with 1 mL of PBSA, pellet the cells at high speed (12,000 g) for 1 min, and resuspend cells in 1 mL PBSA.
312
Tiffany F. Chen et al.
3. Negative sort 1: Add 10 mL of bare beads in the tube and incubate cells and beads at 4 C for at least 2 h rotating. 4. Negative sort 2: After 2 h of incubation at 4 C, place the cells with beads on the magnet and transfer the unbound cells to a new 2-mL microcentrifuge tube. Add 10 mL of bare beads and incubate at 4 C for at least 2 h rotating. Optional: Depending on the desired stringency and the generation of sort, negative sorts can be increased in number to prevent the isolation of bare bead/streptavidin binders. Negative sorts against nontarget molecules (such as epitope tags, fusion partners, or other undesired binding partners) can also be included. 5. Wash the negative sort 1 beads with 1 mL PBSA on the magnet and remove supernatant; repeat wash. Resuspend beads and cells in 5 mL of fresh SD-CAA. Store at 4 C until all sorts are finished and only then grow up cultures at 30 C. 6. Positive sort: After 2 h of incubation at 4 C, place the cells with beads on the magnet and transfer the unbound cells to the tubes with the washed antigen-coated beads. Incubate at 4 C for at least 2 h rotating. Repeat step 5 for negative sort 2. 7. Wash the positive sort with 1 mL PBSA on magnet, remove supernatant, and resuspend beads and cells in 5 mL of fresh SD-CAA. Perform serial dilutions of negative and positive sort cultures and plate on SD-CAA plates to determine and compare numbers of isolated yeast. Optional: Depending on the desired stringency and the generation of sort, the number of washes can be increased to ensure the isolation of specific binders. The results from the serial dilutions on a plate are typically a good indication of whether the stringency should be increased. A good ratio of positive sort to negative sort cells is 10:1. Alternatively or additionally, incubations can be performed at room temperature. 8. Repeat Section 2.3.3 cell growth and induction protocol. 2.3.5 FACS of fully displaying yeast After two rounds of magnetic-bead enrichment, sort for yeast displaying full-length Fn3 clones by isolating yeast that stain double positive for the N-terminal HA epitope tag and the C-terminal c-myc epitope tag. In truncations or frameshift mutants, the c-myc tag detection would be lost and, in the case of plasmid loss, the HA tag would not be detected. This sort ensures that all clones are full-length Fn3 clones, which are then used for mutagenesis.
Engineering Fibronectin-Based Binding Proteins by Yeast Surface Display
313
1. Pellet at least 10 library diversity or 1 107 cells and wash with 1 mL of PBSA. 2. Primary staining: Resuspend cells in 50 mL of PBSA and add 0.5 mL of mouse anti-HA as a 1:100 dilution (16B12, Covance) and 0.5 mL of chicken anti-c-myc (Invitrogen or Gallus Immunotech) as a 1:100 dilution. Incubate cells with the primary antibody at room temperature for at least 20 min. When labeling with primaries, two concerns must be taken into account: stoichiometric excess of the primary, and the concentration, which determines incubation periods. Note: Yeasts typically display 1 105 Fn3s per cell. 3. Wash the cells with 1 mL of PBSA, pellet cells at high speed for 1 min, and remove supernatant. This step removes any unbound primary antibodies. 4. Secondary staining: Resuspend cells in 50 mL of PBSA and add 0.5 mL goat anti-mouse AlexaFluor® 488 (Invitrogen) and 0.5 mL goat antichicken AlexaFluor® 647 (Invitrogen). Incubate on ice for at least 15 min. Other fluorophore combinations can be used, but fluorophores that do not require compensation in flow cytometry are preferred (Shapiro, 2005). 5. Wash the cells with 1 mL of PBSA, pellet cells at high speed for 1 min, and remove supernatant. This step removes unbound secondary antibodies. 6. FACS: Resuspend cells in the desired sorting volume (0.5 mL) of PBSA and collect double-positive population. Collect cells in a small volume (2 mL) of SD-CAA media. Rinse the sides of the tube with 3 mL of SD-CAA media to collect any additional cells. Grow up cells at 30 C with shaking at 250 rpm for at least 16 h. If the volume increases significantly after the sort, dilute cells in excess SD-CAA media, otherwise the yeast will flocculate. Optional: In the case of increased volume of after sorting, cells can be rinsed off the sides of the tube and then gently pelleted at 2500 g for 5 min. Remove as much media as possible and add 5 mL of fresh SD-CAA media.
2.4. Fn3 mutagenesis and electroporation In order to reintroduce diversity into the enriched population of Fn3 binders, plasmids from yeast will be isolated and mutagenized. This will introduce clones with improved binding to the target of interest.
314
Tiffany F. Chen et al.
2.4.1 Zymoprep yeast Extract the plasmid DNA from yeast using the Zymoprep™ Yeast Plasmid Miniprep II (Zymo Research). The following protocol is adapted from the original Zymo Research protocol. 1. Measure the cell density and pellet 1 108 cells in a microcentrifuge tube at 300 g for 1 min. Remove the supernatant. 2. Add 200 mL of Solution 1 to the pellet and resuspend the pellet by gentle pipetting. Add 3 mL of Zymolyase, mix, and incubate at 37 C for 15–60 min. For cells in logarithmic growth (OD600nm ¼ 2–7), 15 min of incubation at 37 C should be sufficient. For cells in the stationary phase, they need to be incubated for at least 30 min. 3. Add 200 mL of Solution 2 with gentle mixing. Then, add 400 mL of Solution 3 and mix gently. Pellet debris at high speed (12,000 g) for 8 min. Remove supernatant and transfer to a new microcentrifuge tube. Pellet remaining debris at high speed (12,000 g) for 3–5 min (depending on the amount of debris remaining). 4. Transfer the clear supernatant to a miniprep column (Epoch or Qiagen) and not the Zymo column. Centrifuge the column at high speed (12,000 g) for 1 min and discard the flow through. 5. Wash column using 550 mL of miniprep wash buffer (Qiagen buffer PE or Epoch WS). Spin the column at high speed for another 1 min and discard the flow through. Spin column again to remove any excess wash buffer. 6. Place column over new microcentrifuge tube and elute DNA with 40 mL of elution buffer (Qiagen or Epoch buffer EB). Spin at high speed for 1 min. The expected yield is approximately five plasmids from each cell. With 1 108 cells, there should be approximately 1.25 107 plasmids per microliter. 2.4.2 Mutagenesis of Fn3 through error-prone PCR Plasmids containing Fn3s will be mutagenized using error-prone PCR with two nucleotide analogues: 8-oxo-20 -deoxyguanosine-50 -triphosphate and 20 -deoxy-p-nucleoside-50 -triphosphate (8-oxo-dGTP and dPTP). Mutation rates can be adjusted by varying the concentration of nucleotide analogues and the number of PCR cycles. Mutations will be introduced using two methods: low levels of mutagenesis to the entire gene to introduce framework mutations and high levels of mutagenesis at the loop regions to improve binding.
315
Engineering Fibronectin-Based Binding Proteins by Yeast Surface Display
1. Error-prone PCR preparation Primers Sample
Sequence
Gene
50 -Primer 30 -Primer 50 -Primer 30 -Primer 50 -Primer 30 -Primer 50 -Primer 30 -Primer
BC loop DE loop FG loop
cgacgattgaaggtagatacccatacgacgttccagactacgctctgcag atctcgagctattacaagtcctcttcagaaataagcttttgttcggatcc gggacctggaagttgttgctgcgacccccaccagcctactgatcagctgg tgaactcctggacagggctatttcctcctgtttctccgtaagtgatcctgtaata caggatcacttacggagaaacaggaggaaatagccctgtccaggagttcactgtg gcatacacagtgatggtataatcaactccaggtttaaggccgctgatggtagc accatcagcggccttaaacctggagttgattataccatcactgtgtatgctgtc gatccctgggatggtttgtcaatttctgttcggtaattaatggaaattgg
PCR in 50 mL volumes Volume
Component
Gene reaction (one reaction total) 5 mL 10 ThermoPol buffer 2.5 mL 50 -Primer (10 mM) 2.5 mL 30 -Primer (10 mM) 1 mL dNTPs (10 mM each) 8 mL Zymoprepped DNA 5 mL 8-oxo-dGTP (20 mM) 5 mL dPTP (20 mM) 20.5 mL ddH2O 0.5 mL Taq DNA polymerase Loop reactions (three reactions total) 5 mL 10 ThermoPol buffer 2.5 mL 50 primer (10 mM) 2.5 mL 30 primer (10 mM) 1 mL dNTPs (10 mM each) 8 mL Zymoprepped DNA 5 mL 8-oxo-dGTP (200 mM) 5 mL dPTP (200 mM) 20.5 mL ddH2O 0.5 mL Taq DNA polymerase
Final concentration
1 ThermoPol buffer 0.5 mM 50 -primer 0.5 mM 30 -primer 200 mM dNTPs each 108 plasmids 2 mM 8-oxo-dGTP 2 mL dPTP 2.5 units 1 ThermoPol buffer 0.5 mM 50 -primer 0.5 mM 30 -primer 200 mM dNTPs each 108 plasmids 20 mM 8-oxo-dGTP 20 mL dPTP 2.5 units
2. Thermal cycle setup Step
Temperature ( C)
Time
Cycle
Initialization
94
3 min
1
Denaturation Annealing Extension
94 60 72
45 s 30 s 90 s
2–16
Final extension
72
10 min
17
316
Tiffany F. Chen et al.
Mutated DNA can be used immediately or stored at 4 C. 3. Add 10 mL of 6 DNA loading buffer to mutated DNA and run half of the reaction (30 mL) on a 1.5% agarose gel precast with GelGreen™ (Biotium, Inc.). Save the remaining half of mutated DNA at 4 C for possible future use in the case that more DNA is needed. Run samples with ladder at 100 V for approximately 45–60 min. The gene PCR product should be visible, but loop PCR products may be hard to differentiate from primers. Excise gene band, and to ensure proper recovery of loops, excise entire loop bands including primers (Fig. 14.5). PCR products should be at 460 18, 139 6, 126 6, 179 6, base pairs for the gene, BC loop, DE loop, and FG loop bands. 4. Purify the PCR products individually (gene, BC loop, DE loop, and FG loop) using the Qiaquick Gel Extraction Kit (Qiagen) according to the manufacturer’s instructions. Elute with 40 mL EB buffer. 2.4.3 Amplification of mutagenized Fn3 The amplification step of the mutagenized Fn3 is to generate sufficient quantities of DNA insert for yeast transformation. This step will amplify the loop regions and not the primers that were excised with the loop regions. 100bp Gene BC DE Ladder Loop Loop
FG Loop
500 400 300 200 100
Figure 14.5 Gel of error-prone PCR products of the gene, BC loop, DE loop, and FG loop. The gene band should be at approximately 460 bp and the loops will run at approximately 120–190 bp. Primer bands run lower than the loop products, but if no differentiation can be detected, purify the entire primer and loop band.
317
Engineering Fibronectin-Based Binding Proteins by Yeast Surface Display
1. Amplification PCR preparation Primers Sample
Sequence
Gene
50 -Primer 30 -Primer 50 -Primer 30 -Primer 50 -Primer 30 -Primer 50 -Primer 30 -Primer
BC loop DE loop FG loop
cgacgattgaaggtagatacccatacg atctcgagctattacaagtcctcttc gggacctggaagttgttgctgcg tgaactcctggacagggctatttcc caggatcacttacggagaaacaggagg gcatacacagtgatggtataatcaac accatcagcggccttaaacctggag gatccctgggatggtttgtcaatttc
Amplification primers are shorter versions of the error-prone PCR primers. Larger quantities of these primers are used; therefore, the shorter primers are more economically favorable. PCR in 200 mL volumes Volume
Component
Final concentration
20 mL 20 mL 20 mL 4 mL 8 mL 126 mL 2 mL
10 ThermoPol buffer 50 -Primer (10 mM) 30 -Primer (10 mM) dNTPs (10 mM each) Extracted mutated DNA ddH2O Taq DNA polymerase
1 ThermoPol buffer 1 mM 50 -primer 1 mM 30 -primer 200 mM dNTPs each 2.5 units
Split reactions into two 100 mL aliquots per sample for a total of eight tubes. 2. Thermal cycle setup Step
Temperature ( C)
Time
Cycle
Initialization Denaturation Annealing Extension Final extension
94 94 60 72 72
3 min 45 s 30 s 90 s 10 min
1 2–31
32
Amplified DNA can be used immediately or stored at 4 C. 3. Concentrate the amplified PCR products by ethanol precipitation. Combine the gene amplification products into a 1.5-mL microcentrifuge tube and combine all of the loop amplifications into a 2-mL microcentrifuge tube. Optional: 2 mL of pellet paint coprecipitant®
318
Tiffany F. Chen et al.
(Novagen, EMD Millipore) can be used to visualize the DNA pellet. Adjust the pH by adding 10% volume of 3 M sodium acetate to the PCR amplifications: 20 mL for the gene amplification and 60 mL for the loop amplifications. Add at least 2 volume of 100% ethanol to each tube: 400 mL for gene amplification and 1200 mL for loops. Incubate at room temperature for 2 min and then spin at high speed (12,000 g) for 5 min to pellet the DNA. Remove the supernatant and add 500 mL of 70% ethanol. Mix/vortex briefly and pellet again at high speed for 5 min. Remove the supernatant and add 500 mL of 100% ethanol. Mix/ vortex briefly and pellet again at high speed for 5 min. Remove supernatant and air dry over night or for 10 min on a heat block at 48 C. Dissolve dried pellet in 1 mL of ddH2O in preparation for electroporation. 2.4.4 Preparation of vectors Since there are two different amplification products: gene and loops, two different vectors that are variants of pCT-CON must be prepared for the electroporation. The pCT-Fn3-Gene vector has a sequence consisting of the PstI, NdeI, and BamHI sites separated by spacers replacing the DNA between the HA and c-myc tags. The pCT-Fn3-Loop vector contains the Fn3 gene except the DNA between the BC loop and FG loop is replaced by NcoI, SmaI, and NdeI cut sites separated by spacers. The vectors are digested at three sites to ensure that the linearized vectors will only recircularize in the presence of insert. Vectors are available upon request. 1. To linearize the pCT-Fn3-Gene vector, digest with NdeI as specified by the manufacture’s protocol at 37 C overnight. To linearize the pCTFn3-Loop vector, digest with SmaI according to the manufacture’s protocol at 25 C overnight. 2. Adjust buffer volumes for both vectors. Digest pCT-Fn3-Gene with PstI and BamHI following the manufacture’s protocol at 37 C overnight. Digest pCT-Fn3-Loop with NcoI and NdeI at 37 C overnight. 3. Concentrate digested vectors using ethanol precipitation as previously described (step 3 of Section 2.4.3). Dissolve vectors in ddH2O at a concentration of 2 mg/mL. Store at 4 C for short term or 20 C for long term. 2.4.5 Electroporation protocol Linearized vector and inserts will be introduced into the yeast through electroporation transformation. Yeast will naturally perform homologous recombination to recircularize linearized vector and inserts. The following
Engineering Fibronectin-Based Binding Proteins by Yeast Surface Display
319
electroporation protocol has been optimized for the Bio-Rad Gene Pulser Xcell (Bio-Rad) electroporation instrument. The electroporation protocol for the Bio-Rad Gene Pulser (Bio-Rad) can be performed as previously described (Chao et al., 2006). 1. An EBY100 starter culture in 5 mL of YPD can be prepared in the following ways: inoculate with a EBY100 colony from a freshly streaked YPD plate, a 1:50 dilution of EBY100 from a culture stored at 4 C, or a streak from an EBY100 frozen stock. Grow culture overnight at 30 C with shaking at 250 rpm. Note: EBY100 doubles every 1.5–2 h in YPD. 2. Inoculate 50 mL of YPD at OD600nm ¼ 0.2 and grow at 30 C with shaking at 250 rpm until OD600nm ¼ 1.3–1.5 (4–6 h). The culture volume varies depending on the number of transformations to be performed; usually, 50 mL is sufficient for two electroporations (one for gene and another for loops). 3. Pellet cells in 50-mL conical tubes at 3000 g for 3 min and remove supernatant. 4. Resuspend cells in half of the original YPD volume (25 mL) with 100 mM lithium acetate. Make fresh 1 M dithiothreitol, sterile filter, and add to cells to a final concentration of 10 mM. Incubate cells at 30 C with shaking for 10 min. 5. Pellet cells at 3000 g for 3min and remove supernatant. Place cells on ice; all of the following steps will be performed on ice and with chilled reagents. 6. Resuspend cells in chilled sterile ddH2O using half of the original volume (25 mL). Pellet cells at 3000 g for 3 min and remove supernatant. 7. Resuspend cells in 250 mL of chilled sterile ddH2O. The total volume will be approximately 500 mL of cells for each 50 mL original culture volume. 8. In parallel with cell preparation, add 4 mg of vector (2 mL) to amplified inserts (digested gene vector to gene inserts and digested loop vector to loop inserts). Chill two 2 mm electroporation cuvettes on ice. 9. Mix 250 mL of cells with the gene preparation and the remaining 250 mL of cells with the loop preparation. Transfer mixtures to prechilled electroporation cuvettes and keep on ice until electroporation. 10. Use the square wave protocol on the Bio-Rad Gene Pulser Xcell. Perform a single pulse at 500 V with a 15-ms pulse duration. Typical “Droop” readings reported by the machine are within 5–6%.
320
Tiffany F. Chen et al.
11. Rescue cells with 1 mL of YPD and transfer cells to a 14-mL polypropylene round bottom tube (Falcon). Rinse the cuvette with an additional 1 mL of YPD and transfer cells to the same tube. Incubate cells at 30 C without shaking for 1 h. 12. Plate dilutions of cells on SD-CAA plates to determine the number of transformants of the new library. Grow plates at 30 C for 2–3 days. This protocol typically yields 107–108 transformants. 13. Pellet the remaining cells at 3000 g for 3 min. Combine both gene and loop libraries in a single culture of 500 mL SD-CAA and grow at 30 C with shaking at 250 rpm overnight. Optional: The library can be passaged to decrease the number of untransformed cells (Optional: Step 1 of Section 2.2). 14. Induce cells at 10 diversity with 500 mL of SG-CAA at 20 C with shaking at 250 rpm for 8–24 h.
2.5. Library screening with FACS After a few rounds of magnetic-bead enrichment, FACS can be used to quantitatively screen yeast-displayed Fn3 libraries. Libraries will be labeled for display through c-myc tag detection and binding with soluble antigen. Using this double labeling, antigen binding can be normalized by display levels. 2.5.1 Labeling protocol for FACS 1. Pellet 10 diversity of induced yeast in a 1.5-mL microcentrifuge tube at max speed for 1 min and remove supernatant. Wash with 1 mL PBSA by pelleting again and remove the supernatant. 2. Resuspend cells in PBSA. Volumes vary depending on number of cells. Typically, a labeling volume of 50 mL is used for 1 106–1 107 cells and a volume of 0.5–1 mL is used for 1 108 cells. 3. Primary labeling: Add anti-c-myc antibody (chicken anti-c-myc (Invitrogen or Gallus Immunotech) or mouse anti-c-myc (9E10, Covance)) to at least 20 nM (3 mg/L) final concentration. Add desired amount of soluble biotinylated antigen. Concentrations will vary depending on the binding affinity of the entire population. Typical labeling concentrations when first switching from magnetic bead sorting to FACS range from 300 to 500 nM. The optimal concentration of labeling for subsequent sorts can be calculated as previously described (Boder & Wittrup, 1998). Note: Always make sure primaries are in stoichiometric excess (10-fold) of Fn3. At lower labeling concentrations, volumes will need to be increased to maintain excess ligand.
Engineering Fibronectin-Based Binding Proteins by Yeast Surface Display
321
4. Incubate at room temperature or 37 C until equilibrium binding has been reached; approximately 30 min should suffice for labeling at 20 nM or higher. Note: Time to half of equilibrium can be calculated by Eq. (14.1), where kon is the rate of association (typical protein–protein kon is 1 105M1s1) and koff is the rate of dissociation, which can be calculated from an approximation of the equilibrium constant, Kd, Eq. (14.2). [L]o is the initial ligand concentration operating under the assumption of no ligand depletion. Five half-lives is enough to reach 97% of equilibrium. ln 2 kon ½Lo þ koff koff Kd ¼ kon
t1=2 ¼
½14:1 ½14:2
5. Secondary labeling: Wash cells with 1 mL PBSA, pellet, and remove supernatant. Subsequent steps are performed on ice. Resuspend in desired volume of chilled PBSA and label with secondaries at 50 nM or higher. Typical secondaries used are anti-chicken or anti-mouse Alexa Fluor® 488 or Alexa Fluor® 647 conjugates (Invitrogen) for detection of the anti-c-myc antibody. Streptavidin Alexa Fluor® 488 or Alexa Fluor® 647 conjugates (Invitrogen) or anti-biotin PE conjugate (ebioscience) are used for biotinylated antigen detection. Incubate for approximately 15–30 min on ice. Once again, make sure secondaries are in stoichiometric excess of Fn3. Time to equilibrium can be calculated as mentioned previously. 6. Wash cells with 1 mL PBSA, pellet, and remove supernatant. Right before sorting, resuspend cells in PBSA at a concentration of 1 108cells/mL and transfer to proper FACS tubes. When sorting for high affinity binders with subnanomolar binding affinities, dissociation competition can be used by first labeling with a stoichiometric excess of biotinylated antigen, washing, and then competing with nonlabeled unbiotinylated antigen. 2.5.2 Sorting for improved clones 1. In initial sorts, if no strong double-positive diagonal is detected, collect all cells that show detectable binding to the antigen of interest, as shown in Fig. 14.6A. This gate should cover the top 1–3% of displaying cells. 2. In subsequent sorts, in a diagonal sort window, collect the top 0.1–1% of cells that show strong display and binding as shown in Fig. 14.6B.
322
Tiffany F. Chen et al.
A
Generation x.0 – 200 nM
B
Generation x.1 – 50 nM 0.1–1%
Binding
Binding
1–3%
Display
Display
Figure 14.6 Representative FACS plots of sorting for improved clones. (A) In initial FACS sorts, collect the top 1–3% of displaying cells that show detectable binding, (B) in subsequent FACS sorts, collection gates should be more stringent (top 0.1–1% of population) to isolate binders with high affinity to the antigen of interest.
3. Collect cells in 2 mL of SD-CAA and follow the same procedure as outlined in step 6 of Section 2.3.5. Grow cells at 30 C with shaking at 250 rpm overnight. 4. Induce cells with at least 10 diversity starting at an initial OD600nm of 1. Incubate cells at 20 C with shaking at 250 rpm for 8–24 h. Induction time can be decreased to increase stringency in sorting by having less Fn3 displayed on the surface of yeast.
3. ANALYSIS OF INDIVIDUAL CLONES After the population with binding of interest is isolated, individual clones can be identified and characterized with titrations.
3.1. Identification of individual clones 1. Zymoprep the population of interest as mentioned previously (Section 2.4.1). Transform 1 mL of zymoprep into XL1-Blue or DH5a supercompetent cells. Plate the entire reaction on LB þ ampicillin plates and grow the plates at 37 C overnight for at least 16 h. 2. Pick individual colonies into 5 mL of LB þ ampicillin media at 37 C with shaking at 250 rpm overnight. 3. Miniprep cultures to isolate plasmid DNA, elute in a volume of 50 mL. Typical yields with the plasmid pCT-CON are approximately 500 ng/mL. Send for sequencing.
Engineering Fibronectin-Based Binding Proteins by Yeast Surface Display
Direction
Sequence
Forward Reverse
50 -gttccagactacgctctgcagg-30 50 -gattttgttacatctacactgttg-30
323
3.2. Clonal yeast preparation The following procedure is adapted from the Frozen-EZ Yeast Transformation II kit (Zymo Research) protocol. 1. Transform 1 mL (100–1000 ng) of miniprep DNA into 10 mL of prepared competent EBY100. Add 100 mL of Solution 3 and mix gently. Perform transformation according to the manufacturer’s protocol. 2. Plate entire reaction on SD-CAA plates for selection. Grow plates at 30 C for 2–3 days. Note: If the cells are extremely competent, the amount of reaction plated can be decreased. 3. Pick a single colony and grow up in 5 mL of SD-CAA media at 30 C with shaking at 250 rpm overnight. 4. Induce cells in 5 mL SG-CAA at starting an OD600nm of 1. Incubate cells at 20 C with shaking at 250 rpm for 8–24 h. Note: Cultures can be stored at 4 C until ready for analysis. 5. Titrations with the target of interest can be performed on the clonal yeast. The titration protocol is as previously described (Chao et al., 2006).
3.3. Expression of soluble Fn3 Soluble expression of Fn3s in E. coli has yielded approximately 50 mg/L of protein. Various expression vectors can be used ranging from the pET (Novagen, EMD Millipore), pMal (NEB), or pET SUMO (Invitrogen) vectors. These vectors can be altered to include a purification tag (i.e., His6 or FLAG) and the restriction sites NheI and BamHI if not already included. We use a modified-pET vector, pEThk, which includes a C-terminal His6KGSGK tag. The addition of two lysines provides primary amines that are available for chemical conjugation. 1. The Fn3 binder gene can be cut out using restriction enzyme digestion with NheI and BamHI following the manufacturer’s protocol. In parallel, the vector of interest should be digested with the same enzymes. 2. The digested product ( 300 bp) should be run on a gel and extracted with the Qiaquick Gel Extraction Kit (Qiagen) according to the manufacturer’s instructions.
324
Tiffany F. Chen et al.
3. The insert can then be ligated to the digested vector with Quick Ligase (NEB) or T4 DNA Ligase (NEB) according to the manufacturer’s protocol. The ligation product should then be transformed into XL1-Blue or DH5a supercompetent cells. The entire transformation should be plated on LB þ antibiotic plates (the antibiotic resistance varies depending on vector used). 4. Pick colonies from the plate into 5 mL cultures of LB þ antibiotic and allow to grow overnight at 37 C shaking at 250 rpm. Miniprep the cultures after approximately 16 h of growth and send the samples for sequencing along with the plasmid-specific sequencing primers. 5. Once the proper sequence is confirmed, the plasmid can be transformed into bacterial strains typically used for protein expression. Our preferred strain is Rosetta 2 (DE3) competent cells (Novagen, EMD Millipore). Transform 0.5 mL (50–250 ng) of the plasmid into 20 mL of cells using heat shock. Plate a fraction (1/5) of the cells on an LB þ antibiotic plate. 6. Pick a colony into a 5-mL overnight culture of LB þ antibiotic for approximately 16 h at 37 C shaking at 250 rpm. 7. Make a 1:1000 dilution of the overnight culture in fresh LB media with no antibiotics. Allow the culture to grow at 37 C shaking at 250 rpm until log phase ( OD600nm ¼ 0.5–1.0). 8. Induce with a 1:1000 dilution of 500 mM IPTG for a final concentration of 0.5 mM IPTG. Induce cells, shaking at 250 rpm at 37 C for approximately 4 h, 30 C for approximately 6 h, or 20 C for overnight inductions. 9. Fn3 protein can be collected by pelleting cells and lysing them using sonication or several freeze–thaw cycles. After cell lysis, protein should be purified using the proper resin depending on the purification tag fused to the Fn3.
4. SUMMARY YSD has been shown to be a powerful platform for protein engineering. In this chapter, we provided a detailed methodology for engineering binders from the 10th type III domain Fn3 protein scaffold. Engineering binders from this single-domain protein scaffold is different from typical scFv engineering. The inherent potential for convexity may alter preferred binding epitopes, while the potentially reduced diversified surface area relative to scFvs heightens the need for appropriate complementarity. Including a
Engineering Fibronectin-Based Binding Proteins by Yeast Surface Display
325
mutagenesis step after every two enrichments allows for the constant introduction of diversity and thoroughly utilizes directed evolution to affinity mature clones. These engineered Fn3 domains have a wide range of applications ranging from imaging (Hackel, Kimura, & Gambhir, 2012), in vitro detection and diagnosis (Gulyani et al., 2011), and in vivo therapeutics (Tolcher et al., 2011), and have many advantages because of their small size and single-domain architecture.
ACKNOWLEDGMENTS We are grateful to all other current and former Wittrup lab members for informative discussions and daily help. We also thank the Koch Institute Flow Cytometry Core facility and Biopolymers Core facility for FACS experiments and sequencing, respectively. Funding sources are from the Sanofi-aventis Biomedical Innovation award program, the NIH/NIGMS Biotechnology Training program, the Gordon & Adele Binder Fellowship, NIH Transformative R01 Program (R01EB010246-02), and Integrative Cancer Biology Program (ICBP) at MIT.
REFERENCES Ackerman, M., Levary, D., Tobon, G., Hackel, B., Orcutt, K. D., & Wittrup, K. D. (2009). Highly avid magnetic bead capture: An efficient selection method for de novo protein engineering utilizing yeast surface display. Biotechnology Progress, 25, 774–783. Binz, H. K., Amstutz, P., & Pluckthun, A. (2005). Engineering novel binding proteins from nonimmunoglobulin domains. Nature Biotechnology, 23, 1257–1268. Boder, E. T., Raeeszadeh-Sarmazdeh, M., & Price, J. V. (2012). Engineering antibodies by yeast display. Archives of Biochemistry and Biophysics, 526, 99–106. Boder, E. T., & Wittrup, K. D. (1997). Yeast surface display for screening combinatorial polypeptide libraries. Nature Biotechnology, 15, 553–557. Boder, E. T., & Wittrup, K. D. (1998). Optimal screening of surface-displayed polypeptide libraries. Biotechnology Progress, 14, 55–62. Bowley, D. R., Labrijn, A. F., Zwick, M. B., & Burton, D. R. (2007). Antigen selection from an HIV-1 immune antibody library displayed on yeast yields many novel antibodies compared to selection from the same library displayed on phage. Protein Engineering, Design and Selection, 20, 81–90. Chao, G., Lau, W. L., Hackel, B. J., Sazinsky, S. L., Lippow, S. M., & Wittrup, K. D. (2006). Isolating and engineering human antibodies using yeast surface display. Nature Protocols, 1, 755–768. Colby, D. W., Kellogg, B. A., Graff, C. P., Yeung, Y. A., Swers, J. S., & Wittrup, K. D. (2004). Engineering antibody affinity by yeast surface display. Methods in Enzymology, 388, 348–358. Gai, S. A., & Wittrup, K. D. (2007). Yeast surface display for protein engineering and characterization. Current Opinion in Structural Biology, 17, 467–473. Gulyani, A., Vitriol, E., Allen, R., Wu, J., Gremyachinskiy, D., Lewis, S., et al. (2011). A biosensor generated via high-throughput screening quantifies cell edge Src dynamics. Nature Chemical Biology, 7, 437–444. Hackel, B. J., Ackerman, M. E., Howland, S. W., & Wittrup, K. D. (2010). Stability and CDR composition biases enrich binder functionality landscapes. Journal of Molecular Biology, 401, 84–96.
326
Tiffany F. Chen et al.
Hackel, B. J., Kapila, A., & Wittrup, K. D. (2008). Picomolar affinity fibronectin domains engineered utilizing loop length diversity, recursive mutagenesis, and loop shuffling. Journal of Molecular Biology, 381, 1238–1252. Hackel, B. J., Kimura, R. H., & Gambhir, S. S. (2012). Use of (64)Cu-labeled fibronectin domain with EGFR-overexpressing tumor xenograft: Molecular imaging. Radiology, 263, 179–188. Hackel, B. J., Neil, J. R., White, F. M., & Wittrup, K. D. (2012). Epidermal growth factor receptor downregulation by small heterodimeric binding proteins. Protein Engineering, Design & Selection, 25, 47–57. Hackel, B. J., & Wittrup, K. D. (2010). The full amino acid repertoire is superior to serine/ tyrosine for selection of high affinity immunoglobulin G binders from the fibronectin scaffold. Protein Engineering, Design and Selection, 23, 211–219. Koide, A., & Koide, S. (2007). Monobodies: Antibody mimics based on the scaffold of the fibronectin type III domain. Methods in Molecular Biology, 352, 95–109. Lipovsek, D., Lippow, S. M., Hackel, B. J., Gregson, M. W., Cheng, P., Kapila, A., et al. (2007). Evolution of an interloop disulfide bond in high-affinity antibody mimics based on fibronectin type III domain and selected by yeast surface display: Molecular convergence with single-domain camelid and shark antibodies. Journal of Molecular Biology, 368, 1024–1041. Lo¨fblom, J., Feldwisch, J., Tolmachev, V., Carlsson, J., Sta˚hl, S., & Frejd, F. Y. (2010). Affibody molecules: Engineered proteins for therapeutic, diagnostic and biotechnological applications. FEBS Letters, 584, 2670–2680. Pirie, C. M., Hackel, B. J., Rosenblum, M. G., & Wittrup, K. D. (2011). Convergent potency of internalized gelonin immunotoxins across varied cell lines, antigens, and targeting moieties. The Journal of Biological Chemistry, 286, 4165–4172. Shapiro, H. M. (2005). Frontmatter, in Practical Flow Cytometry. Hoboken, NJ, USA: John Wiley & Sons, Inc. p. i–l. Skerra, A. (2007). Alternative non-antibody scaffolds for molecular recognition. Current Opinion in Biotechnology, 18, 295–304. Skerra, A. (2008). Alternative binding proteins: Anticalins—Harnessing the structural plasticity of the lipocalin ligand pocket to engineer novel binding activities. The FEBS Journal, 275, 2677–2683. Spangler, J. B., Manzari, M. T., Rosalia, E. K., Chen, T. F., & Wittrup, K. D. (2012). Triepitopic antibody fusions inhibit cetuximab-resistant BRAF- and KRAS-mutant tumors via EGFR signal repression. Journal of Molecular Biology, 422, 532–544. Stumpp, M. T., Binz, H. K., & Amstutz, P. (2008). DARPins: A new generation of protein therapeutics. Drug Discovery Today, 13, 695–701. Tolcher, A. W., Sweeney, C. J., Papadopoulos, K., Patnaik, A., Chiorean, E. G., Mita, A. C., et al. (2011). Phase I and pharmacokinetic study of CT-322 (BMS-844203), a targeted adnectin inhibitor of VEGFR-2 based on a domain of human fibronectin. Clinical Cancer Research, 17, 363–371.
Engineering Fibronectin-Based Binding Proteins by Yeast Surface Display Tiffany F. Chen*,†, Seymour de Picciotto*,†, Benjamin J. Hackel‡, K. Dane Wittrup*,†,},1
*Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, Massachusetts, USA † Koch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, Cambridge, Massachusetts, USA ‡ Department of Chemical Engineering and Materials Science, University of Minnesota, Minneapolis, Minnesota, USA } Department of Chemical Engineering, Massachusetts Institute of Technology, Cambridge, Massachusetts, USA 1 Corresponding author: e-mail address: [email protected]
Contents 1. Introduction 2. Engineering and Screening Approach of Fn3s 2.1 Yeast media and plates 2.2 Naïve yeast library and culture conditions 2.3 Library screening with magnetic beads 2.4 Fn3 mutagenesis and electroporation 2.5 Library screening with FACS 3. Analysis of Individual Clones 3.1 Identification of individual clones 3.2 Clonal yeast preparation 3.3 Expression of soluble Fn3 4. Summary Acknowledgments References
304 307 309 309 310 313 320 322 322 323 323 324 325 325
Abstract Yeast surface display (YSD) presents proteins on the surface of yeast through interaction of the agglutinin subunits Aga1p and Aga2p. The human 10th type III fibronectin (Fn3) is a small, 10-kDa protein domain that maintains its native fold without disulfide bonds. A YSD library of Fn3s has been engineered with a loop amino acid composition similar to that of human antibody complementarity-determining region heavy chain loop 3
Methods in Enzymology, Volume 523 ISSN 0076-6879 http://dx.doi.org/10.1016/B978-0-12-394292-0.00014-X
#
2013 Elsevier Inc. All rights reserved.
303
304
Tiffany F. Chen et al.
(CDR-H3) and varying loop lengths, which has been shown to improve binding ability. There are many advantages of using these small, stable domains that maintain binding capabilities similar to that of antibodies. Here, we outline a YSD methodology to isolate Fn3 binders to a diverse set of target antigens.
1. INTRODUCTION Yeast surface display (YSD) is a versatile platform for engineering proteins. Display of single-chain variable fragments (scFvs) for affinity maturation of already isolated scFvs or isolation of binders from naı¨ve libraries are probably the most characterized applications of YSD (Boder, RaeeszadehSarmazdeh, & Price, 2012; Boder & Wittrup, 1997; Chao et al., 2006; Colby et al., 2004). Several other proteins including T-cell receptors, cytokines, and green fluorescent protein among others have been engineered using YSD for improved characteristics of binding affinity, expression, stability, etc. (Gai & Wittrup, 2007). Yeast display libraries, which range from 107 to 109 transformants, are typically smaller than phage or ribosome display libraries, 1011 to 1013, but have the advantage of a eukaryotic expression machinery. This allows for isolation of clones that would have been missed using other display systems, which suggests more proper display of eukaryotic proteins (Bowley, Labrijn, Zwick, & Burton, 2007). In the YSD system, the protein to be engineered is fused to the C-terminal end of the Aga2p protein, which forms a covalent linkage to the Aga1p protein on the yeast surface through two disulfide bonds (Fig. 14.1). YSD requires two main components: the yeast, EBY100, and the plasmid, pCT-CON. EBY100 is deficient in the machinery to synthesize the amino acid tryptophan and contains the Aga1 gene in the yeast genome. The pCT-CON plasmid encodes for (a) the gene TRP1, which is important for tryptophan synthesis; (b) the Aga2p protein fused to the protein of interest; and (c) ampicillin resistance, for plasmid production in Escherichia coli (Fig. 14.2). Both Aga1p- and Aga2p-mating proteins are controlled under a galactose-inducible promoter. When yeast are properly transformed with the pCT-CON plasmid, they can grow in selective media deficient in tryptophan, whereas untransformed EBY100 will not propagate. Switching the yeast from glucose-rich media to galactose-rich media will induce proper display of the protein of interest. Engineering binders from scFvs and antibodies have been the standard practice, but over the past decade, the use of alternative scaffolds has been
Engineering Fibronectin-Based Binding Proteins by Yeast Surface Display
305
Avidin
Ag
3
c-My
c
HA
Fn
Aga2p S
S
S
S
Aga1p
Yeast surface
Figure 14.1 Schematic of the Fn3 scaffold displayed on the surface of yeast. The Fn3 is a C-terminal fusion to the Aga2p protein and flanked by two detection tags: hemagglutinin (HA) epitope tag (YPYDVPDYA) at the N-terminus and c-Myc epitope (EQKLISEEDL) at the C-terminus. The Aga2p protein forms two disulfide bonds with the Aga1p protein, which is anchored to the cell wall via b-glucan linkage. Biotinylated antigen is detected with a fluorophore-conjugated streptavidin. Full display of Fn3 is detected with a primary chicken anti-c-Myc antibody and a fluorophore-conjugated secondary antibody specific for chicken antibody.
an emerging field in protein engineering (Binz, Amstutz, & Pluckthun, 2005; Skerra, 2007). Antibodies (150 kDa) are quite complex protein structures comprised of several protein domains that require disulfide bonds and glycosylation for proper function. Alternative scaffolds such as anticalins, affibodies, darpins, and fibronectin domains are small proteins that have certain surface regions that can be highly diversified to bind to a variety of proteins (Koide & Koide, 2007; Lo¨fblom et al., 2010; Skerra, 2008; Stumpp, Binz, & Amstutz, 2008). The advantage of alternative scaffolds lies in the fact that they can be quite small, single domains yet fairly stable while lacking disulfide bonds. The alternative scaffold most developed with the YSD platform is the 10th type III domain of the fibronectin (Fn3) protein; the primary domain involved in integrin binding (Hackel, Kapila, & Wittrup, 2008; Hackel & Wittrup, 2010; Lipovsek et al., 2007). This small,
306
Tiffany F. Chen et al.
Gal1-10
Start
ColE1 origin Aga2
(G4S)3 Linker
HA tag, NheI Insert
BamhI, c-myc tag, Stop MFalpha1 terminator
pCT-CON 6934 bp
bla(ampR)
f1(+) origin CEN6 ARSH4 TRP1
Figure 14.2 Vector map of pCT-CON. The Fn3 gene would be in the place of the “insert” label on the plasmid.
approximately 10 kDa, cysteine-free yet stable domain is composed of two b-sheets comprising seven b-strands connected by three solvent-exposed loops on both sides, which resemble antibody CDRs (Fig. 14.3). A library of Fn3s was previously generated that had varying loop lengths compared to that of wild-type Fn3, with an amino acid repertoire similar to that of antibody CDR-H3. This library known as G4 is the naı¨ve library used for our selection processes. The library diversity comprises 2.5 108 transformants with 60% of them being full-length Fn3s, yielding approximately 1.5 108 clones (Hackel, Ackerman, Howland, & Wittrup, 2010). The current library size undersamples the immense sequence space created by the loop length and amino acid diversities. To compensate for this, diversity is constantly introduced into enriched sublibraries by several mechanisms: high mutagenesis through error-prone PCR focused on the three loop areas (BC, DE, FG loops), low mutagenesis by error-prone PCR for the entire Fn3 gene to introduce framework mutations, and shuffling of the loops during homologous recombination (Hackel et al., 2008). This library has yielded several binders to a variety of target proteins ranging from epidermal growth factor receptor (EGFR) (Hackel et al., 2010), immunoglobulins of various species (Hackel & Wittrup, 2010), carcinoembryonic antigen (CEA) (Pirie, Hackel, Rosenblum, & Wittrup, 2011), to human Fc gamma receptors (Hackel et al., 2010). Fn3 clones with high display levels correlate with increased stability as tested with circular
Engineering Fibronectin-Based Binding Proteins by Yeast Surface Display
307
Figure 14.3 Fibronectin domain. The solution structure (PDB ID: 1TTG) of Fn3 is presented with 90 rotations. The wild-type sequence is indicated. The BC (red), DE (green), and FG (blue) loops are highlighted.
dichroism thermal denaturation (Hackel & Wittrup, 2010; Hackel et al., 2010). Fusions of the EGFR binders have been shown to downregulate EGFR expression on various cancer cell lines in vitro (Hackel, Neil, White, & Wittrup, 2012) and inhibit tumor growth in vivo when fused as a triepitopic antibody (Spangler, Manzari, Rosalia, Chen, & Wittrup, 2012). Fusions of CEA binders to gelonin have served as potent immunotoxins in vitro (Pirie et al., 2011). Ongoing work in our laboratory demonstrates the versatility of this library in producing Fn3 binders to a large panel of EGFR ligands, perfringolysin O, DEC-205, among many other targets.
2. ENGINEERING AND SCREENING APPROACH OF Fn3s The following outlines a detailed methodology of Fn3 binder selection using YSD (Fig. 14.4). The naı¨ve G4 library is first screened using magnetic bead selection. The avidity of interaction between the yeast and
308
Tiffany F. Chen et al.
Naive Fn3 Library
Enrich binders by magnetic bead selection
Is binding detectable by FACS ?
No
Construct random mutagenesis library based on selected clones
Yes Enrich magnetic bead sorted cell population using flow cytometry
Begin here to affinity mature a given clone
Construct random mutagenesis library based on flow cytometry-selected clones Repeat until desired properties are achieved Select for improved clones from mutagenesis library using flow cytometry
Characterize individual clones by sequencing and titration
Fn3 to antigen of interest with desired properties
Figure 14.4 Flow chart for the methodology of engineering Fn3s from the naïve G4 library. Fn3 binders are first enriched using magnetic bead selection and then sorted using FACS.
multivalent antigen-coated beads allows for the enrichment of weak affinity binders (Ackerman et al., 2009). After two rounds of magnetic bead enrichment, the Fn3 sublibrary is subjected to mutagenesis to introduce diversity into the population. This new library is screened again using magnetic beads. Once binding of antigen is detectable on flow cytometry, sorting is switched
Engineering Fibronectin-Based Binding Proteins by Yeast Surface Display
309
to fluorescence-activated cell sorting (FACS). The selection process of the Fn3 binders remains the same with two rounds of enrichment followed by mutagenesis. This process of directed evolution has resulted in engineering Fn3 binders with picomolar affinity to antigens of interest (Hackel et al., 2008). The G4 library, EBY100, and associated pCT-CON vectors are available upon request.
2.1. Yeast media and plates 1. SD-CAA: 20 g/L D-glucose, 6.7 g/L yeast nitrogen base, 5 g/L casamino acids, 7.4 g/L citric acid monohydrate, 10.4 g/L sodium citrate, pH 4.5 2. SD-CAA plates: 20 g/L D-glucose, 6.7 g/L yeast nitrogen base, 5 g/L casamino acids, 5.4 g/L Na2HPO4, 8.6 g/L NaH2PO4H2O, 16 g/L agar, 182 g/L sorbitol 3. SG-CAA: 18 g/L galactose, 2 g/L D-glucose, 6.7 g/L yeast nitrogen base, 5 g/L casamino acids, 5.4 g/L Na2HPO4, 8.6 g/L NaH2PO4H2O, pH 6.0 4. YPD: 20 g/L dextrose, 20 g/L peptone, 10 g/L yeast extract 5. YPD plates: 20 g/L dextrose, 20 g/L peptone, 10 g/L yeast extract, 16 g/L agar
2.2. Naïve yeast library and culture conditions 1. To prepare the G4 library, thaw a frozen aliquot with 10 diversity (2.5 109 cells) into 1 L of SD-CAA minimal media. Grow at 30 C with shaking at 250 rpm overnight to a typical OD600nm of 6–8 (OD600nm ¼ 1 is 1 107 cells/ml). Optional: If desired, cells can be passaged to a 1-L culture of fresh SD-CAA media to decrease the percentage of dead cells. Plating serial dilutions of the G4 library on SD-CAA plates can also test for viability. Frozen aliquots of the G4 library can be prepared by freezing 10 diversity in 15% glycerol in SD-CAA at 80 C for long-term storage. 2. Inducing cells for display requires switching the media from glucose- to galactose-rich media. Pellet 30 diversity (7.5 109 cells) of the G4 library at 2500 g for 5 min and resuspend the cells in 1 L of SGCAA induction media for 12–24 h at 20 C. Optimal induction occurs when cells are induced during exponential growth (OD600nm ¼ 2–7). Optional: Cells can be induced at 30 C, but cells will continue to grow, whereas induction at 20 C should allow for less than one doubling from
310
Tiffany F. Chen et al.
the initial OD600nm during the incubation. After induction, cells can be used immediately or stored at 4 C.
2.3. Library screening with magnetic beads Initial library screening is performed using Biotin Binder Dynabeads (Invitrogen). The multivalency of the Dynabeads (5 106 biotin-binding sites per bead) and the yeast (105 fibronectin per cell) allows for the isolation of weak affinity Fn3 binders through avidity interaction. The naı¨ve library is first depleted of bare bead/streptavidin binders and then enriched for binders to the antigen of interest. Antigens of interest must be biotinylated before sorting. 2.3.1 Bead preparation 1. For the initial sort from the naı¨ve library, two batches should be prepared to ensure adequate exposure of cells to the antigen of interest. Prepare 6.7–33 pmoles of biotinylated antigen for 10 mL of Dynabeads (4 105 beads/mL) in 100 mL of PBSA (1 phosphate-buffered saline, 0.1% bovine serum albumin) in 2-mL microcentrifuge tubes. Antigen at 6.7 pmoles is sufficient for enrichment, but if the antigen is not limited, then 33 pmoles should be used. 2. Tubes should be incubated at 4 C, rotating for at least 1 h. 3. Directly before the addition of cells, beads must be washed once with the addition of 1 mL of PBSA. Place the tube on a magnet for 2–5 min before removing the supernatant. After removal of supernatant, cells can be added to beads. This step is to remove any free antigen. 2.3.2 Initial cell sorting 1. Measure the cell density and pellet 15 diversity of the induced G4 library (3.75 109 cells) for sorting. 2. Pellet cells at 3000 g for 5 min and wash the cells with 1 mL of PBSA, then split into two aliquots in two 2-mL microcentrifuge tubes. Pellet cells at high speed (12,000 g) for 1 min and resuspend cells in 1 mL PBSA. 3. Negative sort: Add 10 mL of bare beads in each tube and incubate cells and beads at 4 C for at least 2 h rotating (Ackerman et al., 2009). This step serves as a negative selection by depleting yeast that display Fn3 binders to the bare beads/streptavidin. The initial library should not have many bare bead/streptavidin binders, so one depletion should be sufficient, but subsequent sorts should include at least two negative bare bead
Engineering Fibronectin-Based Binding Proteins by Yeast Surface Display
311
depletions to prevent the isolation of bare bead/streptavidin binders. If your antigen of interest possesses a tag or fusion partner, we recommend including this tag or fusion partner in your negative selection process. Prepare the beads as recommended in the previous subsection using a biotinylated tag-only construct. 4. Positive sort: After 2 h of incubation at 4 C, place the cells with beads on the magnet and transfer the unbound cells to the tubes with the washed, antigen-coated beads. Incubate at 4 C for at least 2 h rotating. 5. Wash the negative sort with 1 mL PBSA on magnet, remove supernatant, and resuspend beads and cells in 5 mL of fresh SD-CAA. Store at 4 C until all sorts are finished, only then grow up cultures at 30 C. 6. Wash the positive sort with 1 mL PBSA on magnet, remove supernatant, and resuspend beads and cells in 5 mL of fresh SD-CAA. Perform serial dilutions of negative and positive sort cultures and plate on SD-CAA plates to determine and compare numbers of isolated yeast. 2.3.3 Cell growth and induction 1. Grow up cells at 30 C with shaking at 250 rpm for at least 16 h. 2. Pellet culture and remove 4 mL of media. Resuspend cells and beads in remaining 1 mL of culture and transfer to 2-mL microcentrifuge tube. Place on magnet to remove the beads. Recover unbound cells and transfer back into original test tube. 3. Pellet at least 10 diversity of cells at high speed for 1 min. Remove supernatant and resuspend cells in 5 mL of fresh SG-CAA media. Yeast double approximately every 4 h in SD-CAA minimal media; therefore, back-calculations of the hours of growth can determine volume of cells needed for 10 diversity. 4. Incubate at 20 C at 250 rpm for 8–24 h for the induction of protein expression. 2.3.4 Intermediate cell sorting The newly induced population of yeast should be enriched in antigen binders and depleted of bare bead/streptavidin binders. To ensure that specific binders are isolated as opposed to nonspecific yeast, the stringency of negative sorts and washes is increased. 1. Measure the cell density and pellet 20 diversity of the induced population for sorting. 2. Wash the cells with 1 mL of PBSA, pellet the cells at high speed (12,000 g) for 1 min, and resuspend cells in 1 mL PBSA.
312
Tiffany F. Chen et al.
3. Negative sort 1: Add 10 mL of bare beads in the tube and incubate cells and beads at 4 C for at least 2 h rotating. 4. Negative sort 2: After 2 h of incubation at 4 C, place the cells with beads on the magnet and transfer the unbound cells to a new 2-mL microcentrifuge tube. Add 10 mL of bare beads and incubate at 4 C for at least 2 h rotating. Optional: Depending on the desired stringency and the generation of sort, negative sorts can be increased in number to prevent the isolation of bare bead/streptavidin binders. Negative sorts against nontarget molecules (such as epitope tags, fusion partners, or other undesired binding partners) can also be included. 5. Wash the negative sort 1 beads with 1 mL PBSA on the magnet and remove supernatant; repeat wash. Resuspend beads and cells in 5 mL of fresh SD-CAA. Store at 4 C until all sorts are finished and only then grow up cultures at 30 C. 6. Positive sort: After 2 h of incubation at 4 C, place the cells with beads on the magnet and transfer the unbound cells to the tubes with the washed antigen-coated beads. Incubate at 4 C for at least 2 h rotating. Repeat step 5 for negative sort 2. 7. Wash the positive sort with 1 mL PBSA on magnet, remove supernatant, and resuspend beads and cells in 5 mL of fresh SD-CAA. Perform serial dilutions of negative and positive sort cultures and plate on SD-CAA plates to determine and compare numbers of isolated yeast. Optional: Depending on the desired stringency and the generation of sort, the number of washes can be increased to ensure the isolation of specific binders. The results from the serial dilutions on a plate are typically a good indication of whether the stringency should be increased. A good ratio of positive sort to negative sort cells is 10:1. Alternatively or additionally, incubations can be performed at room temperature. 8. Repeat Section 2.3.3 cell growth and induction protocol. 2.3.5 FACS of fully displaying yeast After two rounds of magnetic-bead enrichment, sort for yeast displaying full-length Fn3 clones by isolating yeast that stain double positive for the N-terminal HA epitope tag and the C-terminal c-myc epitope tag. In truncations or frameshift mutants, the c-myc tag detection would be lost and, in the case of plasmid loss, the HA tag would not be detected. This sort ensures that all clones are full-length Fn3 clones, which are then used for mutagenesis.
Engineering Fibronectin-Based Binding Proteins by Yeast Surface Display
313
1. Pellet at least 10 library diversity or 1 107 cells and wash with 1 mL of PBSA. 2. Primary staining: Resuspend cells in 50 mL of PBSA and add 0.5 mL of mouse anti-HA as a 1:100 dilution (16B12, Covance) and 0.5 mL of chicken anti-c-myc (Invitrogen or Gallus Immunotech) as a 1:100 dilution. Incubate cells with the primary antibody at room temperature for at least 20 min. When labeling with primaries, two concerns must be taken into account: stoichiometric excess of the primary, and the concentration, which determines incubation periods. Note: Yeasts typically display 1 105 Fn3s per cell. 3. Wash the cells with 1 mL of PBSA, pellet cells at high speed for 1 min, and remove supernatant. This step removes any unbound primary antibodies. 4. Secondary staining: Resuspend cells in 50 mL of PBSA and add 0.5 mL goat anti-mouse AlexaFluor® 488 (Invitrogen) and 0.5 mL goat antichicken AlexaFluor® 647 (Invitrogen). Incubate on ice for at least 15 min. Other fluorophore combinations can be used, but fluorophores that do not require compensation in flow cytometry are preferred (Shapiro, 2005). 5. Wash the cells with 1 mL of PBSA, pellet cells at high speed for 1 min, and remove supernatant. This step removes unbound secondary antibodies. 6. FACS: Resuspend cells in the desired sorting volume (0.5 mL) of PBSA and collect double-positive population. Collect cells in a small volume (2 mL) of SD-CAA media. Rinse the sides of the tube with 3 mL of SD-CAA media to collect any additional cells. Grow up cells at 30 C with shaking at 250 rpm for at least 16 h. If the volume increases significantly after the sort, dilute cells in excess SD-CAA media, otherwise the yeast will flocculate. Optional: In the case of increased volume of after sorting, cells can be rinsed off the sides of the tube and then gently pelleted at 2500 g for 5 min. Remove as much media as possible and add 5 mL of fresh SD-CAA media.
2.4. Fn3 mutagenesis and electroporation In order to reintroduce diversity into the enriched population of Fn3 binders, plasmids from yeast will be isolated and mutagenized. This will introduce clones with improved binding to the target of interest.
314
Tiffany F. Chen et al.
2.4.1 Zymoprep yeast Extract the plasmid DNA from yeast using the Zymoprep™ Yeast Plasmid Miniprep II (Zymo Research). The following protocol is adapted from the original Zymo Research protocol. 1. Measure the cell density and pellet 1 108 cells in a microcentrifuge tube at 300 g for 1 min. Remove the supernatant. 2. Add 200 mL of Solution 1 to the pellet and resuspend the pellet by gentle pipetting. Add 3 mL of Zymolyase, mix, and incubate at 37 C for 15–60 min. For cells in logarithmic growth (OD600nm ¼ 2–7), 15 min of incubation at 37 C should be sufficient. For cells in the stationary phase, they need to be incubated for at least 30 min. 3. Add 200 mL of Solution 2 with gentle mixing. Then, add 400 mL of Solution 3 and mix gently. Pellet debris at high speed (12,000 g) for 8 min. Remove supernatant and transfer to a new microcentrifuge tube. Pellet remaining debris at high speed (12,000 g) for 3–5 min (depending on the amount of debris remaining). 4. Transfer the clear supernatant to a miniprep column (Epoch or Qiagen) and not the Zymo column. Centrifuge the column at high speed (12,000 g) for 1 min and discard the flow through. 5. Wash column using 550 mL of miniprep wash buffer (Qiagen buffer PE or Epoch WS). Spin the column at high speed for another 1 min and discard the flow through. Spin column again to remove any excess wash buffer. 6. Place column over new microcentrifuge tube and elute DNA with 40 mL of elution buffer (Qiagen or Epoch buffer EB). Spin at high speed for 1 min. The expected yield is approximately five plasmids from each cell. With 1 108 cells, there should be approximately 1.25 107 plasmids per microliter. 2.4.2 Mutagenesis of Fn3 through error-prone PCR Plasmids containing Fn3s will be mutagenized using error-prone PCR with two nucleotide analogues: 8-oxo-20 -deoxyguanosine-50 -triphosphate and 20 -deoxy-p-nucleoside-50 -triphosphate (8-oxo-dGTP and dPTP). Mutation rates can be adjusted by varying the concentration of nucleotide analogues and the number of PCR cycles. Mutations will be introduced using two methods: low levels of mutagenesis to the entire gene to introduce framework mutations and high levels of mutagenesis at the loop regions to improve binding.
315
Engineering Fibronectin-Based Binding Proteins by Yeast Surface Display
1. Error-prone PCR preparation Primers Sample
Sequence
Gene
50 -Primer 30 -Primer 50 -Primer 30 -Primer 50 -Primer 30 -Primer 50 -Primer 30 -Primer
BC loop DE loop FG loop
cgacgattgaaggtagatacccatacgacgttccagactacgctctgcag atctcgagctattacaagtcctcttcagaaataagcttttgttcggatcc gggacctggaagttgttgctgcgacccccaccagcctactgatcagctgg tgaactcctggacagggctatttcctcctgtttctccgtaagtgatcctgtaata caggatcacttacggagaaacaggaggaaatagccctgtccaggagttcactgtg gcatacacagtgatggtataatcaactccaggtttaaggccgctgatggtagc accatcagcggccttaaacctggagttgattataccatcactgtgtatgctgtc gatccctgggatggtttgtcaatttctgttcggtaattaatggaaattgg
PCR in 50 mL volumes Volume
Component
Gene reaction (one reaction total) 5 mL 10 ThermoPol buffer 2.5 mL 50 -Primer (10 mM) 2.5 mL 30 -Primer (10 mM) 1 mL dNTPs (10 mM each) 8 mL Zymoprepped DNA 5 mL 8-oxo-dGTP (20 mM) 5 mL dPTP (20 mM) 20.5 mL ddH2O 0.5 mL Taq DNA polymerase Loop reactions (three reactions total) 5 mL 10 ThermoPol buffer 2.5 mL 50 primer (10 mM) 2.5 mL 30 primer (10 mM) 1 mL dNTPs (10 mM each) 8 mL Zymoprepped DNA 5 mL 8-oxo-dGTP (200 mM) 5 mL dPTP (200 mM) 20.5 mL ddH2O 0.5 mL Taq DNA polymerase
Final concentration
1 ThermoPol buffer 0.5 mM 50 -primer 0.5 mM 30 -primer 200 mM dNTPs each 108 plasmids 2 mM 8-oxo-dGTP 2 mL dPTP 2.5 units 1 ThermoPol buffer 0.5 mM 50 -primer 0.5 mM 30 -primer 200 mM dNTPs each 108 plasmids 20 mM 8-oxo-dGTP 20 mL dPTP 2.5 units
2. Thermal cycle setup Step
Temperature ( C)
Time
Cycle
Initialization
94
3 min
1
Denaturation Annealing Extension
94 60 72
45 s 30 s 90 s
2–16
Final extension
72
10 min
17
316
Tiffany F. Chen et al.
Mutated DNA can be used immediately or stored at 4 C. 3. Add 10 mL of 6 DNA loading buffer to mutated DNA and run half of the reaction (30 mL) on a 1.5% agarose gel precast with GelGreen™ (Biotium, Inc.). Save the remaining half of mutated DNA at 4 C for possible future use in the case that more DNA is needed. Run samples with ladder at 100 V for approximately 45–60 min. The gene PCR product should be visible, but loop PCR products may be hard to differentiate from primers. Excise gene band, and to ensure proper recovery of loops, excise entire loop bands including primers (Fig. 14.5). PCR products should be at 460 18, 139 6, 126 6, 179 6, base pairs for the gene, BC loop, DE loop, and FG loop bands. 4. Purify the PCR products individually (gene, BC loop, DE loop, and FG loop) using the Qiaquick Gel Extraction Kit (Qiagen) according to the manufacturer’s instructions. Elute with 40 mL EB buffer. 2.4.3 Amplification of mutagenized Fn3 The amplification step of the mutagenized Fn3 is to generate sufficient quantities of DNA insert for yeast transformation. This step will amplify the loop regions and not the primers that were excised with the loop regions. 100bp Gene BC DE Ladder Loop Loop
FG Loop
500 400 300 200 100
Figure 14.5 Gel of error-prone PCR products of the gene, BC loop, DE loop, and FG loop. The gene band should be at approximately 460 bp and the loops will run at approximately 120–190 bp. Primer bands run lower than the loop products, but if no differentiation can be detected, purify the entire primer and loop band.
317
Engineering Fibronectin-Based Binding Proteins by Yeast Surface Display
1. Amplification PCR preparation Primers Sample
Sequence
Gene
50 -Primer 30 -Primer 50 -Primer 30 -Primer 50 -Primer 30 -Primer 50 -Primer 30 -Primer
BC loop DE loop FG loop
cgacgattgaaggtagatacccatacg atctcgagctattacaagtcctcttc gggacctggaagttgttgctgcg tgaactcctggacagggctatttcc caggatcacttacggagaaacaggagg gcatacacagtgatggtataatcaac accatcagcggccttaaacctggag gatccctgggatggtttgtcaatttc
Amplification primers are shorter versions of the error-prone PCR primers. Larger quantities of these primers are used; therefore, the shorter primers are more economically favorable. PCR in 200 mL volumes Volume
Component
Final concentration
20 mL 20 mL 20 mL 4 mL 8 mL 126 mL 2 mL
10 ThermoPol buffer 50 -Primer (10 mM) 30 -Primer (10 mM) dNTPs (10 mM each) Extracted mutated DNA ddH2O Taq DNA polymerase
1 ThermoPol buffer 1 mM 50 -primer 1 mM 30 -primer 200 mM dNTPs each 2.5 units
Split reactions into two 100 mL aliquots per sample for a total of eight tubes. 2. Thermal cycle setup Step
Temperature ( C)
Time
Cycle
Initialization Denaturation Annealing Extension Final extension
94 94 60 72 72
3 min 45 s 30 s 90 s 10 min
1 2–31
32
Amplified DNA can be used immediately or stored at 4 C. 3. Concentrate the amplified PCR products by ethanol precipitation. Combine the gene amplification products into a 1.5-mL microcentrifuge tube and combine all of the loop amplifications into a 2-mL microcentrifuge tube. Optional: 2 mL of pellet paint coprecipitant®
318
Tiffany F. Chen et al.
(Novagen, EMD Millipore) can be used to visualize the DNA pellet. Adjust the pH by adding 10% volume of 3 M sodium acetate to the PCR amplifications: 20 mL for the gene amplification and 60 mL for the loop amplifications. Add at least 2 volume of 100% ethanol to each tube: 400 mL for gene amplification and 1200 mL for loops. Incubate at room temperature for 2 min and then spin at high speed (12,000 g) for 5 min to pellet the DNA. Remove the supernatant and add 500 mL of 70% ethanol. Mix/vortex briefly and pellet again at high speed for 5 min. Remove the supernatant and add 500 mL of 100% ethanol. Mix/ vortex briefly and pellet again at high speed for 5 min. Remove supernatant and air dry over night or for 10 min on a heat block at 48 C. Dissolve dried pellet in 1 mL of ddH2O in preparation for electroporation. 2.4.4 Preparation of vectors Since there are two different amplification products: gene and loops, two different vectors that are variants of pCT-CON must be prepared for the electroporation. The pCT-Fn3-Gene vector has a sequence consisting of the PstI, NdeI, and BamHI sites separated by spacers replacing the DNA between the HA and c-myc tags. The pCT-Fn3-Loop vector contains the Fn3 gene except the DNA between the BC loop and FG loop is replaced by NcoI, SmaI, and NdeI cut sites separated by spacers. The vectors are digested at three sites to ensure that the linearized vectors will only recircularize in the presence of insert. Vectors are available upon request. 1. To linearize the pCT-Fn3-Gene vector, digest with NdeI as specified by the manufacture’s protocol at 37 C overnight. To linearize the pCTFn3-Loop vector, digest with SmaI according to the manufacture’s protocol at 25 C overnight. 2. Adjust buffer volumes for both vectors. Digest pCT-Fn3-Gene with PstI and BamHI following the manufacture’s protocol at 37 C overnight. Digest pCT-Fn3-Loop with NcoI and NdeI at 37 C overnight. 3. Concentrate digested vectors using ethanol precipitation as previously described (step 3 of Section 2.4.3). Dissolve vectors in ddH2O at a concentration of 2 mg/mL. Store at 4 C for short term or 20 C for long term. 2.4.5 Electroporation protocol Linearized vector and inserts will be introduced into the yeast through electroporation transformation. Yeast will naturally perform homologous recombination to recircularize linearized vector and inserts. The following
Engineering Fibronectin-Based Binding Proteins by Yeast Surface Display
319
electroporation protocol has been optimized for the Bio-Rad Gene Pulser Xcell (Bio-Rad) electroporation instrument. The electroporation protocol for the Bio-Rad Gene Pulser (Bio-Rad) can be performed as previously described (Chao et al., 2006). 1. An EBY100 starter culture in 5 mL of YPD can be prepared in the following ways: inoculate with a EBY100 colony from a freshly streaked YPD plate, a 1:50 dilution of EBY100 from a culture stored at 4 C, or a streak from an EBY100 frozen stock. Grow culture overnight at 30 C with shaking at 250 rpm. Note: EBY100 doubles every 1.5–2 h in YPD. 2. Inoculate 50 mL of YPD at OD600nm ¼ 0.2 and grow at 30 C with shaking at 250 rpm until OD600nm ¼ 1.3–1.5 (4–6 h). The culture volume varies depending on the number of transformations to be performed; usually, 50 mL is sufficient for two electroporations (one for gene and another for loops). 3. Pellet cells in 50-mL conical tubes at 3000 g for 3 min and remove supernatant. 4. Resuspend cells in half of the original YPD volume (25 mL) with 100 mM lithium acetate. Make fresh 1 M dithiothreitol, sterile filter, and add to cells to a final concentration of 10 mM. Incubate cells at 30 C with shaking for 10 min. 5. Pellet cells at 3000 g for 3min and remove supernatant. Place cells on ice; all of the following steps will be performed on ice and with chilled reagents. 6. Resuspend cells in chilled sterile ddH2O using half of the original volume (25 mL). Pellet cells at 3000 g for 3 min and remove supernatant. 7. Resuspend cells in 250 mL of chilled sterile ddH2O. The total volume will be approximately 500 mL of cells for each 50 mL original culture volume. 8. In parallel with cell preparation, add 4 mg of vector (2 mL) to amplified inserts (digested gene vector to gene inserts and digested loop vector to loop inserts). Chill two 2 mm electroporation cuvettes on ice. 9. Mix 250 mL of cells with the gene preparation and the remaining 250 mL of cells with the loop preparation. Transfer mixtures to prechilled electroporation cuvettes and keep on ice until electroporation. 10. Use the square wave protocol on the Bio-Rad Gene Pulser Xcell. Perform a single pulse at 500 V with a 15-ms pulse duration. Typical “Droop” readings reported by the machine are within 5–6%.
320
Tiffany F. Chen et al.
11. Rescue cells with 1 mL of YPD and transfer cells to a 14-mL polypropylene round bottom tube (Falcon). Rinse the cuvette with an additional 1 mL of YPD and transfer cells to the same tube. Incubate cells at 30 C without shaking for 1 h. 12. Plate dilutions of cells on SD-CAA plates to determine the number of transformants of the new library. Grow plates at 30 C for 2–3 days. This protocol typically yields 107–108 transformants. 13. Pellet the remaining cells at 3000 g for 3 min. Combine both gene and loop libraries in a single culture of 500 mL SD-CAA and grow at 30 C with shaking at 250 rpm overnight. Optional: The library can be passaged to decrease the number of untransformed cells (Optional: Step 1 of Section 2.2). 14. Induce cells at 10 diversity with 500 mL of SG-CAA at 20 C with shaking at 250 rpm for 8–24 h.
2.5. Library screening with FACS After a few rounds of magnetic-bead enrichment, FACS can be used to quantitatively screen yeast-displayed Fn3 libraries. Libraries will be labeled for display through c-myc tag detection and binding with soluble antigen. Using this double labeling, antigen binding can be normalized by display levels. 2.5.1 Labeling protocol for FACS 1. Pellet 10 diversity of induced yeast in a 1.5-mL microcentrifuge tube at max speed for 1 min and remove supernatant. Wash with 1 mL PBSA by pelleting again and remove the supernatant. 2. Resuspend cells in PBSA. Volumes vary depending on number of cells. Typically, a labeling volume of 50 mL is used for 1 106–1 107 cells and a volume of 0.5–1 mL is used for 1 108 cells. 3. Primary labeling: Add anti-c-myc antibody (chicken anti-c-myc (Invitrogen or Gallus Immunotech) or mouse anti-c-myc (9E10, Covance)) to at least 20 nM (3 mg/L) final concentration. Add desired amount of soluble biotinylated antigen. Concentrations will vary depending on the binding affinity of the entire population. Typical labeling concentrations when first switching from magnetic bead sorting to FACS range from 300 to 500 nM. The optimal concentration of labeling for subsequent sorts can be calculated as previously described (Boder & Wittrup, 1998). Note: Always make sure primaries are in stoichiometric excess (10-fold) of Fn3. At lower labeling concentrations, volumes will need to be increased to maintain excess ligand.
Engineering Fibronectin-Based Binding Proteins by Yeast Surface Display
321
4. Incubate at room temperature or 37 C until equilibrium binding has been reached; approximately 30 min should suffice for labeling at 20 nM or higher. Note: Time to half of equilibrium can be calculated by Eq. (14.1), where kon is the rate of association (typical protein–protein kon is 1 105M1s1) and koff is the rate of dissociation, which can be calculated from an approximation of the equilibrium constant, Kd, Eq. (14.2). [L]o is the initial ligand concentration operating under the assumption of no ligand depletion. Five half-lives is enough to reach 97% of equilibrium. ln 2 kon ½Lo þ koff koff Kd ¼ kon
t1=2 ¼
½14:1 ½14:2
5. Secondary labeling: Wash cells with 1 mL PBSA, pellet, and remove supernatant. Subsequent steps are performed on ice. Resuspend in desired volume of chilled PBSA and label with secondaries at 50 nM or higher. Typical secondaries used are anti-chicken or anti-mouse Alexa Fluor® 488 or Alexa Fluor® 647 conjugates (Invitrogen) for detection of the anti-c-myc antibody. Streptavidin Alexa Fluor® 488 or Alexa Fluor® 647 conjugates (Invitrogen) or anti-biotin PE conjugate (ebioscience) are used for biotinylated antigen detection. Incubate for approximately 15–30 min on ice. Once again, make sure secondaries are in stoichiometric excess of Fn3. Time to equilibrium can be calculated as mentioned previously. 6. Wash cells with 1 mL PBSA, pellet, and remove supernatant. Right before sorting, resuspend cells in PBSA at a concentration of 1 108cells/mL and transfer to proper FACS tubes. When sorting for high affinity binders with subnanomolar binding affinities, dissociation competition can be used by first labeling with a stoichiometric excess of biotinylated antigen, washing, and then competing with nonlabeled unbiotinylated antigen. 2.5.2 Sorting for improved clones 1. In initial sorts, if no strong double-positive diagonal is detected, collect all cells that show detectable binding to the antigen of interest, as shown in Fig. 14.6A. This gate should cover the top 1–3% of displaying cells. 2. In subsequent sorts, in a diagonal sort window, collect the top 0.1–1% of cells that show strong display and binding as shown in Fig. 14.6B.
322
Tiffany F. Chen et al.
A
Generation x.0 – 200 nM
B
Generation x.1 – 50 nM 0.1–1%
Binding
Binding
1–3%
Display
Display
Figure 14.6 Representative FACS plots of sorting for improved clones. (A) In initial FACS sorts, collect the top 1–3% of displaying cells that show detectable binding, (B) in subsequent FACS sorts, collection gates should be more stringent (top 0.1–1% of population) to isolate binders with high affinity to the antigen of interest.
3. Collect cells in 2 mL of SD-CAA and follow the same procedure as outlined in step 6 of Section 2.3.5. Grow cells at 30 C with shaking at 250 rpm overnight. 4. Induce cells with at least 10 diversity starting at an initial OD600nm of 1. Incubate cells at 20 C with shaking at 250 rpm for 8–24 h. Induction time can be decreased to increase stringency in sorting by having less Fn3 displayed on the surface of yeast.
3. ANALYSIS OF INDIVIDUAL CLONES After the population with binding of interest is isolated, individual clones can be identified and characterized with titrations.
3.1. Identification of individual clones 1. Zymoprep the population of interest as mentioned previously (Section 2.4.1). Transform 1 mL of zymoprep into XL1-Blue or DH5a supercompetent cells. Plate the entire reaction on LB þ ampicillin plates and grow the plates at 37 C overnight for at least 16 h. 2. Pick individual colonies into 5 mL of LB þ ampicillin media at 37 C with shaking at 250 rpm overnight. 3. Miniprep cultures to isolate plasmid DNA, elute in a volume of 50 mL. Typical yields with the plasmid pCT-CON are approximately 500 ng/mL. Send for sequencing.
Engineering Fibronectin-Based Binding Proteins by Yeast Surface Display
Direction
Sequence
Forward Reverse
50 -gttccagactacgctctgcagg-30 50 -gattttgttacatctacactgttg-30
323
3.2. Clonal yeast preparation The following procedure is adapted from the Frozen-EZ Yeast Transformation II kit (Zymo Research) protocol. 1. Transform 1 mL (100–1000 ng) of miniprep DNA into 10 mL of prepared competent EBY100. Add 100 mL of Solution 3 and mix gently. Perform transformation according to the manufacturer’s protocol. 2. Plate entire reaction on SD-CAA plates for selection. Grow plates at 30 C for 2–3 days. Note: If the cells are extremely competent, the amount of reaction plated can be decreased. 3. Pick a single colony and grow up in 5 mL of SD-CAA media at 30 C with shaking at 250 rpm overnight. 4. Induce cells in 5 mL SG-CAA at starting an OD600nm of 1. Incubate cells at 20 C with shaking at 250 rpm for 8–24 h. Note: Cultures can be stored at 4 C until ready for analysis. 5. Titrations with the target of interest can be performed on the clonal yeast. The titration protocol is as previously described (Chao et al., 2006).
3.3. Expression of soluble Fn3 Soluble expression of Fn3s in E. coli has yielded approximately 50 mg/L of protein. Various expression vectors can be used ranging from the pET (Novagen, EMD Millipore), pMal (NEB), or pET SUMO (Invitrogen) vectors. These vectors can be altered to include a purification tag (i.e., His6 or FLAG) and the restriction sites NheI and BamHI if not already included. We use a modified-pET vector, pEThk, which includes a C-terminal His6KGSGK tag. The addition of two lysines provides primary amines that are available for chemical conjugation. 1. The Fn3 binder gene can be cut out using restriction enzyme digestion with NheI and BamHI following the manufacturer’s protocol. In parallel, the vector of interest should be digested with the same enzymes. 2. The digested product ( 300 bp) should be run on a gel and extracted with the Qiaquick Gel Extraction Kit (Qiagen) according to the manufacturer’s instructions.
324
Tiffany F. Chen et al.
3. The insert can then be ligated to the digested vector with Quick Ligase (NEB) or T4 DNA Ligase (NEB) according to the manufacturer’s protocol. The ligation product should then be transformed into XL1-Blue or DH5a supercompetent cells. The entire transformation should be plated on LB þ antibiotic plates (the antibiotic resistance varies depending on vector used). 4. Pick colonies from the plate into 5 mL cultures of LB þ antibiotic and allow to grow overnight at 37 C shaking at 250 rpm. Miniprep the cultures after approximately 16 h of growth and send the samples for sequencing along with the plasmid-specific sequencing primers. 5. Once the proper sequence is confirmed, the plasmid can be transformed into bacterial strains typically used for protein expression. Our preferred strain is Rosetta 2 (DE3) competent cells (Novagen, EMD Millipore). Transform 0.5 mL (50–250 ng) of the plasmid into 20 mL of cells using heat shock. Plate a fraction (1/5) of the cells on an LB þ antibiotic plate. 6. Pick a colony into a 5-mL overnight culture of LB þ antibiotic for approximately 16 h at 37 C shaking at 250 rpm. 7. Make a 1:1000 dilution of the overnight culture in fresh LB media with no antibiotics. Allow the culture to grow at 37 C shaking at 250 rpm until log phase ( OD600nm ¼ 0.5–1.0). 8. Induce with a 1:1000 dilution of 500 mM IPTG for a final concentration of 0.5 mM IPTG. Induce cells, shaking at 250 rpm at 37 C for approximately 4 h, 30 C for approximately 6 h, or 20 C for overnight inductions. 9. Fn3 protein can be collected by pelleting cells and lysing them using sonication or several freeze–thaw cycles. After cell lysis, protein should be purified using the proper resin depending on the purification tag fused to the Fn3.
4. SUMMARY YSD has been shown to be a powerful platform for protein engineering. In this chapter, we provided a detailed methodology for engineering binders from the 10th type III domain Fn3 protein scaffold. Engineering binders from this single-domain protein scaffold is different from typical scFv engineering. The inherent potential for convexity may alter preferred binding epitopes, while the potentially reduced diversified surface area relative to scFvs heightens the need for appropriate complementarity. Including a
Engineering Fibronectin-Based Binding Proteins by Yeast Surface Display
325
mutagenesis step after every two enrichments allows for the constant introduction of diversity and thoroughly utilizes directed evolution to affinity mature clones. These engineered Fn3 domains have a wide range of applications ranging from imaging (Hackel, Kimura, & Gambhir, 2012), in vitro detection and diagnosis (Gulyani et al., 2011), and in vivo therapeutics (Tolcher et al., 2011), and have many advantages because of their small size and single-domain architecture.
ACKNOWLEDGMENTS We are grateful to all other current and former Wittrup lab members for informative discussions and daily help. We also thank the Koch Institute Flow Cytometry Core facility and Biopolymers Core facility for FACS experiments and sequencing, respectively. Funding sources are from the Sanofi-aventis Biomedical Innovation award program, the NIH/NIGMS Biotechnology Training program, the Gordon & Adele Binder Fellowship, NIH Transformative R01 Program (R01EB010246-02), and Integrative Cancer Biology Program (ICBP) at MIT.
REFERENCES Ackerman, M., Levary, D., Tobon, G., Hackel, B., Orcutt, K. D., & Wittrup, K. D. (2009). Highly avid magnetic bead capture: An efficient selection method for de novo protein engineering utilizing yeast surface display. Biotechnology Progress, 25, 774–783. Binz, H. K., Amstutz, P., & Pluckthun, A. (2005). Engineering novel binding proteins from nonimmunoglobulin domains. Nature Biotechnology, 23, 1257–1268. Boder, E. T., Raeeszadeh-Sarmazdeh, M., & Price, J. V. (2012). Engineering antibodies by yeast display. Archives of Biochemistry and Biophysics, 526, 99–106. Boder, E. T., & Wittrup, K. D. (1997). Yeast surface display for screening combinatorial polypeptide libraries. Nature Biotechnology, 15, 553–557. Boder, E. T., & Wittrup, K. D. (1998). Optimal screening of surface-displayed polypeptide libraries. Biotechnology Progress, 14, 55–62. Bowley, D. R., Labrijn, A. F., Zwick, M. B., & Burton, D. R. (2007). Antigen selection from an HIV-1 immune antibody library displayed on yeast yields many novel antibodies compared to selection from the same library displayed on phage. Protein Engineering, Design and Selection, 20, 81–90. Chao, G., Lau, W. L., Hackel, B. J., Sazinsky, S. L., Lippow, S. M., & Wittrup, K. D. (2006). Isolating and engineering human antibodies using yeast surface display. Nature Protocols, 1, 755–768. Colby, D. W., Kellogg, B. A., Graff, C. P., Yeung, Y. A., Swers, J. S., & Wittrup, K. D. (2004). Engineering antibody affinity by yeast surface display. Methods in Enzymology, 388, 348–358. Gai, S. A., & Wittrup, K. D. (2007). Yeast surface display for protein engineering and characterization. Current Opinion in Structural Biology, 17, 467–473. Gulyani, A., Vitriol, E., Allen, R., Wu, J., Gremyachinskiy, D., Lewis, S., et al. (2011). A biosensor generated via high-throughput screening quantifies cell edge Src dynamics. Nature Chemical Biology, 7, 437–444. Hackel, B. J., Ackerman, M. E., Howland, S. W., & Wittrup, K. D. (2010). Stability and CDR composition biases enrich binder functionality landscapes. Journal of Molecular Biology, 401, 84–96.
326
Tiffany F. Chen et al.
Hackel, B. J., Kapila, A., & Wittrup, K. D. (2008). Picomolar affinity fibronectin domains engineered utilizing loop length diversity, recursive mutagenesis, and loop shuffling. Journal of Molecular Biology, 381, 1238–1252. Hackel, B. J., Kimura, R. H., & Gambhir, S. S. (2012). Use of (64)Cu-labeled fibronectin domain with EGFR-overexpressing tumor xenograft: Molecular imaging. Radiology, 263, 179–188. Hackel, B. J., Neil, J. R., White, F. M., & Wittrup, K. D. (2012). Epidermal growth factor receptor downregulation by small heterodimeric binding proteins. Protein Engineering, Design & Selection, 25, 47–57. Hackel, B. J., & Wittrup, K. D. (2010). The full amino acid repertoire is superior to serine/ tyrosine for selection of high affinity immunoglobulin G binders from the fibronectin scaffold. Protein Engineering, Design and Selection, 23, 211–219. Koide, A., & Koide, S. (2007). Monobodies: Antibody mimics based on the scaffold of the fibronectin type III domain. Methods in Molecular Biology, 352, 95–109. Lipovsek, D., Lippow, S. M., Hackel, B. J., Gregson, M. W., Cheng, P., Kapila, A., et al. (2007). Evolution of an interloop disulfide bond in high-affinity antibody mimics based on fibronectin type III domain and selected by yeast surface display: Molecular convergence with single-domain camelid and shark antibodies. Journal of Molecular Biology, 368, 1024–1041. Lo¨fblom, J., Feldwisch, J., Tolmachev, V., Carlsson, J., Sta˚hl, S., & Frejd, F. Y. (2010). Affibody molecules: Engineered proteins for therapeutic, diagnostic and biotechnological applications. FEBS Letters, 584, 2670–2680. Pirie, C. M., Hackel, B. J., Rosenblum, M. G., & Wittrup, K. D. (2011). Convergent potency of internalized gelonin immunotoxins across varied cell lines, antigens, and targeting moieties. The Journal of Biological Chemistry, 286, 4165–4172. Shapiro, H. M. (2005). Frontmatter, in Practical Flow Cytometry. Hoboken, NJ, USA: John Wiley & Sons, Inc. p. i–l. Skerra, A. (2007). Alternative non-antibody scaffolds for molecular recognition. Current Opinion in Biotechnology, 18, 295–304. Skerra, A. (2008). Alternative binding proteins: Anticalins—Harnessing the structural plasticity of the lipocalin ligand pocket to engineer novel binding activities. The FEBS Journal, 275, 2677–2683. Spangler, J. B., Manzari, M. T., Rosalia, E. K., Chen, T. F., & Wittrup, K. D. (2012). Triepitopic antibody fusions inhibit cetuximab-resistant BRAF- and KRAS-mutant tumors via EGFR signal repression. Journal of Molecular Biology, 422, 532–544. Stumpp, M. T., Binz, H. K., & Amstutz, P. (2008). DARPins: A new generation of protein therapeutics. Drug Discovery Today, 13, 695–701. Tolcher, A. W., Sweeney, C. J., Papadopoulos, K., Patnaik, A., Chiorean, E. G., Mita, A. C., et al. (2011). Phase I and pharmacokinetic study of CT-322 (BMS-844203), a targeted adnectin inhibitor of VEGFR-2 based on a domain of human fibronectin. Clinical Cancer Research, 17, 363–371.