Engineering glycolysis branch pathways of Escherichia coli to improve heterologous protein expression

G Model

ARTICLE IN PRESS

PRBI-10244; No. of Pages 8

Process Biochemistry xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

Process Biochemistry journal homepage: www.elsevier.com/locate/procbio

Engineering glycolysis branch pathways of Escherichia coli to improve heterologous protein expression Xian-zhong Chen a,∗ , Ying Xia a , Wei Shen a , You Fan a , Algasan Govender c , Zheng-xiang Wang b,∗ a

Key Laboratory of Industrial Biotechnology, Ministry of Education, School of Biotechnology, Jiangnan University, Wuxi 214122, China Key Laboratory of Industrial Fermentation Microbiology of Ministry of Education, Tianjin University of Science & Technology, Tianjin 300457, China c Department of Biotechnology & Food Technology, Faculty of Applied Sciences, Durban University of Technology, Durban 4001, South Africa b

a r t i c l e

i n f o

Article history: Received 5 August 2014 Received in revised form 17 September 2014 Accepted 18 September 2014 Available online xxx Keywords: Escherichia coli Metabolic engineering Aerobic metabolism d-Lactate dehydrogenase Pyruvate formate lyase Foreign protein production

a b s t r a c t Escherichia coli expression systems are still preferred to other bacterial expression systems. However, by-product formation via glycolytic pathways inhibits protein production efficiency. In this paper, byproduct-forming pathways were engineered to evaluate their effect on foreign protein production. Elimination of d-lactate dehydrogenase (encoded by ldhA) resulted in enhanced cell performance and 17.8% increase in recombinant ␤-mannanase production. Single deletions of pflB (encoding pyruvate formate lyase), pps (encoding phoenolpyruvate synthase) or poxB (encoding pyruvate oxidase) also had an affirmative impact on recombinant protein production. Furthermore, simultaneous deletions of ldhA, pflB, pps and poxB increased cell mass by 29% and ␤-mannanase production by 56% under shake-flasks cultivation. Meanwhile, overall acetate concentration showed a decrease of 33%. This quadruple mutant showed the best performance under bioreactor process, in which volume and specific activity of ␤-mannanase increased by 1.9 and 1.46 fold compared to the control strain respectively. The approach shown here indicated that rational engineering of glycolytic pathways can efficiently improve foreign protein production in E. coli. © 2014 Elsevier Ltd. All rights reserved.

1. Introduction The Escherichia coli foreign protein expression system continues to dominate bacterial expression systems and remains the preferred system for laboratory investigations as well as initial development of commercial activities due to its’ many outstanding features [1,2], some of which include the fact that this organism has been extensively studied, grows rapidly and is easy to genetic engineer [3]. To date, many industrial and therapeutic proteins such as human growth hormone [4], human leukemia inhibitory factor (hLIF) fusion protein [5] and Chikungunya virus envelope 2 protein [6] have been produced using E. coli expression systems. In general, recombinant protein production is affected by a vast range of precursors involved in the cell growth. Many biochemical and metabolic engineering strategies have therefore been developed toward high-level gene expression and high-cell-density cultivation using E. coli [1,7].

∗ Corresponding author. Tel.: +86 510 85918122; fax: +86 510 85918122. E-mail addresses: [email protected] (X.-z. Chen), [email protected] (Z.-x. Wang).

E. coli metabolizes glucose through the glycolysis pathway and the tricarboxylic acid cycle, which provides a large amount of energy and intermediate metabolites (Fig. 1). Indeed, E. coli belongs to the group of microbes known as mixed-acid producers that are capable of fermenting pyruvate to a number of potentially harmful acidic by-products including acetate, lactate, formate and succinate (Fig. 1). The harmful acetate is an organic acid known to be toxic to E. coli due to pH-based and anion-specific effects which inhibit biosynthesis [8]. A previous study found that acetate production is the main problem in batch fermentations leading to reduced recombinant protein yields, frequently occurring in anaerobic high-cell-density or aerobic fast-growing cultures [9]. In addition, acetate formation consumes more substrate and potentially results in a decrease in biomass and protein yield in a glucose-containing medium even when the culture is fully aerated. Similarly, fermentation conditions resulting in a reduction of foreign protein expression can be due to the accumulation of other by-products such as lactate, formate and succinate that could consume the carbon source by competing with the EMP pathway and tricarboxylic acid (TCA) cycle. Several bioprocess and genetic strategies have been developed to overcome the problem of by-product accumulation. These have

http://dx.doi.org/10.1016/j.procbio.2014.09.017 1359-5113/© 2014 Elsevier Ltd. All rights reserved.

Please cite this article in press as: Chen X-z, et al. Engineering glycolysis branch pathways of Escherichia coli to improve heterologous protein expression. Process Biochem (2014), http://dx.doi.org/10.1016/j.procbio.2014.09.017

G Model PRBI-10244; No. of Pages 8 2

ARTICLE IN PRESS X.-z. Chen et al. / Process Biochemistry xxx (2014) xxx–xxx Table 1 Strains and plasmids used in this study.

Fig. 1. Glucose metabolic and by-products forming pathways from glucose in E. coli under aerobic conditions. ackA: acetatekinase; adhE: alcohol dehydrogenase; frdABCD: fumarate reductase; ldhA: fermentative d-lactate dehydrogenase; pps: PEP synthase; pflB: pyruvate formate lyase; poxB: pyruvate oxidase; ppc: PEP carboxylase; pta: phosphotransacetylase; TCA: Tricarboxylic acid.

Strains and plasmids

Relevant characteristics

Sources

Strains B. amyloliquefaciens E. coli JM109 E. coli B0013 E. coli B0013-01 E. coli B0013-02 E. coli B0013-03 E. coli B0013-04 E. coli B0013-05 E. coli B0013-06 E. coli B0013-07 E. coli B0013-13 E. coli B0013-15 E. coli B0013-17

Wild type Cloning host Wild type E. coli B0013(ldhA::dif) E. coli B0013(ackA-pta::dif) E. coli B0013(pflB::dif) E. coli B0013(adhE::dif) E. coli B0013(pps::dif) E. coli B0013(frdA::dif) E. coli B0013(poxB::dif) E. coli B0013-01(pflB::dif) E. coli B0013-13(pps::dif) E. coli B0013-15(poxB::dif)

CICIM-CU, China CICIM-CU, China CICIM-CU, China This study This study This study This study This study This study This study This study This study This study

Plasmids pSK-EcdifGm pEtac-man pKD46 pKK-isa

Apr , Gmr , dif-Gm-dif cassette Kanr , Ptac , lacI, man Apr , help plasmid for gene deletion Kanr , Ptac , lacI, iso

CICIM-CU This study CGSC This study

In this study the genes corresponding for acetate, lactate, formate, pyruvate, succinate and ethanol pathways were deleted individually in E. coli B0013 strain and their impacts on the foreign protein expression were evaluated. Furthermore, combined gene deletions were carried out and different type foreign proteins were overexpressed in the multiple-genes deletion E. coli strain for identifying an efficient strategy for improved heterologous protein production. 2. Materials and methods 2.1. Strains, plasmids and chemicals

been reviewed recently by Eiteman and Altman [10]. A fed-batch process was the general method used to limit acetate accumulation. Xu et al. [11] developed a controlled carbon feeding strategy which was based on a dynamic model of glucose overflow metabolism in batch and fed-batch cultivations of E. coli under fully aerobic conditions. Removal of the inhibitory acetate via dialysis or electrodialysis was also used to improve the recombinant process productivity [12,13]. These studies, however, tend to be conservative, limiting overall process productivity, or lead to other problems, such as a decrease in maximum specific growth rate and lower product yield from carbon source. Khosla and Bailey [14] found heterologous expression of the Vitreoscilla hemoglobin coding gene in E. coli can improve protein production and cell performance under microaerobic conditions however, it was later found that this genetic modification could not reduce the accumulation of by-products [15]. Lara et al. [16] investigated impact of inactivation of ldhA, pflB or poxB genes on culture performance and foreign protein expression efficiency under transient anaerobic conditions. It was found that all mutant strains showed improved specific growth rate as well as reduced by-product formation and specific glucose uptake rate was also reduced compared to the parental strain. In particular, the triple mutant strain showed the best performance, in terms of specific growth and foreign protein production efficiency. The effect of alteration of mixed-acid formation pathways on the protein expression under aerobic conditions were not reported previously. More recently, Nocon et al. [17] found that elimination of several branch points of glycolysis involved to the reduction of the NADP/H pool and the deletion of fermentative pathways could lead to an enhanced production of recombinant protein in Pichia pastoris.

All strains and plasmids used in this study are described in Table 1. The wild type strain E. coli B0013, isolated and stored in our lab previously, was used as the parental strain to generate a series of mutants. E. coli JM109 was used for plasmid propagation. Electroporation transformation was employed using an Eppendorf Multiporator (Eppendorf, Hamburg, Germany) according to a previous report [18]. Restriction enzymes, T4 DNA ligase, Taq DNA polymerase and DNA markers were obtained from Takara Biotechnology Co. Ltd (Dalian, China). All other chemicals were of reagent grade and obtained from commercial sources. 2.2. Inactivation of genes All primers used in this study are shown in Table 2. The ldhA, pflB, pps, adhE, frdA, ack-pta and/or poxB genes were deleted. All gene deletion strains were derived from E. coli B0013 using the classical ␭ Red homologous recombination method as previously reported [19]. For example, the deletion procedure of ldhA gene was as follows. The ldhA gene was amplified by PCR from the chromosome of E. coli B0013 using primers LdhA1 and LdhA2. The size of the PCR product was determined by agarose gel electrophoresis. The PCR product was inserted into the SmalI site of the plasmid pUC19 to generate pUC19-ldhA. Using the resulting recombinant plasmid as the template and RldhA1 and RldhA2 as primers, reverse PCR was carried out. The amplified DNA fragment was then ligated to the difGm fragment which was isolated from the SmaI–SmaI sites of pSK-EcdifGm, to create pUC18-ldhA ::difGm. The resulting plasmid was digested with EcoRI and then used as a template to amplify the deletion cassette ldhA ::difGm using ldhA1 and ldhA2 as primers. The ldhA ::difGm cassette was then electro-transformed into E. coli

Please cite this article in press as: Chen X-z, et al. Engineering glycolysis branch pathways of Escherichia coli to improve heterologous protein expression. Process Biochem (2014), http://dx.doi.org/10.1016/j.procbio.2014.09.017

G Model PRBI-10244; No. of Pages 8

ARTICLE IN PRESS X.-z. Chen et al. / Process Biochemistry xxx (2014) xxx–xxx

Table 2 Primers used in this study. Primers

Sequence (5 –3 )

Restriction site

LdhA1 LdhA2 RldhA1 RldhA2 YldhA1 Gm2 Pps1 Pps2 Pps3 RPps1 RPps2 PflB1 PflB2 PflB3 PoxB3 PoxB4 pbaM02 pbaM03 B-2 B-end

CTTGAATTCAAGCTTGCTGCCGGAAATCATCATTTTTT GGGCAGCCCGAGCGTCATCAG TGTGCTATAAACGGCGAGTTTCATAAG CTGCCCGAACGAACTGGTTTAATCT TTCGCGGTCAGATCCACTTGTG TTTCCCGGGAAGCCGATCTCGGCTTGAACGAATTGTTAG CGGCATGAATGATGTAGACAGGGTT TAACCAGGTTTGCACCACGGTGT CGTGGCGATCAACAGCATTATCC TGTGGCGAAACATTCGGAAC GTCCGACCACGAAGACTTTGCC TTCAGACTTCGGACCAACCTGCA CCGCGAACTGGATCCGATGA TACCAAACTGCGGGTATTCGCC TTGGCACCACGCTACTGGAGG TTGCGGTTGAATACTGCCCAGC AATTACCGGTCGACTTATTCCGCGATCGGCG AATTACCGGAATTCATGCACACCGTTTACCCTGTCAATC TGCACTTAAGTGCAAGGTATCCATGAAGT CCCCTTAAGGGGCTTTTCCGCGATTATCAGTTT

EcoRI – – – – SmaI – – – – – – – – – – SalI EcoRI – –

B0013/pKD46, in which pKD46 contained the Red recombinase. Gentamycin resistant colonies were then screened and confirmed by colony PCR using corresponding primers. The gentamycin resistance gene was further excised at the dif sites by Xer recombinases. Deletion of ldhA gene was confirmed by PCR using the YldhA1 and ldhA2 primers and sequencing. Using the similar method, the pflB, pps, adhE, frdA, ack-pta and/or poxB genes were deleted. 2.3. Construction of recombinant plasmids The ␤-mannanase gene man was amplified from the genomic DNA of Bacillus amyloliquefaciens using the primers pbaM02 and pbaM03 (see Table 1). The resulting PCR fragment was inserted into the SalI and EcoRI sites of the pEtac vector to generate the recombinant plasmid pEtac-man. The positive clones were selected by growing colonies on LB plates supplemented with kanamycin. The recombinant plasmids were confirmed by digestion with the corresponding restriction enzymes. Similarly, a de-branching enzyme gene isa was amplified from genomic DNA of B. amyloliquefaciens using PCR amplification and the primers b-2 and b-end (Table 1). The resulting PCR fragment was inserted into the EcoRI site of the pKK223-3 vector to generate the recombinant plasmid pKK-isa. The positive clones were selected by growing colonies on LB plates supplemented with kanamycin. The correct plasmids were confirmed by digestion with the corresponding restriction enzymes. The above recombinant plasmids were transformed into the indicated hosts and the resulting recombinant strains were used to evaluate their cell performance and protein expression efficiency.

3

0.495. Kanamycin was supplemented to a final concentration of 50 ␮g/mL. IPTG was added as chemical inducer to a final concentration of 0.1 mM at the indicated time point or initial logarithmic phase of the cell growth. The IPTG and antibiotic solution were filter-sterilized through a 0.22 ␮m pore-size filter. 2.5. Growth and fermentation conditions For shake-flask experiments, strains (stored as glycerol stocks at −70 ◦ C) were first grown on LB medium plates for about 12 h at 37 ◦ C and subsequently colonies were transferred to 25 mL LB medium (10 g/L tryptone, 5 g/L yeast extract, 10 g/L NaCl) in a 250-mL flask. After 12 h growth, cells were harvested and resuspended in fermentation medium. This suspension was used to inoculate 30 mL fresh fermentation medium at a concentration of 0.02 g/L dry cell weight (DCW). Cells were cultured at 37 ◦ C and 200 rpm. To induce protein expression, the IPTG from a 100 mM stock was aseptically added at the indicated time point and the culture temperature decreased to the 28 ◦ C for recombinant protein production, otherwise when the optical density at 600 nm (OD600 ) reached about 1. At least three independent experiments were carried out. Bioreactor cultivation was performed in a 3-L fermentor (BioFlo 110, New Brunswick Scientific Co.). A 5% (v/v) of seed culture was inoculated into the fermentation medium (containing 50 ␮g/mL kanamycin or 100 ␮g/mL ampicillin) for cultivation. When a certain dry cell weight (DCW) (7 g/L) reached, 0.1 mM IPTG was added and temperature was decreased to 28 ◦ C for recombinant protein production. During the induction process, the glucose concentration was maintained about 5 g/L by adding glucose. During the whole process, the pH was kept at 7.0 by automatic addition of ammonia solution (25%, v/v). Antifoam was added manually when necessary. To maintain the dissolved oxygen level around 50% of air saturation, the agitation speed was varied from 400 to 1000 rpm. The air flow rate was 1.8 L/min. Fermentations were completed in triplicate, and statistical analyses were completed using the t-student test with SPSS 17.0 software (SPSS, Inc., Chicago, IL), with a P < 0.05 considered the criterion for statistical significance. 2.6. Cell fractionation and SDS-PAGE Recombinant strains cells were cells were harvested by centrifugation (2 min, 3500 × g), washed and re-suspended with phosphate buffer (pH 7.0). Thereafter the cells were sonicated (1-s bursts of ultrasonic sound and 3-s intervals over a total period of 15 min) at 4 ◦ C to release soluble intracellular proteins. Cell lysates were centrifuged at 9000 × g and 4 ◦ C for 5 min to recover the soluble intracellular contents. The protein concentration in the crude extracts was determined using the Bradford protein assay kit and bovine serum albumin was used as the standard. For analysis of soluble and insoluble proteins, the SDS–PAGE gel electrophoresis was performed using 5% stacking gel and 12% separating gel (Bio-Rad Laboratories, Hercules, CA).

2.4. Fermentation medium 2.7. Biochemical analysis Fermentation medium composition in grams per liter of distilled water was: glucose, 20.0; yeast extract, 11.5; casein tryptone, 19.5; (NH4 )2 SO4 , 4.0; KH2 PO4 , 3.0; K2 HPO4 ·3H2 O, 18.0; NaCl, 1.0. The pH of the culture medium was set to 7.0 with HCl and sterilized at 121 ◦ C for 25 min. Separate sterilized solutions of glucose and mineral salts were added to the medium once it was cold. MgCl2 was added to yield a final concentration of 0.095 g of MgCl2 /L of medium. The composition of the mineral salts solutions was (in grams per liter): FeCl3 ·6H2 O, 2.4; CoCl2 ·6H2 O, 0.3; CuCl2 ·2H2 O, 0.15; ZnCl2 , 0.3; Na2 MoO4 ·2H2 O, 0.3; H3 BO3 , 0.075; MnCl2 ·4H2 O,

Optical density during the cultivations was measured at 600 nm. A standard curve relating DCW to OD was constructed (1 OD600 = 0.38 g/L DCW). Glucose concentration was estimated by a biosensor (SBA-40C; Biology Institute of Shandong Academy of Sciences, Tsinan, China). Organic acid concentration was measured by HPLC (Shimadzu Scientific Instruments, Inc., Columbia, MD) equipped with an UV (210 nm) detector, using an Aminex HPX-87H column (300 mm × 7.8 mm; 9 ␮m). A mobile phase of 5 mM H2 SO4 was used at 0.6 mL/min, run at 50 ◦ C, UV detection at 210 nm.

Please cite this article in press as: Chen X-z, et al. Engineering glycolysis branch pathways of Escherichia coli to improve heterologous protein expression. Process Biochem (2014), http://dx.doi.org/10.1016/j.procbio.2014.09.017

G Model

ARTICLE IN PRESS

PRBI-10244; No. of Pages 8

X.-z. Chen et al. / Process Biochemistry xxx (2014) xxx–xxx

4

Table 3 The effect of single and combined gene deletions involved in mix-acid pathways on the culture performance, recombinant ␤-mannanase expression and by-products synthesis under shake flask fermentation conditions. Recombinant strains and the control were cultured in fermentation medium at 37 ◦ C and 200 rpm. Data are expressed as the mean values ± standard deviation of at least three independent experiments. Strain

Controld B0013-01/pEtac-man B0013-03/pEtac-man B0013-04/pEtac-man B0013-05/pEtac-man B0013-06/pEtac-man B0013-13/pEtac-man B0013-15/pEtac-man B0013-17/pEtac-man

Final concentration (g/L) d-Lactate

Acetate

0.35 ± 0.1 ND 0.36 ± 0.1 0.37 ± 0.0 0.37 ± 0.1 0.35 ± 0.1 ND ND ND

4.34 3.75 3.92 4.26 4.35 4.35 3.45 3.41 2.96

± ± ± ± ± ± ± ± ±

0.3 0.1 0.2 0.1 0.3 0.5 0.4 0.2 0.3

Specific activitiy (U/mg protein)a

Volume activity (U/mL)c

86.5 ± 2.5 96.4 ± 7.2 96.7 ± 3.9 85.8 ± 4.4 92.8 ± 2.8 87.3 ± 3.7 104.2 ± 2.8 109.9 ± 5.6 119.6 ± 10.1

29.2 34.4 34.1 28.0 33.6 29.3 36.8 40.8 45.2

b

Formate

Ethanol

Succinate

Pyruvate

Biomass

0.64 ± 0.1 0.52 ± 0.2 ND 0.64 ± 0.1 0.62 ± 0.2 0.61 ± 0.0 ND ND ND

0.04 ± 0.01 0.04 ± 0.0 0.04 ± 0.01 ND 0.04 ± 0.01 0.04 ± 0.01 0.03 ± 0.01 0.04 ± 0.0 0.03 ± 0.0

0.03 ± 0.0 0.03 ± 0.0 0.03 ± 0.0 0.02 ± 0.0 0.02 ± 0.0 ND 0.03 ± 0.01 0.03 ± 0.01 0.03 ± 0.01

0.1 ± 0.01 0.3 ± 0.01 0.1 ± 0.0 0.1 ± 0.01 ND 0.2 ± 0.01 0.2 ± 0.01 0.3 ± 0.01 0.1 ± 0.01

3.13 3.42 3.34 3.10 3.28 3.08 3.57 3.78 4.04

± ± ± ± ± ± ± ± ±

0.5 0.1 0.8 0.4 0.2 0.1 0.2 0.2 0.3.

± ± ± ± ± ± ± ± ±

2.2 2.8 3.1 1.5 2.4 1.7 4.1 3.6 5.2

ND: not detected. a indicates specific activity of ␤-mannanase, ␤-mannanase amount in per mg protein isolated from broth. b Dry cell weight. c Volume enzyme activity of ␤-mannanase, total ␤-mannanase activity in per mL broth. d Recombinant strain B0013/pEtac-man.

Mannanase activity was determined using locust bean gum (Sangon Biotech, Shanghai) as substrate by the dinitrosalicylic acid method as described previously [20]. A 500 ␮L assay containing 200 ␮L of a 0.5% (wt/vol) substrate suspension, 50 ␮L of 500 mM phosphate buffer and the desired dilution of enzyme was incubated for 5 min at 55 ◦ C. The reaction was stopped by addition of 500 ␮L of 3,5-dinitrosalicylic acid solution. A unit of mannanase activity was defined as the amount of enzyme which liberates 1 ␮mol of mannose per min under the given assay conditions. The debranching enzyme activity was assayed by measuring the formation of amylose using amylopectin (Sigma–Aldrich, Seelze, Germany) as substrate according to previous report [21] with modification. A 400 ␮L assay containing 300 ␮L of a 1% (wt/vol) substrate suspension, 100 ␮L of the desired dilution of enzyme, was incubated for 2 h at 45 ◦ C. A 200 ␮L aliquot from the 400 ␮L reaction mixture was mixed with 5 mL dilute iodine solution quickly and optical density was measured at 600 nm. One unit of debranching activity was defined as the amount of enzyme which results in an increase in absorbance by 0.01 at a wavelength of 600 nm in an hour. 3. Results and discussion 3.1. Effect of genes deletion on cell performance and ˇ-mannanase expression The genes of ldhA, pps, pflB, adhE and frdA were deleted independently using E. coli B0013 as a parent strain resulting in a series of engineered strains. Mutant strains were confirmed by PCR. The expression vector of pEtac-man harboring ␤-mannanase gene was constructed and transformed into E. coli B0013 and its derivates to generate various recombinant strains. These recombinant strains were cultivated in a fermentation medium and cell performance and ␤-mannanase production were investigated. LDH, which catalyses pyruvate to d-lactate, is present in substantial basal levels under all conditions but can be induced by low pH under anaerobic conditions. Previous studies indicated that anaerobic regulation of LDH not only might depend on the level of acetyl phosphate but can also be induced indirectly by increased sugar metabolism [22,23]. Also, d-lactate is involved in the regulation of the two-component global regulator of aerobic–anaerobic metabolism by affecting ArcB kinase activity as a physiologically significant effector [24]. Here, we found that deletion of the ldhA gene resulted in a significant increase of biomass and ␤-mannanase expression, in which the cell mass, the specific

activity and volume activity of ␤-mannanase increased by 9.3%, 11.4% and 17.8% (P < 0.05) respectively, compared to the control strain of B0013/pEtac-man (Table 3). These results indicated that engineering the lactate pathway could improve cell performance and foreign protein expression. Furthermore, elimination of LDH could not only abolish lactate production but also reduce acetate and formate synthesis significantly (Table 3). It was also found that deletion of pflB or pps could improve ␤-mannanase production to some extent when compared to the control strain B0013/pEtacman (Table 3). Formate accumulation in the control strain was 0.64 ± 0.1 g/L however, the recombinant strain B0013-03/pEtacman could not accumulate detectable formate (Table 3). This strain produced ␤-mannanase with a specific activity of 96.7 ± 3.9 U/mg protein and a volume activity of 34.1 ± 3.1 U/mL, indicating an increase of 11.8% and 16.8% (P < 0.05), respectively (Table 3). Previous studies have determined that intracellular ATP concentration was 18% higher in a pflB mutant growing under aerobic conditions, compared to the parental strain [18], which may be beneficial for biomass production and protein synthesis. Phosphoenolpyruvate synthetase (Pps) which catalyzes the direct conversion of pyruvate to phoenolpyruvate (PEP), competes with pyruvate dehydrogenase which mediates the formation of acetyl coenzyme A. Deletion of pps gene could increase the cell mass and the recombinant protein expression. ␤-Mannanase specific and volume activity were enhanced by 7.3% and 15% (P < 0.05) via elimination of Pps, respectively (Table 3). In addition, elimination of alcohol dehydrogenase and fumarate reductase had very little effect on fermentation properties (Table 3), which indicated that bypassing ethanol and succinate synthesis distributed only a small proportion of the carbon source. Previous reports demonstrated that fumarate reductase functions both as an anaerobic fumarate reductase and also as an aerobic succinate dehydrogenase in E. coli [25]. Our results indicate that ethanol and succinate were accumulated at a very low concentration (0.04 ± 0.01 g/L and 0.03 g/L, respectively) in the wild type under shake flasks cultivation. Therefore, low metabolic activity of fumarate reductase possibly existed in the parent strain under aerobic conditions, which had a slight effect on the cell performance and foreign protein expression. 3.2. Engineering the acetate pathway to improve foreign protein expression There are two acetate-forming pathways, one employed by acetate kinase-phosphotransacetylase (ackA-pta), another

Please cite this article in press as: Chen X-z, et al. Engineering glycolysis branch pathways of Escherichia coli to improve heterologous protein expression. Process Biochem (2014), http://dx.doi.org/10.1016/j.procbio.2014.09.017

G Model PRBI-10244; No. of Pages 8

ARTICLE IN PRESS X.-z. Chen et al. / Process Biochemistry xxx (2014) xxx–xxx

5

It has been reported that acetate inhibits cell growth and foreign gene expression [31], by reducing the pH value of the medium resulting in cell lysis [32]. Although pyruvate oxidase reaction is not the main acetate pathway, deletion of poxB could reduce to some extent acetate accumulation, which decreased to 3.24 ± 0.2 g/L from 4.34 ± 0.3 g/L (Fig. 2a). Moreover, elimination of the poxB pathway had a negligible effect on the cell mass and glucose consumption. Fig. 2b indicated that the specific and volume activity of ␤-mannanase of the recombinant strain B0013-07/pEtac-man were significantly higher 9.5% and 18.8% (P < 0.05), respectively compared to that of the recombinant control of B0013/pEtac-man. Results indicated that deletion of ldhA, pflB, pps or poxB could improve cell performance and heterologous protein production. Presumably, we can further investigate the impact of combined deletion of genes on the culture performance and by-products accumulation. 3.3. Effect of combined elimination of by-product pathways on culture performance and protein expression

Fig. 2. The effect of modifying ack-pta or poxB involved in the acetate pathway on by-products accumulation (a), and cell mass and ␤-mannanase expression efficiency (b). Each value is the mean ± SD of triplicates from three independent experiments.

employed by pyruvate oxidase (poxB) (Fig. 1). Engineering two pathways had a different impact on culture performance and ␤-mannanase expression. Deletion of the ack-pta led to the recombinant strain producing reduced amount of acetate, a decrease of 70.7% (P < 0.01) compared to the control strain B0013/pEtacman (Fig. 2a and Table 3). Although the recombinant strain B0013-02/pEtac-man showed higher ␤-mannanase specific activity, lower cell mass concentration and volume activity also occurred (Fig. 2b). At the same time, lactate and formate were produced at a higher concentration, an increase of 59.1% (0.49 ± 0.05 g/L) and 61.2% (0.81 ± 0.1 g/L), respectively compared to the control of B0013/pEtac-man (Fig. 2a and Table 3). Furthermore, elimination of the ack-pta pathway could reduce the consumption amount of acetyl-CoA, which inhibits the activity of pyruvate dehydrogenase resulting in pyruvate accumulation. Accordingly, a higher pyruvate concentration inhibits glucose transport, which reduces the glucose metabolic rate and thus growth rate [26]. These differences of cell performance and metabolic characteristics possibly resulted in the flux distributions between the glycolytic and TCA cycle, and reduction in ␤-mannanase production. Although acetate production under aerobic and anaerobic conditions is mainly derived from the ackA-pta pathway [27–29], our results indicated that its elimination has undesirable effects on cell growth. These effects included pyruvate excretion and decreased glucose consumption rate thus resulted in the reduced ␤-mannanase expression in E. coli. Similar results were also observed in previous investigations [27,30].

Combined elimination of mix-acid pathways for lactate, formate and acetate production were employed and engineered strains B0013-13(ldhA, pflB), B0013-15(ldhA, pflB, pps) and B0013-17(ldhA, pflB, pps, poxB) were generated. Recombinant strains containing pEtac-man were constructed and evaluated for their culture performance and foreign protein production. The control strain produced the highest amounts of by-products however, pyruvate was not detectable (Table 3). Combined deletion of ldhA, pflB resulted in not only depletion of lactate and formate accumulation, but also a decrease in acetate production (Table 3). Fig. 1 showed the formate pathway coupled with acetyl-CoA formation, which is involved in the synthesis of acetate. Therefore, deletion of the pflB gene to block the formate synthesis pathway could reduce the carbon wasted in producing formate and acetate. Accordingly, the ␤-mannanase volume activity of B0013-13/pEtacman reached 36.8 ± 4.1 U/mL. Meanwhile, a higher specific growth rate (0.62 ± 0.05 h−1 ) resulted in the final cell mass concentration of 3.78 ± 0.2 g/L from B0013-13/pEtac-man strain. Comparably, a specific growth rate of 0.5 ± 0.03 h−1 and a cell mass concentration of 3.13 ± 0.5 g/L were generated from the control strain of B0013/pEtac-man. Moreover, the combined deletion of ldhA, pflB and pps genes could further reduce by-product accumulation and increase cell performance and ␤-mannanase expression (Table 3). The reasonable speculation was that releasing more carbon source and ATP and balancing the redox potential in triple-mutant strain are attributed to better cell performance and heterologous protein expression of B0013-15/pEtac-man strain. The recombinant strain of B0013-17/pEtac-man produced ␤mannanase with a volume activity of 45.2 ± 5.2 U/mL and a specific activity of 119.6 ± 10.1 U/mg protein, which was 1.56 and 1.38-fold (P < 0.01) higher compared with the control strain B0013/pEtacman, respectively (Table 3). Furthermore, only 2.96 ± 0.3 g/L acetate was produced, which was 32% lower than that of control strain B0013/pEtac-man (Table 3). In addition, the B0013-17/pEtac-man strain produced undetectable lactate and formate however had the highest cell mass concentration (Table 3). This indicated that elimination of the PoxB protein followed by the deletion of ldhA, pflB and pps could improve the growth rate and biomass concentration of engineered strains. A previous study demonstrated that PoxB has a beneficial effect on the overall cell growth efficiency in a glucose minimal medium in which an aerobic glucose-limited chemostat culture process was employed [33]. Our results demonstrated that the combined deletion of the indicated genes could somewhat improve cell performance rather than impair it. One of explanations is that medium compositions and culture conditions were different, whereas the data in this study are from batch cultures

Please cite this article in press as: Chen X-z, et al. Engineering glycolysis branch pathways of Escherichia coli to improve heterologous protein expression. Process Biochem (2014), http://dx.doi.org/10.1016/j.procbio.2014.09.017

G Model PRBI-10244; No. of Pages 8 6

ARTICLE IN PRESS X.-z. Chen et al. / Process Biochemistry xxx (2014) xxx–xxx

grown in a complex medium with excess glucose. Meanwhile Dittrich et al. [28] found that when either the poxB or ackA-pta pathway was deleted, the cell growth rate and final cell mass of the mutants were higher that of the control type. In this study, the poxB− mutant showed a decrease in the conversion rate of acetate, however pyruvate was not accumulated to detectable levels in the fermentation broth. Under aerobic conditions, E. coli consumed pyruvate mainly by the pyruvate dehydrogenase complex, which can direct the substrate flow into the TCA cycle for aerobic respiration to produce more energy and intermediate metabolites. 3.4. Confirmation of enhanced protein production by engineered strain under dissolved oxygen-controlledconditions Dissolved oxygen is very critical for the aerobic growth of E. coli and recombinant protein production [34]. Although shake-flasks is traditionally used in biotechnological process research, it is difficult to accurately control the dissolved oxygen level in the broth under shake-flasks conditions, To certify that engineering mixed-acid fermentation pathways could improve foreign protein production, experiments were performed in a 3 L controlled bioreactor. Fig. 3a showed that the final cell concentrations were similar between the control strain of B0013/pEtac-man strain and the engineered strain of B0013-17/pEtac-man, however the more enhanced protein production were obtained from the later strain. Strain of B0013-17/pEtac-man produced 390.8 ± 17.7 U/mL ␤-mannanase with a specific activity of 150.1 ± 12.2 U/mg protein, which was about 1.9 and 1.46 fold higher than that of the control strain of B0013/pEtac-man (Fig. 3a). Furthermore, compared to the batch cultures in shake flasks, the bioreactor approach resulted in an improvement of 8.6 fold (P < 0.01) of the overall volumetric activity and 1.3 fold of the specific activity. These results demonstrated that it was possible to obtain a high recombinant production even at high cell densities and indicated that optimization of dissolved oxygen concentration could further improve foreign protein production. The lower acetate (0.9 ± 0.06 g/L) concentration was obtained from the strain of B0013-17/pEtac-man using dissolved oxygencontrolled cultivation compared to the shake flasks process (Fig. 3b). Interestingly, a very small change in ethanol and pyruvate accumulations were observed in bioreactor cultures, compared to shake flask conditions. However succinate was produced with a somewhat higher concentration (0.15 ± 0.02 g/L) under bioreactor conditions (Fig. 3b). The control strain of B0013-17/pEtac-man also produced by-products with lower concentrations except for pyruvate under bioreactor process (Fig. 3b). Moreover, a large reduction in acetate accumulation was observed and only 1.6 ± 0.12 g/L of acetate was generated by the control strain (Fig. 3b). Therefore, our results indicated that deletion of poxB gene had a small impact on the acetate production under aerobic conditions and efficient dissolved oxygen could decrease the acetate accumulation. This is in basic agreement with data from other reports [16,18]. Lara et al. [16] found that combined engineering ldhA, pflB and poxB genes could reduce acetate accumulation by 9–12% under the constant dissolved oxygen tension (10%) compared to the control strain. In addition, the ␤-mannanase content was further analyzed by SDS-PAGE (Fig. 3C). The soluble ␤-mannanase was clearly predominant in the total soluble protein fraction after induction. Moreover, very small fraction of ␤-mannanase was in the form of inclusion bodies during fermentation process. 3.5. Expression of the bacterial debranching gene (isa) To assess the contribution and fitness of engineering byproduct-forming pathways to the foreign protein production,

Fig. 3. Comparison of ␤-mannanase production and by-products formation by different host under the bioreactor cultivation. The dissolved oxygen level was constantly maintained at 30% during the fermentation process. Data are the averages from at least two independent experiments. (a) Cell mass and ␤-mannanase production by strains of B0013/pEtac-man and B0013-17/pEtac-man, respectively. (b) By-products concentrations in the fermentation broth using various recombinant strains. (c) SDS-PAGE of proteins prepared from extracts of E. coli B0013-17/pEtacman. Line 1, total protein; Line 2, soluble protein; Line 3, insoluble protein; Line M, molecular weight standards. The arrow indicates the position of ␤-mannanase in the gel.

another recombinant plasmid pKK-isa harboring a debranching enzyme gene under the tac promoter was constructed and introduced into strains of B0013 and B0013-17, respectively. Cell performance and protein expression efficiency were evaluated

Please cite this article in press as: Chen X-z, et al. Engineering glycolysis branch pathways of Escherichia coli to improve heterologous protein expression. Process Biochem (2014), http://dx.doi.org/10.1016/j.procbio.2014.09.017

G Model PRBI-10244; No. of Pages 8

ARTICLE IN PRESS X.-z. Chen et al. / Process Biochemistry xxx (2014) xxx–xxx

7

Table 4 Comparison of culture performance and debranching enzyme expression efficiency of the recombinant strains E. coli B0013/pKK-isa and B0013-17/pKK-isa. Recombinant strains were cultured in fermentation medium at 37 ◦ C and 200 rpm. Experiments were done at least three times and representative data are shown. Strains

B0013/pKK-isa B0013-17/pKK-isa

Specific activity (U/mg protein)

41.9 ± 3.2 65.9 ± 4.6

Volume activity (U/mL)

8.36 ± 0.5 15.39 ± 3.9

Final cell mass and by-products concentration (g/L)

Biomass

Lactate

Acetate

Formate

Ethanol

Succinate

Pyruvate

2.38 ± 0.2 2.97 ± 0.1

0.28 ± 2.1 ND

4.13 ± 0.3 2.65 ± 0.1

0.54 ± 2.1 ND

0.03 ± 0.01 0.03 ± 0.01

0.03 ± 0.01 0.03 ± 0.01

0.2 ± 0.01 0.2 ± 0.02

ND: not detected.

using the two recombinant strains cultured in the fermentation medium. The control strain B0013/pKK-isa produced 8.36 ± 0.5 U/mL debranching enzyme and 2.38 ± 0.2 g/L cell mass. Comparably, the recombinant strain B0013-17/pKK-isa produced 15.39 ± 3.9 U/mL debranching enzyme and 2.97 ± 0.1 g/L cell mass, an increase of 82% and 25% (P < 0.01), respectively (Table 4). Further investigation found that the specific activity of 65.9 ± 4.6 U/mg protein generated from the B0013-17/pKK-isa strain was significantly higher than that of control, which produced recombinant enzyme with a specific activity of 41.9 ± 3.2 U/mg protein (Table 4). Furthermore, by-products contents produced by the B0013-17/pKK-isa strain were very lower compared to the control strain (Table 4). In summary, our results demonstrated that simultaneous deletion of ldhA, pflB, pps and poxB could significantly increase the desired protein production and improve cell performance. It indicates that reducing by-products formation through engineering the mixed-acid fermentation pathways might be an efficient strategy for improving foreign protein production in E. coli. Additionally, the results showed that the dissolved oxygen-controlled process could significantly decrease organic acids formation and had an active impact on the aerobic metabolic pathways. The information provided may be useful toward the rational design of metabolically engineered strains for improved heterologous protein production under aerobic conditions. Acknowledgements The authors gratefully acknowledge the financial support from the National Natural Science Foundation of China (No. 21006039), the science and technology support program of Jiangsu province (No. BE2012618), and the 111 Project (No. 111-2-06). References [1] Chen R. Bacterial expression systems for recombinant protein production: E. coli and beyond. Biotechnol Adv 2012;30(5):1102–7. [2] Park MK, Lee SH, Yang KS, Jung SC, Lee JH, Kim SC. Enhancing recombinant protein production with an Escherichia coli host strain lacking insertion sequences. Appl Microbiol Biotechnol 2014;98(15):6701–13. [3] Terpe K. Overview of bacterial expression systems for heterologous protein production: from molecular and biochemical fundamentals to commercial systems. Appl Microbiol Biotechnol 2006;72(2):211–22. [4] Valdez-Cruz NA, Caspeta L, Pérez NO, Ramírez OT, Trujillo-Roldán MA. Production of recombinant proteins in E. coli by the heat inducible expression system based on the phage lambda pL and/or pR promoters. Microb Cell Fact 2010;9(1):18. [5] Imsoonthornruksa S, Noisa P, Parnpai R, Ketudat-Cairns M. A simple method for production and purification of soluble and biologically active recombinant human leukemia inhibitory factor (hLIF) fusion protein in Escherichia coli. J Biotechnol 2011;151(4):295–302. [6] Tripathi NK, Priya R, Shrivastava A. Production of recombinant Chikungunya virus envelope 2 protein in Escherichia coli. Appl Microbiol Biotechnol 2014;98(6):2461–71. [7] Zwick F, Lale R, Valla S. Strong stimulation of recombinant protein production in Escherichia coli by combining stimulatory control elements in an expression cassette. Microb Cell Fact 2012;11:133.

[8] Wong M, Wright M, Woodley JM, Lye GJ. Enhanced recombinant protein synthesis in batch and fed-batch Escherichia coli fermentation based on removal of inhibitory acetate by electrodialysis. J Chem Technol Biotechnol 2009;84(9):1284–91. [9] Babaeipour V, Shojaosadati SA, Khalilzadeh R, Maghsoudi N, Tabandeh F. A proposed feeding strategy for the overproduction of recombinant proteins in Escherichia coli. Biotechnol Appl Biochem 2008;49(Pt 2):141–7. [10] Eiteman MA, Altman E. Overcoming acetate in Escherichia coli recombinant protein fermentations. Trends Biotechnol 2006;24:530–6. [11] Xu B, Jahic M, Enfors SO. Modeling of overflow metabolism in batch and fed-batch cultures of Escherichia coli. Biotechnol Prog 1999;15: 81–90. [12] Fuchs C, Koster D, Wiebusch S, Mahr K, Eisbrenner G, Märkl H. Scale-up of dialysis fermentation for high cell density cultivation of Escherichia coli. J Biotechnol 2002;93(3):243–51. [13] Warnecke T, Gill RT. Organic acid toxicity, tolerance, and production in Escherichia coli biorefining applications. Microb Cell Fact 2005;4:25. [14] Khosla C, Bailey JE. Heterologous expression of a bacterial haemoglobin improves the growth properties of recombinant Escherichia coli. Nature 1988;331:633–5. [15] Khosla C, Curtis JE, DeModena J, Rinas U, Bailey JE. Expression of intracellular hemoglobin improves protein synthesis in oxygen-limited Escherichia coli. Biotechnology (N Y) 1990;8(9):849–53. [16] Lara AR, Vazquez-Limon C, Gosset G, Bolívar F, López-Munguía A, Ramírez OT. Engineering Escherichia coli to improve culture performance and reduce formation of by-products during recombinant protein production under transient intermittent anaerobic conditions. Biotechnol and Bioeng 2006;94:1164–75. [17] Nocon J, Steiger MG, Pfeffer M, Sohn SB, Kim TY, Maurer M, et al. Model based engineering of Pichia pastoris central metabolism enhances recombinant protein production. Metab Eng 2014;24C:129–38. [18] Zhu J, Shimizu K. The effect of pfl gene knockout on the metabolism for optically pure d-lactate production by Escherichia coli. Appl Microbiol Biotechnol 2004;64(3):367–75. [19] Zhou L, Zuo ZR, Chen XZ, Niu DD, Tian KM, Prior BA, et al. Evaluation of genetic manipulation strategies on d-lactate production by Escherichia coli. Curr Microbiol 2011;62(3):981–9. [20] Talbot G, Sygusch J. Purification and characterization of thermostable betamannanase and alpha-galactosidase from Bacillus stearothermophilus. Appl Environ Microbiol 1990;56(11):3505–10. [21] Li YR, Zhang L, Ding ZY, Shi GY. Constitutive expression of a novel isoamylase from Bacillus lentus in Pichia pastoris for starch processing. Process Biochem 2007;48:1303–10. [22] Bunch PK, Mat-Jan F, Lee N, Clark DP. The ldhA gene encoding the fermentative lactate dehydrogenase of Escherichia coli. Microbiology 1997;143(Pt 1): 187–95. [23] Jiang GR, Nikolova S, Clark DP. Regulation of the ldhA gene, encoding the fermentative lactate dehydrogenase of Escherichia coli. Microbiology 2001;147(Pt 9):2437–46. [24] Rodriguez C, Kwon O, Georgellis D. Effect of d-lactate on the physiological activity of the ArcB sensor kinase in Escherichia coli. J Bacteriol 2004;186(7):2085–90. [25] Cecchini G, Sices H, Schröder I, Gunsalus RP. Aerobic inactivation of fumarate reductase from Escherichia coli by mutation of the [3Fe-4S]-quinone binding domain. J Bacteriol 1995;177(16):4587–92. [26] Liao JC, Hou SY, Chao YP. Pathway analysis, engineering, and physiological considerations for redirecting central metabolism. Biotechnol and Bioeng 1996;52(1):129–40. [27] Diaz-Ricci JC, Regan L, Bailey JE. Effect of alteration of the acetic acid synthesis pathway on the fermentation pattern of Escherichia coli. Biotechnol Bioeng 1991;38(11):1318–24. [28] Dittrich CR, Bennett GN, San KY. Characterization of the acetate-producing pathways in Escherichia coli. Biotechnol Prog 2005;21(4):1062–7. [29] Dittrich CR, Vadali RV, Bennett GN, San KY. Redistribution of metabolic fluxes in the central aerobic metabolic pathway of E. coli mutant strains with deletion of the ackA-pta and poxB pathways for the synthesis of isoamyl acetate. Biotechnol Prog 2005;21(2):627–31. [30] Bauer KA, Ben-Bassat A, Dawson M, de la Puente VT, Neway JO. Improved expression of human interleukin-2 in high-cell-density fermentor cultures of Escherichia coli K-12 by a phosphotransacetylase mutant. Appl Environ Microbiol 1990;56(5):1296–302.

Please cite this article in press as: Chen X-z, et al. Engineering glycolysis branch pathways of Escherichia coli to improve heterologous protein expression. Process Biochem (2014), http://dx.doi.org/10.1016/j.procbio.2014.09.017

G Model PRBI-10244; No. of Pages 8 8

ARTICLE IN PRESS X.-z. Chen et al. / Process Biochemistry xxx (2014) xxx–xxx

[31] Contiero J, Beatty C, Kumari S, DeSanti CL, Strohl WR, Wolfe A. Effects of mutations in acetate metabolism on high-cell-density growth of Escherichia coli. J Ind Microbiol Biotechnol 2000;24(6):421–30. [32] Cherrington CA, Hinton M, Pearson GR, Chopra I. Short-chain organic acids at pH 5.0 kill Escherichia coli and Salmonella spp. without causing membrane perturbation. J Appl Microbiol 1991;70(2):161–5.

[33] Abdel-Hamid AM, Attwood MM, Guest JR. Pyruvate oxidase contributes to the aerobic growth efficiency of Escherichia coli. Microbiology 2001;147(6): 1483–98. [34] Klein T, Schneider K, Heinzle E. A system of miniaturized stirred bioreactors for parallel continuous cultivation of yeast with online measurement of dissolved oxygen and off-gas. Biotechnol Bioeng 2013;110:535–42.

Please cite this article in press as: Chen X-z, et al. Engineering glycolysis branch pathways of Escherichia coli to improve heterologous protein expression. Process Biochem (2014), http://dx.doi.org/10.1016/j.procbio.2014.09.017