Engineering of bone using rhBMP-2-loaded mesoporous silica bioglass and bone marrow stromal cells for oromaxillofacial bone regeneration

Microporous and Mesoporous Materials 173 (2013) 155–165

Contents lists available at SciVerse ScienceDirect

Microporous and Mesoporous Materials journal homepage: www.elsevier.com/locate/micromeso

Engineering of bone using rhBMP-2-loaded mesoporous silica bioglass and bone marrow stromal cells for oromaxillofacial bone regeneration Lunguo Xia a,b,1, Deliang Zeng b,c,1, Xiaojuan Sun d, Yuanjin Xu a, Lianyi Xu b,c, Dongxia Ye b, Xiuli Zhang b, Xinquan Jiang b,c,⇑, Zhiyuan Zhang a,b,⇑ a

Department of Oral and Maxillofacial Surgery, Ninth People’s Hospital Affiliated to Shanghai Jiao Tong University, School of Medicine, 639 Zhizaoju Road, Shanghai 200011, PR China Oral Bioengineering Lab, Shanghai Research Institute of Stomatology, Ninth People’s Hospital Affiliated to Shanghai Jiao Tong University, School of Medicine, Shanghai Key Laboratory of Stomatology, 639 Zhizaoju Road, Shanghai 200011, PR China c Department of Prosthodontics, Ninth People’s Hospital Affiliated to Shanghai Jiao Tong University, School of Medicine, 639 Zhizaoju Road, Shanghai 200011, PR China d Department of Oral Maxillofacial Surgery, General Hospital of Ningxia Medical University, Ningxia 750004, PR China b

a r t i c l e

i n f o

Article history: Received 30 July 2012 Received in revised form 17 December 2012 Accepted 10 February 2013 Available online 26 February 2013 Keywords: Mesoporous silica bioglass rhBMP-2 Bone marrow stromal cells Tissue engineering Oromaxillofacial bone regeneration

a b s t r a c t In present study, CaO–P2O5–SiO2-system mesoporous silica (MS) scaffolds were synthesized and loaded with recombinant human bone morphogenetic protein-2 (rhBMP-2), while their protein release properties and other characteristics were investigated. Furthermore, rabbit bone marrow stromal cells (bMSCs) were cultured and seeded on rhBMP-2-loaded MS (rhBMP-2/MS) scaffolds. Cell adhesion and proliferation were evaluated by scanning electron microscopy (SEM) and MTT assays, while osteogenic differentiation was measured by ALP activity and real-time PCR analysis on the osteogenic markers of runtrelated transcription factor 2 (Runx2), collagen type 1 (COL1), osteocalcin (OCN), and osteopontin (OPN). Finally, twenty-four rabbits received unilateral maxillary sinus floor elevation surgery at each time point (2 and 8 weeks), and randomly filled with one of the following four materials: MS alone; autologous bMSCs/MS complexes; rhBMP-2/MS complexes; or autologous bMSCs/rhBMP-2/MS complexes. New bone formation and mineralization were detected by histological/histomorphometric analysis, and fluorochrome labeling. The results showed that MS scaffolds presented excellent hierarchically large pore and well-ordered mesopore properties; moreover, rhBMP-2/MS scaffolds efficiently released rhBMP-2 in a sustained manner. Furthermore, rhBMP-2/MS scaffolds significantly enhanced the proliferation and osteogenic differentiation of bMSCs. In the maxillary sinus floor elevation experiments, rhBMP2/MS scaffolds promoted new bone formation and augmented the height of the sinus floor, while the addition of bMSCs further enhanced new bone formation and mineralization. The present study revealed that CaO–P2O5–SiO2-system MS scaffolds could act as drug delivery carriers for rhBMP-2 and could be used to construct tissue-engineered bone with bMSCs for oromaxillofacial bone regeneration. Ó 2013 Elsevier Inc. All rights reserved.

1. Introduction Tissue regeneration for jaw bone defects caused by tumor resection, infection, trauma, congenital malformation, or bone deficiencies with aging and anatomic etiologies, remains a challenging problem in oromaxillofacial medicine [1–3]. Autogenous bone grafting is as the ‘‘gold standard’’ for bone regeneration, but has major disadvantages including infection, pain, and loss of function, limiting its clinical application. Moreover, the use of allograft or xenograft tissue as a substitute for autogenous bone, may be limited by the complications such as disease transmission, immunogenic response and limited supply [4–6]. Fortunately, with the ⇑ Corresponding authors. Tel.: +86 21 63135412; fax: +86 21 63136856. E-mail addresses: [email protected] (X. Jiang), [email protected] (Z. Zhang). 1 These authors contributed equally to this work. 1387-1811/$ - see front matter Ó 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.micromeso.2013.02.020

development of stem cells and biomaterial scaffold technology, tissue-engineered bone could be developed as an alternative to achieve better outcomes in oromaxillofacial bone regeneration. Bone tissue engineering is defined as construction of new bone tissue in vitro or in vivo using biomaterials, cells, and growth factors, alone or in combination, based on the basic principles of biology and engineering [7,8]. Biomaterial scaffolds for bone regeneration should possess a series of biological properties, such as good biocompatibility, biodegradability and osteoinductivity. As a synthetic bone graft substitutes, bioactive glass has been studied extensively and used clinically for bone regeneration to induce bone formation and to strongly bond to surrounding bone tissue in vivo [9,10]. However, the new bone growth stimulated by bioactive glass is often limited by several drawbacks. For example, their osteoconduction may not closely approximate that of the host bone, and they may not

156

L. Xia et al. / Microporous and Mesoporous Materials 173 (2013) 155–165

achieve osteoinduction in nature [9]. To solve these problems, the strategies involving the loading of osteoinductive growth factors on bioactive glass scaffolds have been attempted to enhance the ability to stimulate cell differentiation and tissue growth. However, traditionally bioactive glass scaffolds lack efficient delivery capabilities [11]. Recently, mesoporous bioglass (MBG), which has a highly ordered mesopore channel structure with a pore size ranging from 5 to 50 nm, has attracted significant attention in the field of bone regeneration [12,13]. Moreover, MBG scaffolds exhibit greatly enhanced in vitro apatite mineralization, degradation, and drug delivery capability compared with non-mesopore bioglass, due to their more optimal surface area and pore volume [11,12]. It has been reported that MBG scaffolds could support cell adhesion, proliferation and differentiation in vitro. More importantly, MBG might be an excellent drug delivery carrier for osteogenic growth factors or drugs [14–16]. Recently, it was reported that recombinant human bone morphogenetic protein-2 (rhBMP-2) was successfully loaded on calcium/magnesium-doped mesoporous silica (MS) scaffolds and preliminarily applied for bone regeneration [17]. However, no systematic analysis of the rhBMP-2 delivery properties of the MS scaffolds, and their effects on cell proliferation, differentiation without magnesium interference, in vivo bone regeneration or material degradation, has been conducted. More importantly, it is largely unknown whether this MS delivery system could be combined with bone marrow stromal cells (bMSCs) to achieve better bone regeneration. In present study, we hypothesized rhBMP-2-loaded MBG scaffolds could release protein in a sustained manner and that tissue-engineered bone combined with rhBMP-2-loaded MBG and bMSCs may be a better alternative technique for oromaxillofacial bone regeneration. To confirm our hypothesis, CaO–P2O5–SiO2-system MS scaffolds were synthesized, characterized, and then loaded with rhBMP-2. Further, the rhBMP-2 delivery properties of the scaffolds and their effects on proliferation and differentiation of rabbit bMSCs were evaluated systematically in vitro. Finally, a tissue-engineered bone was constructed using the rhBMP-2-loaded MS scaffolds and bMSCs, and used for maxillary sinus floor elevation in a rabbit model, which served as a standardized model of oromaxillofacial bone regeneration [2,18–22]. 2. Materials and methods 2.1. Preparation and characterization of rhBMP-2-loaded MS scaffolds The MS scaffolds were fabricated using the replication technique (also called polymeric sponge method), as previously described [17]. Briefly, the MS bioglass species were synthesized by a modified template-induced and self-assembly method, while nonionic block copolymer EO20PO70EO20 (Pluronic P123, BASF) and tetraethylorthosilicate (TEOS, Sigma, USA) acted as a structure directing agent and silica source, respectively. In a typical reaction, 1 g HCl and 4.0 g P123 were added to 60 mL ethanol with stirring for 3 h; then 0.74 g of Ca(NO3)24H2O, 0.3833 g of triethyl ephosphate (TEP) and 6.7 g of TEOS were added to the above solution, and stirred at room temperature for 24 h. Subsequently, the polyurethane foam was immersed into the silica sol and compressed to ensure complete penetration of the sol throughout the entire foam structure, while the excess sol was squeezed out to provide a reasonably homogeneous coating on the struts so that the pores remained open. The same procedure was repeated after the foams were dried under a fume hood with air at room temperature for 24 h. Finally, an optimized heat treatment program was applied to eliminate the surfactant and polyurethane template and to

increase the density of the struts. The calcination was carried out in air at 600 °C for 10 h at a ramping rate of 5 °C/min. The polyurethane foams were cut to the desired size (5  5  5 mm3) and immersed in 0.1 M NaOH solution, rinsed with deionized water, and then dried and stored in a vacuum desiccator before use. To prepare the rhBMP-2-loaded MS scaffolds, 20 lL of 1 mg/mL rhBMP-2 solution (Rebone, China) was added to the MS scaffolds (20 lg rhBMP-2 for each sample) using a pipette and freeze dried for 24 h. The ordered mesoporous structure of MS scaffolds was evaluated by small-angle X-ray diffraction (SAXRD, Rigaku, Japan) and high-resolution transmission electron microscopy (HRTEM, JEOL, Japan). The surface area and the pore size distribution were evaluated by Brunauer-Emmett-Teller (BET) and Barrett-Joyner-Halenda (BJH) analysis (Micrometrics, USA). The microstructure of MS scaffolds was determined by scanning electron microscopy (SEM) observation. 2.2. Measurement of rhBMP-2 release from rhBMP-2-loaded MS scaffolds To measure rhBMP-2 release from rhBMP-2-loaded MS (rhBMP2/MS) scaffolds, 3 mL simulated body fluid (including NaCl, NaHCO3, KCl, K2HPO43H2O, MgCl26H2O, CaCl2 and Na2SO4) solution was added to rhBMP-2/MS scaffolds, and the scaffolds were then placed into the thermostat oscillator (37 °C, 50 r/min). The rhBMP-2 protein release from the samples at 6, 12, 24, 72, 144, 216, 288, 360, 432, and 504 h was determined using an rhBMP-2 enzyme-linked immunosorbent assay (ELISA) Kit (R&D Systems, USA) according to the manufacturer’s instruction. The results were reported as the ratio of the rhBMP-2 released at various time points to the total rhBMP-2. 2.3. Isolation and culture of rabbit bMSCs Forty-eight male New Zealand White rabbits weighing 2–2.5 kg were used in this experiment. All animal procedures in present study were approved by the Animal Research Committee of the Ninth People’s Hospital affiliated to Shanghai Jiao Tong University, School of Medicine. A 3 mL bone marrow sample was aspirated from a rabbit fibula, and then cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, USA) in a humidified 37 °C and 5% CO2 incubator. On day 5, the medium containing non-adherent cells was removed and replaced with fresh medium; while the remaining adherent cells were mainly mesenchymal stromal cells. The cells were passaged once for expansion, at a confluence of approximately 80%. After the first passage, the growth medium was replaced with osteogenic medium (DMEM, 10% FBS, 50 lg/mL L-ascorbic acid, 10 mM glycerophosphate and 100 nM dexamethasone). bMSCs after passage 2 cultured in osteogenic medium with a seeding density of 2  104 cells/mL were used for each in vitro assay, as described previously [2,19]. 2.4. Cell adhesion and growth assay The adhesion and growth of rabbit bMSCs seeded on MS and rhBMP-2/MS scaffolds were determined by SEM observation. At days 1 and 4 after cell seeding, the cell/scaffold complexes were fixed in 2% glutaraldehyde for 2 h, and then dehydrated in increasing concentrations of ethanol. Finally, the samples were dried by hexamethyldisilazane, sputter-coated with gold and observed by SEM (JEOL, Japan).

157

L. Xia et al. / Microporous and Mesoporous Materials 173 (2013) 155–165

2.5. Cell proliferation assay MTT assay was used to assess cell proliferation at days 1, 4 and 7 after rabbit bMSCs seeded on MS and rhBMP-2/MS scaffolds in 24-well plates. Three samples of co-cultured constructs for each group were placed in culture medium containing MTT and incubated at 37 °C for 4 h to form MTT formazan. Finally, dimethyl sulfoxide (DMSO, Sigma, USA) was used to stop the reaction, and the absorbance of the solution was measured at 490 nm with a microplate reader (Bio–Tek, USA). The results were expressed in units of optical density (O.D.). All experiments were performed in triplicate. 2.6. Cell osteogenic differentiation assay The ALP activity of rabbit bMSCs seeded on MS and rhBMP-2/ MS scaffolds was evaluated at days 7 and 14. Briefly, bMSCs were detached with 0.25% trypsin/ethylenediaminetetraacetic acid (EDTA) and suspended in lysis buffer with 0.2% NP-40, then the cells were mixed with pnitrophenyl phosphate (pNPP, 1 mg/mL, Sigma, USA) in 1 M diethanolamine buffer and incubated at 37 °C for 15 min. The reaction was stopped by adding 3 N NaOH. Finally, ALP activity was measured by absorbance measurements at 405 nm, while the total protein content was determined with the Bio–Rad protein assay kit (Bio–Rad, USA) at 630 nm and calculated with reference to a series of bovine serum albumin (BSA, Sigma, USA) standards. ALP activity was expressed as the O.D. value at 405 nm per milligram of total cellular proteins. All experiments were performed in triplicate. Real-time polymerase chain reaction (PCR) assay was used to measure the osteogenic gene expression of rabbit bMSCs seeded on MS and rhBMP-2/MS scaffolds at days 4 and 7, respectively. Briefly, the cells were collected and resuspended in Trizol reagent (Invitrogen, USA). Chloroform was added to the cell extract to separate the RNA into the aqueous phase, and then the aqueous phase was recovered and precipitated with isopropanol. The RNA pellet was rinsed with 70% ethanol that had been treated with the RNase inhibitor diethyl pyrocarbonate (DEPC, Sigma, USA), and finally solubilized in sterile DEPC-treated water. The RNA was used to synthesize complementary DNA (cDNA) with PrimeScript 1st Strand cDNA Synthesis kit (TaKaRa, Japan). Real-time PCR analysis was performed with the Bio–Rad real-time PCR system (Bio–Rad, USA) on the osteogenic markers of runt-related transcription factor 2 (Runx2), collagen type 1 (COL1), osteopontin (OPN), and osteocalcin (OCN), while glyceraldehyde-3-phosphatedehydrogenase (GAPDH) was used for normalization. The primer sequences used to amplify Runx2, COL1, OPN, OCN, and GAPDH are listed in Table 1. All experiments were performed in triplicate. 2.7. Maxillary sinus floor elevation procedure Rabbit bMSCs were collected and resuspended in the osteogenic medium without FBS, and then combined with MS and rhBMP-2/ MS scaffolds with a density of 2  107 cells/mL for maxillary sinus elevation in vivo. Forty-eight rabbits were randomly allocated into week 2 and 8 time points. At each time point, twenty-four rabbits received unilateral maxillary sinus floor elevation surgery and

randomly assigned to one of the following four groups: group A, grafted with MS alone (n = 6); group B, autologous bMSCs/MS complexes (n = 6); group C, rhBMP-2/MS complexes (n = 6); group D, autologous bMSCs/rhBMP-2/MS complexes (n = 6). The rabbits were anesthetized with ketamine (10 mg/kg) and xylazine (3 mg/ kg), and then a vertical midline incision was made on the nasal skin to expose the nasal bone and nasoincisal suture line. On the right side of the nasal bone, an oval nasal bone window (8  4 mm2), which was located approximately 20 mm from the nasofrontal suture line and 10 mm from the midline, was outlined with a round bur. Then fenestrae were made by osteotomy, with continuous sterile saline solution irrigation for cooling. Finally, a compartment of approximately 13  3  5 mm3 was created by elevating the membrane from the bony floor of the antrum, and filled the appropriate graft. 2.8. Sequential fluorescent labeling A polychrome sequential labeling method for the mineralized tissue was carried out to evaluate the time course of new bone formation and mineralization. At weeks 2 and 4 after implantation, the rabbits were administered 25 mg/kg tetracycline (TE, Sigma, USA) and 30 mg/kg alizarin red (AL, Sigma, USA) intraperitoneally; 20 mg/kg calcein (CA, Sigma, USA) was administered 3 days before the animals were sacrificed at week 8. 2.9. General and histological observation The rabbits were sacrificed, exsanguinated, and perfused with 10% buffered formaldehyde via the jugular vein at either 2 or 8 week time point. Each augmented maxillary sinus sample on the right side was cut into two blocks along the top of the augmented maxillary sinus. Both blocks were further decalcified, embedded in paraffin, and sectioned into 4 lm thick sections, which were stained with hematoxylin-eosin (HE) for samples taken at the 2 week time point. For samples taken at the 8 week time point, one block was used for HE staining and tartrate-resistant acid phosphatase (TRAP, Sigma, USA) staining to identify osteoclasts, and the other block was dehydrated in increasing concentrations of alcohol ranging from 75% to 100%, embedded in polymethylmethacrylate (PMMA), cut into 200 lm thick sections using a microtome (Leica, Germany), and subsequently ground and polished to a thickness of 40–50 lm. The height of the augmented maxillary sinus floor was also measured in these longitudinal sections taken at the 8 week time point, as described in our previous study [21]. 2.10. Histological and histomorphometric observation The area of new bone formation in four groups was calculated using a personal computer-based image analysis system (ImagePro Plus, USA). Briefly, four randomly selected HE slides from a serial sections collected from each sample were analyzed manually. The newly formed bone area was reported as the percentage of newly formed bone area in the augmented maxillary sinus. Undecalcified sections from each of the four groups were observed for fluorescent labeling under a confocal laser scanning

Table 1 Primer sequences used for real time PCR. Gene

Prime (F = forward; R = reverse)

Accession numbers

Product size (bp)

Runx2 COL1 OPN OCN GAPDH

F:50 GCCTTCAAGGTGGTAGCCC30 R:50 CGTTACCCGCCATGACAGTA30 F:50 TCCAACGAGATCGAGATCC30 R:50 AAGCCGAATTCCTGGTCT30 F:50 CATGAGAATTGCAGTGATTTGCT30 R:50 CTTGGAAGGGTCTGTGGGG30 F:50 GAAGCCCAGCGGTGGCA30 R:50 CACTACCTCGCTGCCCTCC30 F:50 TTCGACAGTCAGCCGCATCTT30 R:ATCCGTTGACTCCGACCTTCA30

NM_001015051.3 NM_000088.3 NM_000582.2 NM_1991173.3 NM_002046.3

67 191 186 70 90

158

L. Xia et al. / Microporous and Mesoporous Materials 173 (2013) 155–165

microscope (CLSM, Leica, Germany). The excitation/emission wavelengths used to visualize each of the fluorophores were as follows: 405/580 nm (TE, yellow), 543/617 nm (AL, red) and 488/ 517 nm (CA, green). To quantitate the bone formation and mineralization in the augmented maxillary sinus, TE, AL and CA staining of five areas at the top, mesial, center, distal and bottom for each section were taken at the same area for histomorphometric analysis using Image-Pro Plus, as previously described [19,22]. Moreover, a merged image of all three fluorescent labels and one image taken using transmitted light without a specific filter, combined with the former merged image, were also prepared. The undecalcified sections were further stained with Van Gieson’s picro fuchsin after CLSM analysis. The percentage of the residual scaffold material in the augmented maxillary sinus at week 8 after implantation was calculated for each of the four groups using Image-Pro Plus. 2.11. Statistical analysis All data were reported as the means ± standard deviation. Statistical analysis was performed by ANOVA and the SNK post hoc or Kruskal–Wallis nonparametric procedure, followed by the Mann–Whitney U test for multiple comparisons based on the results of normal distribution and equal variance assumption assays. All statistical analyses were performed using an SAS 8.2 software (SAS, Germany). Values of p < 0.05 indicated statistical significance. 3. Results 3.1. Characterization of MS scaffolds Three peaks appeared in the SAXRD assay for MS scaffolds, indicating a high degree of hexagonal mesoscopic organization

(Fig. 1A). Moreover, a specific surface area of 508 m2/g and an average pore size of 4.9 nm for MS scaffolds were measured by BET assay. The results of N2 adsorption–desorption analysis for MS scaffolds showed a type IV isotherm pattern and pore distribution of approximately 5 nm (Fig. 1B), suggesting a typical mesoporous structure. Moreover, HRTEM image analysis of the MS scaffolds demonstrated uniform and homogeneously distributed mesopores, consistent with the results of SAXRD, BET and N2 adsorption– desorption analyses (Fig. 1C). Moreover, under SEM observation, MS scaffolds exhibited an interconnected porous network with a large pore size of 200–500 lm (Fig. 1D).

3.2. rhBMP-2 release from rhBMP-2/MS scaffolds As shown in Fig. 2, rhBMP-2/MS scaffolds released rhBMP-2 protein relatively rapidly, with a ratio of 28.48 ± 2.54% within 24 h, followed by the sustained release of rhBMP-2 protein even after 504 h, with a release ratio of 85.61 ± 3.53%. These results suggest that rhBMP-2/MS scaffolds can efficiently release rhBMP-2 in a sustained profile, and can be used for subsequent experiments.

3.3. Cell adhesion and growth assay The adhesion and growth of rabbit bMSCs seeded on MS and rhBMP-2/MS scaffolds were examined by SEM (Fig. 3). After 1 day of culture, the cells were attached and spread well on the surfaces of the two scaffolds (Fig. 3A and B). When the culture time was extended to 4 days, the cells seeded on the two scaffolds grew well and had become approximately confluent (Fig. 3C and D). All these data demonstrated that both MS and rhBMP-2/MS scaffolds possessed no obvious cytotoxicity, and could be applied for the following study.

Fig. 1. Characterization of MS scaffolds. (A) SAXRD analysis of MS scaffolds. (B) N2 adsorption–desorption analysis of MS scaffolds. (C) HRTEM image of MS scaffolds. (D) SEM image of MS scaffolds. C, scale bar = 50 nm; D, scale bar = 100 lm.

L. Xia et al. / Microporous and Mesoporous Materials 173 (2013) 155–165

159

the ALP activity of the cells seeded on rhBMP-2/MS scaffolds was significantly higher than that of the cells cultured on MS scaffolds at each time point (p < 0.05) (Fig. 4B). Real-time PCR was used to evaluate the expression of the osteogenic genes Runx2, COL1, OPN and OCN at days 4 and 7 after rabbit bMSCs were seeded on MS and rhBMP-2/MS scaffolds. The results showed that the expression of osteogenic genes was enhanced in the cells on rhBMP-2/MS scaffolds compared with those on MS scaffolds, with significant differences in Runx2 and OCN at days 4 and 7, and significant differences in COL1 and OPN at day 7 only (p < 0.05) (Fig. 5). 3.6. Histological and histomorphometrical findings

Fig. 2. The percentage of rhBMP-2 protein released from rhBMP-2-loaded MS scaffolds at various time points.

3.4. Cell proliferation assay In present study, the MTT assay was performed to evaluate the proliferation of rabbit bMSCs cultured on MS or rhBMP-2/MS scaffolds. The results demonstrated that the proliferation of rabbit bMSCs seeded on two scaffolds increased throughout the whole observation period. More importantly, the cell proliferation was significantly more enhanced for the rhBMP-2/MS scaffolds than the MS scaffolds at days 4 and 7 (p < 0.05), while there was no significant difference on day 1 (Fig. 4A). 3.5. Cell osteogenic differentiation assay The ALP activity of rabbit bMSCs cultured on both MS and rhBMP-2/MS scaffolds increased from day 7 to day 14. Moreover,

HE staining showed that the newly formed bone generally appeared close to the parent bony wall, with elevation of the membrane in the augmented space area for all four groups at 2 weeks after implantation. Moreover, newly formed bone was found in the center of the augmented space in group B (bMSCs/MS complexes) and group D (bMSCs/rhBMP-2/MS complexes) (Fig. 6). When the implantation time was extended to 8 weeks, more newly formed bone was found throughout the maxillary sinus in all four groups compared with the 2 week time point (Fig. 7). Interestingly, under high magnification, osteoblasts with a spindle morphology were distributed around the newly formed bone, while TRAP-positive osteoclasts were observed around residual MS materials (Fig. 8). These results indicate that osteoblast- and osteoclast-mediated action might play an important role in the degradation of MS scaffolds. The results of histomorphometrical analysis showed that the area of new bone formation at the 2 week time point in group A (MS alone) (5.16 ± 1.12%) was smaller than that in group B (7.02 ± 0.97%), group C (rhBMP-2/MS complexes) (7.30 ± 1.26%) or group D (12.56 ± 2.24%) (p < 0.05). Moreover, a significant difference was also observed between groups B, C and group D. At week

Fig. 3. SEM analysis of rabbit bMSCs seeded on MS scaffolds (A and C) and rhBMP-2 loaded MS scaffolds (B and D) for 1 (A and B) and 4 days (C and D). Scale bar = 10 lm.

160

L. Xia et al. / Microporous and Mesoporous Materials 173 (2013) 155–165

Fig. 4. Cell proliferation and ALP activity analysis. (A) MTT analysis of rabbit bMSCs seeded on MS and rhBMP-2-loaded MS scaffolds at days 1, 4 and 7. (B) The ALP activity of rabbit bMSCs seeded on MS and rhBMP-2-loaded MS scaffolds was measured with the pNPP assay at days 7 and 14 after cell seeding. (Asterisk indicates significant differences between rhBMP-2-loaded MS scaffolds vs. MS scaffolds, p < 0.05).

Fig. 5. Real-time PCR analysis of osteogenic differentiation related gene expression of rabbit bMSCs seeded on MS and rhBMP-2-loaded MS scaffolds at days 4 and 7. (A) Runx2; (B) COL1; (C) OPN; (D) OCN. (Asterisk indicates significant differences between rhBMP-2-loaded MS scaffolds vs. MS scaffolds, p < 0.05).

8, group A (18.16 ± 2.68%) had a smaller new bone formation area than groups B (24.13 ± 3.17%), C (25.71 ± 2.49%) and D (33.77 ± 3.31%), while group D had the largest newly formed bone area (p < 0.05). Measurements of augmented height at week 8 after implantation showed that group A (8.76 ± 1.01 mm) had a lower height than groups B (10.42 ± 1.36 mm), C (11.22 ± 1.26 mm) and D (12.53 ± 0.74 mm), and there was also a significant difference between group B and group D (p < 0.05) (Fig. 9). In undecalcified specimens stained with Van Gieson’s picrofuchsin, residual MS materials were surrounded by the newly formed bone in the augmented space in all four groups. Consistent with the results of HE staining, the new formed bone area in group D was the highest among these four groups, while the least was found in group A. Moreover, the percentage of residual material in group A (22.52 ± 1.77%) was greater than that in group B (16.11 ± 1.88%), group C (15.28 ± 1.80%), or group D (10.49 ±

2.52%), and the percentage of residual material in groups B and C was also obviously greater than that in group D (p < 0.05) (Fig. 10). 3.7. Fluorochrome labeling analysis In present study, different fluorescent labeling was used to evaluate new bone formation and mineralization at 2, 4 and 8 weeks after implantation (Fig. 11). At 2 weeks, 1.58 ± 0.19% of the area was labeled with TE (yellow) in group D, which was greater than the area labeled in groups A (0.50 ± 0.13%), B (0.65 ± 0.14%) and C (0.73 ± 0.12%), moreover, the difference between group A and group C was also significant (p < 0.05). AL (red) and CA (green) labeling, which were performed at the 4 and 8 week time points, respectively, labeled larger areas in group D (1.53 ± 0.17% and 11.17 ± 1.90%) than in group A (0.30 ± 0.10%

L. Xia et al. / Microporous and Mesoporous Materials 173 (2013) 155–165

161

Fig. 6. Histological findings for the MS alone (A1 and A2), bMSCs/MS complex (B1 and B2), rhBMP-2/MS complex (C1 and C2), and bMSCs/rhBMP-2/MS complex (D1 and D2) groups at 2 weeks after implantation. NB: nasal bone; M: augmented sinus membrane; B: new formed bone; RS: residual scaffolds. A1, B1, C1 and D1, scale bar = 1 mm; A2, B2, C2 and D2, scale bar = 100 lm.

and 3.97 ± 1.29%), group B (0.58 ± 0.12% and 7.18 ± 0.94%), and group C (0.73 ± 0.20% and 7.42 ± 1.37%), and there were also significant differences in AL and CA labeling between group A and groups B and C (p < 0.05) (Fig. 12). 4. Discussion In present study, we have successfully synthesized CaO–P2O5– SiO2-system MS scaffolds with hierarchically large pores (200– 500 lm) and well-ordered mesopores (4.9 nm). Moreover, we investigated the protein delivery properties of rhBMP-2-loaded MS scaffolds and their effects on the proliferation, and osteogenic differentiation of rabbit bMSCs. Importantly, the effect on new bone formation and mineralization of the combination of rhBMP2-loaded MS scaffolds and bMSCs was systematically evaluated in a rabbit sinus floor elevation model. The current results indicate that rhBMP-2-loaded MS scaffolds show promise as a drug delivery system that could be used to enhance osteogenic properties,

further, a tissue-engineered bone constructed by rhBMP-2-loaded MS scaffolds and bMSCs may be a better alternative bone graft for oromaxillofacial bone regeneration than the currently available materials. The three key factors for bone tissue engineering are osteoprogenitor cells, osteoinductive factors and osteoconductive scaffolds. As seed cells for bone tissue engineering, bMSCs can be easily isolated from bone marrow and expanded in vitro, and large quantities are available for transplantation. It is well known that bMSCs can be differentiated into osteoblasts under osteogenic medium containing dexamethasone, ascorbic acid and b-glycerolphosphate [23,24]. Moreover, their osteoblastic differentiation capacity could be further enhanced by osteoinductive factors such as the rhBMP-2 protein, which has been proved to induce the osteoblastic differentiation of bMSCs in vitro and new bone formation in vivo [25,26]. A product that delivers rhBMP-2 protein in a purified collagen matrix for release and improved local retention has been approved by the FDA (InfuseÒ Bone Graft, Medtronic, USA) and has

162

L. Xia et al. / Microporous and Mesoporous Materials 173 (2013) 155–165

Fig. 7. Histological findings for MS alone (A1 and A2), bMSCs/MS complex (B1 and B2), rhBMP-2/MS complex (C1 and C2), and bMSCs/rhBMP-2/MS complex (D1 and D2) groups at 8 weeks after implantation. NB: nasal bone; M: augmented sinus membrane; B: new formed bone; RS: residual scaffolds. A1, B1, C1 and D1, scale bar = 1 mm; A2, B2, C2 and D2, scale bar = 100 lm.

been successfully applied in some clinical bone repair cases. However, the osteogenic outcome was limited by the rhBMP-2 bolus release properties in the early period, which might not be sufficient to form the amount of bone needed to meet clinical demands [27]. Therefore, a more effective rhBMP-2 delivery system should be developed, ideally one that can act as a bone graft in combination with osteoprogenitor cells. Biomaterials used as scaffolds for bone tissue engineering should have specific properties, such as good biocompatibility and osteoinductivity, that support cell proliferation, osteogenic differentiation, and extracellular matrix deposition, with consequent bone in-growth [28]. Previous studies have demonstrated that MBG had superior bioactivity and drug-loading capacity compared with non-mesopore bioglass due to their high surface area and uniquely ordered channels [11–13]. In present study, the macropore properties (200–500 lm) of CaO–P2O5–SiO2-system MS scaffolds could favor cell growth and the vascularization of the ingrown tissue, as has been partly confirmed by the results of cell adhesion and growth assays [29]. In this respect, the MS scaffolds utilized

in present study might promote tissue in growth and nutrient transportation and consequently meet the requirements of cell carriers for bone tissue engineering. The mesoporous structures of MBG scaffolds are important for drug loading and delivery, and it has been suggested that a mesopore with a size of 3–5 nm would provide an environment sufficient to adsorb a range of biomolecules, such as drugs, antibiotics, and growth factors [30,31]. In present study, rhBMP-2 could be loaded on MS scaffolds (with pore diameter of 4.9 nm) by adsorption processes, more importantly, the sustained release profile the of rhBMP-2-loaded MS scaffolds could be attributed to diffusion-controlled mechanisms, suggesting that this system could exhibit a reduced initial burst release and prolonged local retention, which might overcome the inherent problem associated with bioceramics and traditional bioglasses [32]. In present study, the effect of the continuous release of rhBMP-2 protein from MS scaffolds on rabbit bMSCs was determined by MTT analysis for cell proliferation, ALP activity analysis, and realtime PCR analysis on markers of Runx2, COL1, OPN, and OCN were

L. Xia et al. / Microporous and Mesoporous Materials 173 (2013) 155–165

Fig. 8. High magnification images for the degradation of MS scaffolds with decalcified specimens stained with HE and TRAP in the bMSCs/rhBMP-2/MS complex group. Osteoblasts (blue arrow) were found around the newly formed bone, while TRAP-positive osteoclasts (yellow arrow) surrounded the scaffold surface in the resorption lacunae. Scale bar = 100 lm. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

used to evaluate osteogenic differentiation. The MTT assay results showed that rabbit bMSCs grew well both on MS and rhBMP-2/MS scaffolds, while rhBMP-2/MS scaffolds could achieve enhanced cell proliferation due to the release of the rhBMP-2 protein. ALP

163

regulates organic or inorganic phosphate metabolism and serves as a plasma membrane transporter for inorganic phosphates, and it is usually considered as an early marker for osteoblastic differentiation [33]. Runx2 acts as an osteoblast transcriptional activator, and it is suggested to be a key regulator of osteoblast differentiation and to play an important role in regulating the expression of major osteoblast genes and maintaining the functions of differentiated osteoblasts at an early stage [34]. COL1, which provides a structural framework for inorganic deposition, may affect the biomechanical strength of bone tissue [33]. OPN is reported to be an intermediate or relatively earlier marker of osteogenic differentiation, and it is associated with the maturation of osteoblasts during attachment and matrix synthesis before mineralization [34,35]. As the most specific and late marker of osteogenic differentiation, OCN is related to matrix deposition and mineralization [34]. Thus, the observed higher ALP activity and the enhanced Runx2, COL1, OPN, and OCN gene expression suggested that rhBMP-2-loaded MS scaffolds could promote the osteogenic differentiation of rabbit bMSCs. The results of cell proliferation and osteogenic differentiation assays confirmed that rhBMP-2-loaded MS scaffolds might be a promising drug delivery system with excellent biocompatibility and osteoinductivity properties for bone tissue engineering applications. Histological and histomorphometrical analyses were performed to evaluate the combination of rhBMP-2-loaded MS scaffolds and bMSCs in a rabbit maxillary sinus floor elevation model. Throughout the whole observation period, MS scaffolds alone induced new bone formation and mineralization in the maxillary sinus, while new bone formation and augmented height was significantly enhanced by rhBMP-2-loaded MS scaffolds or MS scaffolds combined

Fig. 9. New bone area (A) and augmented height (B) in maxillary sinuses assessed at weeks 2 and 8 after implantation by histomorphometric analysis. Asterisk indicates significant differences, p < 0.05.

Fig. 10. Microscopic view of bone formation and residual scaffolds in the maxillary sinus from nondecalcified slides for the MS alone (A), bMSCs/MS complex (B), rhBMP-2/ MS complex (C), and bMSCs/rhBMP-2/MS complex (D) groups at week 8 after implantation. (E) The percentage of residual scaffolds in the maxillary sinus assessed at week 8 after implantation. Scale bar = 100 lm. Asterisk indicates significant differences, p < 0.05.

164

L. Xia et al. / Microporous and Mesoporous Materials 173 (2013) 155–165

Fig. 11. Sequential fluorescent labeling of TE, AL and CA for the MS alone (A1–A5), bMSCs/MS complex (B1–B5), rhBMP-2/MS complex (C1–C5), and bMSCs/rhBMP-2/MS complex (D1–D5) groups at 8 week time point. The images in yellow (TE; A1, B1, C1 and D1), red (AL; A2, B2, C2 and D2) and green (CA; A3, B3, C3 and D4) indicated the rate of bone formation and mineralization at 2, 4, and 8 weeks after implantation, respectively. (A4, B4, C4 and D4) Merged images of the three fluorochromes for the same group. (A5, B5, C5 and D5) Merged images of the three fluorochromes together with a brightfield confocal laser microscope image for the same group. Scale bar = 100 lm. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

with bMSCs. Moreover, rhBMP-2-loaded MS scaffolds in synergy with bMSCs could achieve much more new bone formation and mineralization than either the rhBMP-2/MS or bMSCs/MS complexes. Interestingly, greater new bone formation in the center of the augmented space at the early (2 week) time point and enhanced new bone formation was observed in both the bMSCs/ MS and bMSCs/rhBMP-2/MS groups compared with the MS and

Fig. 12. The percentage of single fluorochrome staining in maxillary sinuses assessed at week 8 after implantation by histomorphometric analysis. Asterisk indicates significant differences, p < 0.05.

rhBMP-2/MS groups, respectively. We believe that this may be attributed to the effect of implanted bMSCs, including osteogenic activity of implanted bMSCs, the paracrine stimulation of resident osteoprogenitor cells mediated by implanted bMSCs, and vascular ingrowth mediated by implanted bMSCs [36]. Moreover, MS scaffolds with hierarchical large pores and well-ordered mesopores also provided a greater surface area, and sufficient oxygen and nutrients via vascular invasion for implanted bMSCs extension and growth [17]. Moreover, rhBMP-2 released from rhBMP-2/MS scaffolds could also enhance the proliferation and osteogenic differentiation of resident osteoprogenitor or implanted bMSCs, resulting in enhanced new bone formation and mineralization in the rhBMP-2/MS and especially the bMSCs/rhBMP-2/MS groups. Besides, analysis of the histological findings from the 2 week to 8 week time points demonstrated that CaO–P2O5–SiO2-system MS scaffolds continued to degrade and be replaced with newly formed bone. This process was accelerated in the rhBMP-2/MS and bMSCs/MS groups, accompanied by more new bone formation. Furthermore, rhBMP-2/MS scaffolds had the least residual material area and the largest newly formed bone area when combined with bMSCs. It is possible that osteoblast- and osteoclast-mediated activities play important roles in the degradation of the MS scaffolds. In present study, MS scaffolds combined with rhBMP-2 or/ and bMSCs created a more permissive microenvironment for bone

L. Xia et al. / Microporous and Mesoporous Materials 173 (2013) 155–165

formation and mineral resorption, associated with the presence of osteoblasts, multinuclear giant cells and extracellular matrix; meanwhile, extracellular matrix protein and osteoblasts could facilitate multinuclear giant cell adhesion [37,38]. In summary, more new bone formation and faster material degradation rate was observed for rhBMP-2-loaded MS scaffolds transplanted in combination with bMSCs, suggesting that this material might be useful for dental implants, especially for patients with severe atrophic posterior maxillary alveolar bone or those who need simultaneous clinical dental implants. Consequently, this material may be of great benefit for follow-up oromaxillofacial functional restoration. However, larger animal models with simultaneous implant placement need to be investigated for longer time periods to provide more clinically relevant data in the future. 5. Conclusion In conclusion, our data suggested that CaO–P2O5–SiO2-system MS loaded with rhBMP-2 exhibited a sustained release profile, and these rhBMP-2-loaded MS scaffolds could promote the proliferation and differentiation of rabbit bMSCs in vitro. Moreover, in a rabbit maxillary floor elevation model, rhBMP-2-loaded MS scaffolds enhanced new bone formation and augmented maxillary floor height relative to MS scaffolds alone, while the combination of rhBMP-2-loaded MS scaffolds and bMSCs achieved the greatest new bone formation and mineralization. Therefore, CaO–P2O5– SiO2-system MS scaffolds could act as drug delivery vehicles for rhBMP-2 protein, as well as cell carriers for bMSCs, while tissueengineered bone constructed by rhBMP-2-loaded MS scaffolds and bMSCs might be a good alternative bone graft for oromaxillofacial bone regeneration. Acknowledgments This work was supported by National Basic Research Program of China (973 Program, 2012CB933600(4)), National Natural Science Foundation of China (30973342, 81170939), Science and Technology Commission of Shanghai Municipality (12nm0501600, 10ZR1418100), Biomedical Engineering Cross Research Foundation of Shanghai Jiao Tong University School (YG2012MS29). References [1] J. Yuan, L. Cui, W.J. Zhang, W. Liu, Y. Cao, Biomaterials 28 (2007) 1005–1013. [2] X.J. Sun, Z.Y. Zhang, S.Y. Wang, S.A. Gittens, X.Q. Jiang, L.L. Chou, Clin. Oral Implants Res. 19 (2008) 804–813. [3] S. Wang, Z. Zhang, J. Zhao, X. Zhang, X. Sun, L. Xia, Q. Chang, D. Ye, X. Jiang, Biomaterials 30 (2009) 2489–2498. [4] A.S. Greenwald, S.D. Boden, V.M. Goldberg, Y. Khan, C.T. Laurencin, R.N. Rosier, J. Bone Joint Surg. Am. 83 (2001) 98–103.

165

[5] K. Ito, Y. Yamada, T. Naiki, M. Ueda, Clin. Oral Implants Res. 17 (2006) 579–586. [6] J. Zhao, Z. Zhang, S. Wang, X. Sun, X. Zhang, J. Chen, D.L. Kaplan, X. Jiang, Bone 45 (2009) 517–527. [7] G.M. Crane, S.L. Ishaug, A.G. Mikos, Nat. Med. 1 (1995) 1322–1324. [8] X. Jiang, Int. J. Prosthodont. 25 (2012) 132–134. [9] A. El-Ghannam, Expert Rev. Med. Devices 2 (2005) 87–101. [10] C. Przybylowski, T. Quinn, A. Callahan, M. Kaplan, A. Golding, C. Alesi, M. Ammar, C.E. LeBlon, Y. Guo, X. Zhang, S.S. Jedlicka, J. Mater. Chem. 22 (2012) 10672–10683. [11] C. Wu, R. Miron, A. Sculean, S. Kaskel, T. Doert, R. Schulze, Y. Zhang, Biomaterials 32 (2011) 7068–7078. [12] M. Zhu, L. Zhang, Q. He, J. Zhao, L. Guo, J. Shi, J. Mater. Chem. 21 (2011) 1064– 1072. [13] M. Vallet-Regí, E. Ruiz-Hernández, Adv. Mater. 23 (2011) 5177–5218. [14] J.M. Rosenholm, C. Sahlgren, M. Linden, Nanoscale 2 (2010) 1870–1883. [15] C. Wu, Y. Zhang, Y. Zhu, T. Friis, Y. Xiao, Biomaterials 31 (2010) 3429–3438. [16] H. Zhu, B. Wu, X. Feng, J. Chen, J. Biomed. Mater. Res. B Appl. Biomater. 98B (2011) 330–341. [17] C. Dai, H. Guo, J. Lu, J. Shi, J. Wei, C. Liu, Biomaterials 32 (2011) 8506–8517. [18] X.Q. Jiang, X.J. Sun, H.C. Lai, J. Zhao, S.Y. Wang, Z.Y. Zhang, Clin. Oral Implants Res. 20 (2009) 1333–1340. [19] L. Xia, Y. Xu, J. Wei, D. Zeng, D. Ye, C. Liu, Z. Zhang, X. Jiang, Cells Tissues Organs 194 (2011) 481–493. [20] L. Xia, Y. Xu, Q. Chang, X. Sun, D. Zeng, W. Zhang, X. Zhang, Z. Zhang, X. Jiang, Calcif. Tissue Int. 89 (2011) 53–64. [21] W. Zhang, X. Wang, S. Wang, J. Zhao, L. Xu, C. Zhu, D. Zeng, J. Chen, Z. Zhang, D.L. Kaplan, X. Jiang, Biomaterials 32 (2011) 9415–9424. [22] D. Zeng, L. Xia, W. Zhang, H. Huang, B. Wei, Q. Huang, J. Wei, C. Liu, X. Jiang, Tissue Eng. Part A 18 (2012) 870–881. [23] M.F. Pittenger, A.M. Mackay, S.C. Beck, R.K. Jaiswal, R. Douglas, J.D. Mosca, M.A. Moorman, D.W. Simonetti, Craig S. Craig, D.R. Marshak, Science 284 (1999) 143–147. [24] I. Drosse, E. Volkmer, R. Capanna, P. De Biase, W. Mutschler, M. Schieker, Injury 39 (2008) S9–S20. [25] D. Chen, M. Zhao, G.R. Mundy, Growth Factors 22 (2004) 233–241. [26] O. Jeon, S.J. Song, S.W. Kang, A.J. Putnam, B.S. Kim, Biomaterials 28 (2007) 2763–2771. [27] S. Zhang, C. Kucharski, M.R. Doschak, W. Sebald, H. Uludag˘, Biomaterials 31 (2010) 952–963. [28] J. Meng, Y. Zhang, X. Qi, H. Kong, C. Wang, Z. Xu, S. Xie, N. Gu, H. Xu, Nanoscale 2 (2010) 2565–2569. [29] D.W. Hutmacher, Biomaterials 21 (2000) 2529–2543. [30] C. Zhang, C. Li, S. Huang, Z. Hou, Z. Cheng, P. Yang, J. Lin, Biomaterials 2010 (31) (2010) 3374–3383. [31] M. Vallet-Regí, F. Balas, D. Arcos, Angew. Chem. Int. Ed. Engl. 46 (2007) 7548– 7558. [32] M. Vallet-Regí, I. Izquierdo-Barba, M. Colilla, Transact. A Math. Phys. Eng. Sci. 370 (2012) 1400–1421. [33] Q. Liu, L. Cen, S. Yin, L. Chen, G. Liu, J. Chang, L. Cui, Biomaterials 29 (2008) 4792–4799. [34] X. Jiang, J. Zhao, S. Wang, X. Sun, X. Zhang, J. Chen, D.L. Kaplan, Z. Zhang, Biomaterials 30 (2009) 4522–4532. [35] J. Sodek, B. Ganss, M.D. McKee, Crit. Rev. Oral Biol. Med. 11 (2000) 279–303. [36] P. Giannoni, M. Mastrogiacomo, M. Alini, S.G. Pearce, A. Corsi, F. Santolini, A. Muraglia, P. Bianco, R. Cancedda, J. Tissue Eng. Regen. Med. 2 (2008) 253– 262. [37] M. Mastrogiacomo, S. Scaglione, R. Martinetti, L. Dolcini, F. Beltrame, R. Cancedda, R. Quarto, Biomaterials 27 (2006) 3230–3237. [38] M.. Mastrogiacomo, A. Papadimitropoulos, A. Cedola, F. Peyrin, P. Giannoni, S.G. Pearce, M. Alini, C. Giannini, A. Guagliardi, R. Cancedda, Biomaterials 28 (2007) 1376–1384.