Engineering the K+ uptake regulatory pathway by MultiRound Gateway

Journal of Plant Physiology 167 (2010) 1412–1417

Contents lists available at ScienceDirect

Journal of Plant Physiology journal homepage: www.elsevier.de/jplph

Engineering the K+ uptake regulatory pathway by MultiRound Gateway Fei Ren 1 , Qi-Jun Chen 1 , Min Xie, Li-Juan Li, Wei-Hua Wu, Jia Chen, Xue-Chen Wang ∗ State Key Laboratory of Plant Physiology and Biochemistry, College of Biological Sciences, China Agricultural University, Beijing 100193, China

a r t i c l e

i n f o

Article history: Received 17 September 2009 Received in revised form 22 March 2010 Accepted 22 March 2010 Keywords: CBL pathway Genetic engineering K+ nutrition Multigene transformation MultiRound Gateway

a b s t r a c t In a previous study, we described improved versions of MultiRound Gateway vectors. Here, we engineered a calcineurin B-like (CBL) pathway for potassium (K+ ) nutrition to demonstrate their effectiveness. Using the two improved entry vectors pL12R34H-Ap and pL34R12-Cm, and through 2–4 rounds of Gateway recombination reactions, we generated five pMDC99-derived binary vectors [pK21 (CIPK23 + CBL1), pK29 (CIPK23 + CBL9), pK31 (CIPK23 + CBL1 + AKT1), pK39 (CIPK23 + CBL9 + AKT1), and pK4 (CIPK23 + CBL1 + AKT1 + CBL9)], in which all four genes have the same pSuper promoter and tNos terminator. pK31, pK39 and pK4 were transformed into Arabidopsis. PCR analysis confirmed that all transgenes usually co-existed in the K31, K39 or K4 transgenic plants, and qRT-PCR analysis indicated that the transgenes were expressed at reasonably high levels. The eight overexpression lines, except K31-1, displayed significantly tolerant phenotypes to low-K+ and low-K+ combined with low-Ca2+ compared to the wild type. Significant differences between the K31, K39 and K4 lines were not observed. These results indicate that the improved MultiRound Gateway vectors efficiently assembled multiple transgenes, which were stably inherited and expressed in transformed plants, even with the same promoter and terminator. © 2010 Elsevier GmbH. All rights reserved.

1. Introduction Polygenes can control some crop production traits, metabolic pathways (e.g. carotenoid biosynthesis), signaling pathways (e.g. ABA signal transduction), and multimeric proteins such as vacuolar H+ -ATPase. Characterization of genetic regulatory and metabolic pathways progresses alongside functional genomics efforts. Genetic engineering of these polygenic traits, pathways or protein complexes is frequently required for both basic and applied research (Daniell and Dhingra, 2002; Halpin, 2005; DafnyYelin and Tzfira, 2007). Transgenic golden rice (Ye et al., 2000), purple tomatoes (Butelli et al., 2008), and red corn (Zhu et al., 2008) demonstrate the bright prospects for plant multigene transformation. The linking of multiple expression cassettes into a single binary plasmid has strong advantages over other approaches, though co-transformation, re-transformation, and sexual crosses can be applied to the delivery of multiple genes into plant cells (Dafny-Yelin and Tzfira, 2007). Therefore, researchers developed

Abbreviations: AKT, Arabidopsis K+ transporter; Ap, ampicillin; ApR, ampicillinresistant; CBL, calcineurin B-like; CIPK, CBL-interacting protein kinase; Cm, chloramphenicol; CmR, chloramphenicol-resistant; Gm, gentamycin; Kn, kanamycin; MS, Murashige and Skoog; qRT-PCR, quantitative real-time PCR. ∗ Corresponding author. Tel.: +86 10 62732706; fax: +86 10 62895156. E-mail address: [email protected] (X.-C. Wang). 1 These authors contributed equally to this work. 0176-1617/$ – see front matter © 2010 Elsevier GmbH. All rights reserved. doi:10.1016/j.jplph.2010.03.021

several systems to assemble multiple genes, such as the homing endonuclease-based pRCS/pAUX and pSAT vector systems (Goderis et al., 2002; Tzfira et al., 2005; Dafny-Yelin et al., 2007; DafnyYelin and Tzfira, 2007), Cre-lox P recombination (Lin et al., 2003), MultiSite Gateway (Cheo et al., 2004; Sasaki et al., 2004; Karimi et al., 2007a,b), and MultiRound Gateway (Chen et al., 2006). The MultiRound Gateway approach we developed is simple, efficient and more flexible than existing methods. DNA fragments of interest are cloned into two entry vectors via traditional cut-and-ligate methods, and then introduced into a destination vector in a defined order and orientation through multiple rounds of two-component Gateway recombination reactions. Transferring only desired DNA fragments from entry clones to destination vectors eliminates the steps to remove redundant recombination sites or the vector backbone. We previously developed two sets of MultiRound Gateway entry vectors, with one set (pL12R34-sacB/pL34R12-ccdB) based on sacB and ccdB negative selection markers, and the other (pL12R34Ap/pL34R12-Cm) based on ApR and CmR positive selection markers (Chen et al., 2006). However, both sets had a high rate of false background clones. Correct clones were rarely acquired using positive selection vectors derived from pL12R34-Ap/pL34R12-Cm due to co-transformation of the entry clones and destination vectors (unpublished data). We performed four rounds of LR recombination reactions using negative selection vectors derived from pL12R34-sacB/pL34R12-ccdB, but the sacB negative selection was sometimes not reliable (unpublished data). In order to enhance LR

F. Ren et al. / Journal of Plant Physiology 167 (2010) 1412–1417

recombination reactions, we developed two improved vector sets (pL12R34H-sacB/pL34R12H-ccdB and pL12R34H-Ap/pL34R12HCm) by introducing two kinds of homing endonuclease sites, I-SceI and PI-SceI, into the two original entry vector sets (pL12R34sacB/pL34R12-ccdB and pL12R34-Ap/pL34R12-Cm). These sites should not be contained in the DNA fragments of interest, ensuring that the fragments remain intact (Chen et al., 2006). Thus, beginning from the second round of Gateway LR reactions, the entry clones and destination vectors can be linearized by digestion with I-SceI and PI-SceI, respectively. We prefer using the improved MultiRound Gateway vectors based on positive selection markers since positive selection is more efficient, simpler, and more convenient than the negative selection method, which requires two E. coli strains and sucrose. However, the cloning efficiency of the improved entry vectors based on positive selection markers is not known. Potassium (K+ ) is an essential element for plant growth and development. In China, K+ deficiency in soil is a serious problem that must be overcome by K+ fertilizer application. Thus, it is important to cultivate transgenic crops with enhanced K+ uptake efficiency under K+ deficiency. A novel K+ uptake regulatory pathway in Arabidopsis has been established (Xu et al., 2006; Cheong et al., 2007; Lee et al., 2007b; Batistiˇc and Kudla, 2009). In this pathway, the activity of Arabidopsis K+ transporter 1 (AKT1) under low-K+ conditions is regulated by CBL-interacting protein kinase 23 (CIPK23) via protein phosphorylation, and CIPK23 is activated by the binding of two calcineurin B-like (CBL) proteins, CBL1 and CBL9 (Xu et al., 2006). Although overexpressing single genes in this pathway enhanced tolerance to low-K+ stress (Xu et al., 2006), molecular engineering of the entire pathway has not yet been done. In this study, we used the improved MultiRound Gateway entry vectors, pL12R34H-Ap and pL34R12H-Cm, to manipulate the K+ uptake regulatory pathway so as to demonstrate the effectiveness of the improved MultiRound Gateway method, and to enhance K+ uptake efficiency of transgenic plants under K+ deficiency. 2. Materials and methods 2.1. Construction of entry vectors/clones The entry and destination vectors/clones constructed in this report are listed in Table 1, and the primers used are listed in Table 2. The HindIII/EcoRI fragment of the pSuper-tNos cassette from the pSuper1300 (Lee et al., 2007a; Yang et al., 2009) was inserted between the HindIII and EcoRI sites of pL12R34H-Ap and pL34R12H-Cm (Chen et al., 2006) to generate p14A-pSuper and p32HC-pSuper, respectively. The XbaI/KpnI fragment of CIPK23 from pBIB-CIPK23 (Xu et al., 2006) was inserted between the XbaI and KpnI sites of p14HA-pSuper to generate p14HA-CIPK23. The XbaI/SmaI fragment of AKT1 from pSuper1300-AKT1 (unpublished Table 1 Entry clones and plant binary vectors (destination vectors/clones) constructed in this study. Entry clones

Destination vectors/clones

Simplified designation

p14HA-pSuper p32HC-pSuper p14HA-CIPK23 p32HC-CBL1 p32HC-CBL9 p32HC-CBL1 p32HC-CBL9 p14HA-AKT1

N/A N/A pMDC99-CIPK23-R34 pMDC99-CIPK23-CBL1-R12 pMDC99-CIPK23-CBL9-R12 pMDC99-CIPK23-CBL1 pMDC99-CIPK23-CBL9 pMDC99-CIPK23-CBL1-AKT-R34 pMDC99-CIPK23-CBL9-AKT-R34 pMDC99-CIPK23-CBL1-AKT pMDC99-CIPK23-CBL9-AKT pMDC99-CIPK23-CBL1-AKT-CBL9

N/A N/A pK10-R34 pK21-R12 pK29-R12 pK21 pK29 pK31-R34 pK39-R34 pK31 pK39 pK4

p14HA-AKT1 p32HC-CBL9

1413

Table 2 Primers used in this study. Sequences (5 → 3 )

Primer names Cloning primers

CBL1F CBL1R CBL9F CBL9R CIPK23IDF CIPK23IDR AKT1IDF AKT1IDR CBL1IDF CBL1IDR CBL9IDF CBL9IDR

GGGTCTATGGGCTGCTTCCACTCAAAGGC CCACGAGCTCATGTGGCAATCTCATCGAC GGGTCTATGGGTTGTTTCCATTCCACGGC TTTCGAGCTCACGTCGCAATCTCGTCCAC ATCTCGACATCCCAGGGTCTCAATC CACCATCGGTTCCTTCCTCTTTCTC CATAGAAACCATTTACCACCTCGTC TCCAGTATCTACATCCACCAAGTCC AAGAGCATAAGCAGTTCGGTTGTTG CCAGTTTCATTTCAGATTCGCAGAG AAGAGCATAAGCAGCTCGGTTGTTG TATCAATCTTTCCATCCCGATCCAC

Transgene identification primers

pSuperIDF CIPK23IDR2 CBL1IDR2 CBL9IDR2 AKT1IDR2 CIPK23IDF2 AKT1IDR3 CBL9IDR3

TTTCGGCGTGTAGGACATGGCAACC GTGTCCTACCACCAGAAGAACTACC AGACCATCATCAACAACCGAACTGC CTTCCTTGTTTATCAAGCCATCGTC TCAATCTCATCTTGGACTTGTCCGC GAACCGATGGTGGTGGTACTAATGG CTCATCTTGGACTTGTCCGCATAAC CTGGCAGCCGTGGAATGGAAACAAC

qRT-PCR primers

CIPK23RTF CIPK23RTR AKT1RTF AKT1RTR CBL1RTF CBL1RTR CBL9RTF CBL9RTR Actin2/8RTF Actin2/8RTR

TCGACATCCCAGGGTCTCAATC TGTAACTATCTCATTAGCCGAAG TAGCAAATCAAAGCGTACCCAA GTACCAGCTTCCCGGCTATGTC CGAGGACACGAAGACCCTGTTA TAATCAGACCATCATCAACAAC GATGTTGATTGCACTTCTCTGC AACGAAATTGCTCCATTCTGTC GGTAACATTGTGCTCAGTGGTGG CACGACCTTAATCTTCATGCTGC

data) was inserted between the XbaI and SmaI sites of p14HApSuper to generate p14HA-AKT1. The p14HA-AKT1 was digested with AscI/PacI, end-filled and re-ligated to generate p14HAAKT1. To generate p32HC-CBL1, the blunt-ended CBL1 PCR products amplified with primers CBL1F and CBL1R were digested with SacI and inserted between the SmaI and XbaI sites. p32HC-CBL9 was similarly generated. The p32HC-CBL1/9 was digested with AscI/PacI, end-filled and re-ligated to generate the p32HC-CBL1/9. 2.2. Generation of destination vectors/clones through multiple rounds of Gateway LR recombination reactions The first round of Gateway LR recombination was performed between pMDC99 (Curtis and Grossniklaus, 2003) and p14HACIPK23 to generate pMDC99-CIPK23. From the second round of Gateway LR reactions, entry clones were digested with I-SceI and destination vectors were digested with PI-SceI. The digested vectors were directly column purified regardless of the existence of small cut-off fragments. The purified and linearized entry clones and destination vectors were then used to perform Gateway LR reactions according to the Gateway technology manual (Invitrogen, USA). From the second round of Gateway LR reactions, when using the pL12R34H-Ap derived entry clones, the positive clones were selected on LB agar plates supplemented with 50 ␮g/mL kanamycin (Kn) and 50 ␮g/mL ampicillin (Ap). The Kn- and Ap-resistant clones were counterselected on 25 ␮g/mL chloramphenicol (Cm), and the Kn- and Ap-resistant and Cm-sensitive clones were identified by colony PCR and by digestion of the corresponding vectors with HindIII or EcoRI. Similarly, when using the pL34R12H-Cm derived entry clones, the positive clones were selected on 50 ␮g/mL Kn and 25 ␮g/mL Cm, then the Kn- and Cm-resistant clones were counterselected on 50 ␮g/mL Ap, and finally, the Kn- and Cm-resistant and Ap-sensitive clones were identified by colony PCR and by digestion of the corresponding vectors with HindIII or EcoRI. When using the gentamycin (Gm)-resistant entry clones, in which the attR3-

1414

F. Ren et al. / Journal of Plant Physiology 167 (2010) 1412–1417

ApR-attR4 or attR1-CmR-attR2 cassette was removed, the positive clones were selected on 50 ␮g/mL Kn, then the Kn-resistant clones were counterselected on 50 ␮g/mL Ap or 25 ␮g/mL Cm, and finally, the Kn-resistant and Ap- or Cm-sensitive clones were identified by colony PCR and by digestion of the corresponding vectors with HindIII or EcoRI.

2.3. Creation of transgenic Arabidopsis The destination clones pK31, pK39 and pK4 were introduced into Agrobacterium tumefaciens strain GV3101, and then Arabidopsis thaliana (ecotype Columbia) wild-type plants transformed by the floral dip method (Clough and Bent, 1998). T1 seeds were screened on MS agar plates supplemented with 25 ␮g/mL hygromycin (Amresco, USA). The putative T1 transgenic lines were transferred into soil and the leaves used for PCR identification of the transgenes, using the forward primer of the pSuper promoter and the reverse primers of transgenes of interest. To further confirm T-DNA integrity, PCR amplification of selected lines was performed with the forward primer located in CIPK23 (CIPK23IDF2) and reverse primer located in AKT1 for K31 or K39 (AKT1IDR3) and in CBL9 for K4 (CBL9IDR3). According to the segregation ratios of T2 and T3 seeds on hygromycin, T3 homozygous lines were selected and used for the expression analysis and phenotype characterization.

2.4. Quantitative real-time PCR (qRT-PCR) Wild type (ecotype Columbia) and transgenic seeds were sown on MS medium (Sigma, USA), and the seeds were grown for 14 days under a 16/8 h light/dark cycle. Total RNA was prepared from the frozen seedlings in liquid nitrogen using an RNA extraction kit (Bioteke, China) according to the manufacturer’s instructions. Reverse transcription was performed using MMLV reverse transcriptase (TaKaRa, China) with the Oligo-dT primer (TaKaRa, China). The cDNA was synthesized and then PCR reactions performed in the presence of SYBR Green I (Invitrogen, USA) on a BioRad MyIQ5 real-time quantitative thermal cycler (BioRad, USA). The data were analyzed with MyIQ5 software (BioRad, USA) according to the manufacturer’s instructions. Relative expression levels of transgenic seedlings were calculated using the 2−CT method (Livak and Schmittgen, 2001). ACTIN2/8 was used as an internal control for qRT-PCR analysis. Three independent qRT-PCRs were performed and the average values and standard deviation calculated.

2.5. Phenotype characterization of the transgenic lines Seeds were germinated and grown on MS medium (Sigma, USA) supplemented with 3% (w/v) sucrose and 1% (w/v) agar, placed in the darkness at 4 ◦ C for three days, and thereafter grown in a greenhouse at 22 ◦ C under constant illumination at 130 ␮E/m2 s. The LK MS agar plates were prepared as described by Xu et al. (2006), except that 50 ␮M K+ was used. The LK + LCa agar plates were prepared by removing CaCl2 from the LK medium. Four-dayold seedlings grown on MS agar plates were transferred to LK or LK + LCa media, grown for 10 days, and then photographed. 3. Results 3.1. Linking of multiple genes involved in the K+ uptake regulatory pathway Using the improved version of the MultiRound Gateway entry vectors, pL12R34H-Ap and pL34R12H-Cm, we assembled 2–4 genes involved in the K+ nutrient uptake pathway (Figs. 1 and 2). To increase the cloning efficiency, from the second round of LR reaction, we used homing endonuclease I-SceI and PI-SceI to linearize the entry clones and destination vectors, respectively. The linearized vectors reduced the number of false background clones derived from the co-transformation of the two vectors under antibiotic selection pressure, and enhanced recombination efficiency according to the Gateway technology manual. HindIII and EcoRI digestion confirmed vector fragment lengths (Fig. S1). The cloning efficiencies of every round of the LR reactions indicated that the improved MultiRound Gateway method had very high cloning efficiencies, especially for the first 3 rounds of Gateway LR reactions, which had no background clones (Table 3). 3.2. Analysis of the integration and expression of the linked multiple genes in transgenic Arabidopsis The destination clones pK31, pK39 and pK4 were used to generate Arabidopsis transgenic lines and a total of 26 lines for pK31, a total of 16 lines for pK39 and a total of 20 lines for pK4 were obtained. The Arabidopsis transform efficiency for pK31, pK39 and pK4, which is about 0.36%, 0.25% and 0.13%, respectively, is slightly lower than that for single transgenes (usually 0.2–1% in our lab). PCR analysis was used to confirm that all multiple transgenes were integrated into the genome of independent T1 transformants. The

Fig. 1. Maps of multiple gene binary vectors generated by two to four rounds of MultiRound Gateway reactions. All of the binary vectors are derived from pMDC99 and only the features between the LB and the RB are shown. pS = pSuper; tN = tNos; B1/2/3/4 = attB1/2/3/4; LB/RB = left/right border of T-DNA.

F. Ren et al. / Journal of Plant Physiology 167 (2010) 1412–1417

1415

Fig. 2. Simplified and schematic diagram of four rounds of LR recombination reactions used to create the pK4 binary vector. Kn = kanamycin; Ap = Ampicillin; Cm = chloramphenicol; LB = left border; RB = right border; Cm(S)/Ap(S) = counterselection on Cm/Ap agar plates.

PCR results indicated that the ratios of the number of transgenic lines that contained entire transgenic fragments to total number of transgenic lines were (i) K31: 23/26 = 88%, (ii) K39: 14/16 = 88%, and (iii) K4: 16/20 = 80% (Fig. S2). Since most transgenic lines should contain a single T-DNA insertion, PCR amplification results of individual genes can largely reflect the integrity of T-DNAs. To further confirm the integrity of the transgenes in selected lines, we performed PCR with a forward primer located in the first assembled transgene and the reverse primer located in the last assembled transgene. The results were in accordance with those obtained with PCR amplification of individual transgenes (Fig. S2). These data indicate highly efficient multiple transgene integration into the genome using the same promoter and terminator. To detect expression levels of the transgenes, we performed quantitative RT-PCR (qRT-PCR) analysis of T3 transgenic seedlings. For each construct, three replicate qRT-PCR analyses were done for three lines (Fig. 3). Compared to the wild type, expression levels of all three transgenes were higher in K31-2 and K31-5 lines, but were similar to wild type in the K31-1 line. The expression level of CBL1 in the K31-2 line was about 30-fold compared to wild-type plants. In the K39 transgenic lines, all three transgenes were overexpressed at high levels. CIPK23 in the K39-1 line was overexpressed about

Fig. 3. The relative transcript level of CIPK23, CBL1, AKT1 and CBL9 in different transgenic lines. The transgenes are normalized to Actin2/8, and the transgenic lines are normalized to wild type. Average ± standard deviation (n = 3).

20-fold higher than in the wild type. In the three K4 lines, the four transgenes showed 5- to 15-fold higher expression than in wild type (Fig. 3). These results indicate that the transgenes were usually overexpressed at a reasonably high level.

Table 3 Cloning efficiencies of MultiRound Gateway reactions. Total coloniesa

Ap(S) or Cm(S)b

PCR(+)c

Cloning efficiencyd

Round

Destination vectors

Round 1

pK10-R34

∼96

8/8 (100%)

8/8 (100%)

100%

Round 2

pK21-R12 pK29-R12 pK21 pK29

∼151 ∼163 ∼186 ∼193

8/8 (100%) 8/8 (100%) 8/8 (100%) 8/8 (100%)

8/8 (100%) 8/8 (100%) 8/8 (100%) 8/8 (100%)

100% 100% 100% 100%

Round 3

pK31-R34 pK39-R34 pK31 pK39

∼102 ∼121 ∼147 ∼130

8/8 (100%) 8/8 (100%) 8/8 (100%) 8/8 (100%)

4/4 (100%) 4/4 (100%) 4/4 (100%) 4/4 (100%)

100% 100% 100% 100%

Round 4

pK4

∼64

10/64 (16%)

4/4 (100%)

16%

The total number of colonies was acquired with transformation from 5 ␮L out of 10 ␮L of LR reaction. The randomly selected recombination clones were counterselected by streaking them on LB agar plates supplemented with Ap or Cm. The clones sensitive and resistant to Cm and/or Ap were counted separately, and the percentage of the Cm(S)/Ap(S) clones is indicated in brackets. c The Ap- and/or Cm-sensitive clones were submitted for colony PCR identification. Those clones which were PCR-positive for all the different DNA fragments tested were counted as appropriate ones and indicated as PCR(+). The total number of tested clones is indicated in the denominators of the fractions. The percentage of the PCR(+) clones is indicated in brackets. d The cloning efficiencies were calculated by multiplying the percentage of Ap/Cm-sensitive clones by the percentage of the PCR(+) clones. a

b

1416

F. Ren et al. / Journal of Plant Physiology 167 (2010) 1412–1417

antibiotic selection pressure, (iii) decreasing LR recombination efficiency with increasing rounds of LR reactions, or (iv) homologous sequences may have affected Gateway LR reactions, since the four genes had the same pSuper promoter and tNos terminator, and CBL9 was highly homologous with CBL1. Our results showed that more than 80% of the transgenic lines tested retained all three or four linked transgenes, suggesting low homologous recombination probabilities in Agrobacterium or Arabidopsis. We are uncertain as to whether the transgenes are lost in Agrobacterium and/or in transgenic Arabidopsis, making it difficult to assess the recombination rate in Arabidopsis. Although overexpression of the K+ uptake regulatory pathway conferred enhanced LK tolerance (Xu et al., 2006), we did not observe better performance in the multiple gene overexpression lines compared to single gene overexpression lines. The overexpressing lines also showed no significantly enhanced tolerance to LCa, high salt, or LK combined with high salt (data not shown). Similarly, SOS1, SOS2 and SOS3 multiple overexpression lines did not show better salt tolerance than the single gene overexpression lines (Yang et al., 2009). It is possible that similar mechanisms resulted in the failed enhanced performance of the multitransgenic engineered SOS pathway and the K+ uptake regulatory pathway. Acknowledgements

Fig. 4. LK and LK + LCa tolerance of K31, K39 and K4 transgenic plants. 4-day-old seedlings grown on MS agar medium were transferred to MS (A and B), LK (C and D) and LK + LCa (E and F) medium, and the pictures were taken after 10 days.

This work was supported by the National Basic Research Program of China (No. 2006CB100100), the “111 Project” (No. B06003) and the Transgenic Engineering Crops Breeding Special Funds (No. 2009ZX08009-025B). Appendix A. Supplementary data

3.3. Analysis of low-K+ tolerance of transgenic plants To test whether overexpression of genes in the K+ uptake pathway enhanced plant tolerance to low-K+ (LK) with or without low-Ca2+ (LCa) stress, root-bending assays were performed on transgenic seedlings with known transcript levels (Fig. 3). Eight of the nine independent overexpressing lines showed root-bending growth and had more lateral roots than wild types (Col-0) in the LK medium (Fig. 4C and D), which is consistent with overexpression phenotypes in single CIPK23, CBL1 or CBL9 genes (Xu et al., 2006). K31-1 failed to exhibit an enhanced LK-tolerant phenotype in accordance with the lower expression levels of the three transgenes. Growth was more severely inhibited in LK + LCa medium than in LK medium, and all transgenic lines except K31-1 had significantly enhanced root growth compared to the wild type (Fig. 4E and F). Thus, the eight overexpression lines, except K31-1, displayed significant tolerance to LK with or without LCa compared to wild types. Significant differences between the K31, K39 and K4 lines were not observed. 4. Discussion In this study, we use the improved MultiRound Gateway vectors for efficient assembly and high-level overexpression of two to four transgenes using the same promoter and terminator. Our cloning scheme requires both restriction/ligation and Gateway steps. Once genes of interest were cloned into the improved entry vectors via traditional cut-and-ligate method, the subsequent multiple gene assembly via Gateway recombination cloning steps were easy and efficient. The cloning efficiency of the first three rounds of Gateway LR reactions was 100%, with zero background clones. The lower cloning efficiency in the fourth round of LR reactions may have been due to the (i) insufficient digestion with PI-SceI, (ii) lack of

Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.jplph.2010.03.021. References Batistiˇc O, Kudla J. Plant calcineurin B-like proteins and their interacting protein kinases. BBA – Mol Cell Res 2009;1793:985–92. Butelli E, Titta L, Giorgio M, Mock HP, Matros A, Peterek S, et al. Enrichment of tomato fruit with health-promoting anthocyanins by expression of select transcription factors. Nat Biotechnol 2008;26:1301–8. Chen QJ, Zhou HM, Chen J, Wang XC. A Gateway-based platform for multigene plant transformation. Plant Mol Biol 2006;62:927–36. Cheo DL, Titus SA, Byrd DR, Hartley JL, Temple GF, Brasch MA. Concerted assembly and cloning of multiple DNA segments using in vitro site-specific recombination: functional analysis of multi-segment expression clones. Genome Res 2004;14:2111–20. Cheong YH, Pandey GK, Grant JJ, Batistic O, Li L, Kim BG, et al. Two calcineurin B-like calcium sensors, interacting with protein kinase CIPK23, regulate leaf transpiration and root potassium uptake in Arabidopsis. Plant J 2007;52: 223–39. Clough SJ, Bent AF. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 1998;16:735–43. Curtis MD, Grossniklaus U. A gateway cloning vector set for high-throughput functional analysis of genes in planta. Plant Physiol 2003;133:462–9. Dafny-Yelin M, Chung SM, Frankman EL, Tzira T. pSAT RNA interference vectors: a modular series for multiple gene down-regulation in plants. Plant Physiol 2007;145:1272–81. Dafny-Yelin M, Tzfira T. Delivery of multiple transgenes to plant cells. Plant Physiol 2007;145:1118–28. Daniell H, Dhingra A. Multigene engineering: dawn of an exciting new era in biotechnology. Curr Opin Biotechnol 2002;13:136–41. Goderis IJ, De Bolle MF, Francois IE, Wouters PF, Broekaert WF, Cammue BP. A set of modular plant transformation vectors allowing flexible insertion of up to six expression units. Plant Mol Biol 2002;50:17–27. Halpin C. Gene stacking in transgenic plants – the challenge for 21st century plant biotechnology. Plant Biotechnol J 2005;3:141–55. Karimi M, Bleys A, Vanderhaeghen R, Hilson P. Building blocks for plant gene assembly. Plant Physiol 2007a;145:1183–91. Karimi M, Depicker A, Hilson P. Recombinational cloning with plant gateway vectors. Plant Physiol 2007b;145:1144–54.

F. Ren et al. / Journal of Plant Physiology 167 (2010) 1412–1417 Lee LY, Kononov ME, Bassuner B, Frame BR, Wang K, Gelvin SB. Novel plant transformation vectors containing the superpromoter. Plant Physiol 2007a;145: 1294–300. Lee SC, Lan WZ, Kim BG, Li L, Cheong YH, Pandey GK, et al. A protein phosphorylation/dephosphorylation network regulates a plant potassium channel. Proc Natl Acad Sci USA 2007b;104:15959–64. Lin L, Liu YG, Xu X, Li B. Efficient linking and transfer of multiple genes by a multigene assembly and transformation vector system. Proc Natl Acad Sci USA 2003;100:5962–7. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative pcr and the 2(-delta delta c(t)) method. Methods 2001;25: 402–8. Sasaki Y, SoneT, Yoshida S, Yahata K, Hotta J, Chesnut JD, et al. Evidence for high specificity and efficiency of multiple recombination signals in mixed DNA cloning by the Multisite Gateway system. J Biotechnol 2004;107:233–43.

1417

Tzfira T, Tian GW, Lacroix B, Vyas S, Li J, Leitner-Dagan Y, et al. pSAT vectors: a modular series of plasmids for autofluorescent protein tagging and expression of multiple genes in plants. Plant Mol Biol 2005;57:503–16. Xu J, Li HD, Chen LQ, Wang Y, Liu LL, He L, et al. A protein kinase, interacting with two calcineurin B-like proteins, regulates K+ transporter AKT1 in Arabidopsis. Cell 2006;125:1347–60. Yang Q, Chen ZZ, Zhou XF, Yin HB, Li X, Xin XF, et al. Overexpression of SOS (salt overly sensitive) genes increases salt tolerance in transgenic Arabidopsis. Mol Plant 2009;2:22–31. Ye X, Al Babili S, Kloti A, Zhang J, Lucca P, Beyer P, et al. Engineering the provitamin A (beta-carotene) biosynthetic pathway into (carotenoid-free) rice endosperm. Science 2000;287:303–5. Zhu C, Naqvi S, Breitenbach J, Sandmann G, Christou P, Capell T. Combinatorial genetic transformation generates a library of metabolic phenotypes for the carotenoid pathway in maize. Proc Natl Acad Sci USA 2008;105:18232–7.