Enhanced angiogenesis promoted by human umbilical mesenchymal stem cell transplantation in stroked mouse is Notch1 signaling associated

Accepted Manuscript Enhanced Angiogenesis Promoted by Human Umbilical Mesenchymal Stem Cell Transplantation in Stroked Model is Notch1 Signaling Associated Juehua Zhu, Qian Liu, Yongjun Jiang, Li Wu, Gelin Xu, Xinfeng Liu PII: DOI: Reference:

S0306-4522(15)00093-7 http://dx.doi.org/10.1016/j.neuroscience.2015.01.038 NSC 16018

To appear in:

Neuroscience

Accepted Date:

8 January 2015

Please cite this article as: J. Zhu, Q. Liu, Y. Jiang, L. Wu, G. Xu, X. Liu, Enhanced Angiogenesis Promoted by Human Umbilical Mesenchymal Stem Cell Transplantation in Stroked Model is Notch1 Signaling Associated, Neuroscience (2015), doi: http://dx.doi.org/10.1016/j.neuroscience.2015.01.038

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Enhanced Angiogenesis Promoted by Human Umbilical Mesenchymal Stem Cell Transplantation in Stroked Model is Notch1 Signaling Associated

Juehua Zhu, Qian Liu, Yongjun Jiang, Li Wu, Gelin Xu, Xinfeng Liu* Department of Neurology, Jinling Hospital, Nanjing University School of Medicine, 305 East Zhongshan Road, Nanjing 210002, Jiangsu, China *Correspondence addressed to: Xinfeng Liu, Department of Neurology, Jinling Hospital, Nanjing University School of Medicine, 305 East Zhongshan Road, Nanjing 210002, Jiangsu, China Tel: +86 25 84801861 Fax: +86 25 84664563 Email address: Xinfeng Liu: [email protected] Juehua Zhu: [email protected] Qian Liu : [email protected] Li Wu: [email protected] Gelin Xu: [email protected] Yongjun Jiang: [email protected]

Abstract Cellular therapy has provided hope for restoring neurological function post stroke through promoting endogenous neurogenesis, angiogenesis and synaptogenesis. The current study was based on the observation that transplantation of human umbilical cord mesenchymal stem cells (hUCMSCs) promoted the neurological function improvement in stroked mice and meanwhile enhanced angiogenesis in the stroked hemisphere. Grafted hUCMSCs secreted human VEGF-A. Notch1 signaling was activated after stroke and also in the grafted hUCMSCs. To address the potential mechanism that might mediate such pro-angiogenic effect, we established a hUCMSCs-neurons co-culture system. Neurons were subjected to oxygen glucose deprivation (OGD) injury before coculturing to mimic the in vivo cell transplantation. Consistent with the in vivo data, coculture medium claimed from hUCMSCs-OGD neurons co-culture system significantly promoted the capillary-like tube formation of brain derived endothelial cells. Moreover, coincident with our in vivo data, Notch 1 signaling activation was detected in hUCMSCs after co-cultured with OGD neurons as demonstrated by the up-regulation of key Notch1 signaling components Notch1 and NICD. In addition, OGD-neuron co-culture also increased the VEGF-A production by hUCMSCs. To verify whether Notch1 activation was involved in the pro-angiogenic effect, γ–secretase inhibitor DAPT was added into the co-culture medium before co-culture. It turned out that DAPT significantly prevented the Notch1 activation in hUCMSCs after co-culture with OGD neurons. More importantly, the pro-angiogenic effect of hUCMSCs was remarkably abolished by DAPT addition as demonstrated by inhibited capillary-like tube formation and less VEGF-A production. Regarding how Notch1 signaling was linked with VEGF-A secretion, we provided some

2

clue that Notch1 effector Hes1 mRNA expression was significantly up-regulated by OGD-neuron co-culturing and down-regulated after additional treatment of DAPT. In summary, our data provided evidence that the VEGF-A secretion from hUCMSCs after being triggered by OGD neurons is Notch1 signaling associated. This might be a possible mechanism that contributes to the angiogenic effect of hUCMSCs transplantation in stroked brain.

Keywords stroke; angiogenesis; human umbilical mesenchymal stem cells; Notch1 signaling; Hes1; VEGF-A

3

Abbreviation DAPT: N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester hUCMSCs: human umbilical cord mesenchymal stem cells MSCs: mesenchymal stem cells MCA: middle cerebral artery MCAo: middle cerebral artery occlusion NICD: Notch1 Intercellular Domain OGD: oxygen and glucose deprivation PBS: phosphate buffered saline RT-qPCR: real-time quantitative polymerase chain reaction TTC: 2, 3, 5-Triphenyltetrazolium chloride VEGF-A: vascular endothelial growth factor A

4

In recent years, transplantation of stem cells has been shown to improve neurological outcome in rodents with stroke (Vu et al., 2014). Among the plentiful range of stem cell options, human umbilical cord mesenchymal stem cells (hUCMSCs) are dominant for their ready availability in the acute stroke situation and the capability of high passage (Misra et al., 2012). It is well accepted that mesenchymal stem cells (MSCs) stimulated functional recovery after stroke by secreting trophic factors which directly or indirectly promote endogenous brain tissue repair and regeneration (such as neurogenesis, angiogenesis, synaptogenesis) (Hao et al., 2014). Current notion proposes that angiogenesis promotes neurogenesis and might provide the requisite molecular as well anatomic support for neural network, suggesting that modulation of angiogenesis might be promising in stroke rehabilitation (Beck and Plate, 2009). The hUCMSCs secrete many pro-angiogenic growth factors such as VEGF-A both in vitro culture (Koh et al., 2008, Edwards et al., 2014) and in vivo transplantation (Chung et al., 2009). Accompanied with increased vessel density and synaptogenesis in the ischemic boundary zone, hUCMSCs transplantation could finally improve neurological functional recovery after rodent stroke (Zhang et al., 2011). It is reasonable to propose that functional benefit gained by hUCMSCs treatment may derive at least partially from enhanced cerebral angiogenesis. However, up to now, most of the studies gave evidence that angiogenesis was enhanced by stem cell based therapy, but failed to elucidate the underlying mechanism how the pro-angiogenic effect was triggered or mediated. The current study is designed to focus on the pro-angiogenic effect of hUCMSCs and to address the possible mechanism that might mediate the secretome by hUCMSCs after transplantation in stroke mouse. The potential participation of VEGF-A-Notch1 signaling

5

was exclusively verified due to its fundamental function in angiogenesis (Kuhnert et al., 2011, Li et al., 2011). To mimic the in vivo transplantation and clarify the cross-talk between OGD injured neurons and grafted hUCMSCs, a hUCMSCs-neurons co-culture system is established.

6

Experimental Procedures Experimental design The current study included in vivo transplantation and in vitro co-culture. The in vivo part was designed to address whether our hUCMSCs transplantation could exert neurorestorative effect in mouse middle cerebral artery occlusion (MCAo) model and give some clue of the mechanism how the angiogenic effect was achieved. Neurological function recovery test, angiogenesis post stroke, secretion of human VEGF-A and the activation of Notch1 signaling were verified (Fig. 1A). To explore the pathway that might mediate the cross-talk between grafted hUCMSCs and ischemic neurons, a hUCMSCsneurons co-culture system was designed (Fig. 4A). The hUCMSCs were co-cultured with normal intact or OGD injured neurons with or without Notch inhibitor DAPT. Capillarylike tube formation assay, secretion of VEGF-A by hUCMSCs and activation of Notch1 signaling were verified using the co-culture medium or hUCMSCs samples after coculturing. Focal cerebral ischemia and reperfusion Adult male C57BL6/J mice (8-10 weeks age) were provided by the Model Animal Research Centre of Jingling Hospital (Nanjing, Jiangsu, P.R. China). Focal cerebral ischemia was induced by right intraluminal middle cerebral artery (MCA) occlusion as described previously (Zhu et al., 2012). Briefly, after mice were anesthetized with pentobarbital sodium (50mg/kg, i.p.), a 6-0 silicone-coated nylon filament was advanced from the external carotid artery into the lumen of internal carotid artery until the rounded tip reached the entrance to the MCA. The decline of blood flow in the MCA supply territory was confirmed by the laser Doppler flowmeter (LDF; Perimed PF5000, Stockholm, Sweden). Mouse presented at least 70% decrease of the baseline blood flow were included in the following transplantation (n=57). The mice were then briefly reanesthetized, and the filament was withdrawn to restore the blood flow 90 min after 7

occlusion. Body temperature was maintained at 37-38°C using a heating pad during the procedure. Ventral tail artery was isolated and cannulated. Before middle cerebral artery occlusion, during occlusion, and after reperfusion, arterial blood pressure was measured. Artery blood was collected for PaO2 and PaCO2 measurement. These recorded physiological parameters were shown in table 1. There were no difference between parameters at each time point between control group and hUCMSCs group. The mortality rate was 9% (5 out of 57) within the 24 hrs post stroke onset. Additionally, 12 animals were included in the sham group (6 for immunohistology staining and 6 for western blot). In the sham groups, all the procedures were the same as the stroked groups except that the filament was inserted less far so it would not block the blood flow in the MCA supplied area. No animals died in sham group. Isolation and preparation of hUCMSCs The hUCMSCs were provided by the Stem Cell Center of Jiangsu Province (Beike BioTechnology). These cells were derived from umbilical cord of informed, healthy mothers in local maternity hospitals after normal deliveries. Briefly, fresh human umbilical cords without cord blood were cut into 1mm2 pieces and floated in low-glucose Dulbecco’s modified Eagle’s medium (Life Technologies, Grand Island, NY) containing 10% fetal bovine serum (Life Technologies, Grand Island, NY). The pieces of cord were subsequently incubated at 37°C in a humidified atmosphere consisting of 5% CO2. When well-developed colonies of fibroblast-like cells appeared after 10 days, the cultures were trypsinized and passaged into a new flask for further expansion. All of the infused hUCMSCs were derived from passages 2-5, with rigorous purification and quality control. Cell viability was re-confirmed before injection, only samples meeting viability >90% were injected into animals. These cells express CD29, CD73, CD90 and CD105 (flow cytometry suggests expression >95% respectively; BD Biosciences (Frankliln Lakes, NJ)), and do not express CD45, CD34, CD14, CD79 or HLA-DR (<2%; BD Biosciences).

8

The differentiation capacity of hUCMSCs into adipogenic and osteogenic lineage was also confirmed. Transplantation Procedure The survived 52 animals post MCAo surgery, were randomly allocated to hUCMSCs group (n=26) or vehicle group (n=26) one day post stroke. The transplantation procedures were performed under aseptic conditions. At 24h after ischemia, cells for injection were prepared immediately before delivery. The hUCMSCs were dissociated, centrifuged and re-suspended with PBS. Mice were anesthetized with pentobarbital sodium (50 mg/kg, i.p, Sigma-Aldrich, USA). Approximately 0.75×105 hUCMSCs dissociated in 2 µl PBS (described as hUCMSCs group) were injected into the peri-infarct cortex: anteriorposterior (AP)=0 mm, middle-lateral (ML)=1.2 mm, dorsal-ventral (DV)=1.5 mm from the bregma . Immunosuppressors were not applied. Plain PBS without cells was injected in the same region of animals post stroke as vehicle control (described as vehicle group). No animals died after the hUCMSCs or vehicle transplantation. Behavioral Test A battery of behavior tests were performed on all animals before MCAO and on 1, 3, 7, 14, 28 days post hUCMSCs transplantation by an investigator who was blinded to the study design. The modified Neurological Severity Scores (mNSS) is composed of motor, sensory, reflex, and balance tests (Chen et al., 2001). It was graded on a scale of 0 to 18 with 0 considered as normal state and 18 as the maximum severe injury. For rotarod test, animals were placed on an accelerating rotarod cylinder and the time the animals remained on the rotarod was measured. The speed of the cylinder was slowly increased from 4 to 40 rpm within 5 minutes. Animals were trained 3 days before surgery and a 9

baseline was taken. The mean duration (seconds) on the rod was recorded in 3 trials per day. The rotarod test was presented as percentage of mean duration on the rod compared with the baseline. For adhesive removal test, small adhesive tape strips (0.3 cm × 0.4 cm) were applied on both forepaws of the animal. The time to remove them was counted. A training session of 1 trial per day for 1 week was given before surgical procedures and baseline was taken. The time to remove the tape was recorded on 5 trials per day. Those animals showed baseline mNSS score higher than 0, or baseline Rotarod test duration time on third day of test lower than 20s, or baseline adhesive removal time longer than 10 seconds were excluded from following post stroke behavior tests. Twenty animals were included in each group (n=20). Among them, 12 animals in each group were sacrificed on D14 after behavior tests (6 for immunohistochemistry and 6 for western blot) for histology tests. And on D28 the remaining 8 animals were sacrificed after behavior tests. So as for results of our behavior tests, from D0-D14 they are data collected from 20 animals; and on D28, the data were from 8 animals. Infarct volume evaluation Three days post stroke onset, 6 animals in vehicle or hUCMSCs group were sacrificed. Brains were removed and briefly frozen at -20ºC for 15min. Frozen brain were sliced into section of 1mm thickness and then incubated in 2% 2, 3, 5-Triphenyltetrazolium chloride (TTC) at 37ºC for 20min. The infarct area of each slice was measured by an investigator who was blinded to the experiment design using Image J. Infarct volume was presented as a percentage of total contralateral hemisphere volume according to our published paper (Zhu et al., 2012). Immunohistochemistry and quantification

10

At 14 days after transplantation, after behavior tests, 6 animals in each group were randomly selected and were perfused transcardially with PBS and 4% PFA. Then brains were removed, dehydrated and sliced. All sections were processed simultaneously to ensure identical staining conditions. To identify angiogenesis, mouse brain slides were incubated with the primary antibody polyclonal rabbit anti-von Willebrand factor (vWF, 1:100, EMD Millipore, Billerica, MA, USA) at 4ºC overnight. Negative controls were prepared by omitting the primary antibodies. Detection took place by the Envision detection system (Dako, Carpinteria, CA, USA) with diaminobenzidine peroxidase serving as chromogen. The slides were briefly counterstained with hematoxylin and aqueously mounted. Any brown-stained endothelial cell or endothelial cell cluster that was clearly separated from adjacent microvessels was counted as one microvessel. The microvessel count was quantified on 10 vWF immunostained coronal sections at 200µm interval from -1mm to 1mm of bregma for each brain using Image J. For each section, counting was performed on six randomly selected non-overlapping areas in the ipsilateral hemisphere. Microvessel density was presented as number of vWF positive cells per mm2. As for immunostaining, brain slices of animals 14 days or 28 days post stroke were used accordingly. After rinsing in PBS and blocking using 10% normal donkey serum, the sections were incubated at 4°C overnight with the anti-human nuclei antibody (HuNu, MAB1281, Millipore, Billerica, MA, USA) diluted in 10% normal donkey (1:200), or VEGF-A antibody (Abcam, Cambridge, MA, 1:200) or NICD (Abcam, Cambridge, MA, 1:200). After 3 washes with PBS, antibody visualization was achieved by the incubation at room temperature for 1h with Alexa Fluor 555-conjugated donkey anti-mouse (1:500) (Life Technologies, USA). Negative controls were prepared by omitting the primary

11

antibody. The sections were then cover slipped with a fluorescent mounting medium. Sections were stored at 4°C until viewing under a Leica SP5 confocal microscope (Leica, France). For quantification of the number of HuNu+ cells within the grafted hemisphere, we assume that he grafted cells were evenly distributed in the injected site and the cells distributed in the shape of a cylinder, and in the inject point (AP=0mm) the distribution area of the cells were largest. The HuNu+ cell number (n) on this level was counted and the largest length (l) and largest width (w) of the distribution were measured. So the cell density (d) on this level would be d= n/(l*w). The distribution volume (V) would be V= π*(w/2)2*l. Then the total number of cells (N) would be N=d*V. Human UCMSCs-neurons co-culture system and oxygen-glucose deprivation (OGD) injury Our co-culture system was established using 0.4 µm pore size Transwell® plates (Corning Incorporated, Wujiang, China) that allow exchange of medium factors but not penetration of cells. Primary cortical neurons used in the current study were extracted from cortex of E16 C57 mouse as previously described. Purity of the primary culture was verified as the ratio of MAP2 positive cells higher than 95% among total cells. Neurons were planted on the upper chamber of transwell plates above of the 0.4 µm pore polycarbonate membrane (Fig. 4A). On the 7th day post primary neuronal culture, the culture medium was replaced with deoxygenated HBSS buffer. Neurons were then placed into an oxygen deprivation box aerated with 5% CO2 and 95% N2 at 37 °C for 2 hours. The neurons in the control group received HBSS without deoxygenation and were incubated in regular incubator for 2 hour. After OGD pretreatment, the HBSS buffer was removed and the old culture medium was added back. The cells were then placed back in

12

the regular incubator at with 5% CO2 at 37 °C for 24 hours for the re-oxygen and reglucose treatment. The upper insert wells with OGD or control treated neurons were then put above the lower chamber in which hUCMSCs are cultured. Gamma-secretase inhibitor DAPT was added to corresponding wells at the beginning of co-culturing to modulate the Notch pathway. 24 hours post co-culture, the co-culture medium was collected for capillary like tube formation and human VEGF-A ELISA tests. The hUCMSCs were extracted for protein or RNA collection for further western blotting or rt-qPCR. At least 3 wells duplicates were used in each experiments, and each experiment were repeated 3 times. Capillary-Like Tube Formation Assay To examine whether hUCMSCs induced angiogenesis after co-culturing with OGD injured neuron, a capillary-like tube formation assay was performed (Chen et al., 2003). Briefly, 24-well plates were coated with 0.3 mL of growth factor reduced chilled matrigel (BD Biosciences, Bedford, MA, USA) and allowed to polymerize at 37 °C for 30-60 minutes. Human brain derived endothelial cells (1.2×105 cells) were incubated for 16-18 hours at 37°C atmosphere in 24 hour with co-culture medium claimed from OGD neurons- hUCMSCs or intact neurons- hUCMSCs with or without DAPT. Endothelial cells cultured with plain DMEM medium were used as negative control, and cells cultured with DMEM medium containing 100 ng/ml VEGF-A were used as positive control. Tracks of endothelial cells organized into networks of cellular cords (tubes) were counted and averaged in randomly selected 3 microscopic fields. Total tube length was measured using Image J (NIH, USA). Enzyme-linked immunosorbent assay (ELISA) for human VEGF-A

13

Human VEGF-A protein level in the ischemic cortex in vehicle and hUCMSCs groups or according region in sham group 14 days post stroke and in the supernatant of co-culture medium was measured using commercially available kit specific for human VEGF-A (Human VEGF Quantiline ELISA kit, R&D systems, USA), according to the manufacture’s instructions. Quantitative real-time polymerase chain reaction (RT-qPCR) Total RNA was extracted from mouse ischemic boundary region or hUCMSCs using the TRIzol reagent (Life Technologies, Camarillo, CA, USA) following the manufacturer’s recommendation. Reverse transcript-reaction (RT) was carried out using the First-strand cDNA synthesis kit (Takara, Dalian, China) following the manufacturer’s recommendations. Obtained cDNA was amplified using the following primers: Notch1, 5’- GCAACAGCTCCTTCCACTTC - 3’ and 5’- GCCTCAGACACTTTGAAGCC -3’; Hes1, 5’-ATGGAGAAAAATTCCTCGTCCC-3’ and 5’GTTTATCCGGTGTCGTGTTGA-3’; Hes5, 5’-CTCAGCCCCAAAGAGAAAAA-3’ and 5’-GACAGCCATCTCCAGGATGT-3’; β-actin, 5’AGCGGGAAATCGTGCGTGAC-3’ and 5’- AGTTTCGTGGATGCCACAAGAC-3’. The amplification and data acquisition were run on a real-time PCR system (Agilent, USA) using FastStart universal STBR green master (Roche, Mannheim, Germany). All samples were analyzed in triplicates in three independent experiments. Reaction without cDNA was used as no template control and no RT controls were also set up to rule out genomic DNA contamination. Relative quantification of mRNA expression was determined using the 2-△△Ct method. Western Blot Analysis 14

Protein lysates were extracted from the ischemic boundary regions or hUCMSCs after coculture with neurons. Blots were probed with the following antibodies: Notch1, NICD, Dll4 and β-actin (all purchase from Cell Signalling Technology, Danvers, MA, USA). Protein expression of Relative changes in protein expression were estimated from the mean pixel density using Quantity One software 4.6.2 (Bio-Rad, USA), normalized to βactin, and calculated as target protein expression/β-actin expression ratios. Statistical analysis Statistical data were presented as mean±SEM. The significance of differences was determined using independent sample t-test and one-way ANOVA followed by post hoc test. Statistical significance was defined as P<0.05.

Results Human UCMSCs transplantation promoted neurorestoration and angiogenesis post stroke We grafted 1.5×105 hUCMSCs into the ischemic hemisphere of the mouse brain 24hrs post stroke onset. As long as 28 days post stroke, hUCMSCs could still be visualized at the grafted region with anti-human nuclei antibody (HuNu) immunostaining (Fig. 1B), suggesting that grafted cells could survive in the host brain for at least 4 weeks. Majority of survived cells distributed within the injected area, with very limited cells migrated outside of the injected core by 28 days post transplantation. The survival rate of the grafted cells was around 15.4% by 14 days post stroke (2.31×104 ±0.76×104, n=6), and 10.5% (1.68×104 ±0.52×104, n=8) by 28 days post stroke. No HuNu positive cells were found in vehicle-treated mouse brain. By 3 days post stroke, there was a tendency of 15

infarction volume reduction in the hUCMSCs group (Fig. 1C, n=6, 35.17%±3.70% vs. 43.83%±3.26, P=0.08), but statistically significant difference was not reached. But functional improvement was promoted by our hUCMSCs transplantation (Fig. 1D-1F). Compared with vehicle PBS treatment, hUCMSCs transplantation was demonstrated to fasten the motor, sensory and balance function. From D14 post stroke, mouse received hUCMSCs transplantation gave better performance in mNSS test (Fig. 1D, n=20, 5.0±0.3 vs. 6.0±0.3, P<0.05) and adhesive removal test (Fig. 1E, n=20, 74.3±2.2 vs. 95.2±4.0, P<0.01). On 28 days post stroke, mouse in hUCMSCs grafted group also showed better recovery compared with those in vehicle treated group (mNSS test: Fig. 1D, n=8, 3.3±0.4 vs. 4.8±0.2, P<0.05; rotarod test: Fig. 1F, n=8, 95.2±4.0 vs. 74.3±2.2, P<0.01). Accompanied with improved neurological function, hUCMSCs transplantation promoted angiogenesis in the ipsilateral hemisphere by 2wks post stroke (Fig. 1G-1J). We chose 2wks as the time point to observe angiogenesis because neurological performance improvement firstly emerged on 2wks post stroke in our transplantation setting. It turned out that stroke injury itself triggered angiogenesis in the ischemic boundary. Compared with that in sham-operated group, increased angiogenesis reaction was observed in vehicle treated stroke group as determined by increased vWF immunoreactive vascular density (Fig. 1J, n=6, 170±8.8/mm2 vs. 49.0±7.0/mm2, P<0.01) after stroke. Treatment with hUCMSCs further increased the vascular density at 14 days after stroke onset (230.3±11.0/mm2 vs. 170.0±8.8/mm2, P<0.01).

VEGF-A secretion by grafted hUCMSCs and Notch1 activation after transplantation

16

Our ELASA data (Fig. 2A) of brain homogenates from animals 2wks post stroke (13 days post hUCMSCs transplantation) demonstrated that human VEGF-A protein could be detected with the concentration of 19.21±1.93 (/total protein, pg/g) in the hUCMSCs group. In sham and vehicle groups, human VEGF-A in mouse brain homogenates could be barely detected (0.23±0.05pg/g, 0.24±0.04pg/g). And immunostaining of brain slices 2wks post stroke confirmed that some of the HuNu positive cells were also VEGF positive (Fig. 2B). These data provided evidence that in our study grafted hUCMSCs could excrete human VEGF-A after transplantation in stroked mouse. To explore how hUCMSCs transplantation promoted angiogenesis in the ischemic hemisphere, we detected the activation of many angiogenesis related pathway in the stroked mice. One of the many pathways that were dominantly activated by the ischemic injury was the Notch1 signaling. By 14 days post stroke, important elements of Notch1 signaling (Notch1, NICD, Dll4) were still activated in the ischemic hemisphere (Fig. 2C) in two groups subjected to MCAo stroke modeling. The protein expression of Notch1 (Fig. 2D, n=6, 0.72±0.42 vs. 0.51±0.03, P=0.036) and Dll4 (Fig. 2F, n=6, 0.73±0.04 vs. 0.52±0.03, P=0.035) were significantly up-regulated in the ischemic ipsilateral hemisphere of the PBS injected mice brain compared with that in sham group. Similarly, compared with the sham-operated group, all the three elements were remarkably increased in the hUCMSCs group (Notch1: 0.75±0.07 vs. 0.51±0.02, P=0.016; NICD: 0.53±0.05 vs. 0.37±0.02, P=0.022; Dll4: 0.78±0.07 vs. 0,52±0.03, P=0.009). However, the protein expression of Notch1, NICD or Dll4 was not altered by the hUCMSCs transplantation as relative to the control PBS injection. And more excitingly, our immunostaining of the brain slices 2wks post stroke demonstrated that in the hUCMSCs

17

group some of the HuNu+ hUCMSCs were also NICD positive (Fig. 2G), suggesting that Notch1 was activated in these grafted hUCMSCs. Here we hypothesized that stroke might activate Notch1 signaling within the host neurons, which afterwards triggered the pro-angiogenesis effect of hUCMSCs via interaction between the host injured neurons and the grafted hUCMSCs. To study exclusively the participation of Notch1 signaling in hUCMSCs secretion after ischemic injury, we designed the following in vitro neuron-hUCMSCs co-culture and performed related angiogenesis-related assays.

OGD pre-treated neuron co-culturing triggered Notch1 signaling activation in hUCMSCs We designed a neurons-hUCMSCs co-culture system with neurons planted on the upper chamber of the transwell and hUCMSCs cultured in the lower chamber (Fig. 4A). After 24hrs of co-culturing, the hUCMSCs were collected for RNA and protein sample extraction. Consistent with the in vivo data, co-culturing with OGD pre-treated neurons increased the Notch1 protein expression (Fig. 3A, 3B; 1.17±0.03 vs. 0.58±0.03, P<0.01) and mRNA transcription (Fig. 3D; 5.81±0.67 vs. 1.60±9.13, P<0.01) in hUCMSCs, as compared with co-culturing with intact neurons. Protein expression of cleaved Notch1 NICD (Fig. 3A, 3C) was also significantly increased in hUCMSCs after co-culturing with OGD neurons (0.89±0.06 vs. 0.61±0.04, P<0.01), suggesting that Notch1 was activated after OGD neuron co-culturing. Among the many NICD downstream genes, mRNA expression of Hes1 was up-regulated by 35.1 folds (Fig. 3E; 44.25±5.86 vs. 1.26±0.19, P<0.01) in hUCMSCs after OGD neuron stimulation. When γ-secretase inhibitor DAPT

18

was added into the medium before co-culture started, the OGD-induced Notch1 signaling activation was significantly reversed. Compared with hUCMSCs co-cultured with OGD neurons without DPAT, DAPT addition decreased the OGD triggered Notch1 protein expression by 44.4% (0.65±0.05 vs. 1.17±0.03, P=0.022) and mRNA transcription by 67.6% (1.88±0.23 vs. 5.81±0.67, P<0.01); NICD protein expression by 39.3% (0.54±0.07 vs. 0.89±0.06, P<0.01); as well as Hes1 mRNA expression by 54.9% (19.94±1.63 vs. 44.25±5.86, P<0.01). Hes5 mRNA expression (Fig. 3F) was also detected, but the overall change in different settings was not high enough for conclusion. Pro-angiogenesis effect provided by hUCMSCs was Notch1 signaling associated We collected the neurons-hUCMSCs co-culture medium for capillary like tube formation assay (Fig. 4A). Medium conditioned by OGD neurons-hUCMSCs co-culturing significantly promoted the formation of network of human brain derived endothelium as relative to that by intact neurons-hUCMSCs co-culturing (Fig 4B, 4D, 4H; 3.72±0.14mm/mm2 vs. 2.78±0.13 mm/mm2, P=0.015). When the endothelial cells were incubated with supernatant from OGD neurons co-cultured with hUCMSCs with DAPT added, capillary tube formation was remarkably decreased compared with that without DAPT (Fig. 4D, 4E, 4H, 2.03±0.16 mm/mm2 vs. 3.72±0.14mm/mm2, P<0.01). This suggested that the angiogenesis effect of hUCMSCs induced by OGD neuron coculturing is Notch1 signaling dependent or at least associated. Endothelium incubated with DMEM containing 100 ng/ml VEGF-A was used as positive control. This group showed the as much capillary tube formation as the OGD neuron-hUCMSCs co-culture medium (Fig. 4D, 4F, 4H; 4.30±0.17 mm/mm2 vs. 3.73±0.14, P=0.248). Plain DMEM

19

medium was used as negative control, in which setting no obvious capillary tube network was formed (Fig. 4G). VEGF-A mediated the pro-angiogenesis of hUCMSCs in a Notch1 dependent pattern The tube formation result gave a clue that VEGF-A might mediate the Notch1 dependent pro-angiogenesis factor of hUCMSCs. To verify the Notch1 signaling was involved in VEGF-A secretion, we further detected the mRNA transcription and protein translation of VEGF-A by hUCMSCs with or without DAPT by RT-qPCR and ELISA (Fig. 5). Compared with intact neurons, OGD pretreated neuron co-culturing increased the mRNA expression of VEGF-A in hUCMSCs from by 7.93 folds (Fig. 5A, 1.00±0.07 to 7.93±0.53, P<0.01). Supporting our assumption, such VEGF-A mRNA up-regulation was significantly inversed by the addition of DAPT (Fig. 5A, 4.20±0.82 vs. 7.93±0.53, P<0.01). Similarly, VEGF-A secretion in the co-culture medium suggested that OGD neuron co-culturing significantly increased VEGF-A level (Fig. 5B, 38.52±3.01 vs. 27.76±2.97, P=0.026). Blockade of Notch1 signaling by DAPT dramatically decreased the secretion VEGF-A from hUCMSCs into the co-culture medium (25.11±1.10 vs. 38.52±3.01, P<0.01).

Discussion Our data demonstrated that cellular therapy with hUCMSCs significantly improved neurological recovery post stroke in mice. Such neurorehabilitation might be to some extent related to promoted angiogenesis and secreted VEGF-A in the infarcted hemisphere contributed by the hUCMSCs transplantation. Notch1 signaling was activated

20

in the botch the stroke brain and the grafted hUCMSCs. In vitro neurons-hUCMSCs coculturing further revealed that ischemic injury could activate the Notch1 signaling in hUCMSCs and thereafter triggered the secretion of VEGF-A in a Notch1 signaling dependent manner. In the current study, the grafted hUCMSCs survived at least 28 days post stroke. The survival rate was 15.4% by 14 days post stroke and 10.6% by 28 days. The hUCMSCs decreased the infarction volume by 8.66%, but the difference was not significantly important (P=0.08). However, hUCMSCs transplantation still turned out promising as a stroke therapy. As on functional recovery perspective, hUCMSCs transplantation significantly improved the neurological function following stroke. We assume that the many factors might contribute to the no significantly reduced infarction, such as the administration route, the time of transplantation and the graft position. The hUCMSCs were injected 1 day after stroke into the ipsilateral cortex in our stroked mice. After acute ischemic stroke, the pathological cascades post stroke such as excitatory toxicity, oxidative stress, and inflammation made the ischemic hemisphere a very harsh environment for grafted cells to survive (Hao et al., 2014). Besides, there are reports that endogenous neurogenesis happens healthily and robustly in the striatum after stroke, but seldom in the infarcted cortex, suggesting that cortex itself is not a favorable microenvironment. The relatively low cell survival might be one of the reasons that the infarction volume was not changed. But the current study also indicated that hUCMSCs were powerful enough to enhance angiogenesis even at low effective dose (10.6-15.4% survival rate). Generally speaking, enhancing these endogenous regenerative processes (neurogenesis, angiogenesis,

21

synaptogenesis, et al.) has proved a shared way for stem cells to stimulate brain plasticity and functional recovery after stroke (Zhang and Chopp, 2009). We therefore assume that increased angiogenesis and potentially other enhanced endogenous brain repair might contribute to the improved behavior performance. It is well accepted that induction of angiogenesis stimulates endogenous repair mechanism, including neurogenesis, synaptogenesis, and neuronal and synaptic plasticity (Ergul et al., 2012). To make our story straightforward, the current study focused exclusively on the pro-angiogenesis remodeling of hUCMSCs transplantation. Accompanied with improved neurological recovery, we observed that angiogenesis was augmented by hUCMSCs. Clinical data supports that better angiogenesis remodeling is correlated with improved functional outcome in stroke patients (Szpak et al., 1999, Henderson et al., 2000). In the current study, increased angiogenesis activity, if not most the important, must be one of the many contributors of better performance in hUCMSCs transplanted group. Angiogenesis is a multi-step process involves VEGF/VEGFR2, angiogiopoietins 1 and 2 and their receptor, Tie 2 (Yancopoulos et al., 1998). Among all of these, VEGF-A signaling is demonstrated to be the major pathway activates embryonic vasculogenesis and postnatal angiogenesis (Lohela et al., 2009). Manipulation of VEGF-A-Notch1 signaling circuit drives the formation and maturation of vascular endothelial progenitors from human embryonic stem cells (Sahara et al., 2014). It is believed that MSCs secrete a broad spectrum of trophic factors and immunodulatory cytokines and have considerable potential for the treatment of cardiovascular disease and brain damage via enhancing endogenous neuroprotection, neurogenesis and angiogenesis (Xiong et al., 2010,

22

Ranganath et al., 2012). Our data supported these literation by providing evidence that hUCMSCs secreted VEGF-A after transplanted in stroked hemisphere and co-culturing with OGD pretreated neurons. Co-culture medium from hUCMSCs and OGD neurons could also induce robust capillary-like tube formation of human brain derived endothelial cells. Furthermore, our transplantation data revealed that Notch1 signaling was activated in stroked hemisphere as long as 14 days post stroke. And Notch1 was also activated in the grafted hUCMSCs. In tumor, Dll4/Notch1 signaling has recently emerged as a critical regulator of tumor angiogenesis and thus as a promising new therapeutic antiangiogenesis target for tumor treatment (Dufraine et al., 2008, Kuhnert et al., 2011). In addition, injection of MSCs overexpressing NICD into infarcted hearts promotes cardiac repair after myocardial infarction probably through Notch-1 mediated neovascularization (Li et al., 2011). We assume that Notch1 signaling might be involved in the secretome of hUCMSCs and their pro-angiogenesis effect in stroke. However, due to the cross-talk between multiple cells, it is challenging to modulate the signal activation in a single cell population in vivo transplantation situation. To this end, we employed a hUCMSCs-neurons co-culture system that allows the further molecular biology study and proper pharmacological treatment of hUCMSCs. Consistent with the in vivo transplantation data which showed Notch1 activation in hUCMSCs grafted brain and grafted hUCMSCs, the co-culture results suggested that Notch1 and NICD expression within hUCMSCs were up-regulated when co-cultured with OGD injured neurons. And administration of γ–secretase inhibitor DAPT dramatically inhibited the S-cleavage of Notch1, further revealing that such Notch1 activation induced by OGD neuron was γ–secretase dependent.

23

Generally speaking, canonical Notch signaling provides a short-range communication transducer that requires the physical contact between Notch ligands and receptors (Kopan and Ilagan, 2009). While canonical Notch ligands are responsible for the majority of Notch signaling, a diverse group of non-canonical ligands has been identified that activate Notch and contribute to the pleiotropic effects of Notch signaling (D'Souza et al., 2010). Secreted Notch ligands such as CNN3/NOV activate Notch and produce changes in Hes1 expression in an autocrine fashion (Gupta et al., 2007). Other activators of Notch1 have been identified such as EZH2(Gonzalez et al., 2014) and valproic acid (Greenblatt et al., 2008), to bind to Notch1 promoter and activate Notch1 signaling. It is true our co-culture system could not perfectly mimic the in vivo transplantation circumstance since the OGD injured neurons could not physically contact the hUCMSCs and there was no participation of other cell populations like endothelial cells and glia. Nevertheless, in our neurons-hUCMSCs co-culture model, the Notch1 signaling was similarly activated as the in vivo condition in a γ–secretase-dependent manner, and mechanically might through the non-canonical pathway or by the canonical pathway within the same cell population in an autocrine way. Accompanied the Notch1 activation, co-culture medium from hUCMSCs with OGD injured neurons showed powerful pro-angiogenic effect upon brain derived endothelial cells. Capillary like tube formation triggered by the co-culture medium was as good as that treated with medium containing VEGF-A. These data on the one hand supported the in vivo transplantation result that hUCMSCs promote angiogenesis in ischemic circumstance, and on the other hand suggested that hUCMSCs might secrete proangiogenic neurotrophic factors such as VEGF-A. To verify the production of VEGF-A

24

by hUCMSCs, we both detected the mRNA level and the soluble VEGF-A concentration in the co-culture medium. Just as we reasoned, co-culture with OGD neurons upregulated the transcription of VEGF-A mRNA and also its protein secretion. To verify whether Notch1 signal activation was involved in the VEGF-A secretome, we further added DAPT into the co-culture medium. It turned out that the DAPT totally abolished the pro-angiogenic effects of hUCMSCs gained from co-culturing with OGD pretreated neurons. As relative to hUCMSCs culturing with OGD neurons without DAPT, DAPT addition significantly decreased the mRNA production of VEGF-A and thereafter its secretion into the co-culture medium. Meanwhile, this co-culture medium could not support as well capillary like tube network formation as that without DAPT. Decreased VEGF-A could be one of the possible reasons. Since there is cross-talk between Notch signaling and other vascular pathway involving platelet-derived growth factor, Wnt, hedgehog, and bone morphogenic protein in regulating angiogenesis (Lawson et al., 2002), we could not exclude that DAPT might alter the expression of other angiogenesis related factors. To further explore how activation of Notch1 signaling triggered the VEGF-A secretion by hUCMSCs, we measured the modulation of Notch1 target genes in the co-culture system. Hes1 and hes5 are primary targets of Notch in tissue culture (Iso et al., 2003), so we focused our attention on the mRNA expression of these two genes. Although the expression of Hes5 was slightly changed in our co-culture condition, surprisingly, Hes1 mRNA expression was remarkably up-regulated in hUCMSCs co-cultured with OGD neurons along with the increased VEGF-A production and enhanced capillary-like tube formation. Inhibited Notch1 cleavage with DAPT blocked Hes1 mRNA transcription and

25

also the VEGF-A secretion. We assume that increased Hes1 in hUCMSCs might promote VEGF-A production and release. Supporting evidence could be found from previous literature. Hes1 is suggested to repress the PI3K/Akt pathway inhibitor PTEN (phosphatase and tension homolog) (Wong et al., 2012). And PTEN inhibition is shown to increase VEGF-A secretion (Ma et al., 2009). Evidence has been provided that Notch signaling is the upper stream signaling of the VEGF-HIF-1α pathway. Depending on the expression of Notch effector Hes1, Notch signaling enhances signal transducers and activators of transcription3 (STAT3) phosphorylation that is required for HIF-1α expression (Lee et al., 2009). And it is reported that HIF-1α-modification enhanced the VEGF-A release from bone marrow MSCs (Zhong et al., 2012). Here our study further demonstrates that the pro-angiogenic effect of hUCMSCs is VEGF-A related and more interestingly Notch 1 signaling dependent. Moreover, Notch1 effector Hes1 up-regulation might modulate the VEGF-A secretome by hUCMSCs. Hes1 or Notch1 gene overexpression might be promising target to enhance the effectiveness of hUCMSCs or the stem cells transplantation.

Conclusions Here we extend the understanding of hUCMSCs based cellular therapy by providing experimental evidence that the pro-angiogenic effect of hUCMSCs triggered by ischemic injury is Notch1 signaling associated. Using an in vitro co-culture model, our data suggested that Notch1 activation in hUCMSCs is essential for their secretion of VEGF-A. This is probably through the direct effects of Notch1 target genes such as Hes1.

26

Pharmacological inhibition of Notch1 signaling in hUCMSCs dramatically abolished the secretion of VEGF-A and the subsequent pro-angiogenesis effects. The limitation of the current study is that our co-culture model could not perfectly mimic the in vivo transplantation. Our co-culture system does not include the glia, and the physical contact between the grafted cells and host brain cells are not allowed. But at least, through exclusively study of the cross talk between grafted hUCMSCs and host neurons, our data suggests that non-canonical Notch1 activation is dependent for the angiogenic effect of hUCMSCs. Moreover, since DPAT also inhibited Notch3, we could exclude the possibility that Notch3 might play a role in the pro-angiogenic effect of hUCMSCs too. Optimizing of the co-culture system is on-going to better mimic the in vivo transplantation.

Acknowledgements This study is supported by Natural Science Foundation of China (31171016 to Xinfeng Liu and 31200817 to Yongjun Jiang). Special thanks to Xin Wang from Stem Cell Center of Jiangsu Province (Beike Bio-Technology) for providing the hUCMSCs.

27

References Beck H, Plate KH (2009) Angiogenesis after cerebral ischemia. Acta neuropathologica 117:481-496. Chen J, Li Y, Wang L, Zhang Z, Lu D, Lu M, Chopp M (2001) Therapeutic benefit of intravenous administration of bone marrow stromal cells after cerebral ischemia in rats. Stroke 32:1005-1011. Chen J, Zhang ZG, Li Y, Wang L, Xu YX, Gautam SC, Lu M, Zhu Z, Chopp M (2003) Intravenous administration of human bone marrow stromal cells induces angiogenesis in the ischemic boundary zone after stroke in rats. Circ Res 92:692699. Chung DJ, Choi CB, Lee SH, Kang EH, Lee JH, Hwang SH, Han H, Lee JH, Choe BY, Lee SY, Kim HY (2009) Intraarterially delivered human umbilical cord bloodderived mesenchymal stem cells in canine cerebral ischemia. J Neurosci Res 87:3554-3567. D'Souza B, Meloty-Kapella L, Weinmaster G (2010) Canonical and non-canonical Notch ligands. Curr Top Dev Biol 92:73-129. Dufraine J, Funahashi Y, Kitajewski J (2008) Notch signaling regulates tumor angiogenesis by diverse mechanisms. Oncogene 27:5132-5137. Edwards SS, Zavala G, Prieto CP, Elliott M, Martinez S, Egana JT, Bono MR, Palma V (2014) Functional analysis reveals angiogenic potential of human mesenchymal stem cells from Wharton's jelly in dermal regeneration. Angiogenesis. Ergul A, Alhusban A, Fagan SC (2012) Angiogenesis: a harmonized target for recovery after stroke. Stroke 43:2270-2274. Gonzalez ME, Moore HM, Li X, Toy KA, Huang W, Sabel MS, Kidwell KM, Kleer CG (2014) EZH2 expands breast stem cells through activation of NOTCH1 signaling. Proc Natl Acad Sci U S A 111:3098-3103. Greenblatt DY, Cayo MA, Adler JT, Ning L, Haymart MR, Kunnimalaiyaan M, Chen H (2008) Valproic acid activates Notch1 signaling and induces apoptosis in medullary thyroid cancer cells. Annals of surgery 247:1036-1040. Gupta R, Hong D, Iborra F, Sarno S, Enver T (2007) NOV (CCN3) functions as a regulator of human hematopoietic stem or progenitor cells. Science 316:590-593. Hao L, Zou Z, Tian H, Zhang Y, Zhou H, Liu L (2014) Stem cell-based therapies for ischemic stroke. BioMed research international 2014:468748. Henderson RD, Eliasziw M, Fox AJ, Rothwell PM, Barnett HJ (2000) Angiographically defined collateral circulation and risk of stroke in patients with severe carotid artery stenosis. North American Symptomatic Carotid Endarterectomy Trial (NASCET) Group. Stroke 31:128-132. Iso T, Kedes L, Hamamori Y (2003) HES and HERP families: multiple effectors of the Notch signaling pathway. Journal of cellular physiology 194:237-255. Koh SH, Kim KS, Choi MR, Jung KH, Park KS, Chai YG, Roh W, Hwang SJ, Ko HJ, Huh YM, Kim HT, Kim SH (2008) Implantation of human umbilical cord-derived mesenchymal stem cells as a neuroprotective therapy for ischemic stroke in rats. Brain Res 1229:233-248. Kopan R, Ilagan MX (2009) The canonical Notch signaling pathway: unfolding the activation mechanism. Cell 137:216-233. 28

Kuhnert F, Kirshner JR, Thurston G (2011) Dll4-Notch signaling as a therapeutic target in tumor angiogenesis. Vascular cell 3:20. Lawson ND, Vogel AM, Weinstein BM (2002) sonic hedgehog and vascular endothelial growth factor act upstream of the Notch pathway during arterial endothelial differentiation. Dev Cell 3:127-136. Lee JH, Suk J, Park J, Kim SB, Kwak SS, Kim JW, Lee CH, Byun B, Ahn JK, Joe CO (2009) Notch signal activates hypoxia pathway through HES1-dependent SRC/signal transducers and activators of transcription 3 pathway. Molecular cancer research : MCR 7:1663-1671. Li Y, Hiroi Y, Ngoy S, Okamoto R, Noma K, Wang CY, Wang HW, Zhou Q, Radtke F, Liao R, Liao JK (2011) Notch1 in bone marrow-derived cells mediates cardiac repair after myocardial infarction. Circulation 123:866-876. Lohela M, Bry M, Tammela T, Alitalo K (2009) VEGFs and receptors involved in angiogenesis versus lymphangiogenesis. Current opinion in cell biology 21:154165. Ma J, Sawai H, Ochi N, Matsuo Y, Xu D, Yasuda A, Takahashi H, Wakasugi T, Takeyama H (2009) PTEN regulates angiogenesis through PI3K/Akt/VEGF signaling pathway in human pancreatic cancer cells. Molecular and cellular biochemistry 331:161-171. Misra V, Ritchie MM, Stone LL, Low WC, Janardhan V (2012) Stem cell therapy in ischemic stroke: role of IV and intra-arterial therapy. Neurology 79:S207-212. Ranganath SH, Levy O, Inamdar MS, Karp JM (2012) Harnessing the mesenchymal stem cell secretome for the treatment of cardiovascular disease. Cell stem cell 10:244258. Sahara M, Hansson EM, Wernet O, Lui KO, Spater D, Chien KR (2014) Manipulation of a VEGF-Notch signaling circuit drives formation of functional vascular endothelial progenitors from human pluripotent stem cells. Cell research. Szpak GM, Lechowicz W, Lewandowska E, Bertrand E, Wierzba-Bobrowicz T, Dymecki J (1999) Border zone neovascularization in cerebral ischemic infarct. Folia neuropathologica / Association of Polish Neuropathologists and Medical Research Centre, Polish Academy of Sciences 37:264-268. Vu Q, Xie K, Eckert M, Zhao W, Cramer SC (2014) Meta-analysis of preclinical studies of mesenchymal stromal cells for ischemic stroke. Neurology 82:1277-1286. Wong GW, Knowles GC, Mak TW, Ferrando AA, Zuniga-Pflucker JC (2012) HES1 opposes a PTEN-dependent check on survival, differentiation, and proliferation of TCRbeta-selected mouse thymocytes. Blood 120:1439-1448. Xiong Y, Mahmood A, Chopp M (2010) Angiogenesis, neurogenesis and brain recovery of function following injury. Curr Opin Investig Drugs 11:298-308. Yancopoulos GD, Klagsbrun M, Folkman J (1998) Vasculogenesis, angiogenesis, and growth factors: ephrins enter the fray at the border. Cell 93:661-664. Zhang L, Li Y, Zhang C, Chopp M, Gosiewska A, Hong K (2011) Delayed administration of human umbilical tissue-derived cells improved neurological functional recovery in a rodent model of focal ischemia. Stroke 42:1437-1444. Zhang ZG, Chopp M (2009) Neurorestorative therapies for stroke: underlying mechanisms and translation to the clinic. Lancet Neurol 8:491-500.

29

Zhong Q, Zhou Y, Ye W, Cai T, Zhang X, Deng DY (2012) Hypoxia-inducible factor 1alpha-AA-modified bone marrow stem cells protect PC12 cells from hypoxiainduced apoptosis, partially through VEGF/PI3K/Akt/FoxO1 pathway. Stem Cells Dev 21:2703-2717. Zhu J, Jiang Y, Wu L, Lu T, Xu G, Liu X (2012) Suppression of local inflammation contributes to the neuroprotective effect of ginsenoside Rb1 in rats with cerebral ischemia. Neuroscience 202:342-351.

30

Figure Captions Figure 1. The human umbilical mesenchymal stem cells (hUCMSCs) transplantation accelerated the neurological function recovery and promoted angiogenesis post stroke. (A) Schematic diagram of the study design of in vivo hUCMSCs transplantation in stroked mouse. (B) Grafted hUCMSCs could be visualized via anti-human nucleic antibody (HuNu) staining as long as 28 days post after transplantation within the ipsilateral hemisphere, scale bar= 50 µm. (C) Infarcted volume of the animals subjected to hUCMSCs or PBS control transplantation 3 days post stroke. (D) Modified neurological severity score (mNSS), (E) adhesive removal test, and (F) accelerating rotarod test were performed to verify the neurological function recovery post stroke up to 28 days post transplantation both in hUCMSCs and vehicle treated groups. (G-I) Representative images of angiogenesis as indicated by anti-vWF immunostaining, scale bar=100 µm. (J) Quantitative analysis of capillary density in the stroke ipsilateral brain. All values are shown as mean±SEM, *P<0.05, **P<0.01.

Figure 2. VEGF-A secretion from hUCMSCs and Notch1 signaling activation post stroke. (A) Human VEGF-A (hVEGFa) ELISA assay of the ipsilateral brain homogenates 14 days post stroke. (B, G) Immunostaining of brain slices from animals in hUCMSCs group 14 days post stroke, scale bar=50 or 100µm. (C) Representative western blot images of Notch1 signaling key components using protein extract from ipsilateral hemisphere of brain 14 days post stroke and their analysis: (D) Notch1, (E) NICD and (F) Dll4. All values are presented as mean±SEM, *P<0.05, **P<0.01.

31

Figure 3. Notch1 signaling activation in hUCMSCs after co-culturing with neurons. Western blot detected the protein expression of (A, B) Notch1 and (A, C) NICD in the hUCMSCs. And real-time qPCR detected the mRNA expression of (D) Notch1, (E) Hes1 and (F) Hes5 in the hUCMSCs. Data presented as mean±SEM, *P<0.05, **P<0.01.

Figure 4. Neurons and hUCMSCs co-culture medium induced capillary-like tube formation. (A) Schematic diagram of neurons-hUCMSCs co-culture system. Capillarylike tube formation of human brain derived endothelial cells incubated with medium from hUCMSCs and intact neurons co-culture system (B) without or with (C) DPAT, from hUCMSCs and OGD neurons co-culture system (D) without or with (E) DAPT. Human brain derived endothelial cells incubated with a regular DMEM medium with VEGF-A were used as positive control (F), and those incubated with plain DMEM medium as negative control (G); Scale bar = 100 µm. (H) Quantitative analysis of capillary-like tube formation. All values presented as mean±SEM, *P<0.05, **P<0.01.

Figure 5. Human VEGF-A secretion by hUCMSCs after co-culture with neurons. After 24 hours of co-culture with normal or OGD treated neurons with or without DPAT, hUCMSCs were collected for real-time qPCR measurement of VEGF-A mRNA expression (A), and co-culture medium collected for secreted human VEGF-A measurement by ELISA (B). All values presented as mean±SEM, *P<0.05, **P<0.05

32

33

34

35

36

37

Table 1. Physiological parameters for animals during the surgical procedure Parameters Blood flow (%)

BP (mmHg)

pH

PaO2 (mmHg)

PaCO2 (mmHg)

Temperature (°C)

hUCMSCs group

Control group

P

before MCAo

100±0.0

100±0.0

>0.05

during MCAo

24.4±4.9

22.6±4.2

>0.05

after reperfusion

94.5±2.6

93.8±2.9

>0.05

before MCAo

100±4

100±8

>0.05

during MCAo

101±5

101±4

>0.05

after reperfusion

99±6

100±7

>0.05

before MCAo

7.35±0.03

7.35±0.02

>0.05

during MCAo

7.34±0.04

7.34±0.08

>0.05

after reperfusion

7.34±0.08

7.35±0.04

>0.05

before MCAo

115±6

114±5

>0.05

during MCAo

110±5

113±8

>0.05

after reperfusion

116±8

115±7

>0.05

before MCAo

47±5

47±3

>0.05

during MCAo

48±4

48±3

>0.05

after reperfusion

49±2

47±8

>0.05

before MCAo

37.1±0.3

37.2±0.2

>0.05

during MCAo

37.4±0.5

37.5±0.5

>0.05

after reperfusion

37.2±0.4

37.4±0.4

>0.05

BP: blood pressure, blood flow was quantified as percentage of baseline; data presented as Mean±SEM. 38

1. hUCMSCs transplantation enhances angiogenesis. 2. Notch1 activation is involved in VEGF-A secretion by hUCMSCs and promotes angiogenesis. 3. Hes5 up-regulation might mediate the VEGF-A secretome.

39