- Email: [email protected]
Enhanced biofilm formation and denitrification in biofilters for advanced nitrogen removal by rhamnolipid addition
Bioresource Technology 287 (2019) 121387
Contents lists available at ScienceDirect
Bioresource Technology journal homepage: www.elsevier.com/locate/biortech
Short Communication
Enhanced biofilm formation and denitrification in biofilters for advanced nitrogen removal by rhamnolipid addition
T
⁎
Chong Peng, Yilin Gao, Xuan Fan, Pengcheng Peng, Hui Huang , Xuxiang Zhang, Hongqiang Ren State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023, Jiangsu, PR China
A R T I C LE I N FO
A B S T R A C T
Keywords: Denitrification biofilters (DNBFs) Advanced nitrogen removal Start-up Rhamnolipid Biofilm
Denitrification biofilters (DNBFs) are widely used in advanced nitrogen removal of wastewater with low C/N and effective biofilm formation is critical to their long-term operation. Hereby the influence of rhamnolipid addition in DNBFs was investigated for the first time. Gradient concentrations (0, 20, 40, 80, 120 mg/L) of rhamnolipid were applied to investigate nitrogen removal, biofilm properties and microbial community of lab-scale DNBFs. A significant increase of nitrogen removal was observed in rhamnolipid-treated DNBFs (p < 0.05). Total solid (TS), extracellular polymeric substances (EPS) and adhesion force of biofilms in DNBF with 120 mg/L rhamnolipid reached the maximum, which were 2.17, 2.15 and 3.36 times of those in the control, respectively. Moreover, rhamnolipid exhibited an improvement in abundance of Simplicispira and Gemmatimonas which were responsible for enhanced biofilm formation and denitrification. The results suggested that rhamnolipid addition can be a novel strategy to improve the start-up and denitrification performance of DNBFs.
1. Introduction Excessive nitrogen in the effluent of wastewater treatment plants (WWTPs) discharged to aquatic environments contributes to severe eutrophication which has been a thorny issue over these years. Therefore, advanced nitrogen removal which means reducing the total nitrogen (TN) concentration in the discharged effluent to meet specific standards and mitigate the impact of wastewater on eco-systems has attracted much attention in the field of wastewater treatment worldwide. For example, Grade Ⅰ-A discharge standard (≤15 mg/L TN in the effluent) for WWTPs in China has been extensively implemented, leading to a technological innovation boom for advanced nitrogen removal of secondary biochemical effluent (Zhang et al., 2016). Among advanced nitrogen removal processes, denitrification biofilters (DNBFs) has been widely applied in treatment of municipal wastewater and secondary effluent in WWTPs (Loupasaki and Diamadopoulos, 2013) for its simple operation, small footprint, low operation cost together with its capacities of advanced nitrogen removal. However, insufficient carbon source in advanced wastewater treatment usually has an obstacle for the denitrification process and leads to a low cell growth and biomass yield on carriers (Sun et al., 2016), resulting in the delay of the biofilm formation and start-up of DNBFs. Besides, the bacterial community in biofilm systems was closely related to nutrient removal efficiency (Truu et al., 2018), thus a mature biofilm consisted of
⁎
functional denitrifying bacteria is critical to the long-term stable operation of DNBFs. Recent studies have paid attention to the effective biofilm formation and start-up of DNBFs such as inoculating the DNBFs with enriched sludge (Cai et al., 2015). However, the pretreatment of inoculum takes a relatively long period and the adaptability of enriched sludge remains challenging, which raises the need for more efficient methods. Rhamnolipid, as one kind of commercially viable biosurfactants secreted by bacteria, yeasts and fungi, has begun to enter people’s field of vision in biofilm-based processes recently since it can effectively bind macromolecules and carrier surfaces through its hydrophobic and hydrophilic groups and thus accelerate biofilm formation (Zhang et al., 2018). Zhang et al (2017) reported the acceleration of biofilm formation in microbial full cells (MFC) at an appropriate concentration (0–120 mg/L). A low concentration (20–50 mg/L) of rhamnolipid was also found to mitigate the hydration repulsion and lead to a greater deposition of soluble macromolecules in our previous study (Huang et al., 2018a). Recently, a higher treatment efficiency of wastewater with poor biodegradability by rhamnolipid addition in plastic materialbased moving bed biofilm reactors (MBBRs) was further testified in our study (Peng et al., 2018). Therefore, considering the low bacterial biomass on the silicon-based carriers (sands, ceramics) in DNBFs (Dalahmeh et al.,2014), exogenous rhamnolipid may have great potential in promoting biofilm formation and denitrification efficiency in
Corresponding author at: School of the Environment, Nanjing University, N.O. 163, Xianlin Avenue, Qixia District, Nanjing 210023, Jiangsu, PR China. E-mail address: [email protected] (H. Huang).
https://doi.org/10.1016/j.biortech.2019.121387 Received 3 April 2019; Received in revised form 24 April 2019; Accepted 27 April 2019 Available online 29 April 2019 0960-8524/ © 2019 Elsevier Ltd. All rights reserved.
Bioresource Technology 287 (2019) 121387
C. Peng, et al.
then preserved at about 4 °C after being filtered by 0.45 μm cellulose acetate filters (Millipore, USA) for water quality analysis. Concentrations of NH4+-N, NO3−-N and NO2−-N were characterized by standard methods (APHA, 2005). Total organic carbon (TOC) and TN were detected by TOC/TN analyzer (Multi + N/C 3100, Analytikjena, Germany), all above indicators were measured in duplicate for each sample. Dissolved oxygen (DO) and pH values were measured by oxygen (SG6, METTLER TOLEDO Inc., USA) and pH meters (FE20, METTLER TOLEDO Inc., USA), respectively. Biofilm samples were collected at 48th day during the stable operation stage. As shown in Fig. 1, ceramics were taken from 3 biomass sampling valves (top, middle and bottom) and then mixed as one sample. Biofilms were detached using ultrasonic treatment (100 KHz, 5 min) for the determination of biomass and EPS. Total solid (TS) and extracellular polymeric substances (EPS) including protein (PN) and polysaccharide (PS) was measured according to the standard method (APHA, 2005) and Zhu et al (2015), respectively. Three dimensional images of biofilms were determined by an atomic force microscopic (AFM, Multimode 8, Bruker Inc., Germany). All the detailed processes were described in SI. Fig. 1. Schematic diagram of the DNBFs in this study (RL stands for rhamnolipid).
2.3. Microbial community analysis
DNBFs, which has not been reported yet. This study investigated the effect of rhamnolipid addition on biofilm formation and denitrification of DNBFs with low C/N ratio for the first time. Gradient concentrations (0, 20, 40, 80, 120 mg/L) of rhamnolipid were added into five lab-scale DNBFs, respectively. The removal performance of organics and nitrogen, biofilm properties and microbial community structure in different layer heights during the 85 days’ operation, were systematically analyzed, to provide a novel strategy for fast start-up and enhanced denitrification performance of DNBFs.
Biofilm samples collected from different reactors and layer heights were detached using ultrasonic treatment (100 KHz, 5 min) and then centrifuged at 8000 rpm for 5 min. The DNA extraction for the prepared biofilm samples was done by using a Fast DNA SPIN Kit for soil (MP Biomedicals, OH, USA), after that the samples were sent to Sangon Biotech (Shanghai, China) for purification and sequencing through Illumina sequencing platform (Miseq, Illumina Inc., USA), using primers 341F (CCCTACACGACGCTCTTCCGATCTG)/805R (GACTGGAGT TCCTTGGCACCCGAGAATTCCA), with the details shown in SI. 2.4. Data analysis
2. Materials and methods
The inter-group significant differences were analyzed by using SPSS 22.0 software (SPSS Inc., USA) and p < 0.05 was deemed as the significance level under one-way analysis of variance (ANOVA) comparison. Canonical-correlation analysis (CCA) was performed by CANOCO software (ScientiaPro, Hungary). Pearson correlation analysis (two-tail test) on relevant indicators was also conducted by using SPSS 22.0 software (SPSS Inc., USA).
2.1. Experimental materials and DNBFs operation The ceramic used in this study was purchased from Anhui Huaqi Environmental Protection Technology Co., Ltd (China), with its diameter of 3–5 mm, specific surface area of 500–650 m2/g and apparent density of 1.5–1.6 g/cm3. The rhamnolipid was purchased from Daqing Vertex Co., Ltd (Heilongjiang, China), with its composition shown in Supporting Information. The DNBFs (Fig. 1) named as H0, H1, H2, H3 and H4, were related to 0, 20, 40 80 and 120 mg/L rhamnolipid addition in the influent, respectively. All DNBFs were operated with a total volume of 1.65 L (7 cm in diameter, 43 cm in height) in downward continuous flow mode by peristaltic pumps, with hydraulic retention time (HRT) of 8 h and the height of packing layer in the reactors of 30 cm, respectively. Firstly, the DNBFs were inoculated for 24 h with activated sludge (4000 mg/L of MLSS) collected from the anoxic tank of a municipal WWTP in Nanjing, China, then the synthetic wastewater was pumped into the reactors. The composition of synthetic wastewater was as follows: 192.3 mg/L CH3COONa (approximately 150 mg/L chemical oxygen demand (COD)), 360.7 mg/L KNO3 (50 mg/L NO3−-N), 25 mg/L HK2PO4, 24 mg/L CaCl2·2H2O and 1 ml/L trace element consisted of 24 g MgCl2·6H20, 0.44 g ZnSO4, 0.5 g CoCl2·6H2O, 0.5 g (NH4)6Mo7O24·4H2O, 0.28 g MnCl2·4H2O and 5 g EDTA-2Na (Ethylenediamine tetraacetic acid disodium salt). Inorganic carbon source was supplied by 500 mg/L of NaHCO3 and the initial pH values were maintained at 8.10 ± 0.15.
3. Results and discussion 3.1. DNBFs operation performance The TOC and TN removal performances of five DNBFs under 85 days of operation were depicted as Fig. 2(a) and (b), respectively, and the concentrations of effluent NO3−-N and NO2−-N were exhibited in Supporting information. It showed that the operation process can be generally divided into 3 periods. During the first 20 days (period 1), effluent TOC of all the biofilters gradually decreased due to biofilm growth, and a stable effluent TOC concentration was reached after period 1 in each reactor. In terms of TN, significant fluctuations occurred in the effluent of H0, H1 and H2, while a relatively stable decline of TN concentrations was observed in both H3 and H4. Rhamnolipid was reported to have low biodegradability (Katz et al., 2018), resulting in a slower evolutionary process for the microbes to utilize rhamnolipid as a carbon source for denitrification. Effluent TN concentrations decreased significantly with the increase of rhamnolipid concentration in periods 2 (21–50th day) (p < 0.05), with average values of 25.46, 22.00, 19.70, 14.44 and 3.95 mg/L in H0, H1, H2, H3 and H4, respectively (See Table 1). Among them, effluent TN concentrations of H0, H1 and H2 exceeded the China’s Grade Ⅰ-A standard due to the high concentration of influent TN (50 mg/L) and low initial C/N ratio
2.2. Chemical analysis and biofilm properties determination The influent and effluent were sampled once every two days and 2
Bioresource Technology 287 (2019) 121387
C. Peng, et al.
exogenous rhamnolipid increased to 40 and 80 mg/L, no significant differences in effluent NO3−-N (p > 0.05) while significant differences in NO2−-N (p < 0.05) were detected among reactors H1, H2 and H3, respectively. In reactor H4, effluent NO3−-N and NO2−-N maintained the lowest values (1.57 ± 1.69 and 2.20 ± 2.39 mg/L, respectively). On the contrary, different levels of nitrite accumulation occurred in H0 - H3 and the effluent TN concentrations were all relatively high due to the suppression of nitrite nitrogen reduction caused by the low TOC/TN ratio (1.14–1.63) (Xu et al., 2018). The nitrogen loading rate (NLR) of DNBFs gradually increased along with the rhamnolipid addition (0.051–0.096 kg N/(m3·d)). However, the NLR in this study was relatively low compared to a previous report of sodium acetate-driven denitrification (0.18–0.37 kg N/(m3·d), HRT: 2.0–2.5 h) (Xu et al., 2018) because of the long HRT and low C/N ratio. An undesirable removal of TOC and TN was observed in period 3 which was attributed by the aging biofilm after a long-time operation without backwashing process (Huang et al., 2018b; Huang et al., 2019).
3.2. Biofilm properties In the stable period of operation, EPS and TS of biofilms were determined. EPS, as a mixture of complex microbial secretion, is mainly composed of PN and PS and is critical to biofilm adhesion and formation (Wang et al., 2019). The PN and PS contents of the DNBFs were shown in Fig. 3(a). In H1 with 20 mg/L rhamnolipid, both PN and PS were significantly increased compared with H0 (p < 0.05). However, in H2 and H3, there were a slight increase in PN content while a relatively greater decline in PS, leading to a slight decrease in EPS content. In the meantime, PN and EPS content reached the maximum values in H4. The TS of biofilms on the surface of ceramics was shown as Fig. 3(b). It was obvious to find that biomass increased with the amount of exogenous rhamnolipid, indicating that rhamnolipid might partly contribute to microbial growth. PN, EPS and TS in H4 reached the maximum which were 2.34, 2.17 and 2.15 folds of those in H0, respectively. The surface morphology of biofilms was also observed through an AFM (Supporting information), more obvious fluctuations in peaks and valleys were observed in H1-H4 than those in H0. Furthermore, the force-distance between tips and the biofilms was also measured to analyze the adhesion force by AFM in a contact mode. As shown in Fig. 3(c), a maximum value (14.17 nN) was obtained in the biofilm of H4, which was 3.36 times of that of H0 (4.22 nN), while no significant differences were shown among H1, H2, H3 and H4 (p > 0.05), indicating that rhamnolipid addition may promote biofilm adhesion force and result in a much more stable biofilm matrix. The quantitative description of surface roughness based on AFM images were shown in Fig. 3(c), no particular trend was found along with the increased rhamnolipid. However, the surface roughness of H4 biofilm was significantly lower than that of H0 (p < 0.05). An increasing biofilm roughness usually means an increasing adhesion rate (Janjaroen et al., 2013), suggesting the characteristics of a more mature biofilm with a lower roughness. The increased EPS content and adhesion force indicated that enhanced biofilm formation occurred in rhamnolipidtreated DNBFs.
Fig. 2. Effluent TOC and TN concentrations of H0-H4: (a) TOC; (b) TN.
(∼3:1), while the effluent TN of H3 and H4 met the standard because of the higher organic concentration by increased rhamnolipid. The increase of TOC concentration in the influent by adding rhamnolipid may be the main reason for the higher nitrogen removal rate (Katz et al., 2018). However, effluent TOC concentration was increased along with rhamnolipid addition, which was due to insufficient biodegradation of rhamnolipid at this stage. Therefore, a higher concentration of rhamnolipid was inappropriate which may lead to organic pollution. In periods 2, the concentrations of NO3−-N and NO2−-N showed certain regularities with the changes of rhamnolipid concentration. Compared with the control (H0), there was a significant decrease in effluent NO3−-N (p < 0.05) while no significant difference in effluent NO2−-N (p > 0.05) in reactor H1. When the concentration of
Table 1 Concentrations of effluent contaminants from day 21 to 50. Reactors
TOC (mg·L−1)
TN (mg·L−1)
NO3−-N (mg·L−1)
NO2−-N (mg·L−1)
NLR (kg·N/m3·d)
H0 H1 H2 H3 H4
3.55 3.56 3.96 4.38 5.96
25.46 ± 2.17 22.00 ± 3.84(*) 19.7 ± 2.05(*) 14.44 ± 5.50(*) 3.95 ± 2.18(*)
6.34 3.62 3.78 3.80 1.57
17.83 ± 4.94 18.33 ± 2.40 15.43 ± 2.90(*) 11.53 ± 5.24(*) 2.20 ± 2.39(*)
0.0505 0.0579 0.0624 0.0787 0.0964
± ± ± ± ±
1.10 0.92 1.11(*) 1.20(*) 1.55(*)
Note: NLR means nitrogen loading rate; *, p < 0.05. 3
± ± ± ± ±
1.76 1.97(*) 1.91(*) 3.52(*) 1.69(*)
± ± ± ± ±
0.0062 0.0086(*) 0.0059(*) 0.0069(*) 0.0042(*)
Bioresource Technology 287 (2019) 121387
C. Peng, et al.
Fig. 3. Properties of H0-H4 biofilms sampled at 48th day: (a) EPS content including PN and PS; (b) TS content; (c) adhesion force and roughness based on AFM images (*, p < 0.05; **, p < 0.01).
respectively. Corresponding to this, a lower abundance of Proteobacteria was found in the middle and bottom layers. The phylum Bacteroidetes and Planctomycetes, known as anaerobic denitrification bacteria with nitrate or nitrite as substrates and utilize organics (Qin et al., 2017), had the second and third abundance levels. It was worth mentioning that the abundance of phylum Chlamydiae increased to 2.70% and 5.82% in the middle and bottom layers of H4, which was significantly higher than that of other biofilm samples (< 0.82%) (p < 0.05). As seen from Fig. 4, Thauera, Simplicispira, Tepidisphaera, Zoogloea and Comamonas were the main genera in all the biofilms. Thauera was the most dominant bacteria in H0 (11.83%, 9.73% and 12.36% in the top, middle and bottom layer, respectively), H1 (33.3%, 10.47% and 17.72%) and H2 (48.23%, 6.39% and 14.48%), while Simplicispira took the first place in H3 (25.09%, 14.81% and 6.61%) and H4 (24.82%, 26.62% and 14.54%). The abundance of Simplicispira also showed an upward trend in H0 - H2 as well. Thauera, belonging to Betaproteobacteria, was a kind of denitrifying bacteria under aerobic conditions and can also survive under anaerobic conditions (Yang et al., 2019). Since there was no oxygen removal process, a certain concentration of dissolved oxygen remained in the influent (approximately 2 mg/L). Therefore, organics can be utilized by Thauera bacteria in aerobic condition and a more adequate organic was supplied due to the addition of rhamnolipid, leading to the increase of Thauera. Simplicispira and
3.3. Microbial community structure A deeper insight into microbial community was obtained by Illumina Miseq sequencing, and the sequences were trimmed and classified into operational taxonomic units (OTUs) at the similarity of 0.97 for the evaluation of microbial community diversity and richness. As shown in Supporting information, a decrease of Shannon index and a rise of Simpson index of biofilm samples from the upper layers were found after adding rhamnolipid, indicating that rhamnolipid might reduce the biodiversity of the upper layer biofilms. Furthermore, the biodiversities of biofilms from the middle and bottom layers were higher than those of the upper layer. It meant that the habitat conditions were improved with the degradation of pollutants in the direction of water flow. Bacteria community was analyzed in phylum and genus levels based on the pyrosequencing of 16S rRNA gene (Fig. 4 & Supporting information) and differences were found among reactors and sampling heights. It could be seen that 20 phyla of bacteria (relative abundance > 0.01%) was obtained in all the biofilm samples. Proteobacteria, the most common bacteria phylum reported in wastewater treatment (Wang et al., 2017), was detected as the dominant phylum in all the five reactors, with the abundance of 69.28%, 87.09%, 87.41%, 80.46% and 77.12% in the top layer of H0, H1, H2, H3 and H4, 4
Bioresource Technology 287 (2019) 121387
C. Peng, et al.
Fig. 4. Microbial community structure of biofilms sampled at 50th day in genus level. T, M, B means biofilm samples collected from the top, middle and bottom layers, respectively.
rhamnolipid addition, while the TOC removal rate and biofilm roughness exhibited the opposite results, indicating that the addition of rhamnolipid brought into the organics and reduced the biofilm roughness. It seemed that PN have a stronger relationship with adhesion force. However, there was dispute in the previous literatures that whether PN or PS could make more contribution to biofilm adhesion force (Zhu et al., 2015). It was also shown that Simplicispira, Gemmatimonas and Comamonas had strong relationships with rhamnolipid addition, while Thauera, Aquimonas and Tepidisphaera ran the opposite direction. Besides, an increased abundance of Thauera also showed in the low rhamnolipid concentration environment. Pearson correlation analysis was applied to investigate the correlations among the main related bacteria, TN removal rate and biofilm properties. As shown in Fig. 5(b), Simplicispira and Gemmatimonas showed significant positive correlation with TN removal rate, PN and TS. Simplicispira was a kind of typical denitrificans while Gemmatimonas was a kind of bacteria involved in nitrogen fixation and organics decomposition which can usually be found in the soil (Lupwayi et al., 2017). In conclusion, the abundances of denitrification bacteria Simplicispira and Gemmatimonas were enriched after rhamnolipid addition, which may be responsible for the promotion of TN removal efficiency, PN secretion and biomass production in the DNBFs, thus leading to an enhanced biofilm formation and denitrification. However, considering the increased cost caused by the addition of rhamnolipid all the time along with the operation, it is of great necessity to testify the feasibility of adding rhamnolipid only in the start-up period of DNBFs and observe the subsequent operation performance of denitrification in the next step. This part of work is already under way and will be presented in the follow-up report.
Comamonas were typical facultatively anaerobic denitrifiers especially in biofilm process (Wang and Chu, 2016). The enrichment of Thauera in H0 - H2 and Simplicispira in all the five DNBFs was corresponding to the higher nitrogen removal efficiency. However, as a strain of facultative aerobe belonging to phylum Planctomycetes, the Tepidisphaera was rarely reported in previous literatures in the field of wastewater treatment. It was reported to be able to degrade mono-, di- and polysaccharides and produce exopolysaccharide in a liquid environment which may play a major role in the degradation of rhamnolipid (Kovaleva et al., 2015). An interesting discovery was that Zoogloea was mainly distributed in the top layer (4.29%, 7.57%, 9.79% 9.21% and 0.25% for H0 - H4, respectively) and Sphaerotilus was only distributed in the top layer with an abundance of 0.26–4.36%. Sphaerotilus was a kind of filamentous bacteria which could produce large assemblage and more EPS than others, thus can exhibit a better ability of colonization, so did Zoogloea (Ma et al., 2013; Peng et al., 2018; Zhu et al., 2015). Moreover, microbial community structure of H4 showed significant difference with other biofilters through cluster analysis. The microbial community structure of top layers in H0 - H3 shared similarities with each other, while H1 and H2 with less rhamnolipid shared a much more similarity. It demonstrated that a relatively high concentration of rhamnolipid have a stronger impact on the microbial composition in the DNBFs. 3.4. Relationship of DNBFs operation, biofilm characteristics and rhamnolipid addition The relationship among biofilm properties, microbial community (top 11 genera) and operation conditions during the stable operation was evaluated using canonical-correlation analysis (CCA). As shown in Fig. 5(a), the TS, TN removal rate and PN were positively related to the 5
Bioresource Technology 287 (2019) 121387
C. Peng, et al.
Fig. 5. CCA map (a) and Pearson correlation analysis (b) of bacteria and operational conditions. RR means removal rate; T, M, B means bacteria from the top, middle and bottom layers, respectively.
4. Conclusion
enhanced biofilm formation and TN removal. The above results confirmed the feasibility of rhamnolipid addition in DNBFs to enhance the biofilm formation and enrich denitrificans for advanced nitrogen removal.
Higher TN removal rate was found in rhamnolipid-treated DNBFs. TS, EPS and biofilm adhesion force were significantly and maximally improved by 120 mg/L rhamnolipid which were 2.17, 2.15 and 3.36 times of those in the control. Proteobacteria and Bacteroidetes phyla were dominant in DNBFs and the abundance of Proteobacteria increased especially in top layers after rhamnolipid addition. Besides, Simplicispira and Gemmatimonas genera were enriched which were responsible for
Acknowledgements This work was supported by the National Natural Science Foundation of China (51878336, 51608254), National Major Science 6
Bioresource Technology 287 (2019) 121387
C. Peng, et al.
and Technology Project of China (2017ZX07204001) and Jiangsu Science and Technology Project, China (BE2018632, BE2017632).
2017. Pyrosequencing reveals profiles of soil bacterial communities after 12 years of conservation management on irrigated crop rotations. Appl. Soil Ecol. 121, 65–73. Ma, Z., Wen, X., Zhao, F., Xia, Y., Huang, X., Waite, D., Guan, J., 2013. Effect of temperature variation on membrane fouling and microbial community structure in membrane bioreactor. Bioresour. Technol. 133, 462–468. Peng, P., Huang, H., Ren, H., 2018. Effect of adding low-concentration of rhamnolipid on reactor performances and microbial community evolution in MBBRs for low C/N ratio and antibiotic wastewater treatment. Bioresour. Technol. 256, 557–561. Qin, Y., Cao, Y., Ren, J., Wang, T., Han, B., 2017. Effect of glucose on nitrogen removal and microbial community in anammox-denitrification system. Bioresour. Technol.. 244 (Pt 1), 33–39. Sun, Y., Shen, D., Zhou, X., Shi, N., Tian, Y., 2016. Microbial diversity and community structure of denitrifying biological filters operated with different carbon sources. Springerplus 5, 1752. Truu, M., Oopkaup, K., Krustok, I., Koiv-Vainik, M., Nolvak, H., Truu, J., 2018. Bacterial community activity and dynamics in the biofilm of an experimental hybrid wetland system treating greywater. Environ. Sci. Pollut. Res. Int. 26 (4), 4013–4026. Wang, J., Chu, L., 2016. Biological nitrate removal from water and wastewater by solidphase denitrification process. Biotechnol. Adv. 34 (6), 1103–1112. Wang, J., Gong, B., Huang, W., Wang, Y., Zhou, J., 2017. Bacterial community structure in simultaneous nitrification, denitrification and organic matter removal process treating saline mustard tuber wastewater as revealed by 16S rRNA sequencing. Bioresour. Technol. 228, 31–38. Wang, S., Qian, K., Zhu, Y., Yi, X., Zhang, G., Du, G., Tay, J.H., Li, J., 2019. Reactivation and pilot-scale application of long-term storage denitrification biofilm based on flow cytometry. Water Res. 148, 368–377. Xu, Z., Dai, X., Chai, X., 2018. Effect of different carbon sources on denitrification performance, microbial community structure and denitrification genes. Sci. Total Environ. 634, 195–204. Yang, N., Zhan, G., Li, D., Wang, X., He, X., Liu, H., 2019. Complete nitrogen removal and electricity production in Thauera-dominated air-cathode single chambered microbial fuel cell. Chem. Eng. J. 356, 506–515. Zhang, Q.H., Yang, W.N., Ngo, H.H., Guo, W.S., Jin, P.K., Dzakpasu, M., Yang, S.J., Wang, Q., Wang, X.C., Ao, D., 2016. Current status of urban wastewater treatment plants in China. Environ. Int. 92–93, 11–22. Zhang, X., Yuan, H., Jiang, Z., Lin, D., Zhang, X., 2018. Impact of surface tension of wastewater on biofilm formation of microalgae Chlorella sp. Bioresour. Technol. 266, 498–506. Zhang, Y., Jiang, J., Zhao, Q., Gao, Y., Wang, K., Ding, J., Yu, H., Yao, Y., 2017. Accelerating anodic biofilms formation and electron transfer in microbial fuel cells: role of anionic biosurfactants and mechanism. Bioelectrochemistry 117, 48–56. Zhu, Y., Zhang, Y., Ren, H.Q., Geng, J.J., Xu, K., Huang, H., Ding, L.L., 2015. Physicochemical characteristics and microbial community evolution of biofilms during the start-up period in a moving bed biofilm reactor. Bioresour. Technol. 180, 345–351.
Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.biortech.2019.121387. References APHA, 2005. Standard Methods for the Examination of Water and Wastewater, 21st ed. American Public Health Association, Washington DC, USA. Cai, Y., Li, D., Liang, Y., Luo, Y., Zeng, H., Zhang, J., 2015. Effective start-up biofiltration method for Fe, Mn, and ammonia removal and bacterial community analysis. Bioresour. Technol. 176, 149–155. Dalahmeh, S.S., Jonsson, H., Hylander, L.D., Hui, N., Yu, D., Pell, M., 2014. Dynamics and functions of bacterial communities in bark, charcoal and sand filters treating greywater. Water Res. 54, 21–32. Huang, H., Lin, Y., Peng, P., Geng, J., Xu, K., Zhang, Y., Ding, L., Ren, H., 2018a. Calcium ion- and rhamnolipid-mediated deposition of soluble matters on biocarriers. Water Res. 133, 37–46. Huang, H., Peng, C., Peng, P., Lin, Y., Zhang, X., Ren, H., 2019. Towards the biofilm characterization and regulation in biological wastewater treatment. Appl. Microbiol. Biotechnol. 103 (3), 1115–1129. Huang, H., Yu, Q., Ren, H., Geng, J., Xu, K., Zhang, Y., Ding, L., 2018b. Towards physicochemical and biological effects on detachment and activity recovery of aging biofilm by enzyme and surfactant treatments. Bioresour. Technol. 247, 319–326. Janjaroen, D., Ling, F., Monroy, G., Derlon, N., Mogenroth, E., Boppart, S.A., Liu, W.T., Nguyen, T.H., 2013. Roles of ionic strength and biofilm roughness on adhesion kinetics of Escherichia coli onto groundwater biofilm grown on PVC surfaces. Water Res. 47 (7), 2531–2542. Katz, H., Farber, R., Chaniel, G., Ankar, Y., Cohen, H., Cahan, R., 2018. Rhamnolipidenhanced Pseudomonas putida biofilm formation on hydrophilic surfaces with toluene as the bacterium's sole carbon source. Int. Biodeterior. Biodegrad. 127, 87–94. Kovaleva, O.L., Merkel, A.Y., Novikov, A.A., Baslerov, R.V., Toshchakov, S.V., BonchOsmolovskaya, E.A., 2015. Tepidisphaera mucosa gen. nov., sp nov., a moderately thermophilic member of the class Phycisphaerae in the phylum Planctomycetes, and proposal of a new family, Tepidisphaeraceae fam. nov., and a new order, Tepidisphaerales ord. nov. Int. J. Syst. Evol. Microbiol. 65, 549–555. Loupasaki, E., Diamadopoulos, E., 2013. Attached growth systems for wastewater treatment in small and rural communities: a review. J. Chem. Technol. Biotechnol. 88 (2), 190–204. Lupwayi, N.Z., Larney, F.J., Blackshaw, R.E., Kanashiro, D.A., Pearson, D.C., Petri, R.M.,
7
Contents lists available at ScienceDirect
Bioresource Technology journal homepage: www.elsevier.com/locate/biortech
Short Communication
Enhanced biofilm formation and denitrification in biofilters for advanced nitrogen removal by rhamnolipid addition
T
⁎
Chong Peng, Yilin Gao, Xuan Fan, Pengcheng Peng, Hui Huang , Xuxiang Zhang, Hongqiang Ren State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023, Jiangsu, PR China
A R T I C LE I N FO
A B S T R A C T
Keywords: Denitrification biofilters (DNBFs) Advanced nitrogen removal Start-up Rhamnolipid Biofilm
Denitrification biofilters (DNBFs) are widely used in advanced nitrogen removal of wastewater with low C/N and effective biofilm formation is critical to their long-term operation. Hereby the influence of rhamnolipid addition in DNBFs was investigated for the first time. Gradient concentrations (0, 20, 40, 80, 120 mg/L) of rhamnolipid were applied to investigate nitrogen removal, biofilm properties and microbial community of lab-scale DNBFs. A significant increase of nitrogen removal was observed in rhamnolipid-treated DNBFs (p < 0.05). Total solid (TS), extracellular polymeric substances (EPS) and adhesion force of biofilms in DNBF with 120 mg/L rhamnolipid reached the maximum, which were 2.17, 2.15 and 3.36 times of those in the control, respectively. Moreover, rhamnolipid exhibited an improvement in abundance of Simplicispira and Gemmatimonas which were responsible for enhanced biofilm formation and denitrification. The results suggested that rhamnolipid addition can be a novel strategy to improve the start-up and denitrification performance of DNBFs.
1. Introduction Excessive nitrogen in the effluent of wastewater treatment plants (WWTPs) discharged to aquatic environments contributes to severe eutrophication which has been a thorny issue over these years. Therefore, advanced nitrogen removal which means reducing the total nitrogen (TN) concentration in the discharged effluent to meet specific standards and mitigate the impact of wastewater on eco-systems has attracted much attention in the field of wastewater treatment worldwide. For example, Grade Ⅰ-A discharge standard (≤15 mg/L TN in the effluent) for WWTPs in China has been extensively implemented, leading to a technological innovation boom for advanced nitrogen removal of secondary biochemical effluent (Zhang et al., 2016). Among advanced nitrogen removal processes, denitrification biofilters (DNBFs) has been widely applied in treatment of municipal wastewater and secondary effluent in WWTPs (Loupasaki and Diamadopoulos, 2013) for its simple operation, small footprint, low operation cost together with its capacities of advanced nitrogen removal. However, insufficient carbon source in advanced wastewater treatment usually has an obstacle for the denitrification process and leads to a low cell growth and biomass yield on carriers (Sun et al., 2016), resulting in the delay of the biofilm formation and start-up of DNBFs. Besides, the bacterial community in biofilm systems was closely related to nutrient removal efficiency (Truu et al., 2018), thus a mature biofilm consisted of
⁎
functional denitrifying bacteria is critical to the long-term stable operation of DNBFs. Recent studies have paid attention to the effective biofilm formation and start-up of DNBFs such as inoculating the DNBFs with enriched sludge (Cai et al., 2015). However, the pretreatment of inoculum takes a relatively long period and the adaptability of enriched sludge remains challenging, which raises the need for more efficient methods. Rhamnolipid, as one kind of commercially viable biosurfactants secreted by bacteria, yeasts and fungi, has begun to enter people’s field of vision in biofilm-based processes recently since it can effectively bind macromolecules and carrier surfaces through its hydrophobic and hydrophilic groups and thus accelerate biofilm formation (Zhang et al., 2018). Zhang et al (2017) reported the acceleration of biofilm formation in microbial full cells (MFC) at an appropriate concentration (0–120 mg/L). A low concentration (20–50 mg/L) of rhamnolipid was also found to mitigate the hydration repulsion and lead to a greater deposition of soluble macromolecules in our previous study (Huang et al., 2018a). Recently, a higher treatment efficiency of wastewater with poor biodegradability by rhamnolipid addition in plastic materialbased moving bed biofilm reactors (MBBRs) was further testified in our study (Peng et al., 2018). Therefore, considering the low bacterial biomass on the silicon-based carriers (sands, ceramics) in DNBFs (Dalahmeh et al.,2014), exogenous rhamnolipid may have great potential in promoting biofilm formation and denitrification efficiency in
Corresponding author at: School of the Environment, Nanjing University, N.O. 163, Xianlin Avenue, Qixia District, Nanjing 210023, Jiangsu, PR China. E-mail address: [email protected] (H. Huang).
https://doi.org/10.1016/j.biortech.2019.121387 Received 3 April 2019; Received in revised form 24 April 2019; Accepted 27 April 2019 Available online 29 April 2019 0960-8524/ © 2019 Elsevier Ltd. All rights reserved.
Bioresource Technology 287 (2019) 121387
C. Peng, et al.
then preserved at about 4 °C after being filtered by 0.45 μm cellulose acetate filters (Millipore, USA) for water quality analysis. Concentrations of NH4+-N, NO3−-N and NO2−-N were characterized by standard methods (APHA, 2005). Total organic carbon (TOC) and TN were detected by TOC/TN analyzer (Multi + N/C 3100, Analytikjena, Germany), all above indicators were measured in duplicate for each sample. Dissolved oxygen (DO) and pH values were measured by oxygen (SG6, METTLER TOLEDO Inc., USA) and pH meters (FE20, METTLER TOLEDO Inc., USA), respectively. Biofilm samples were collected at 48th day during the stable operation stage. As shown in Fig. 1, ceramics were taken from 3 biomass sampling valves (top, middle and bottom) and then mixed as one sample. Biofilms were detached using ultrasonic treatment (100 KHz, 5 min) for the determination of biomass and EPS. Total solid (TS) and extracellular polymeric substances (EPS) including protein (PN) and polysaccharide (PS) was measured according to the standard method (APHA, 2005) and Zhu et al (2015), respectively. Three dimensional images of biofilms were determined by an atomic force microscopic (AFM, Multimode 8, Bruker Inc., Germany). All the detailed processes were described in SI. Fig. 1. Schematic diagram of the DNBFs in this study (RL stands for rhamnolipid).
2.3. Microbial community analysis
DNBFs, which has not been reported yet. This study investigated the effect of rhamnolipid addition on biofilm formation and denitrification of DNBFs with low C/N ratio for the first time. Gradient concentrations (0, 20, 40, 80, 120 mg/L) of rhamnolipid were added into five lab-scale DNBFs, respectively. The removal performance of organics and nitrogen, biofilm properties and microbial community structure in different layer heights during the 85 days’ operation, were systematically analyzed, to provide a novel strategy for fast start-up and enhanced denitrification performance of DNBFs.
Biofilm samples collected from different reactors and layer heights were detached using ultrasonic treatment (100 KHz, 5 min) and then centrifuged at 8000 rpm for 5 min. The DNA extraction for the prepared biofilm samples was done by using a Fast DNA SPIN Kit for soil (MP Biomedicals, OH, USA), after that the samples were sent to Sangon Biotech (Shanghai, China) for purification and sequencing through Illumina sequencing platform (Miseq, Illumina Inc., USA), using primers 341F (CCCTACACGACGCTCTTCCGATCTG)/805R (GACTGGAGT TCCTTGGCACCCGAGAATTCCA), with the details shown in SI. 2.4. Data analysis
2. Materials and methods
The inter-group significant differences were analyzed by using SPSS 22.0 software (SPSS Inc., USA) and p < 0.05 was deemed as the significance level under one-way analysis of variance (ANOVA) comparison. Canonical-correlation analysis (CCA) was performed by CANOCO software (ScientiaPro, Hungary). Pearson correlation analysis (two-tail test) on relevant indicators was also conducted by using SPSS 22.0 software (SPSS Inc., USA).
2.1. Experimental materials and DNBFs operation The ceramic used in this study was purchased from Anhui Huaqi Environmental Protection Technology Co., Ltd (China), with its diameter of 3–5 mm, specific surface area of 500–650 m2/g and apparent density of 1.5–1.6 g/cm3. The rhamnolipid was purchased from Daqing Vertex Co., Ltd (Heilongjiang, China), with its composition shown in Supporting Information. The DNBFs (Fig. 1) named as H0, H1, H2, H3 and H4, were related to 0, 20, 40 80 and 120 mg/L rhamnolipid addition in the influent, respectively. All DNBFs were operated with a total volume of 1.65 L (7 cm in diameter, 43 cm in height) in downward continuous flow mode by peristaltic pumps, with hydraulic retention time (HRT) of 8 h and the height of packing layer in the reactors of 30 cm, respectively. Firstly, the DNBFs were inoculated for 24 h with activated sludge (4000 mg/L of MLSS) collected from the anoxic tank of a municipal WWTP in Nanjing, China, then the synthetic wastewater was pumped into the reactors. The composition of synthetic wastewater was as follows: 192.3 mg/L CH3COONa (approximately 150 mg/L chemical oxygen demand (COD)), 360.7 mg/L KNO3 (50 mg/L NO3−-N), 25 mg/L HK2PO4, 24 mg/L CaCl2·2H2O and 1 ml/L trace element consisted of 24 g MgCl2·6H20, 0.44 g ZnSO4, 0.5 g CoCl2·6H2O, 0.5 g (NH4)6Mo7O24·4H2O, 0.28 g MnCl2·4H2O and 5 g EDTA-2Na (Ethylenediamine tetraacetic acid disodium salt). Inorganic carbon source was supplied by 500 mg/L of NaHCO3 and the initial pH values were maintained at 8.10 ± 0.15.
3. Results and discussion 3.1. DNBFs operation performance The TOC and TN removal performances of five DNBFs under 85 days of operation were depicted as Fig. 2(a) and (b), respectively, and the concentrations of effluent NO3−-N and NO2−-N were exhibited in Supporting information. It showed that the operation process can be generally divided into 3 periods. During the first 20 days (period 1), effluent TOC of all the biofilters gradually decreased due to biofilm growth, and a stable effluent TOC concentration was reached after period 1 in each reactor. In terms of TN, significant fluctuations occurred in the effluent of H0, H1 and H2, while a relatively stable decline of TN concentrations was observed in both H3 and H4. Rhamnolipid was reported to have low biodegradability (Katz et al., 2018), resulting in a slower evolutionary process for the microbes to utilize rhamnolipid as a carbon source for denitrification. Effluent TN concentrations decreased significantly with the increase of rhamnolipid concentration in periods 2 (21–50th day) (p < 0.05), with average values of 25.46, 22.00, 19.70, 14.44 and 3.95 mg/L in H0, H1, H2, H3 and H4, respectively (See Table 1). Among them, effluent TN concentrations of H0, H1 and H2 exceeded the China’s Grade Ⅰ-A standard due to the high concentration of influent TN (50 mg/L) and low initial C/N ratio
2.2. Chemical analysis and biofilm properties determination The influent and effluent were sampled once every two days and 2
Bioresource Technology 287 (2019) 121387
C. Peng, et al.
exogenous rhamnolipid increased to 40 and 80 mg/L, no significant differences in effluent NO3−-N (p > 0.05) while significant differences in NO2−-N (p < 0.05) were detected among reactors H1, H2 and H3, respectively. In reactor H4, effluent NO3−-N and NO2−-N maintained the lowest values (1.57 ± 1.69 and 2.20 ± 2.39 mg/L, respectively). On the contrary, different levels of nitrite accumulation occurred in H0 - H3 and the effluent TN concentrations were all relatively high due to the suppression of nitrite nitrogen reduction caused by the low TOC/TN ratio (1.14–1.63) (Xu et al., 2018). The nitrogen loading rate (NLR) of DNBFs gradually increased along with the rhamnolipid addition (0.051–0.096 kg N/(m3·d)). However, the NLR in this study was relatively low compared to a previous report of sodium acetate-driven denitrification (0.18–0.37 kg N/(m3·d), HRT: 2.0–2.5 h) (Xu et al., 2018) because of the long HRT and low C/N ratio. An undesirable removal of TOC and TN was observed in period 3 which was attributed by the aging biofilm after a long-time operation without backwashing process (Huang et al., 2018b; Huang et al., 2019).
3.2. Biofilm properties In the stable period of operation, EPS and TS of biofilms were determined. EPS, as a mixture of complex microbial secretion, is mainly composed of PN and PS and is critical to biofilm adhesion and formation (Wang et al., 2019). The PN and PS contents of the DNBFs were shown in Fig. 3(a). In H1 with 20 mg/L rhamnolipid, both PN and PS were significantly increased compared with H0 (p < 0.05). However, in H2 and H3, there were a slight increase in PN content while a relatively greater decline in PS, leading to a slight decrease in EPS content. In the meantime, PN and EPS content reached the maximum values in H4. The TS of biofilms on the surface of ceramics was shown as Fig. 3(b). It was obvious to find that biomass increased with the amount of exogenous rhamnolipid, indicating that rhamnolipid might partly contribute to microbial growth. PN, EPS and TS in H4 reached the maximum which were 2.34, 2.17 and 2.15 folds of those in H0, respectively. The surface morphology of biofilms was also observed through an AFM (Supporting information), more obvious fluctuations in peaks and valleys were observed in H1-H4 than those in H0. Furthermore, the force-distance between tips and the biofilms was also measured to analyze the adhesion force by AFM in a contact mode. As shown in Fig. 3(c), a maximum value (14.17 nN) was obtained in the biofilm of H4, which was 3.36 times of that of H0 (4.22 nN), while no significant differences were shown among H1, H2, H3 and H4 (p > 0.05), indicating that rhamnolipid addition may promote biofilm adhesion force and result in a much more stable biofilm matrix. The quantitative description of surface roughness based on AFM images were shown in Fig. 3(c), no particular trend was found along with the increased rhamnolipid. However, the surface roughness of H4 biofilm was significantly lower than that of H0 (p < 0.05). An increasing biofilm roughness usually means an increasing adhesion rate (Janjaroen et al., 2013), suggesting the characteristics of a more mature biofilm with a lower roughness. The increased EPS content and adhesion force indicated that enhanced biofilm formation occurred in rhamnolipidtreated DNBFs.
Fig. 2. Effluent TOC and TN concentrations of H0-H4: (a) TOC; (b) TN.
(∼3:1), while the effluent TN of H3 and H4 met the standard because of the higher organic concentration by increased rhamnolipid. The increase of TOC concentration in the influent by adding rhamnolipid may be the main reason for the higher nitrogen removal rate (Katz et al., 2018). However, effluent TOC concentration was increased along with rhamnolipid addition, which was due to insufficient biodegradation of rhamnolipid at this stage. Therefore, a higher concentration of rhamnolipid was inappropriate which may lead to organic pollution. In periods 2, the concentrations of NO3−-N and NO2−-N showed certain regularities with the changes of rhamnolipid concentration. Compared with the control (H0), there was a significant decrease in effluent NO3−-N (p < 0.05) while no significant difference in effluent NO2−-N (p > 0.05) in reactor H1. When the concentration of
Table 1 Concentrations of effluent contaminants from day 21 to 50. Reactors
TOC (mg·L−1)
TN (mg·L−1)
NO3−-N (mg·L−1)
NO2−-N (mg·L−1)
NLR (kg·N/m3·d)
H0 H1 H2 H3 H4
3.55 3.56 3.96 4.38 5.96
25.46 ± 2.17 22.00 ± 3.84(*) 19.7 ± 2.05(*) 14.44 ± 5.50(*) 3.95 ± 2.18(*)
6.34 3.62 3.78 3.80 1.57
17.83 ± 4.94 18.33 ± 2.40 15.43 ± 2.90(*) 11.53 ± 5.24(*) 2.20 ± 2.39(*)
0.0505 0.0579 0.0624 0.0787 0.0964
± ± ± ± ±
1.10 0.92 1.11(*) 1.20(*) 1.55(*)
Note: NLR means nitrogen loading rate; *, p < 0.05. 3
± ± ± ± ±
1.76 1.97(*) 1.91(*) 3.52(*) 1.69(*)
± ± ± ± ±
0.0062 0.0086(*) 0.0059(*) 0.0069(*) 0.0042(*)
Bioresource Technology 287 (2019) 121387
C. Peng, et al.
Fig. 3. Properties of H0-H4 biofilms sampled at 48th day: (a) EPS content including PN and PS; (b) TS content; (c) adhesion force and roughness based on AFM images (*, p < 0.05; **, p < 0.01).
respectively. Corresponding to this, a lower abundance of Proteobacteria was found in the middle and bottom layers. The phylum Bacteroidetes and Planctomycetes, known as anaerobic denitrification bacteria with nitrate or nitrite as substrates and utilize organics (Qin et al., 2017), had the second and third abundance levels. It was worth mentioning that the abundance of phylum Chlamydiae increased to 2.70% and 5.82% in the middle and bottom layers of H4, which was significantly higher than that of other biofilm samples (< 0.82%) (p < 0.05). As seen from Fig. 4, Thauera, Simplicispira, Tepidisphaera, Zoogloea and Comamonas were the main genera in all the biofilms. Thauera was the most dominant bacteria in H0 (11.83%, 9.73% and 12.36% in the top, middle and bottom layer, respectively), H1 (33.3%, 10.47% and 17.72%) and H2 (48.23%, 6.39% and 14.48%), while Simplicispira took the first place in H3 (25.09%, 14.81% and 6.61%) and H4 (24.82%, 26.62% and 14.54%). The abundance of Simplicispira also showed an upward trend in H0 - H2 as well. Thauera, belonging to Betaproteobacteria, was a kind of denitrifying bacteria under aerobic conditions and can also survive under anaerobic conditions (Yang et al., 2019). Since there was no oxygen removal process, a certain concentration of dissolved oxygen remained in the influent (approximately 2 mg/L). Therefore, organics can be utilized by Thauera bacteria in aerobic condition and a more adequate organic was supplied due to the addition of rhamnolipid, leading to the increase of Thauera. Simplicispira and
3.3. Microbial community structure A deeper insight into microbial community was obtained by Illumina Miseq sequencing, and the sequences were trimmed and classified into operational taxonomic units (OTUs) at the similarity of 0.97 for the evaluation of microbial community diversity and richness. As shown in Supporting information, a decrease of Shannon index and a rise of Simpson index of biofilm samples from the upper layers were found after adding rhamnolipid, indicating that rhamnolipid might reduce the biodiversity of the upper layer biofilms. Furthermore, the biodiversities of biofilms from the middle and bottom layers were higher than those of the upper layer. It meant that the habitat conditions were improved with the degradation of pollutants in the direction of water flow. Bacteria community was analyzed in phylum and genus levels based on the pyrosequencing of 16S rRNA gene (Fig. 4 & Supporting information) and differences were found among reactors and sampling heights. It could be seen that 20 phyla of bacteria (relative abundance > 0.01%) was obtained in all the biofilm samples. Proteobacteria, the most common bacteria phylum reported in wastewater treatment (Wang et al., 2017), was detected as the dominant phylum in all the five reactors, with the abundance of 69.28%, 87.09%, 87.41%, 80.46% and 77.12% in the top layer of H0, H1, H2, H3 and H4, 4
Bioresource Technology 287 (2019) 121387
C. Peng, et al.
Fig. 4. Microbial community structure of biofilms sampled at 50th day in genus level. T, M, B means biofilm samples collected from the top, middle and bottom layers, respectively.
rhamnolipid addition, while the TOC removal rate and biofilm roughness exhibited the opposite results, indicating that the addition of rhamnolipid brought into the organics and reduced the biofilm roughness. It seemed that PN have a stronger relationship with adhesion force. However, there was dispute in the previous literatures that whether PN or PS could make more contribution to biofilm adhesion force (Zhu et al., 2015). It was also shown that Simplicispira, Gemmatimonas and Comamonas had strong relationships with rhamnolipid addition, while Thauera, Aquimonas and Tepidisphaera ran the opposite direction. Besides, an increased abundance of Thauera also showed in the low rhamnolipid concentration environment. Pearson correlation analysis was applied to investigate the correlations among the main related bacteria, TN removal rate and biofilm properties. As shown in Fig. 5(b), Simplicispira and Gemmatimonas showed significant positive correlation with TN removal rate, PN and TS. Simplicispira was a kind of typical denitrificans while Gemmatimonas was a kind of bacteria involved in nitrogen fixation and organics decomposition which can usually be found in the soil (Lupwayi et al., 2017). In conclusion, the abundances of denitrification bacteria Simplicispira and Gemmatimonas were enriched after rhamnolipid addition, which may be responsible for the promotion of TN removal efficiency, PN secretion and biomass production in the DNBFs, thus leading to an enhanced biofilm formation and denitrification. However, considering the increased cost caused by the addition of rhamnolipid all the time along with the operation, it is of great necessity to testify the feasibility of adding rhamnolipid only in the start-up period of DNBFs and observe the subsequent operation performance of denitrification in the next step. This part of work is already under way and will be presented in the follow-up report.
Comamonas were typical facultatively anaerobic denitrifiers especially in biofilm process (Wang and Chu, 2016). The enrichment of Thauera in H0 - H2 and Simplicispira in all the five DNBFs was corresponding to the higher nitrogen removal efficiency. However, as a strain of facultative aerobe belonging to phylum Planctomycetes, the Tepidisphaera was rarely reported in previous literatures in the field of wastewater treatment. It was reported to be able to degrade mono-, di- and polysaccharides and produce exopolysaccharide in a liquid environment which may play a major role in the degradation of rhamnolipid (Kovaleva et al., 2015). An interesting discovery was that Zoogloea was mainly distributed in the top layer (4.29%, 7.57%, 9.79% 9.21% and 0.25% for H0 - H4, respectively) and Sphaerotilus was only distributed in the top layer with an abundance of 0.26–4.36%. Sphaerotilus was a kind of filamentous bacteria which could produce large assemblage and more EPS than others, thus can exhibit a better ability of colonization, so did Zoogloea (Ma et al., 2013; Peng et al., 2018; Zhu et al., 2015). Moreover, microbial community structure of H4 showed significant difference with other biofilters through cluster analysis. The microbial community structure of top layers in H0 - H3 shared similarities with each other, while H1 and H2 with less rhamnolipid shared a much more similarity. It demonstrated that a relatively high concentration of rhamnolipid have a stronger impact on the microbial composition in the DNBFs. 3.4. Relationship of DNBFs operation, biofilm characteristics and rhamnolipid addition The relationship among biofilm properties, microbial community (top 11 genera) and operation conditions during the stable operation was evaluated using canonical-correlation analysis (CCA). As shown in Fig. 5(a), the TS, TN removal rate and PN were positively related to the 5
Bioresource Technology 287 (2019) 121387
C. Peng, et al.
Fig. 5. CCA map (a) and Pearson correlation analysis (b) of bacteria and operational conditions. RR means removal rate; T, M, B means bacteria from the top, middle and bottom layers, respectively.
4. Conclusion
enhanced biofilm formation and TN removal. The above results confirmed the feasibility of rhamnolipid addition in DNBFs to enhance the biofilm formation and enrich denitrificans for advanced nitrogen removal.
Higher TN removal rate was found in rhamnolipid-treated DNBFs. TS, EPS and biofilm adhesion force were significantly and maximally improved by 120 mg/L rhamnolipid which were 2.17, 2.15 and 3.36 times of those in the control. Proteobacteria and Bacteroidetes phyla were dominant in DNBFs and the abundance of Proteobacteria increased especially in top layers after rhamnolipid addition. Besides, Simplicispira and Gemmatimonas genera were enriched which were responsible for
Acknowledgements This work was supported by the National Natural Science Foundation of China (51878336, 51608254), National Major Science 6
Bioresource Technology 287 (2019) 121387
C. Peng, et al.
and Technology Project of China (2017ZX07204001) and Jiangsu Science and Technology Project, China (BE2018632, BE2017632).
2017. Pyrosequencing reveals profiles of soil bacterial communities after 12 years of conservation management on irrigated crop rotations. Appl. Soil Ecol. 121, 65–73. Ma, Z., Wen, X., Zhao, F., Xia, Y., Huang, X., Waite, D., Guan, J., 2013. Effect of temperature variation on membrane fouling and microbial community structure in membrane bioreactor. Bioresour. Technol. 133, 462–468. Peng, P., Huang, H., Ren, H., 2018. Effect of adding low-concentration of rhamnolipid on reactor performances and microbial community evolution in MBBRs for low C/N ratio and antibiotic wastewater treatment. Bioresour. Technol. 256, 557–561. Qin, Y., Cao, Y., Ren, J., Wang, T., Han, B., 2017. Effect of glucose on nitrogen removal and microbial community in anammox-denitrification system. Bioresour. Technol.. 244 (Pt 1), 33–39. Sun, Y., Shen, D., Zhou, X., Shi, N., Tian, Y., 2016. Microbial diversity and community structure of denitrifying biological filters operated with different carbon sources. Springerplus 5, 1752. Truu, M., Oopkaup, K., Krustok, I., Koiv-Vainik, M., Nolvak, H., Truu, J., 2018. Bacterial community activity and dynamics in the biofilm of an experimental hybrid wetland system treating greywater. Environ. Sci. Pollut. Res. Int. 26 (4), 4013–4026. Wang, J., Chu, L., 2016. Biological nitrate removal from water and wastewater by solidphase denitrification process. Biotechnol. Adv. 34 (6), 1103–1112. Wang, J., Gong, B., Huang, W., Wang, Y., Zhou, J., 2017. Bacterial community structure in simultaneous nitrification, denitrification and organic matter removal process treating saline mustard tuber wastewater as revealed by 16S rRNA sequencing. Bioresour. Technol. 228, 31–38. Wang, S., Qian, K., Zhu, Y., Yi, X., Zhang, G., Du, G., Tay, J.H., Li, J., 2019. Reactivation and pilot-scale application of long-term storage denitrification biofilm based on flow cytometry. Water Res. 148, 368–377. Xu, Z., Dai, X., Chai, X., 2018. Effect of different carbon sources on denitrification performance, microbial community structure and denitrification genes. Sci. Total Environ. 634, 195–204. Yang, N., Zhan, G., Li, D., Wang, X., He, X., Liu, H., 2019. Complete nitrogen removal and electricity production in Thauera-dominated air-cathode single chambered microbial fuel cell. Chem. Eng. J. 356, 506–515. Zhang, Q.H., Yang, W.N., Ngo, H.H., Guo, W.S., Jin, P.K., Dzakpasu, M., Yang, S.J., Wang, Q., Wang, X.C., Ao, D., 2016. Current status of urban wastewater treatment plants in China. Environ. Int. 92–93, 11–22. Zhang, X., Yuan, H., Jiang, Z., Lin, D., Zhang, X., 2018. Impact of surface tension of wastewater on biofilm formation of microalgae Chlorella sp. Bioresour. Technol. 266, 498–506. Zhang, Y., Jiang, J., Zhao, Q., Gao, Y., Wang, K., Ding, J., Yu, H., Yao, Y., 2017. Accelerating anodic biofilms formation and electron transfer in microbial fuel cells: role of anionic biosurfactants and mechanism. Bioelectrochemistry 117, 48–56. Zhu, Y., Zhang, Y., Ren, H.Q., Geng, J.J., Xu, K., Huang, H., Ding, L.L., 2015. Physicochemical characteristics and microbial community evolution of biofilms during the start-up period in a moving bed biofilm reactor. Bioresour. Technol. 180, 345–351.
Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.biortech.2019.121387. References APHA, 2005. Standard Methods for the Examination of Water and Wastewater, 21st ed. American Public Health Association, Washington DC, USA. Cai, Y., Li, D., Liang, Y., Luo, Y., Zeng, H., Zhang, J., 2015. Effective start-up biofiltration method for Fe, Mn, and ammonia removal and bacterial community analysis. Bioresour. Technol. 176, 149–155. Dalahmeh, S.S., Jonsson, H., Hylander, L.D., Hui, N., Yu, D., Pell, M., 2014. Dynamics and functions of bacterial communities in bark, charcoal and sand filters treating greywater. Water Res. 54, 21–32. Huang, H., Lin, Y., Peng, P., Geng, J., Xu, K., Zhang, Y., Ding, L., Ren, H., 2018a. Calcium ion- and rhamnolipid-mediated deposition of soluble matters on biocarriers. Water Res. 133, 37–46. Huang, H., Peng, C., Peng, P., Lin, Y., Zhang, X., Ren, H., 2019. Towards the biofilm characterization and regulation in biological wastewater treatment. Appl. Microbiol. Biotechnol. 103 (3), 1115–1129. Huang, H., Yu, Q., Ren, H., Geng, J., Xu, K., Zhang, Y., Ding, L., 2018b. Towards physicochemical and biological effects on detachment and activity recovery of aging biofilm by enzyme and surfactant treatments. Bioresour. Technol. 247, 319–326. Janjaroen, D., Ling, F., Monroy, G., Derlon, N., Mogenroth, E., Boppart, S.A., Liu, W.T., Nguyen, T.H., 2013. Roles of ionic strength and biofilm roughness on adhesion kinetics of Escherichia coli onto groundwater biofilm grown on PVC surfaces. Water Res. 47 (7), 2531–2542. Katz, H., Farber, R., Chaniel, G., Ankar, Y., Cohen, H., Cahan, R., 2018. Rhamnolipidenhanced Pseudomonas putida biofilm formation on hydrophilic surfaces with toluene as the bacterium's sole carbon source. Int. Biodeterior. Biodegrad. 127, 87–94. Kovaleva, O.L., Merkel, A.Y., Novikov, A.A., Baslerov, R.V., Toshchakov, S.V., BonchOsmolovskaya, E.A., 2015. Tepidisphaera mucosa gen. nov., sp nov., a moderately thermophilic member of the class Phycisphaerae in the phylum Planctomycetes, and proposal of a new family, Tepidisphaeraceae fam. nov., and a new order, Tepidisphaerales ord. nov. Int. J. Syst. Evol. Microbiol. 65, 549–555. Loupasaki, E., Diamadopoulos, E., 2013. Attached growth systems for wastewater treatment in small and rural communities: a review. J. Chem. Technol. Biotechnol. 88 (2), 190–204. Lupwayi, N.Z., Larney, F.J., Blackshaw, R.E., Kanashiro, D.A., Pearson, D.C., Petri, R.M.,
7