Enhanced catalytic efficiency of endo-β-agarase I by fusion of carbohydrate-binding modules for agar prehydrolysis

Enzyme and Microbial Technology 93–94 (2016) 142–149

Contents lists available at ScienceDirect

Enzyme and Microbial Technology journal homepage: www.elsevier.com/locate/emt

Enhanced catalytic efficiency of endo-␤-agarase I by fusion of carbohydrate-binding modules for agar prehydrolysis Bassam Alkotaini a , Nam Soo Han b , Beom Soo Kim a,∗ a b

Department of Chemical Engineering, Chungbuk National University, Cheongju, Chungbuk 28644, Republic of Korea Department of Food Science and Biotechnology, Chungbuk National University, Cheongju, Chungbuk, 28644, Republic of Korea

a r t i c l e

i n f o

Article history: Received 16 April 2016 Received in revised form 23 July 2016 Accepted 17 August 2016 Available online 18 August 2016 Keywords: Endo-␤-agarase I GH16 CBM6 CBM13 Agar prehydrolysis Fusion enzyme

a b s t r a c t Recently, Microbulbifer thermotolerans JAMB-A94 endo-␤-agarase I was expressed as catalytic domain (GH16) without a carbohydrate-binding module (CBM). In this study, we successfully constructed different fusions of GH16 with its original CBM6 and CBM13 derived from Catenovulum agarivorans. The optimum temperature and pH for fusions GH16-CBM6, GH16-CBM13, GH16-CBM6-CBM13 and GH16CBM13-CBM6 were similar to GH16, at 55 ◦ C and pH 7. All the constructed fusions significantly enhanced the GH16 affinity (Km) and the catalytic efficiency (Kcat/Km) toward agar. Among them, GH16-CBM6CBM13 exhibited the highest agarolytic activity, for which Km decreased from 3.67 to 2.11 mg/mL and Kcat/Km increased from 98.6 (mg/mL)−1 sec−1 to 400.6 (mg/mL)−1 sec−1 . Moreover, all fusions selectively increased GH16 binding ability to agar, in which the highest binding ability of 95% was obtained with fusion GH16-CBM6-CBM13. Melted agar was prehydrolyzed with GH16-CBM6-CBM13, resulting in a degree of liquefaction of 45.3% and reducing sugar yield of 14.2%. Further addition of Saccharophagus degradans agarolytic enzymes resulted in mono-sugar yields of 35.4% for galactose and 31.5% for 3,6-anhydro-l-galactose. There was no pH neutralization step required and no 5-hydroxymethylfurfural detected, suggesting the potential of a new enzymatic prehydrolysis process for efficient production of bio-products such as biofuels. © 2016 Elsevier Inc. All rights reserved.

1. Introduction Agarases are natural enzymes produced by certain agarolytic organisms found mostly in marine habitats [1]. Based on their similarity in amino acid sequences and structure folding, agarases are classified into five major glycoside hydrolase (GH) families. These families are GH16, GH50, GH86, GH96 and GH118 (http://www.cazy.org/Glycoside-Hydrolases.html). Agarase members from all the mentioned families carry a glycoside hydrolase domain that catalyzes the hydrolysis reaction and a carbohydratebinding module (CBM) that brings the catalytic domain into intimate contact with the polysaccharide structure [2]. Those CBMs are generally classified into 71 families according to the CAZy database (http://www.cazy.org/Carbohydrate-BindingModules.html) of which only CBM6 and CBM13 are found in agarases. Agarases have been widely used in genetic manipulations to recover DNA from agarose gels. The Takara Company (Otsu, Japan)

∗ Corresponding author. E-mail address: [email protected] (B.S. Kim). http://dx.doi.org/10.1016/j.enzmictec.2016.08.010 0141-0229/© 2016 Elsevier Inc. All rights reserved.

used a thermostable endo-␤-agarase I, isolated from Vibrio sp. JT0107, to develop a DNA purification kit [3]. In addition, agarases were described as successful candidates for agar-derived oligosaccharide production better than acidic hydrolysis [1] because they have the ability to produce oligosaccharides and then D-galactose preferred for fermentation without undesirable inhibitors such as 5-hydroxymethylfurfural (5-HMF) and furfural [4]. Because red macroalgae biomass has high carbohydrate contents and it lacks lignin in the structure, it has attracted much attention as a promising carbohydrate source for the production of bio-products including bioethanol and bioplastics [5]. Red macroalgae biomass, Gelidium amansii, is composed of agar as the major component, together with carrageenan and cellulose as minor components. In order to hydrolyze Gelidium amansii, techniques were developed on agar and agarose. Different treatments were investigated including a fully acidic hydrolysis using strong acids like sulfuric acid [6], or a fully enzymatic saccharification using the crude enzymes of a strong agarolytic bacteria such as Saccharophagus degradans [7]. A combination of acidic and enzymatic treatment was recently developed using weak acidic prehydrolysis such as acetic acid followed by enzymatic saccharification [8,9], or a ther-

B. Alkotaini et al. / Enzyme and Microbial Technology 93–94 (2016) 142–149

mal prehydrolysis step using the acid-base Tris-HCl buffer followed by enzymatic saccharification [10]. It has been reported that using acidic prehydrolysis such as weak acids or an acid-base buffer usually resulted in 5-HMF accumulation in the reaction medium [8,10]. Furthermore, acidic prehydrolysis treatment requires high temperature processing followed by a neutralization step and salt removal due to its inhibitory effect on the fermentation process [4]. Alternatively, endo-␤-agarase I has the ability to replace the prehydrolysis step to produce agaro-oligosaccharides. According to recent studies, employing endo-␤-agarase I in the prehydrolysis step has two major limitations: a rate-determining step, in which the saccharification time of acidic prehydrolyzed agar is half that of agar [9], and a lower yield due to the low solubility of agar in water as a reaction medium [11]. To overcome these limitations, the ability of endo-␤-agarase I with its high activity to speed-up the reaction and thermostability to hydrolyze melted agar in water above gelling temperature was investigated in this study. In the past decade, Ohta and her colleagues have isolated and identified a thermostable endo-␤agarase I with a remarkable thermostability [12]. The enzyme was extracellularly expressed using Bacillus subtilis and further characterized. Analysis using mass spectrometry and SDS-PAGE showed an un-expected molecular weight of 32 kDa instead of 46 kDa. The N-terminal amino acid sequence of the enzyme was identified as a catalytic domain (GH16) only without CBM in the structure. In this study, we successfully expressed the enzyme fused to its own CBM6 or CBM13 from Catenovulum agarivorans YM01 thermostable endo␤-agarase I. Additionally, we enhanced the catalytic efficiency by attaching another CBM to the designated fusions. The enhanced fusion enzyme, with higher catalytic efficiency, was used in prehydrolysis of agar and agarose as the first step in saccharification.

143

into E. coli DH5␣ and the cells were grown overnight in LB media in the presence of ampicillin. The plasmid was then extracted using the Nano-Plus Plasmid Extraction Kit (Bioneer, Korea). The GH16 gene (849 bp) was amplified from pBHA-GH16-CBM6-CBM13 using forward primer GH16, GCGGCTAGCATGTATGCCGCAGA and reverse primer GH16, GCGGGATCCTGTTTGTAAAACCGTACCCAATCT, and cloned into the NheI and BamHI restriction sites in plasmid pET21b(+) to produce pET-GH16. CBM13 with its original linker was amplified from pBHA-GH16-CBM6-CBM13 using forward primer CBM13, GCGGGATCCGGGCGCCGGAATCAACGGG and reverse primer CBM13, GCGGTCGACCTGGAATTTCCACTGTTGATTA, and cloned into the BamHI and SalI restriction sites in pET-GH16 to produce pET-GH16-CBM13. CBM6 with its original linker was further cloned downstream of GH16-CBM13 between the SalI and XhoI restriction sites to produce pETGH16-CBM13-CBM6. Primers used were forward primer CBM6, GCGGTCGACCCGGTTCCCATAAATGGTAAT and reverse primer CBM6, GCGCTCGAGCAGCTTAACAAAACGGATTTC. The GH16-CBM6 gene was retrieved from pBHA-GH16-CBM6-CBM13 by digestion with NheI and SalI and the resulting 1251 bp DNA fragment was cloned into the corresponding sites of pET21b(+) to obtain pETGH16-CBM6. The cloning was verified using the set of primers (forward primer GH16 and reverse primer GH16-CBM6, GCGGTCGACCAGCTTAACAAAACG). In a separate experiment, plasmid pBHA-GH16-CBM6-CBM13 was digested with NheI and XhoI and the resulting 1704 bp DNA fragment was cloned into the corresponding sites of pET21b(+) to obtain pET-GH16-CBM6-CBM13 harboring the fusion GH16-CBM6-CBM13. Primers used were forward primer GH16 and reverse primer GH16-CBM6-CBM13, GCGCTCGAGCTGGAATTTCCACT. 2.3. Expression and purification

2. Materials and methods 2.1. Bacterial strains, growth media and plasmids Escherichia coli DH5␣ and E. coli BL21 (DE3) strains were purchased from New England Biolabs (Ipswich, MA, USA) and used as cloning and protein expression hosts, respectively. Both hosts were cultivated in Luria Bertani (LB) medium (Neogen, Lansing, MI, USA). Ampicillin was purchased from Sigma-Aldrich (Steinheim, Germany) and used as a selectable marker at 50 ␮g/mL. pET21b(+) plasmid was purchased from Novagen (Madison, WI, USA) and was used as an expression vector. Restriction enzymes were purchased from Takara (Otsu, Japan). Agar and agarose were purchased from Junsei (Tokyo, Japan) and Bioneer (Daejeon, Korea), respectively.

The constructed plasmids were transformed into E. coli BL21 (DE3) and selected on LB-agar plates containing ampicillin. The expression of the fusion enzymes was induced at an OD600 of about 0.6 by adding isopropyl ␤-d-1-thiogalactopyranoside (IPTG) to a final concentration of 0.1 mM and further incubated at 20 ◦ C for 20 h. The E. coli cells were harvested by centrifugation at 9000 rpm at 4 ◦ C for 20 min and re-suspended in a lysis buffer (20 mM sodium phosphate, 500 mM NaCl, pH 7.4). The cells were disrupted by sonication and the crude extract was centrifuged at 16,000 rpm at 4 ◦ C for 20 min. The histidine-tagged soluble fusion enzymes were purified with Ni-NTA magnetic nano-beads (Bioneer, Korea) according to the manufacturer’s instructions. The purified fusion enzymes were analyzed by 12% SDS-PAGE [13]. The protein concentration was determined by BCA assay using bovine serum albumin as a standard.

2.2. Construction of fusion enzymes 2.4. Agarase activity assay The CAZy database (http://www.cazy.org/CarbohydrateBinding-Modules.html) was used to collate different CBM families attached to thermostable endo-␤-agarase I enzymes. The gene encoding the catalytic domain of thermostable ␤-agarase linked with CBM6 was selected from M. thermotolerans JAMB-A94 (EMBL: BAK08910.1). CBM13 with its native peptide linker was chosen from C. agarivorans YM01 (EMBL: AGU13985). A full length gene encoding GH16-CBM6-CBM13 was optimized for expression in E. coli, synthesized by Bioneer, Korea and delivered in lyophilized pBHA plasmid. The GH16-CBM6-CBM13 gene was deposited in GenBank under accession number KU674364. In order to clone the two fusion enzymes GH16-CBM6 and GH16-CBM6-CBM13, restriction sites NheI and XhoI were introduced upstream of GH16 and downstream of CBM13, respectively, whereas SalI was added downstream of CBM6. The synthesized gene GH16-CBM6-CBM13 delivered in pBHA-GH16-CBM6-CBM13 plasmid was transformed

Agarase activity was measured by a modified 3,5-dinitrosalicylic acid (DNS) method described previously [14]. A total of 25 ␮L of the enzyme solution was mixed with 975 ␮L of 20 mM Tris-HCl (pH 7) buffer containing 2 mg/mL of melted or un-melted agar. Agar was melted in 100 mM NaCl and 20 mM Tris-HCl (pH 7) at 80 ◦ C for 15 min and then kept at 45 ◦ C to prevent gelation, while un-melted agar was presented by agar powder in a reaction mixture (100 mM NaCl and 20 mM Tris-HCl, pH 7). The reaction was incubated at 45 ◦ C for 10 min and interrupted by incubating the mixture in boiling water for 5 min. Then, 1 mL of DNS reagent solution (6.5 g of DNS, 325 mL of 2 M NaOH and 45 mL of glycerol in 1 L distilled water) was added and heated in boiling water for 10 min. The mixture was then cooled to room temperature and the absorbance was measured at 540 nm against a blank where 25 ␮L of distilled water was added instead of the enzyme solution. One unit (U) of agarase was defined

144

B. Alkotaini et al. / Enzyme and Microbial Technology 93–94 (2016) 142–149

as the amount of enzyme that produced 1 ␮mol of reducing sugar per minute at the above conditions. 2.5. Biochemical properties and stability The optimum pH was determined by measuring the agarase activity at different pHs using 0.2 M sodium acetate buffer (pH 4–5), 20 mM Tris-HCl buffer, 150 mM NaCl (pH 6–9) and 50 mM disodium phosphate (pH 9–10). The optimum temperature was also examined at a temperature range from 30 to 70 ◦ C using 20 mM Tris-HCl buffer (pH 7). The pH stability was determined by measuring the relative remaining activity after incubating the fusion enzymes at different pH values for 1 h at 45 ◦ C. The thermostability was examined by incubating the fusion enzymes at temperatures of 30–100 ◦ C for 1 h in 20 mM Tris-HCl (pH 7). The effect of metal ions, chelator and denaturant on the agarase activity was determined in 20 mM Tris-HCl (pH 7) buffer containing NaCl, KCl, CaCl2 , MgCl2 , CuCl2 , ZnCl2 , FeCl3 , ethylenediaminetetraacetic acid (EDTA) and sodium dodecyl sulfate (SDS) at different concentrations (Table S1). The effect of CBM6 and CBM13 on the mechanism of the catalytic domain of GH16 was observed by thin layer chromatography (TLC). During a 24 h reaction, samples were collected, loaded onto a silica gel 60 plate (Merck, Darmstadt, Germany) and further developed with n-butanol:acetic acid:water = 2:1:1. The reaction products were visualized by spraying the TLC plate with 10% (v/v) H2 SO4 in ethanol and incubated at 95 ◦ C for 10 min. 2.6. Enzyme kinetics The kinetic parameters of the fusion enzymes Km, Kcat, and Kcat/Km were determined using melted agar concentrations ranging from 0.25 to 6 mg/mL and analyzed by Lineweaver-Burk plot. The reactions were done at 55 ◦ C in 20 mM Tris-HCl (pH 7) containing 100 mM NaCl. 2.7. Binding assay The binding ability of the enzymes was determined against melted and un-melted agar. A total of 30 ␮g of enzyme was added to 15 mg of agar in 3 mL of the reaction mixture and was then incubated for 1 h at 55 ◦ C with shaking at 225 rpm. The agar was then pelleted and the supernatant was concentrated using a 10 kDa cutoff membrane. The percentage of unbound protein was determined by measuring the protein concentration using BCA assay. The results were reported as a percentage of bound protein, for which it was calculated by subtracting the unbound protein percentage from 100. 2.8. Application of fusion GH16-CBM6-CBM13 in agar prehydrolysis 2.8.1. Preparation of S. degradans agarolytic crude enzymes The agarolytic crude enzymes were prepared as described previously [7]. S. degradans 2–40 (ATCC 43961) was grown in minimal broth media containing; 2 g/L agar, 23 g/L of ocean sea salt, 1 g/L yeast extract and 0.5 g/L ammonium chloride in 50 mM Tris–HCl at 30 ◦ C to reach early exponential phase. Cells were collected by centrifugation at 9000 rpm, 4 ◦ C for 20 min and were then washed twice with 2.3% NaCl and re-suspended in 50 mM Tris-HCl buffer (pH 7.4). Cells were disrupted by sonication and the soluble fraction was collected by centrifugation at 16,000 rpm, 4 ◦ C for 20 min. The soluble fraction was then concentrated using a 10 kDa cutoff membrane to obtain the agarolytic crude enzymes. The protein concentration was measured using BCA assay.

2.8.2. Agar prehydrolysis The ability of GH16-CBM6-CBM13 to prehydrolyze agar and agarose was evaluated by measuring the degree of liquefaction and the yield of reducing sugar. The initial substrate concentration was 15 mg/mL in 100 mM NaCl and 20 mM Tris-HCl, pH 7. The enzyme loading was 0.29 mg per g of substrate. The reaction was run at 45 ◦ C for 10 h with shaking at 225 rpm. 2.8.3. Saccharification of the prehydrolyzed substrates The prehydrolyzed substrates were subjected to enzymatic saccharification process using S. degradans agarolytic crude enzymes. The loading of agarolytic crude enzymes was 100 mg per 1 g of initial substrate, and the reactions were run at 30 ◦ C for 12 h. A control was run containing un-melted substrate and only S. degradans agarolytic enzymes at 30 ◦ C for total of 22 h. 2.8.4. Analysis Liquefaction of melted and un-melted agar and agarose into soluble products was determined as previously described [9]. Samples were centrifuged at 16,000 rpm at 4 ◦ C for 20 min, and soluble fractions were collected to analyze the reduced sugars with the DNS method (Section 2.4). Insoluble pellets were collected by centrifugation at 16,000 rpm at 4 ◦ C for 20 min and were then washed twice with distilled water. The pellets were dried in oven at 90 ◦ C for 6 h and the degree of liquefaction was calculated as: degree of liquefaction(%) =

initial substrate(g) − insoluble fraction(g) × 100 initial substrate(g)

Both TLC and HPLC were used to monitor the production of mono-sugars. Mono-sugars and HMF were analyzed by HPLC system (YL 9100, YOUNG-LIN Inc., Korea) using Biorad Aminex hpx–87 h column with a refractive index detector. A solvent mixture of 40% (v/v) acetonitrile in 0.01 M trifluoroacetic acid was used as the mobile phase at a flow rate of 0.5 mL/min [15]. 3. Results and discussion 3.1. Production of soluble enzymes Our recent study investigated G. amansii as a substrate to produce polyhydroxyalkanoates (PHA) by different Bacillus megaterium strains. The findings showed a relatively lower dry cell weight yield (Yx/s = 0.28 g dry cell weight/g carbon substrate) due to the accumulated 5-HMF as a result of acidic hydrolysis [16,17]. Thus, we were encouraged to investigate the potential of a complete enzymatic saccharification that eliminates the formation of inhibitors. Fusions of thermostable endo-␤-agarase I and CBM6 and CBM13 were constructed (Fig. 1). The protein domains were linked to each other using their original flexible peptide linkers in order to facilitate CBM rotation and interaction with its substrate [18]. The codon-optimized GH16-CBM6-CBM13 gene and the amino acid sequence were deposited in GenBank under accession number KU674364. The expressed enzymes were initially expressed in E. coli BL21 (DE3) as inclusion bodies when the cells were induced with 1 mM IPTG at 37 ◦ C. In order to obtain soluble active fractions, the induction concentration and temperature were optimized in which the highest soluble fractions were obtained after induction with 0.1 mM and further incubation at 20 ◦ C for 20 h (data not shown). The molecular weights of the purified enzymes were estimated to be 32, 46, 47, 62 and 62 kDa for GH16, GH16-CBM6, GH16-CBM13, GH16-CBM13-CBM6 and GH16CBM6-CBM13, respectively, as seen in the SDS-PAGE (Fig. 2). The purification procedures from a 200 mL culture medium are summarized in Table S1.

B. Alkotaini et al. / Enzyme and Microbial Technology 93–94 (2016) 142–149

(A)

GH16

145

HHHHHH

6X His tag

(B)

GH16

PVPIN

CBM6

6X His tag

Linker

(C)

GH16

HHHHHH

PVPIN

CBM6

PVDSGASAPTPPTGATSLQARH

GH16

PVDSGASAPTPPTGATSLQARH

HHHHHH

CBM13

Linker

(E)

GH16

PVDSGASAPTPPTGATSLQARH

HHHHHH

6X His tag

Linker

Linker

(D)

CBM13

6X His tag PVPIN

CBM13

Linker

Linker

CBM6

HHHHHH

6X His tag

Fig. 1. Schematic representation of engineered fusion enzymes. GH16 is agarolytic domain. CBM6 and CBM13 are carbohydrate-binding modules. GH16 and CBM6 are from M. thermotolerans JAMB-A94 and CBM13 is from C. agarivorans YM01. (A) control enzyme including GH16 only, (B) GH16 linked with CBM6, (C) GH16 linked with CBM 6 and CBM13, (D) GH16 linked with CBM13, (E) GH16 linked with CBM13 and CBM6.

Fig. 2. SDS-PAGE analysis of fusion enzymes purified using Ni-NTA magnetic nanobeads, (M) Protein ladder, (A) (1) purified GH16-CBM6, (2) purified GH16-CBM6CBM13, (3) purified GH16, (B) (1) purified GH16-CBM13, (2) purified GH16-CBM13CBM6.

3.2. Biochemical characteristics of the enzymes The optimum temperature and pH for all the expressed enzymes were determined as 55 ◦ C and pH 7. All enzymes maintained their highest agarase activity at temperatures ranging between 40 and

55 ◦ C and pH ranging from 6.5 to 7.5. The agarase activity, however, was significantly decreased outside of these ranges (Fig. S1). The effect of different temperature and pH values on the enzyme stability was determined by measuring the relative activity compared to the original activity prior to incubation. The residual activities of the enzymes were approximately 95% after being incubated at 50 ◦ C for 1 h, and a quick decrease in the activity to 23% for GH16, GH16-CBM6 and GH16-CBM13 and 43% for GH16-CBM6CBM13 and GH16-CBM13-CBM6 was observed after incubating the enzymes at 60 ◦ C for 1 h (Fig. S1). Additionally, the tested enzymes showed almost identical cation effects on their activities. Table S1 shows that heavy metals including Cu2+ , Zn2+ and Fe3+ decreased the activity due to the interactions between these heavy metals and some of the enzyme amino acid residues [12], whereas other cations (K+ , Ca2+ and Mg2+ ) did not affect it. Na+ showed a significant enhancement of the agarase activity up to 1.3 times which is due to the presence of two Na+ binding-sites donated in the GH16 crystal structure [19]. The agarase activity did not significantly decrease when the enzymes were incubated with EDTA which binds only to divalent metal ions rather than Na+ . In contrast, with SDS, the enzymes maintained only 21–26% of their activities due to its denaturation action [20]. The agar hydrolysis products by the enzymes were visualized by TLC. The products were predominantly neoagarotetraose (DP4) and neoagarohexaose (DP6) at the end of the reaction (Fig. S2), indicating that the addition of one or two CBMs did not modify the endo-hydrolysis mechanism of the GH16 action on agar.

Table 1 Michaelis-Menten parameters of GH16 and CBM fusions. Enzyme

Km (mg/mL)

GH16 GH16-CBM6 GH16-CBM13 GH16-CBM6-CBM13 GH16-CBM13-CBM6

3.67 2.71 2.73 2.11 2.11

a,b

± ± ± ± ±

0.06 0.02 0.01 0.004 0.01

Kcat (sec−1 )a 362.3 650.4 639.4 844.3 843.5

± ± ± ± ±

3.6 1.2 1.7 1.3 1.6

Results were expressed as a mean ± standard deviation of the mean. Kcat: Turnover number is the mole of the formed reducing sugar per second using one mole of enzyme. Kcat/Km: Catalytic efficiency rate used to compare enzyme acting on similar substrate.

a b

Kcat/Km (mg/mL)−1 sec−1 b 98.6 240 234.5 400.6 399.3

± ± ± ± ±

0.9 1.8 1.7 1 1.43

146

B. Alkotaini et al. / Enzyme and Microbial Technology 93–94 (2016) 142–149

Table 2 Binding percentage of GH16 and CBM fusions to the melted and un-melted agarose. Enzyme

Portion bound (%)

GH16 GH16-CBM6 GH16-CBM13 GH16-CBM6-CBM13 GH16-CBM13-CBM6

melted agarose

un-melted agarose

16 70 71 92 91

7 47 49 76 76

3.3. Binding and kinetics of the enzymes The Michaelis-Menten constants for the fusion enzymes are listed in Table 1. As predicted by the group who identified GH16 [12], the addition of one CBM, CBM6 or CBM13, significantly improved the catalytic domain affinity from 3.6 mg/mL to 2.7 mg/mL. Moreover, fusions GH16-CBM6-CBM13 and GH16CBM13-CBM6 exhibited a further affinity enhancement to 2.1 mg/mL. Along with Km, the catalytic efficiency Kcat/Km, which is considered as a reliable index [21], was increased. The catalytic domain GH16 had a Kcat/Km value of 98.6 (mg/mL)−1 sec−1 compared to the fusion enzymes GH16-CBM13 and GH16-CBM6 which

showed a remarkable increment to 234.5 (mg/mL)−1 sec−1 and 240 (mg/mL)−1 sec−1 , respectively. Attaching another CBM resulted in further catalytic activity enhancement to 400.6 (mg/mL)−1 sec−1 and 399.3 (mg/mL)−1 sec−1 for GH16-CBM6-CBM13 and GH16CBM13-CBM6, respectively. The binding capacity was measured against melted and un-melted agar. Addition of either CBM to GH16-CBM6 or GH16-CBM13 significantly improved the binding ability to melted and un-melted agar (Table 2). The results show that 92% of GH16-CBM6-CBM13 and 91% of GH16-CBM13-CBM6 were bound to the pelleted substrate compared to GH16 (16%), GH16-CBM6 (70%) and GH16-CBM13 (71%). In fact, CBM6 is a protein that binds to the non-reducing end of the agarose chain [22]. The exact bond is between the L-AHG residue and only cleft A in CBM6 structure [23]. Thus, the addition of CBM6 to GH16 or GH16CBM13 increased the potential of adhesion occurrence between the catalytic domain GH16 and L-AHG. Moreover, attaching CBM13 to GH16 or GH16-CBM6 resulted in further affinity and binding ability increment. CBM13, as other CBMs, helps to bring the catalytic domain to the substrate [24]. CBM13 is a well-known ligandbinding module that binds galactose or galactose-derivatives at the non-reducing ends of the agarose chain [25,26]. Due to its three subdomains and each one having a sugar-binding site, CBM13

Fig. 3. Schematic diagram of the fully enzymatic saccharification of agar and agarose.

Table 3 Degree of liquefaction, reducing and mono-sugar yields from agar and agarose after prehydrolysis with GH16-CBM6-CBM13 and saccharification with S. degradans agarolytic enzymes. Substrate

Status

Degree of liquefaction (%)a

Reducing sugar yield (%)a

Mono-sugar yield (%)a

Mono-sugar yield from control (%)b

Agar

Melted

45.31 ± 3.2

14.26 ± 2.6

35.4 ± 2.1 (Gal)31.5 ± 3.6 (AHG)

Un-melted

16.88 ± 2.2

6.54 ± 1.3

21.7 ± 2.9 (Gal)19.9 ± 3.2 (AHG)

Melted

43.98 ± 3.7

15.11 ± 2.7

40.0 ± 2.9 (Gal)37.1 ± 3.3 (AHG)

Un-melted

12.22 ± 2.6

6.98 ± 1.4

24.2 ± 1.9 (Gal)22.7 ± 3.3 (AHG)

NDc NDc 19.1 ± 3.1 (Gal) 17.3 ± 2.8 (AHG) NDc NDc 20.9 ± 2.5 (Gal) 19.8 ± 2.6 (AHG)

Agarose

a b c

Results were expressed as a mean ± standard deviation of the mean. A control was run containing un-melted substrate and only S. degradans agarolytic enzymes at 30 ◦ C for total of 22 h. Values are not measured using melted substrates.

Table 4 Comparison of enzymatic and acidic prehydrolysis and saccharification processes for reducing- and mono-sugar production from agar and agarose. Prehydrolysis process

Saccharification process

pH neutralizing requireda

Degree of liquefaction (%)

Reducing sugar yield (%)c

Mono-sugar yield (%)c

HMF (%)c

Comments

Reference

Melted agar

80 ◦ C for 15 min, 45 ◦ C for 10 h using fusion GH16-CBM6-CBM13

S. degradans agarolytic crude enzymes

No

45.3

14.3

35.4 (Gal), 31.5 (AHG)

NDb

No

43.9

15.1

NDb

This study

NAb

NAb

40 (Gal), 37.1 (AHG) NAb (Gal), 31 (AHG)

Suitable for fermentation, high liquefaction, average reducing sugar, pH neutralizing is not required

Yes

NAb

NAb

44.9 (Gal), 44.8 (AHG)

1.3

No

NAb

NAb

20 (Gal), 19.3 (AHG)

0.3

Yes

NAb

30.6

65 (Gal and AHG)

Yes (high)

NAb

NAb

Yes

25.4

Yes (high)

87.4

This study Melted agarose Low melting point agarose

No prehydrolysis process

S. degradans agarolytic crude enzymes

Agar

170 ◦ C for 10 min using 0.3% Tris-HCl

Agar

170 ◦ C for 5 min using 0.3% Tris-HCl

Agarose

130 ◦ C for 30 min using 3% acetic acid

Agarose

130 ◦ C for 30 min using 3% acetic acid

Recombinant enzymes including; Aga50D, NABH, and ABG Recombinant enzymes including; Aga50D, NABH, and ABG Recombinant enzymes including; Aga50D, NABH, and the crude enzyme of Vibrio sp. EJY3 Recombinant enzymes including; Aga50D, NABH, and ABG

Agarose

80 ◦ C for 3 h using 5.5% acetic acid

Agarose

80 ◦ C for 3 h using 27.4% acetic acid

a b c d

Recombinant enzymes including; DagA, Aga16B, Aga50D, and NABH Recombinant enzymes including; DagA, Aga16B, Aga50D, and NABH

NDb

Not suitable for fermentation due to the high cost of the substrate. However, agarotriose was not detected in the reaction medium. Suitable for fermentation, high yield of mono-sugars, relatively high HMF content Not suitable for fermentation, low yield of mono-sugars

[7]

2.1

Average suitable for fermentation, high HMF content

[8]

54.5 (Gal), 47 (AHG)

0.3

[10]

∼ 9d

62.8 (Gal and AHG)

NAb

16.7

79.1 (Gal and AHG)

NAb

Suitable for fermentation, with relatively low HMF content. Require high volume of neutralizing agent Not suitable for fermentation, high HMF content with low liquefaction and low yield of reducing- and mono- sugar Low suitable for fermentation, relatively high HMF content

[10]

[10]

[9]

B. Alkotaini et al. / Enzyme and Microbial Technology 93–94 (2016) 142–149

Substrate

[8,9]

Additional step after pre-hydrolysis to adjust pH from acidic to neutral for enzymatic activity. NA: not available in the reference, ND: not detected in the sample. Reducing sugar was measured by DNS method after the prehydrolysis process. Mono-sugars and HMF were analyzed by HPLC after the saccharification process. Values are generated from figures.

147

148

B. Alkotaini et al. / Enzyme and Microbial Technology 93–94 (2016) 142–149

Fig. 4. Thin layer chromatography analysis of enzymatic liquefaction and mono-sugar production using 15 g/L of (A) agarose, (B) agar. 1: enzymatic liquefaction of melted substrate, 2: enzymatic liquefaction of un-melted substrate, 3: enzymatic saccharification of melted substrate, 4: enzymatic saccharification of un-melted substrate, Gal: D-galactose standard, AHG: 3,6-anhydro-d-galactose standard.

has a multivalent binding ability [24]. Even though the presence of multiple CBMs in one enzyme is quite uncommon for endo␤-agarases I [1], it has been reported that multiple CBMs grant the catalytic domain higher affinity through avidity effects by an obscure mechanism [27]. Henshaw and his colleagues suggested that multiple-CBMs in one ␤-agarase interact with a single double helical agarose chain increasing the accessibility of agarose binding sites to the catalytic domain [22], which explains the relatively higher affinity of the fusion GH16-CBM6-CBM13 toward the agarose chain among the tested enzymes. Thus, GH16-CBM6CBM13, with its higher catalytic efficiency and higher binding ability, was used in the agar prehydrolysis process. 3.4. Application of GH16-CBM6-CBM13 in agar prehydrolysis The complete enzymatic saccharification of agar is mediated by three enzymes, endo-agarase I, exo-agarase II and neoagarobiose hydrolase (NABH) (Fig. 3). In order to evaluate the function of the fusion GH16-CBM6-CBM13 as a prehydrolysis agent, both the degree of liquefaction and reducing sugars at the end of the reactions were measured. Due to its solubility in water which makes a substrate disperse higher in the reaction medium, melted substrates prehydrolyzed with GH16-CBM6-CBM13 yielded a higher degree of liquefaction (i.e., 45.31% and 43.98% for agar and agarose, respectively) and yield of reduced sugars (i.e., 14.26% and 15.11% for agar and agarose, respectively) compared to the un-melted ones (Table 3). According to the HPLC analysis, 5-HMF was not detected at the end of the reactions. To evaluate the prehydrolysis process, agarolytic crude enzymes of S. degradans were added to the reaction medium and the products were observed using TLC (Fig. 4). HPLC analysis showed that the yield of mono-sugars from melted agar was 35.4 ± 2.1% for D-galactose and 31.5 ± 3.6% for L-AHG of theoretical maximum yields (Table 3). Meanwhile, higher yield was obtained using melted agarose (i.e., 40.0 ± 2.9% and 37.1 ± 3.3% for D-galactose and L-AHG, respectively). Although agar and agarose were used as substrates, the yield of L-AHG in this study (i.e., 31.5% and 37.1% from melted agar and agarose, respectively) are higher than the previous study which used only agarolytic crude enzymes of S. degradans to pro-

duce L-AHG (i.e., 31% from low melting point agarose, Table 4) [7], supporting the important role played by fusion GH16-CBM6CBM13 in liquefying agar prior to fully enzymatic saccharification process. Table 4 shows a comparison of our enzymatic and previous acidic prehydrolysis processes. Although the degree of liquefaction and yield of reduced sugars was not much higher than previous studies, 5-HMF was not detected compared to the acidic prehydrolysis (i.e., 5-HMF of 0.3–2.1%). While the enzymatic prehydrolysis process was carried out for 10 h, there was no pH neutralization step needed unlike previous thermal acidic protocols that required extra time for cooling and addition of NaOH for neutralizing the pH [10]. Agar is cheaper than agarose and contains agaropectin which is not hydrolyzed by common agarases [15]. In our experiment, the yield of reduced sugars was slightly higher with agarose than with agar, which is due to the simple structure of agarose consisting of 50:50 D-galactose:L-AHG, rather than the sulfated and methylated galactose units in the agar structure [11]. Due to its thermostability above the gelling temperature together with its high liquefying ability, the secretion of the fusion GH16-CBM6-CBM13 should be considered in future studies to reduce the cost of the downstream process and furthermore used as a prehydrolysis agent for the production of bio-products such as biofuels and PHAs.

4. Conclusion The affinity of the catalytic domain GH16 was increased by attaching the CBM6-CBM13 fusion at the C-terminus. The fusion GH16-CBM6-CBM13 had the highest binding ability and catalytic efficiency. Prehydrolysis of melted agar and agarose with GH16CBM6-CBM13 significantly increased the degree of liquefaction and yield of reduced sugars compared to using un-melted substrates. The proposed prehydrolysis process does not require a pH neutralizing step and eliminates the formation of 5-HMF. Thus, this study shows the potential of a new enzymatic prehydrolysis process prior to the saccharification of agar which is a major component in red macroalgae.

B. Alkotaini et al. / Enzyme and Microbial Technology 93–94 (2016) 142–149

Acknowledgement This research was supported by the Basic Science Research Program of the National Research Foundation of Korea (NRF2013R1A2A2A01067117). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.enzmictec.2016. 08.010. References [1] X.T. Fu, S.M. Kim, Agarase: review of major sources, categories, purification method, enzyme characteristics and applications, Mar. Drugs 8 (2010) 200–218. [2] A.B. Boraston, D.N. Bolam, H.J. Gilbert, G.J. Davies, Carbohydrate-binding modules: fine-tuning polysaccharide recognition, Biochem. J. 382 (2004) 769–781. [3] Y. Sugano, I. Terada, M. Arita, M. Noma, T. Matsumoto, Purification and characterization of a new agarase from a marine bacterium, Vibrio sp. strain JT0107, Appl. Environ. Microbiol. 59 (1993) 1549–1554. [4] E.J. Yun, H.T. Kim, K.M. Cho, S. Yu, S. Kim, I.G. Choi, et al., Pretreatment and saccharification of red macroalgae to produce fermentable sugars, Bioresour. Technol. 199 (2016) 311–318. [5] N. Wei, J. Quarterman, Y.S. Jin, Marine macroalgae: an untapped resource for producing fuels and chemicals, Trends Biotechnol. 31 (2013) 70–77. [6] J.H. Park, J.Y. Hong, H.C. Jang, S.G. Oh, S.H. Kim, J.J. Yoon, et al., Use of Gelidium amansii as a promising resource for bioethanol: a practical approach for continuous dilute-acid hydrolysis and fermentation, Bioresour. Technol. 108 (2012) 83–88. [7] E.J. Yun, M.H. Shin, J.J. Yoon, Y.J. Kim, I.G. Choi, K.H. Kim, et al., Production of 3,6-anhydro-l-galactose from agarose by agarolytic enzymes of Saccharophagus degradans 2–40, Process Biochem. 46 (2011) 88–93. [8] H.T. Kim, E.J. Yun, D. Wang, J.H. Chung, I.G. Choi, K.H. Kim, et al., High temperature and low acid pretreatment and agarase treatment of agarose for the production of sugar and ethanol from red seaweed biomass, Bioresour. Technol. 136 (2013) 582–587. [9] H.T. Kim, S. Lee, K.H. Kim, I.G. Choi, The complete enzymatic saccharification of agarose and its application to simultaneous saccharification and fermentation of agarose for ethanol production, Bioresour. Technol. 107 (2012) 301–306. [10] C.H. Lee, E.J. Yun, H.T. Kim, I.G. Choi, K.H. Kim, Saccharification of agar using hydrothermal pretreatment and enzymes supplemented with agarolytic ␤-galactosidase, Bioresour. Technol. 50 (2015) 1629–1633. [11] E.J. Yun, I.G. Choi, K.H. Kim, Red macroalgae as a sustainable resource for bio-based products, Trends Biotechnol. 33 (2015) 247–249.

149

[12] Y. Ohta, Y. Nogi, M. Miyazaki, Z. Li, Y. Hatada, S. Ito, et al., Enzymatic properties and nucleotide and amino acid sequences of a thermostable beta-agarase from the novel marine isolate, JAMB-A94, Biosci. Biotechnol. Biochem. 68 (2004) 1073–1081. [13] U.K. Laemmli, Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature 227 (1970) 680–685. [14] W.J. Chi, D.Y. Park, Y.B. Seo, Y.K. Chang, S.Y. Lee, S.K. Hong, et al., Cloning, expression, and biochemical characterization of a novel GH16 ␤-agarase AgaG1 from Alteromonas sp. GNUM-1, Appl. Microbiol. Biotechnol. 98 (2014) 4545–4555. [15] C.H. Lee, E.J. Yun, H.T. Kim, I.G. Choi, K.H. Kim, Saccharification of agar using hydrothermal pretreatment and enzymes supplemented with agarolytic ␤-galactosidase, Process Biochem. 50 (2015) 1629–1633. [16] B. Alkotaini, E. Sathiyamoorthi, B. Kim, Potential of Bacillus megaterium for production of polyhydroxyalkanoates using the red algae Gelidium amansii, Biotechnol. Bioproc. E 20 (2015) 856–860. [17] B. Alkotaini, H. Koo, B. Kim, Production of polyhydroxyalkanoates by batch and fed-batch cultivations of Bacillus megaterium from acid-treated red algae, Korean J. Chem. Eng. (2016), http://dx.doi.org/10.1007/s11814-015-0293-6. [18] X. Chen, J.L. Zaro, W.C. Shen, Fusion protein linkers: property, design and functionality, Adv. Drug Deliv. Rev. 65 (2013) 1357–1369. [19] E. Takagi, Y. Hatada, M. Akita, Y. Ohta, G. Yokoi, T. Miyazaki, et al., Crystal structure of the catalytic domain of a GH16 ␤-agarase from a deep-sea bacterium, Microbulbifer thermotolerans JAMB-A94, Biosci. Biotechnol. Biochem. 79 (2015) 625–632. [20] A.K. Bhuyan, On the mechanism of SDS-induced protein denaturation, Biopolymers 93 (2010) 186–199. [21] R. Eisenthal, M.J. Danson, D.W. Hough, Catalytic efficiency and kcat/KM: a useful comparator? Trends Biotechnol. 25 (2007) 247–249. [22] J. Henshaw, A. Horne-Bitschy, A.L. van Bueren, V.A. Money, D.N. Bolam, M. Czjzek, et al., Family 6 carbohydrate binding modules in beta-agarases display exquisite selectivity for the non-reducing termini of agarose chains, J. Biol. Chem. 281 (2006) 17099–17107. [23] G. Michel, T. Barbeyron, B. Kloareg, M. Czjzek, The family 6 carbohydrate-binding modules have coevolved with their appended catalytic modules toward similar substrate specificity, Glycobiology 19 (2009) 615–623. [24] Z. Fujimoto, Structure and function of carbohydrate-binding module families 13 and 42 of glycoside hydrolases, comprising a ␤-trefoil fold, Biosci. Biotechnol. Biochem. 77 (2013) 1363–1371. [25] A. Kuno, S. Kaneko, H. Ohtsuki, S. Ito, Z. Fujimoto, H. Mizuno, et al., Novel sugar-binding specificity of the type XIII xylan-binding domain of a family F10 xylanase from Streptomyces olivaceoviridis E-86, FEBS Lett. 482 (2000) 231–236. [26] N. Sphyris, J.M. Lord, R. Wales, L.M. Roberts, Mutational analysis of the Ricinus lectin B-chains. Galactose-binding ability of the 2gamma subdomain of Ricinus communis agglutinin B-chain, J. Biol. Chem. 270 (1995) 20292–20297. [27] D.N. Bolam, H. Xie, P. White, P.J. Simpson, S.M. Hancock, M.P. Williamson, et al., Evidence for synergy between family 2b carbohydrate binding modules in Cellulomonas fimi xylanase 11A, Biochemistry 40 (2001) 2468–2477.