- Email: [email protected]
Enhanced conversion of L -lysine to L -pipecolic acid using a recombinant Escherichia coli containing lysine cyclodeaminase as whole-cell biocatalyst
Journal of Molecular Catalysis B: Enzymatic 117 (2015) 75–80
Contents lists available at ScienceDirect
Journal of Molecular Catalysis B: Enzymatic journal homepage: www.elsevier.com/locate/molcatb
Enhanced conversion of L-lysine to L-pipecolic acid using a recombinant Escherichia coli containing lysine cyclodeaminase as whole-cell biocatalyst Hanxiao Ying, Jing Wang, Zhen Wang, Jiao Feng, Kequan Chen ∗ , Yan Li, Pingkai Ouyang State Key Laboratory of Materials-Oriented Chemical Engineering, College of Life Science and Pharmacy, Nanjing University of Technology, Nanjing 211816, People’s Republic of China
a r t i c l e
i n f o
Article history: Received 12 December 2014 Received in revised form 27 April 2015 Accepted 5 May 2015 Available online 13 May 2015 Keywords: pipA L-Pipecolic acid Whole-cell biocatalyst Repeated cell recycling
a b s t r a c t L-pipecolic acid, a fundamental chiral unit for numerous alkaloids and drugs, was biosynthesized from L-lysine using recombinant Escherichia coli containing pipA as the whole-cell catalyst. The effects of pH, temperature, surfactant, NAD+ , Fe2+ concentration and substrate and product concentration on Lpipecolic acid bioconversion were investigated in small scale experiments. By optimizing the reaction conditions, a dramatic increase (71.8%) in L-pipecolic acid concentration and yield was observed. Furthermore, whole-cell biocatalyst reaction process with repeated cell recycling to eliminate product inhibition was conducted in 1-L bioreactor under the optimum reaction conditions for L-pipecolic acid production. In the presence of NAD+ , an average L-pipecolic acid concentration of 17.25 g/L was achieved with a productivity of 0.36 g/(L h) after three cycles of cell recycling, which was up to 2.7 fold higher, when compared with that obtained in the process without repeated cell recycling. Thus, this study suggests that whole-cell biocatalyst may be an alternative choice for simple and efficient L-pipecolic acid production. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Piperidine rings are found in the core structure of many naturally occurring alkaloids and drugs [1], such as the potent immunosuppressant rapamysin [2], the amyloglucosidase inhibitor lentiginosine [3] and the anesthetics ropivacaine [4]. L-Pipecolic acid, an important precursor for the production of piperidine derivatives, has an increasing demand worldwide [5]. Currently, pure L-pipecolic acid enantiomer is mainly prepared by chemical enantioselective synthesis [6], stereoselective transformation [7], and biosynthesis [8–12]. However, owing to limitations, such as tedious procedures, low yield, and high manufacturing cost, these chemical processes have failed to provide a satisfactory solution for the chiral L-pipecolic acid production. Biosynthesis of L-pipecolic acid has been extensively investigated because of its close relationship with L-lysine metabolism [13,14]. Previous studies [8,13,14] have established two basic routes for converting L-lysine to Lpipecolic acid. Although biosynthesis of L-pipecolic acid is better than chemical synthesis with respect to substrate specificity, product chiral purity and reaction efficiency, both these pathways require two or more enzymes and several steps to convert L-lysine
to L-pipecolic acid [15], which may lead to the problems of excessive by-products and high cost of enzyme purification. Recently, studies on the biosynthesis of rapamysin in Streptomyces hygroscopicus found that lysine cyclodeaminase (LCD) could directly catalyze the conversion of L-lysine to L-pipecolic acid in one step [12]. Tsotsou et al. expressed LCD in Escherichia coli and investigated the biocatalytic properties of this enzyme [16], whereas Walsh et al., after heterologous expression and purification, demonstrated the mechanisms of LCD and confirmed the cofactor of this enzyme [12]. When compared with purified enzymes, whole-cell biocatalyst could simplify the process, leading to a relatively high reaction efficiency [17]. Furthermore, enzymes inside the cells are protected from the external environment and stabilized by intracellular medium [18]. To date, there have been no reports on the biosynthesis of L-pipecolic acid using whole-cell catalysts containing pipA. Thus, the present study was aimed at clarifying the biocatalytic properties of LCD in whole cells and investigating the performance of recovered cells for efficient production of L-pipecolic acid. 2. Materials and methods 2.1. Heterologous expression of LCD in E. coli
∗ Corresponding author. Tel.: +86 138 141 80652. E-mail address: [email protected] (K. Chen). http://dx.doi.org/10.1016/j.molcatb.2015.05.001 1381-1177/© 2015 Elsevier B.V. All rights reserved.
E. coli BL21(DE3) was used as the host strain in the present study. The pipA gene encoding LCD was amplified by PCR using
76
H. Ying et al. / Journal of Molecular Catalysis B: Enzymatic 117 (2015) 75–80
Streptomyces pristinaespiralis ATCC25486 chromosomal DNA as the template. Primer 1 was (CATGCCATGGAGACCTGGGTCCTGG) and primer 2 was (CCCAAGCTTTCAGTGGGCGGGGGC). The amplified PCR product was digested with NcoI and HindIII (underlined) and ligated into similarly digested pET-22b to generate the recombinant plasmid. Transformation of the plasmid into E. coli was performed by the classical CaCl2 procedure [19]. The cultivation processes, whole-cell biocatalyst preparation were described in details in supplementary material. 2.2. Assay of the properties of the whole-cell biocatalyst A standard whole-cell biocatalyst properties assay was conducted in 50-mL tubes containing recombinant E. coli whole cells as the biocatalyst, L-lysine as the substrate and 50 mM phosphate buffer solution (pH = 7.0) as the solvent. The OD600 of the reaction system were controlled at 200 and the L-lysine concentration in the reaction system were 25 g/L with a total reaction system volume of 25 mL. 2.3. Investigation of the whole-cell biocatalyst reaction process The reactions were initially performed in 1-L stirred bioreactors containing recombinant E. coli whole cells as the biocatalyst, L-lysine as the substrate and 50 mM phosphate buffer solution (pH = 7.0) as the solvent under the optimal conditions investigated in the whole-cell biocatalyst properties assay. The OD600 of the reaction system were controlled at 200 and the L-lysine concentration in the reaction system were 25 g/L with a total reaction system volume of 500 mL. In the process without cell recycling, 25 g/L lysine supplement was directly added to the media in its powder form every 48 h; in the processes with cell recycling, the media was centrifuged and the cell was harvested every 48 h, lysine as substrate in phosphate buffer solution was added to a final concentration of 25 g/L with a total volume of 500 mL. The reaction pH was monitored by using a Mettler electrode and controlled at the optimal pH with the addition of 10 M NaOH. 2.4. Analytical methods The concentrations of L-lysine were analyzed by using a SBA40 C biosensor analyzer (Shandong Province Academy of Sciences, China) [20]. During the reaction, product identity was monitored by TLC. When the reactions were completed, the cells were removed by centrifugation (9000 × g, 4 ◦ C, 10 min) and the supernatant was diluted the appropriate number of times for high-performance liquid chromatography (HPLC) analysis, the exact methods for TLC and HPLC analysis were described in details in supplementary material. 3. Results and discussion
Fig. 1. SDS-PAGE analysis of pipA with and without induction. Lane 1 was marker, Lane 2 was uninduced LCD, Lane 3 and 4 were induced LCD (Lane 3 and Lane 4 were parallel experiments).
bioconversion of L-lysine at various pHs was measured at 37 ◦ C (standard catalytic properties assay condition, Fig. 2a), the optimal pH of whole-cell biocatalyst was 7.5, the L-pipecolic acid concentration and yield were as high as 10.03 g/L, 0.43 g/g, respectively. The whole-cell biocatalyst seems to be more stable in alkaline condition, less active in acidic condition. At pH 5.0, the L-pipecolic acid concentration was decreased 55.8% in comparison with the pH at 7.5. Although the optimal pH of whole-cell biocatalyst was different from the optimal pH of purified enzyme [16], the whole-cell biocatalyst was obviously more stable in wider pH ranges. This might be the differences between the environment of intracellular enzyme and free purified enzyme. Inside the cells, the enzymes are protected from the external environment and stabilized by the intracellular medium [18,22]. Furthermore, the effect of temperature on L-lysine bioconversion was also investigated. As shown in Fig. 2b, the optimal temperature was 37 ◦ C at which an L-pipecolic acid yield of 0.40 g/g was obtained, but only 35.7% of yield was remained at 55 ◦ C. Furthermore, while no significant difference in the thermostability of the whole-cell biocatalyst was observed, when compared with that of the purified enzyme, similar to the performance at different pH, the whole-cell biocatalyst exhibited less loss of activity at extreme temperature, suggesting the extra protection provided by the cell membrane [18,22].
3.1. Heterologous expression of LCD in E. coli
3.3. Effect of surfactant on the whole-cell biocatalyst
To catalyze the conversion of L-lysine to L-pipecolic acid directly in E. coli cells, an overexpression strain was constructed by transforming a multi-copy recombinant expression vector harboring pipA gene (as mentioned in the “Materials and methods” Section) into E. coli BL21(DE3). The overexpression of pipA was analyzed by SDS-PAGE. As shown in Fig. 1, large amounts of protein were observed in the induced cells, when compared with that noted in the uninduced cells.
Owing to the permeability barriers imposed by cell envelopes, the reactions catalyzed by whole-cell biocatalysts have been reported to be slower than those catalyzed by free enzymes [23]. Nevertheless, the barrier permeability could be altered with the addition of surfactants, thus improving the mobility of intra/extracellular substrates and products. As shown in Table 1, with the addition of five different types of 1 mM surfactants, the L-pipecolic acid concentrations and yields were enhanced, indicating a significant improvement in the mass transfer of L-lysine and L-pipecolic acid through the cell envelopes. The highest L-pipecolic acid concentration of 12.51 g/L was obtained with the addition of Triton X-100, which was 28.7% higher than that achieved in the control.
3.2. Effect of pH and temperature on the whole-cell biocatalyst Appropriate pH and temperature, which could accelerate the reaction, are significant to biosynthesis [21]. Firstly, the
H. Ying et al. / Journal of Molecular Catalysis B: Enzymatic 117 (2015) 75–80
77
Table 1 Effect of surfactant on the whole-cell biocatalyst.a Surfactant
L-pipecolic acid concentration (g/L)
Control Sorbitol Brij S20 EDTA CTAB Trition X-100
9.72 11.37 11.84 12.24 11.04 12.51
a
± ± ± ± ± ±
0.15 0.3 0.72 0.13 0.53 0.31
L-pipecolic acid yield (g/g) 0.39 0.46 0.47 0.49 0.44 0.50
± ± ± ± ± ±
0.01 0.01 0.03 0.01 0.02 0.01
L-pipecolic acid productivity (g/L h) 0.14 0.16 0.16 0.17 0.15 0.18
± ± ± ± ± ±
0.00 0.00 0.01 0.01 0.01 0.00
Yield increased campared with control (%) 0 16.98 21.81 25.93 13.58 28.70
± ± ± ± ± ±
0 0.60 2.28 0.08 1.52 0.64
Each value is an average of three parallel replicates and is represented as mean standard deviation.
12
1.0
10
0.8
8 0.6 6 0.4 4 0.2
2
0
L-pipecolic acid yield (g/g)
L-pipecolic acid concentration (g/L)
L-pipecolic acid concentration (g/L) L-pipecolic acid yield (g/g)
0.0 +
Without NAD supplement
+
With 0.5% NAD supplement
Fig. 3. The effect of NAD+ supplement on the whole-cell biocatalyst. With or without NAD+ supplement was investigated by a standard whole-cell biocatalyst properties assay. (The yield of L-pipecolic acid was defined as the amount of L-pipecolic acid obtained from 1 g of L-lysine as the substrate and expressed in g/g).
3.5. Effect of iron concentration on the whole-cell biocatalyst
Fig. 2. (a) The effect of pH on whole-cell biocatalyst. Various pHs of 5.0, 5.5, 6.0, 6.5, 7.0, 8.0, 8.5 were investigated by a standard whole-cell biocatalyst properties assay. (The yield of L-pipecolic acid was defined as the amount of L-pipecolic acid obtained from 1 g of L-lysine as the substrate and expressed in g/g). (b) The effect of temperature on whole-cell biocatalyst. Various temperature of 30 ◦ C, 37 ◦ C, 40 ◦ C, 45 ◦ C, 50 ◦ C, 55 ◦ C were investigated by a standard whole-cell biocatalyst properties assay. (The yield of L-pipecolic acid was defined as the amount of Lpipecolic acid obtained from 1 g of L-lysine as the substrate and expressed in g/g).
3.4. Effect of NAD+ supplementation on the whole-cell biocatalyst With regard to LCD, Gatto et al. indicated that LCD was incompletely loaded with NAD+ when overproduced in E. coli [12]. In the presence of exogenous NAD+ , the initial rate was elevated by 8 fold. Therefore, in the present study, the effect of NAD+ supplementation on the whole-cell biocatalyst was investigated, and the results of bioconversion with and without exogenous NAD+ were represented in Fig. 3. With the addition of 0.5% NAD+ , after 72 h reaction, the L-pipecolic acid concentration was increased by 17.0%, reaching 11.37 g/L, which indicated that exogenous NAD+ could also stimulate the activity of LCD within the cell.
Various cations, particularly metal ions, could affect the activity of enzymes [16]. Tsotrou et al. studied the effect of different cations on the activity of purified LCD [16], and suggested that iron(II) appeared to have the most significant stimulating and stabilizing effect on LCD, enhancing the enzyme activity by 13 fold. However, excess metal ion concentration might inhibit the enzyme activity or cells as well [24]. Therefore, in the present study, we investigated the effect of iron(II) sulfate concentration on the whole-cell bioconversion process. As shown in Table 2, the L-pipecolic acid concentration increased with the increasing iron(II) sulfate concentration between 0 and 0.5 g/L, but an inhibition was observed at an iron(II) sulfate concentration of more than 0.5 g/L. The yield decreased by 23.6% with the addition of 1.0 g/L iron(II) sulfate, when compared with that observed with the addition of 0.5 g/L iron(II) sulfate, which might be owing to the inhibition caused by the presence of excessive iron(II). Furthermore, as shown in Fig. 4, addition of iron(II) sulfate accelerated the consumption of L-lysine. The reaction conducted without the addition of iron(II) sulfate took more than 72 h to reach thermodynamic equilibrium, a duration which was almost one-third longer than that observed with the supplementation of 0.5 g/L iron(II) sulfate, indicating a 61.5% increase in L-pipecolic acid productivity, when compared with the control. In conclusion, the highest L-pipecolic acid concentration, yield, and productivity of 15.19 g/L, 0.61 g/g, and 0.21 g/(L h), respectively, were obtained with the addition of 0.5 g/L iron(II) sulfate. 3.6. Effect of substrate and product concentration on the whole-cell biocatalyst Many enzymes, especially some cyclodeaminases, have been reported to be subjected to substrate or product inhibition [25–27].
78
H. Ying et al. / Journal of Molecular Catalysis B: Enzymatic 117 (2015) 75–80
Table 2 Effect of iron concentration on the whole-cell biocatalyst.a Iron (II) sulphate concentration (g/L)
L-pipecolic acid concentration (g/L)
Control 0.10 0.15 0.20 0.25 0.50; 1.00
9.72 9.74 10.45 11.17 14.27 15.19
a
± ± ± ± ± ±
L-pipecolic acid yield (g/g)
0.15 0.44 0.31 0.52 0.28 0.30; 11.60 ± 0.87
0.39 0.39 0.42 0.45 0.57 0.61
± ± ± ± ± ±
L-pipecolic acid productivity (g/L h)
0.01 0.03 0.01 0.02 0.01 0.01; 0.46 ± 0.03
0.13 0.14 0.15 0.16 0.20 0.21
± ± ± ± ± ±
0.00 0.01 0.00 0.01 0.00 0.00; 0.16 ± 0.00
Each value is an average of three parallel replicates and is represented as mean standard deviation.
a)
0.5 L-pipecolic acid yield (g/g)
0.4 8 0.3 6 0.2
4
0.1
2
0.0
0 5 g/L
12.5 g/L
L-pipecolic acid concentration (g/L)
50 g/L
75 g/L 0.5
L-pipecolic acid concentration (g/L)
10
L-pipecolic acid yield (g/g)
0.4 8 0.3 6 0.2
4
0.1
2
L-pipecolic acid yield (g/g)
As the extremely low substrate and product concentrations investigated in purified LCD property assays might not provide strong evidence for potential inhibition, Therefore, in the present study, the effects of substrate and product concentration on the wholecell biocatalyst were investigated. As shown in Fig. 5a, the activity of the whole-cell biocatalyst dropped sharply at an L-lysine concentration higher than 25 g/L. On the other hand, as shown in Fig. 5b, with the exogenous addition of 10 g/L product, the L-pipecolic acid concentration was 2.11 g/L, which was only 21.7% of that obtained without the addition of exogenous product (0 g/L), suggesting that product removal was necessary for the production of L-pipecolic acid using whole-cell biocatalyst. To confirm the performance of whole-cell biocatalyst, an assay was conducted under the optimum reaction conditions, supplemented with 0.5 g/L iron(II) sulfate (the effect of iron(II) sulfate on the whole-cell biocatalyst were described in details in supplementary material), 0.5% NAD+ , 1 mM Triton X-100 and the L-lysine concentration in the reaction system were 25 g/L with a total reaction system volume of 25 mL. The OD600 of the reaction system were controlled at 200 and the initial pH was adjusted to 7.5 and the tube was incubated in a 37 ◦ C shaker for 72 h (the effect of pH and temperature on the whole-cell biocatalyst were described in details in supplementary material). The control was prepared under a standard whole-cell biocatalyst properties assay and was incubated in the same shaker for 72 h. The highest L-pipecolic acid concentration and yield obtained were 16.71 g/L and 0.67 g/g under the optimal reaction conditions (data not shown), respectively, exhibiting a 71.9% increase, when compared with that obtained in the
25 g/L
L-lysine concentration (g/L)
b) Fig. 4. The effect of iron concentration on L-lysine consumption. Various concentration of 0.1 g/L, 0.15 g/L, 0.20 g/L, 0.25 g/L, 0.50 g/L, 1.00 g/L were investigated (, without supplement of iron(II) sulphate; 䊉, iron(II) sulphate concentration of 0.10 g/L; , iron(II) sulphate concentration of 0.15 g/L; , iron(II) sulphate concentration of 0.20 g/L; , iron(II) sulphate concentration of 0.25 g/L; , iron(II) sulphate concentration of 0.50 g/L; , iron(II) sulphate concentration of 1.00 g/L).
L-pipecolic acid yield (g/g)
L-pipecolic acid concentration (g/L)
L-pipecolic acid concentration (g/L)
10
0.0
0 0
2
4
6
8
10
Concentration effect of the product added exogenously (g/L) Fig. 5. (a) The effect of substrate concentration on the whole-cell biocatalyst. Various of L-lysine concentration of 5 g/L, 12.5 g/L, 25 g/L, 50 g/L, 75 g/L were investigated by a standard whole-cell biocatalyst properties assay. (The yield of L-pipecolic acid was defined as the amount of L-pipecolic acid obtained from 1 g of L-lysine as the substrate and expressed in g/g).(b) Effect of exogenous added product concentration on the whole-cell biocatalyst. Various exogenous L-pipecolic acid concentrations of 0 g/L, 2 g/L, 4 g/L, 6 g/L, 8 g/L, 10 g/L were investigated. (The yield of L-pipecolic acid was defined as the amount of L-pipecolic acid obtained from 1 g of L-lysine as the substrate and expressed in g/g).
control. Meanwhile, the reaction procedure was shortened by 24 h under the optimum reaction conditions, suggesting that optimization of the reaction conditions sharply improved the performance of the process. 3.7. Cell recycling processes Although a significant enhancement in the reaction performance could be achieved by optimizing the reaction conditions, conditions such as substrate inhibition, product inhibition, complicated cell cultivation procedure, and poor utilization of cells limit the further application of whole-cell biocatalysts in L-pipecolic
H. Ying et al. / Journal of Molecular Catalysis B: Enzymatic 117 (2015) 75–80
79
Table 3 L-pipecolic acid concentration, yield and productivity for each process.a , b
Without cell recycle Cell recycle without NAD+ Cell recycle with NAD+ a b
L-pipecolic acid production (g)
L-pipecolic acid yield (g/g)
L-pipecolic acid productivity (g/L h)
9.61 ± 0.40 17.22 ± 0.94 25.88 ± 0.52
0.26 ± 0.04 0.44 ± 0.04 0.69 ± 0.04
0.13 ± 0.00 0.23 ± 0.01 0.36 ± 0.01
Each value is an average of three parallel replicates and is represented as mean standard deviation. The L-pipecolic acid production, L-pipecolic acid yield and L-pipecolic acid productivity were the average of three cycles.
20
The first cycle
The second cycle
The third cycle 2.8 2.4
14 2.0
12
1.6
10 8
1.2
6 4
0.8
2
0.4
0
L-pipecolic acid productivity (g/L*h)
16
L-pipecolic acid yield (g/g)
L-pipecolic acid concentration (g/L)
18
0.0
-2 0
20
40
60
80
100
120
140
Time (h) Fig. 6. L-pipecolic acid concentration, yield and productivity of the repeated cell recycling processes with or without NAD+ supplement (, L-pipecolic acid concentration without NAD+ supplement; 䊉, L-pipecolic acid concentration with 0.5% NAD+ supplement; ♦, L-pipecolic acid productivity without NAD+ supplement; , L-pipecolic acid productivity with 0.5% NAD+ supplement; , L-pipecolic acid yield without NAD+ supplement; , L-pipecolic acid yield with 0.5% NAD+ supplement). (The yield of L-pipecolic acid was defined as the amount of L-pipecolic acid obtained from 1 g of L-lysine as the substrate and expressed in g/g).
acid production. To overcome these shortcomings, repeated cell recycling is usually employed to eliminate the inhibition, ensure continuous bioconversion, and maximize biocatalytic productivity [28]. In the present study, three different processes were investigated. The first process was not using cell recycling. 25 g/L L-lysine was added to the medium at 0 h, 48 h and 96 h. (Table 3). The yield achieved at 144 h was only 0.26 g/g, suggesting that the accumulation of L-pipecolic acid prevented L-lysine conversion. Moreover, the accumulation of excessive unreacted substrate also affected the activity of the whole-cell biocatalyst as mentioned earlier. Consequently, a productivity of 0.13 g/(L h) were obtained, demonstrating that product removal should be employed in the reaction procedure. The second and third reactions were using cell recycling. As shown in Fig. 6, 25 g/L L-lysine was added to the medium and the products were removed while the cells were recycled by centrifugation every 48 h for three times. In both the processes, substrate and product inhibitions were eliminated owing to product removal. Furthermore, a 1.8–2.7 fold increase in the productivity was observed, when compared with that achieved without repeated cell recycling. However, without NAD+ supplementation, the LCD might not completely loaded with NAD+ [12]. Also the strong centrifugation used in the cell recycling procedure might loose the binding between enzyme and NAD+ , which led to the inactive of the biocatalyst. Comparison of the first and last batches with the addition of NAD+ revealed that the L-pipecolic acid concentration decreased only by 0.56 g/L, whereas the concentration dropped by 5.8 g/L without NAD+ supplementation. In conclusion, product removal procedure combined with the supplementation of
NAD+ resulted in the highest average L-pipecolic acid concentration and yield of 17.25 g/L and 0.69 g/g, respectively. To compare with the other L-pipecolic acid production approach [29], Muramatsu, H. produced L-pipecolic acid using a three enzyme system (lysine oxidase, piperidine-2-carboxylate reductase and glucose dehydrogenase), although a relatively higher yield was achieved, the cost of lysine oxidase and two cofactors (NADP+ and FAD) might limited its application. However, our biosynthesis method used recombinant E. coli containing single enzyme LCD as whole-cell biocatalyst, it might be more competitive owing to the lower cost and simplified process. 4. Conclusion The present study demonstrated that recombinant E. coli containing pipA could be used as the whole-cell biocatalyst for the production of L-pipecolic acid. During repeated L-lysine bioconversion in a bioreactor with the addition of NAD+ , an average L-pipecolic acid concentration and yield of 17.25 g/L and 0.69 g/g were achieved in each cycle, respectively. Therefore, we believe that whole-cell biocatalyst could be used as an alternative to purified enzymes for L-pipecolic acid production because of the comparable catalytic efficiency, preferable stability, and less cost. Acknowledgements This work was supported by the National Nature Science Foundation of China (grant no. 21390200, 21106068), National Key Technology Support Program (grant no. 2012BAI44G00), “973” program of China (grant no. 2011CBA00807), and “863” program of China (grant no. 2014AA021703). References [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18] [19] [20] [21]
M.K. Ghora, S. Halder, R.K. Das, J. Org. Chem. 75 (2010) 7061–7072. D.C.N. Swindells, P.S. White, J.A. Findlay, Can. J. Chem. 56 (1978) 2491–2492. I. Pastuszak, R.J. Molyneux, L.F. Jame, Biochemistry 29 (1990) 1886–1891. N. Shankaraiah, R.A. Pilli, L.S. Santos, Tetrahedron Lett. 49 (2008) 5098–5100. A.A. Cant, A. Sutherland, Synthesis 44 (2012) 1935–1950. T. Wilkinson, N.W. Stehle, P. Beak, Org. Lett. 2 (2000) 155–158. E. Eichhorn, J.P. Roduit, A. Kiener, Tetrahedron Asymmet. 8 (1997) 2533–2536. D.L. Miller, V.W. Rodwell, J. Biol. Chem. 246 (1971) 2758–2764. T. Fujii, M. Mukaihara, H. Tsunekawa, Biosci. Biotechnol. Biochem. 66 (2002) 622–627. T. Fujii, H. Agematu, H. Tsunekawa, Biosci. Biotechnol. Biochem. 66 (2002) 1981–1984. I. Molnar, J.F. Aparicio, P.F. Leadlay, Gene 169 (1996) 1–7. J. Gregory, J. Gatto, T.W. Christopher, J. Am. Chem. Soc. 128 (2006) 3838–3847. H.P. Broquist, Annu. Rev. Nutr. 11 (1991) 435–448. R.N. Gupta, I.D. Spenser, J. Biol. Chem. 244 (1969) 88–94. M. He, J. Ind. Microbiol. Biotechnol. 33 (2006) 401–407. G.E. Tsotsou, F. Barbirato, Biochimie 89 (2007) 591–604. X.F. Li, Z. Zhu, H. Wu, Appl. Microbiol. Biotechnol. 93 (2012) 143–150. J.D. Carballeira, M.A. Quezada, J.V. Sinisterra, Biotechnol. Adv. 27 (2009) 686–714. S. Orkin, Molecular Cloning A Laboratory Manual, second ed., Cold Spring Harbor Laboratory Press, 1989. H.X. Ying, K.Q. Chen, P.K. Ouyang, Appl. Biochem. Biotechnol. 172 (2014) 3835–3843. A. Siriphongphaew, P. Pisnupong, J. Wongkongkatep, Appl. Microbiol. Biotechnol. 95 (2012) 357–367.
80 [22] [23] [24] [25]
H. Ying et al. / Journal of Molecular Catalysis B: Enzymatic 117 (2015) 75–80 W.S. Liu, B. Jia, Y.J. Yan, J. Agric. Food Chem. 58 (2010) 10426–10430. Y. Ni, R.R. Chen, Biotechnol. Bioeng. 87 (2004) 804–811. X.H. Wang, Y. Zhao, H. Yin, Int. J. Biol. Macromol. 70 (2014) 455–462. M. Trovato, B. Maras, P. Costantino, Proc. Natl. Acad. Sci. 98 (2001) 13449–13453.
[26] [27] [28] [29]
N. Sans, U. Schindler, J. Schröder, Eur. J. Biochem. 173 (1988) 123–130. R.N. Costilow, L. Laycock, J. Biol. Chem. 246 (1971) 6655–6660. J.F. Ma, K.Q. Chen, M. Jiang, Biotechnol. Lett. 32 (2010) 1413–1418. H. Muramatsu, H. Mihara, N. Esaki, Biosci. Biotech. Biochem. 70 (2006) 2296–2298.
Contents lists available at ScienceDirect
Journal of Molecular Catalysis B: Enzymatic journal homepage: www.elsevier.com/locate/molcatb
Enhanced conversion of L-lysine to L-pipecolic acid using a recombinant Escherichia coli containing lysine cyclodeaminase as whole-cell biocatalyst Hanxiao Ying, Jing Wang, Zhen Wang, Jiao Feng, Kequan Chen ∗ , Yan Li, Pingkai Ouyang State Key Laboratory of Materials-Oriented Chemical Engineering, College of Life Science and Pharmacy, Nanjing University of Technology, Nanjing 211816, People’s Republic of China
a r t i c l e
i n f o
Article history: Received 12 December 2014 Received in revised form 27 April 2015 Accepted 5 May 2015 Available online 13 May 2015 Keywords: pipA L-Pipecolic acid Whole-cell biocatalyst Repeated cell recycling
a b s t r a c t L-pipecolic acid, a fundamental chiral unit for numerous alkaloids and drugs, was biosynthesized from L-lysine using recombinant Escherichia coli containing pipA as the whole-cell catalyst. The effects of pH, temperature, surfactant, NAD+ , Fe2+ concentration and substrate and product concentration on Lpipecolic acid bioconversion were investigated in small scale experiments. By optimizing the reaction conditions, a dramatic increase (71.8%) in L-pipecolic acid concentration and yield was observed. Furthermore, whole-cell biocatalyst reaction process with repeated cell recycling to eliminate product inhibition was conducted in 1-L bioreactor under the optimum reaction conditions for L-pipecolic acid production. In the presence of NAD+ , an average L-pipecolic acid concentration of 17.25 g/L was achieved with a productivity of 0.36 g/(L h) after three cycles of cell recycling, which was up to 2.7 fold higher, when compared with that obtained in the process without repeated cell recycling. Thus, this study suggests that whole-cell biocatalyst may be an alternative choice for simple and efficient L-pipecolic acid production. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Piperidine rings are found in the core structure of many naturally occurring alkaloids and drugs [1], such as the potent immunosuppressant rapamysin [2], the amyloglucosidase inhibitor lentiginosine [3] and the anesthetics ropivacaine [4]. L-Pipecolic acid, an important precursor for the production of piperidine derivatives, has an increasing demand worldwide [5]. Currently, pure L-pipecolic acid enantiomer is mainly prepared by chemical enantioselective synthesis [6], stereoselective transformation [7], and biosynthesis [8–12]. However, owing to limitations, such as tedious procedures, low yield, and high manufacturing cost, these chemical processes have failed to provide a satisfactory solution for the chiral L-pipecolic acid production. Biosynthesis of L-pipecolic acid has been extensively investigated because of its close relationship with L-lysine metabolism [13,14]. Previous studies [8,13,14] have established two basic routes for converting L-lysine to Lpipecolic acid. Although biosynthesis of L-pipecolic acid is better than chemical synthesis with respect to substrate specificity, product chiral purity and reaction efficiency, both these pathways require two or more enzymes and several steps to convert L-lysine
to L-pipecolic acid [15], which may lead to the problems of excessive by-products and high cost of enzyme purification. Recently, studies on the biosynthesis of rapamysin in Streptomyces hygroscopicus found that lysine cyclodeaminase (LCD) could directly catalyze the conversion of L-lysine to L-pipecolic acid in one step [12]. Tsotsou et al. expressed LCD in Escherichia coli and investigated the biocatalytic properties of this enzyme [16], whereas Walsh et al., after heterologous expression and purification, demonstrated the mechanisms of LCD and confirmed the cofactor of this enzyme [12]. When compared with purified enzymes, whole-cell biocatalyst could simplify the process, leading to a relatively high reaction efficiency [17]. Furthermore, enzymes inside the cells are protected from the external environment and stabilized by intracellular medium [18]. To date, there have been no reports on the biosynthesis of L-pipecolic acid using whole-cell catalysts containing pipA. Thus, the present study was aimed at clarifying the biocatalytic properties of LCD in whole cells and investigating the performance of recovered cells for efficient production of L-pipecolic acid. 2. Materials and methods 2.1. Heterologous expression of LCD in E. coli
∗ Corresponding author. Tel.: +86 138 141 80652. E-mail address: [email protected] (K. Chen). http://dx.doi.org/10.1016/j.molcatb.2015.05.001 1381-1177/© 2015 Elsevier B.V. All rights reserved.
E. coli BL21(DE3) was used as the host strain in the present study. The pipA gene encoding LCD was amplified by PCR using
76
H. Ying et al. / Journal of Molecular Catalysis B: Enzymatic 117 (2015) 75–80
Streptomyces pristinaespiralis ATCC25486 chromosomal DNA as the template. Primer 1 was (CATGCCATGGAGACCTGGGTCCTGG) and primer 2 was (CCCAAGCTTTCAGTGGGCGGGGGC). The amplified PCR product was digested with NcoI and HindIII (underlined) and ligated into similarly digested pET-22b to generate the recombinant plasmid. Transformation of the plasmid into E. coli was performed by the classical CaCl2 procedure [19]. The cultivation processes, whole-cell biocatalyst preparation were described in details in supplementary material. 2.2. Assay of the properties of the whole-cell biocatalyst A standard whole-cell biocatalyst properties assay was conducted in 50-mL tubes containing recombinant E. coli whole cells as the biocatalyst, L-lysine as the substrate and 50 mM phosphate buffer solution (pH = 7.0) as the solvent. The OD600 of the reaction system were controlled at 200 and the L-lysine concentration in the reaction system were 25 g/L with a total reaction system volume of 25 mL. 2.3. Investigation of the whole-cell biocatalyst reaction process The reactions were initially performed in 1-L stirred bioreactors containing recombinant E. coli whole cells as the biocatalyst, L-lysine as the substrate and 50 mM phosphate buffer solution (pH = 7.0) as the solvent under the optimal conditions investigated in the whole-cell biocatalyst properties assay. The OD600 of the reaction system were controlled at 200 and the L-lysine concentration in the reaction system were 25 g/L with a total reaction system volume of 500 mL. In the process without cell recycling, 25 g/L lysine supplement was directly added to the media in its powder form every 48 h; in the processes with cell recycling, the media was centrifuged and the cell was harvested every 48 h, lysine as substrate in phosphate buffer solution was added to a final concentration of 25 g/L with a total volume of 500 mL. The reaction pH was monitored by using a Mettler electrode and controlled at the optimal pH with the addition of 10 M NaOH. 2.4. Analytical methods The concentrations of L-lysine were analyzed by using a SBA40 C biosensor analyzer (Shandong Province Academy of Sciences, China) [20]. During the reaction, product identity was monitored by TLC. When the reactions were completed, the cells were removed by centrifugation (9000 × g, 4 ◦ C, 10 min) and the supernatant was diluted the appropriate number of times for high-performance liquid chromatography (HPLC) analysis, the exact methods for TLC and HPLC analysis were described in details in supplementary material. 3. Results and discussion
Fig. 1. SDS-PAGE analysis of pipA with and without induction. Lane 1 was marker, Lane 2 was uninduced LCD, Lane 3 and 4 were induced LCD (Lane 3 and Lane 4 were parallel experiments).
bioconversion of L-lysine at various pHs was measured at 37 ◦ C (standard catalytic properties assay condition, Fig. 2a), the optimal pH of whole-cell biocatalyst was 7.5, the L-pipecolic acid concentration and yield were as high as 10.03 g/L, 0.43 g/g, respectively. The whole-cell biocatalyst seems to be more stable in alkaline condition, less active in acidic condition. At pH 5.0, the L-pipecolic acid concentration was decreased 55.8% in comparison with the pH at 7.5. Although the optimal pH of whole-cell biocatalyst was different from the optimal pH of purified enzyme [16], the whole-cell biocatalyst was obviously more stable in wider pH ranges. This might be the differences between the environment of intracellular enzyme and free purified enzyme. Inside the cells, the enzymes are protected from the external environment and stabilized by the intracellular medium [18,22]. Furthermore, the effect of temperature on L-lysine bioconversion was also investigated. As shown in Fig. 2b, the optimal temperature was 37 ◦ C at which an L-pipecolic acid yield of 0.40 g/g was obtained, but only 35.7% of yield was remained at 55 ◦ C. Furthermore, while no significant difference in the thermostability of the whole-cell biocatalyst was observed, when compared with that of the purified enzyme, similar to the performance at different pH, the whole-cell biocatalyst exhibited less loss of activity at extreme temperature, suggesting the extra protection provided by the cell membrane [18,22].
3.1. Heterologous expression of LCD in E. coli
3.3. Effect of surfactant on the whole-cell biocatalyst
To catalyze the conversion of L-lysine to L-pipecolic acid directly in E. coli cells, an overexpression strain was constructed by transforming a multi-copy recombinant expression vector harboring pipA gene (as mentioned in the “Materials and methods” Section) into E. coli BL21(DE3). The overexpression of pipA was analyzed by SDS-PAGE. As shown in Fig. 1, large amounts of protein were observed in the induced cells, when compared with that noted in the uninduced cells.
Owing to the permeability barriers imposed by cell envelopes, the reactions catalyzed by whole-cell biocatalysts have been reported to be slower than those catalyzed by free enzymes [23]. Nevertheless, the barrier permeability could be altered with the addition of surfactants, thus improving the mobility of intra/extracellular substrates and products. As shown in Table 1, with the addition of five different types of 1 mM surfactants, the L-pipecolic acid concentrations and yields were enhanced, indicating a significant improvement in the mass transfer of L-lysine and L-pipecolic acid through the cell envelopes. The highest L-pipecolic acid concentration of 12.51 g/L was obtained with the addition of Triton X-100, which was 28.7% higher than that achieved in the control.
3.2. Effect of pH and temperature on the whole-cell biocatalyst Appropriate pH and temperature, which could accelerate the reaction, are significant to biosynthesis [21]. Firstly, the
H. Ying et al. / Journal of Molecular Catalysis B: Enzymatic 117 (2015) 75–80
77
Table 1 Effect of surfactant on the whole-cell biocatalyst.a Surfactant
L-pipecolic acid concentration (g/L)
Control Sorbitol Brij S20 EDTA CTAB Trition X-100
9.72 11.37 11.84 12.24 11.04 12.51
a
± ± ± ± ± ±
0.15 0.3 0.72 0.13 0.53 0.31
L-pipecolic acid yield (g/g) 0.39 0.46 0.47 0.49 0.44 0.50
± ± ± ± ± ±
0.01 0.01 0.03 0.01 0.02 0.01
L-pipecolic acid productivity (g/L h) 0.14 0.16 0.16 0.17 0.15 0.18
± ± ± ± ± ±
0.00 0.00 0.01 0.01 0.01 0.00
Yield increased campared with control (%) 0 16.98 21.81 25.93 13.58 28.70
± ± ± ± ± ±
0 0.60 2.28 0.08 1.52 0.64
Each value is an average of three parallel replicates and is represented as mean standard deviation.
12
1.0
10
0.8
8 0.6 6 0.4 4 0.2
2
0
L-pipecolic acid yield (g/g)
L-pipecolic acid concentration (g/L)
L-pipecolic acid concentration (g/L) L-pipecolic acid yield (g/g)
0.0 +
Without NAD supplement
+
With 0.5% NAD supplement
Fig. 3. The effect of NAD+ supplement on the whole-cell biocatalyst. With or without NAD+ supplement was investigated by a standard whole-cell biocatalyst properties assay. (The yield of L-pipecolic acid was defined as the amount of L-pipecolic acid obtained from 1 g of L-lysine as the substrate and expressed in g/g).
3.5. Effect of iron concentration on the whole-cell biocatalyst
Fig. 2. (a) The effect of pH on whole-cell biocatalyst. Various pHs of 5.0, 5.5, 6.0, 6.5, 7.0, 8.0, 8.5 were investigated by a standard whole-cell biocatalyst properties assay. (The yield of L-pipecolic acid was defined as the amount of L-pipecolic acid obtained from 1 g of L-lysine as the substrate and expressed in g/g). (b) The effect of temperature on whole-cell biocatalyst. Various temperature of 30 ◦ C, 37 ◦ C, 40 ◦ C, 45 ◦ C, 50 ◦ C, 55 ◦ C were investigated by a standard whole-cell biocatalyst properties assay. (The yield of L-pipecolic acid was defined as the amount of Lpipecolic acid obtained from 1 g of L-lysine as the substrate and expressed in g/g).
3.4. Effect of NAD+ supplementation on the whole-cell biocatalyst With regard to LCD, Gatto et al. indicated that LCD was incompletely loaded with NAD+ when overproduced in E. coli [12]. In the presence of exogenous NAD+ , the initial rate was elevated by 8 fold. Therefore, in the present study, the effect of NAD+ supplementation on the whole-cell biocatalyst was investigated, and the results of bioconversion with and without exogenous NAD+ were represented in Fig. 3. With the addition of 0.5% NAD+ , after 72 h reaction, the L-pipecolic acid concentration was increased by 17.0%, reaching 11.37 g/L, which indicated that exogenous NAD+ could also stimulate the activity of LCD within the cell.
Various cations, particularly metal ions, could affect the activity of enzymes [16]. Tsotrou et al. studied the effect of different cations on the activity of purified LCD [16], and suggested that iron(II) appeared to have the most significant stimulating and stabilizing effect on LCD, enhancing the enzyme activity by 13 fold. However, excess metal ion concentration might inhibit the enzyme activity or cells as well [24]. Therefore, in the present study, we investigated the effect of iron(II) sulfate concentration on the whole-cell bioconversion process. As shown in Table 2, the L-pipecolic acid concentration increased with the increasing iron(II) sulfate concentration between 0 and 0.5 g/L, but an inhibition was observed at an iron(II) sulfate concentration of more than 0.5 g/L. The yield decreased by 23.6% with the addition of 1.0 g/L iron(II) sulfate, when compared with that observed with the addition of 0.5 g/L iron(II) sulfate, which might be owing to the inhibition caused by the presence of excessive iron(II). Furthermore, as shown in Fig. 4, addition of iron(II) sulfate accelerated the consumption of L-lysine. The reaction conducted without the addition of iron(II) sulfate took more than 72 h to reach thermodynamic equilibrium, a duration which was almost one-third longer than that observed with the supplementation of 0.5 g/L iron(II) sulfate, indicating a 61.5% increase in L-pipecolic acid productivity, when compared with the control. In conclusion, the highest L-pipecolic acid concentration, yield, and productivity of 15.19 g/L, 0.61 g/g, and 0.21 g/(L h), respectively, were obtained with the addition of 0.5 g/L iron(II) sulfate. 3.6. Effect of substrate and product concentration on the whole-cell biocatalyst Many enzymes, especially some cyclodeaminases, have been reported to be subjected to substrate or product inhibition [25–27].
78
H. Ying et al. / Journal of Molecular Catalysis B: Enzymatic 117 (2015) 75–80
Table 2 Effect of iron concentration on the whole-cell biocatalyst.a Iron (II) sulphate concentration (g/L)
L-pipecolic acid concentration (g/L)
Control 0.10 0.15 0.20 0.25 0.50; 1.00
9.72 9.74 10.45 11.17 14.27 15.19
a
± ± ± ± ± ±
L-pipecolic acid yield (g/g)
0.15 0.44 0.31 0.52 0.28 0.30; 11.60 ± 0.87
0.39 0.39 0.42 0.45 0.57 0.61
± ± ± ± ± ±
L-pipecolic acid productivity (g/L h)
0.01 0.03 0.01 0.02 0.01 0.01; 0.46 ± 0.03
0.13 0.14 0.15 0.16 0.20 0.21
± ± ± ± ± ±
0.00 0.01 0.00 0.01 0.00 0.00; 0.16 ± 0.00
Each value is an average of three parallel replicates and is represented as mean standard deviation.
a)
0.5 L-pipecolic acid yield (g/g)
0.4 8 0.3 6 0.2
4
0.1
2
0.0
0 5 g/L
12.5 g/L
L-pipecolic acid concentration (g/L)
50 g/L
75 g/L 0.5
L-pipecolic acid concentration (g/L)
10
L-pipecolic acid yield (g/g)
0.4 8 0.3 6 0.2
4
0.1
2
L-pipecolic acid yield (g/g)
As the extremely low substrate and product concentrations investigated in purified LCD property assays might not provide strong evidence for potential inhibition, Therefore, in the present study, the effects of substrate and product concentration on the wholecell biocatalyst were investigated. As shown in Fig. 5a, the activity of the whole-cell biocatalyst dropped sharply at an L-lysine concentration higher than 25 g/L. On the other hand, as shown in Fig. 5b, with the exogenous addition of 10 g/L product, the L-pipecolic acid concentration was 2.11 g/L, which was only 21.7% of that obtained without the addition of exogenous product (0 g/L), suggesting that product removal was necessary for the production of L-pipecolic acid using whole-cell biocatalyst. To confirm the performance of whole-cell biocatalyst, an assay was conducted under the optimum reaction conditions, supplemented with 0.5 g/L iron(II) sulfate (the effect of iron(II) sulfate on the whole-cell biocatalyst were described in details in supplementary material), 0.5% NAD+ , 1 mM Triton X-100 and the L-lysine concentration in the reaction system were 25 g/L with a total reaction system volume of 25 mL. The OD600 of the reaction system were controlled at 200 and the initial pH was adjusted to 7.5 and the tube was incubated in a 37 ◦ C shaker for 72 h (the effect of pH and temperature on the whole-cell biocatalyst were described in details in supplementary material). The control was prepared under a standard whole-cell biocatalyst properties assay and was incubated in the same shaker for 72 h. The highest L-pipecolic acid concentration and yield obtained were 16.71 g/L and 0.67 g/g under the optimal reaction conditions (data not shown), respectively, exhibiting a 71.9% increase, when compared with that obtained in the
25 g/L
L-lysine concentration (g/L)
b) Fig. 4. The effect of iron concentration on L-lysine consumption. Various concentration of 0.1 g/L, 0.15 g/L, 0.20 g/L, 0.25 g/L, 0.50 g/L, 1.00 g/L were investigated (, without supplement of iron(II) sulphate; 䊉, iron(II) sulphate concentration of 0.10 g/L; , iron(II) sulphate concentration of 0.15 g/L; , iron(II) sulphate concentration of 0.20 g/L; , iron(II) sulphate concentration of 0.25 g/L; , iron(II) sulphate concentration of 0.50 g/L; , iron(II) sulphate concentration of 1.00 g/L).
L-pipecolic acid yield (g/g)
L-pipecolic acid concentration (g/L)
L-pipecolic acid concentration (g/L)
10
0.0
0 0
2
4
6
8
10
Concentration effect of the product added exogenously (g/L) Fig. 5. (a) The effect of substrate concentration on the whole-cell biocatalyst. Various of L-lysine concentration of 5 g/L, 12.5 g/L, 25 g/L, 50 g/L, 75 g/L were investigated by a standard whole-cell biocatalyst properties assay. (The yield of L-pipecolic acid was defined as the amount of L-pipecolic acid obtained from 1 g of L-lysine as the substrate and expressed in g/g).(b) Effect of exogenous added product concentration on the whole-cell biocatalyst. Various exogenous L-pipecolic acid concentrations of 0 g/L, 2 g/L, 4 g/L, 6 g/L, 8 g/L, 10 g/L were investigated. (The yield of L-pipecolic acid was defined as the amount of L-pipecolic acid obtained from 1 g of L-lysine as the substrate and expressed in g/g).
control. Meanwhile, the reaction procedure was shortened by 24 h under the optimum reaction conditions, suggesting that optimization of the reaction conditions sharply improved the performance of the process. 3.7. Cell recycling processes Although a significant enhancement in the reaction performance could be achieved by optimizing the reaction conditions, conditions such as substrate inhibition, product inhibition, complicated cell cultivation procedure, and poor utilization of cells limit the further application of whole-cell biocatalysts in L-pipecolic
H. Ying et al. / Journal of Molecular Catalysis B: Enzymatic 117 (2015) 75–80
79
Table 3 L-pipecolic acid concentration, yield and productivity for each process.a , b
Without cell recycle Cell recycle without NAD+ Cell recycle with NAD+ a b
L-pipecolic acid production (g)
L-pipecolic acid yield (g/g)
L-pipecolic acid productivity (g/L h)
9.61 ± 0.40 17.22 ± 0.94 25.88 ± 0.52
0.26 ± 0.04 0.44 ± 0.04 0.69 ± 0.04
0.13 ± 0.00 0.23 ± 0.01 0.36 ± 0.01
Each value is an average of three parallel replicates and is represented as mean standard deviation. The L-pipecolic acid production, L-pipecolic acid yield and L-pipecolic acid productivity were the average of three cycles.
20
The first cycle
The second cycle
The third cycle 2.8 2.4
14 2.0
12
1.6
10 8
1.2
6 4
0.8
2
0.4
0
L-pipecolic acid productivity (g/L*h)
16
L-pipecolic acid yield (g/g)
L-pipecolic acid concentration (g/L)
18
0.0
-2 0
20
40
60
80
100
120
140
Time (h) Fig. 6. L-pipecolic acid concentration, yield and productivity of the repeated cell recycling processes with or without NAD+ supplement (, L-pipecolic acid concentration without NAD+ supplement; 䊉, L-pipecolic acid concentration with 0.5% NAD+ supplement; ♦, L-pipecolic acid productivity without NAD+ supplement; , L-pipecolic acid productivity with 0.5% NAD+ supplement; , L-pipecolic acid yield without NAD+ supplement; , L-pipecolic acid yield with 0.5% NAD+ supplement). (The yield of L-pipecolic acid was defined as the amount of L-pipecolic acid obtained from 1 g of L-lysine as the substrate and expressed in g/g).
acid production. To overcome these shortcomings, repeated cell recycling is usually employed to eliminate the inhibition, ensure continuous bioconversion, and maximize biocatalytic productivity [28]. In the present study, three different processes were investigated. The first process was not using cell recycling. 25 g/L L-lysine was added to the medium at 0 h, 48 h and 96 h. (Table 3). The yield achieved at 144 h was only 0.26 g/g, suggesting that the accumulation of L-pipecolic acid prevented L-lysine conversion. Moreover, the accumulation of excessive unreacted substrate also affected the activity of the whole-cell biocatalyst as mentioned earlier. Consequently, a productivity of 0.13 g/(L h) were obtained, demonstrating that product removal should be employed in the reaction procedure. The second and third reactions were using cell recycling. As shown in Fig. 6, 25 g/L L-lysine was added to the medium and the products were removed while the cells were recycled by centrifugation every 48 h for three times. In both the processes, substrate and product inhibitions were eliminated owing to product removal. Furthermore, a 1.8–2.7 fold increase in the productivity was observed, when compared with that achieved without repeated cell recycling. However, without NAD+ supplementation, the LCD might not completely loaded with NAD+ [12]. Also the strong centrifugation used in the cell recycling procedure might loose the binding between enzyme and NAD+ , which led to the inactive of the biocatalyst. Comparison of the first and last batches with the addition of NAD+ revealed that the L-pipecolic acid concentration decreased only by 0.56 g/L, whereas the concentration dropped by 5.8 g/L without NAD+ supplementation. In conclusion, product removal procedure combined with the supplementation of
NAD+ resulted in the highest average L-pipecolic acid concentration and yield of 17.25 g/L and 0.69 g/g, respectively. To compare with the other L-pipecolic acid production approach [29], Muramatsu, H. produced L-pipecolic acid using a three enzyme system (lysine oxidase, piperidine-2-carboxylate reductase and glucose dehydrogenase), although a relatively higher yield was achieved, the cost of lysine oxidase and two cofactors (NADP+ and FAD) might limited its application. However, our biosynthesis method used recombinant E. coli containing single enzyme LCD as whole-cell biocatalyst, it might be more competitive owing to the lower cost and simplified process. 4. Conclusion The present study demonstrated that recombinant E. coli containing pipA could be used as the whole-cell biocatalyst for the production of L-pipecolic acid. During repeated L-lysine bioconversion in a bioreactor with the addition of NAD+ , an average L-pipecolic acid concentration and yield of 17.25 g/L and 0.69 g/g were achieved in each cycle, respectively. Therefore, we believe that whole-cell biocatalyst could be used as an alternative to purified enzymes for L-pipecolic acid production because of the comparable catalytic efficiency, preferable stability, and less cost. Acknowledgements This work was supported by the National Nature Science Foundation of China (grant no. 21390200, 21106068), National Key Technology Support Program (grant no. 2012BAI44G00), “973” program of China (grant no. 2011CBA00807), and “863” program of China (grant no. 2014AA021703). References [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18] [19] [20] [21]
M.K. Ghora, S. Halder, R.K. Das, J. Org. Chem. 75 (2010) 7061–7072. D.C.N. Swindells, P.S. White, J.A. Findlay, Can. J. Chem. 56 (1978) 2491–2492. I. Pastuszak, R.J. Molyneux, L.F. Jame, Biochemistry 29 (1990) 1886–1891. N. Shankaraiah, R.A. Pilli, L.S. Santos, Tetrahedron Lett. 49 (2008) 5098–5100. A.A. Cant, A. Sutherland, Synthesis 44 (2012) 1935–1950. T. Wilkinson, N.W. Stehle, P. Beak, Org. Lett. 2 (2000) 155–158. E. Eichhorn, J.P. Roduit, A. Kiener, Tetrahedron Asymmet. 8 (1997) 2533–2536. D.L. Miller, V.W. Rodwell, J. Biol. Chem. 246 (1971) 2758–2764. T. Fujii, M. Mukaihara, H. Tsunekawa, Biosci. Biotechnol. Biochem. 66 (2002) 622–627. T. Fujii, H. Agematu, H. Tsunekawa, Biosci. Biotechnol. Biochem. 66 (2002) 1981–1984. I. Molnar, J.F. Aparicio, P.F. Leadlay, Gene 169 (1996) 1–7. J. Gregory, J. Gatto, T.W. Christopher, J. Am. Chem. Soc. 128 (2006) 3838–3847. H.P. Broquist, Annu. Rev. Nutr. 11 (1991) 435–448. R.N. Gupta, I.D. Spenser, J. Biol. Chem. 244 (1969) 88–94. M. He, J. Ind. Microbiol. Biotechnol. 33 (2006) 401–407. G.E. Tsotsou, F. Barbirato, Biochimie 89 (2007) 591–604. X.F. Li, Z. Zhu, H. Wu, Appl. Microbiol. Biotechnol. 93 (2012) 143–150. J.D. Carballeira, M.A. Quezada, J.V. Sinisterra, Biotechnol. Adv. 27 (2009) 686–714. S. Orkin, Molecular Cloning A Laboratory Manual, second ed., Cold Spring Harbor Laboratory Press, 1989. H.X. Ying, K.Q. Chen, P.K. Ouyang, Appl. Biochem. Biotechnol. 172 (2014) 3835–3843. A. Siriphongphaew, P. Pisnupong, J. Wongkongkatep, Appl. Microbiol. Biotechnol. 95 (2012) 357–367.
80 [22] [23] [24] [25]
H. Ying et al. / Journal of Molecular Catalysis B: Enzymatic 117 (2015) 75–80 W.S. Liu, B. Jia, Y.J. Yan, J. Agric. Food Chem. 58 (2010) 10426–10430. Y. Ni, R.R. Chen, Biotechnol. Bioeng. 87 (2004) 804–811. X.H. Wang, Y. Zhao, H. Yin, Int. J. Biol. Macromol. 70 (2014) 455–462. M. Trovato, B. Maras, P. Costantino, Proc. Natl. Acad. Sci. 98 (2001) 13449–13453.
[26] [27] [28] [29]
N. Sans, U. Schindler, J. Schröder, Eur. J. Biochem. 173 (1988) 123–130. R.N. Costilow, L. Laycock, J. Biol. Chem. 246 (1971) 6655–6660. J.F. Ma, K.Q. Chen, M. Jiang, Biotechnol. Lett. 32 (2010) 1413–1418. H. Muramatsu, H. Mihara, N. Esaki, Biosci. Biotech. Biochem. 70 (2006) 2296–2298.