Enhanced cyclooxygenase-2 expression in olfactory-limbic forebrain following kainate-induced seizures

Neuroscience 140 (2006) 1051–1065

ENHANCED CYCLOOXYGENASE-2 EXPRESSION IN OLFACTORY-LIMBIC FOREBRAIN FOLLOWING KAINATE-INDUCED SEIZURES S. A. JOSEPH,a* E. LYND-BALTA,a M. K. O’BANION,b P. M. RAPPOLD,a J. DASCHNER,b A. ALLENb AND J. PADOWSKIa

produce profound consequences including gliosis and neuronal death (Babb and Brown, 1987; Kim et al., 1990), as well as synaptic reorganization and subsequent circuitry changes (de Lanerolle et al., 1989; Sutula et al., 1989; Houser et al., 1990; Babb et al., 1991; Lynd-Balta et al., 1996; Joseph and Lynd-Balta, 2001; Lado et al., 2002). Numerous studies have been performed in tissue procured at surgery from patients with complex partial seizures, nevertheless the phenomenon of intractable recurrent seizures is poorly understood. Thus the kainate model has been used to examine mechanisms of epileptogenesis and synaptic reorganization associated with limbic seizures since this model closely replicates temporal lobe epilepsy in the human (Ben-Ari et al., 1980; Nadler, 1981; Ben-Ari, 1985; Sperk, 1994; Siddiqui and Joseph, 2005). Kainic acid, a glutamate analog, binds to glutamate receptors causing unrelenting neurotransmission that is disseminated to widespread limbic structures with subsequent molecular, cellular, and circuitry changes ensuing (Ben-Ari and Cossart, 2000; Ben-Ari, 2001). Kainate instigates a prolonged depolarization and the subsequent neurotoxicity is dependent on an intact glutamatergic circuitry (Biziere and Coyle, 1978; McGeer et al., 1978; Schwob et al., 1980). Putative contributing factors leading to this cell death include excitotoxicity and inflammation in selectively vulnerable areas rich in glutamatergic neurotransmission. Excitotoxicity as defined by Olney et al. (1974) refers to the destruction of neurons by excessive transmission of glutamate (and other excitatory amino acids) and has been linked to several neurological disorders including seizures, hypoxia, ischemia, as well as different degenerative diseases of the nervous system (Coyle and Puttfarcken, 1993). Furthermore, excitotoxic injury is believed to provoke pro-inflammatory mediators, including prostaglandins and cytokines (Pepicelli et al., 2005; Vezzani, 2005). Whether or not these contribute to the pathogenesis of seizures is unknown at this time. Prostaglandins have been documented in diverse processes throughout the body, with their effects varying by tissue location and the types of receptors present. Prostaglandins and their G-protein-coupled receptors have been associated with neuroinflammation and neurotoxicity in ischemic brain regions (Ahmad et al., 2006). Two forms of cyclooxygenase (COX) exist, COX-1 and COX-2, which catalyze the rate-limiting step in the synthesis of prostaglandins from arachidonic acid. In brain, COX-1 is expressed constitutively mainly in microglia (Yermakova et al., 1999), whereas COX-2, considered to be the inducible

a Department of Neurosurgery, University of Rochester Medical Center, Box 670, Rochester, NY 14642, USA b Department of Neurobiology and Anatomy, University of Rochester School of Medicine and Dentistry, 601 Elmwood Avenue, Box 670, Rochester, NY 14642, USA

Abstract—Cyclooxygenase-2 is expressed at low levels in a subset of neurons in CNS and is rapidly induced by a multiplicity of factors including seizure activity. A putative relationship exists between cyclooxygenase-2 induction and glutamatergic neurotransmission. Cyclooxygenase-1 is constitutively expressed in glial cells and has been specifically linked to microglia. In this study we evaluated cyclooxygenase-2 protein immunocytochemically and found markedly enhanced immunostaining primarily in olfactory-limbic regions at 2, 6 and 24 h following kainate-induced status epilepticus. Impressive enhanced cyclooxygenase-2 immunoreactivity was localized in anterior olfactory nucleus, tenia tecta, nucleus of the lateral olfactory tract, piriform cortex, lateral and basolateral amygdala, orbital frontal cortex, nucleus accumbens (shell) and associated areas of ventral striatum, entorhinal cortex, dentate gyrus granule cells and hilar neurons, hippocampal CA subfields and subiculum. Alternate sections were processed for dual immunocytochemical analysis utilizing c-Fos and cyclooxygenase-2 antiserum to examine the possibility that the neuronal induction of cyclooxygenase-2 was associated with seizure activity. Neurons that showed a timeline of cyclooxygenase-2 upregulation were found to possess c-Fos immunopositive nuclei. Additional results from all seizure groups showed cyclooxygenase-1 induction in microglia, which was confirmed by Western blot analysis of hippocampus. Western blot and real-time quantitative RTPCR analysis showed significant upregulation of cyclooxygenase-2 expression, confirming its induction in neurons. These data indicate that cyclooxygenase-2 induction in a neuronal network can be a useful marker for pathways associated with seizure activity. © 2006 IBRO. Published by Elsevier Ltd. All rights reserved. Key words: excitotoxicity, olfactory brain, hippocampus, piriform cortex, temporal lobe epilepsy, immunohistochemistry.

Seizures are transitory, abnormal, synchronous electrical discharges of groups of cortical neurons. Recurrent seizures associated with temporal lobe epilepsy in the human *Corresponding author. Tel: ⫹1-585-275-2579; fax: ⫹1-585-273-2960. E-mail address: [email protected] (S. A. Joseph). Abbreviations: COX, cyclooxygenase; DAB, 3=3=-diaminobenzidine; IR, immunoreactivity; NGS, normal goat serum; PBS, phosphate-buffered saline; PSI, post-seizure induction.

0306-4522/06$30.00⫹0.00 © 2006 IBRO. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.neuroscience.2006.02.075

1051

1052

S. A. Joseph et al. / Neuroscience 140 (2006) 1051–1065

isoform, is found at low levels in a subset of neurons that are associated with glutamatergic neurotransmission (Kaufmann et al., 1996). COX-2 is an immediate early gene, and its expression is up-regulated by a multiplicity of factors, including signals resulting from tissue injury (Pritchard et al., 1994; O’Banion, 1999). One of the most intensely studied aspects of COX-2 is its role in inflammation and secondary brain injury (Hurley et al., 2002). It has previously been shown that neuronal COX-2 expression is affected by synaptic activation (Yamagata et al., 1993; Kaufmann et al., 1996). Thus we used COX-2 immunoexpression in our kainate model of status epilepticus as a marker for glutamatergic activation in the epileptic brain. Other investigators have shown changes in COX-2 expression in rat kainate seizure models in selected brain regions (Chen et al., 1995; Marcheselli and Bazan, 1996). In these investigations, we have extended the studies to demonstrate COX immunoreactivity (IR) along limbic pathways not previously investigated. COX-1 IR was largely confined to microglia. COX-2 was profoundly induced by seizures. COX-2 immunostaining in the kainate rat delineated an exquisite functional network from the olfactory-limbic forebrain to the hippocampus which we hypothesize is an important circuit during limbic seizures and provides the neural substrate influencing the spread of excitation to areas distant from the seizure focus.

EXPERIMENTAL PROCEDURES Animal model Twenty-five adult male Sprague–Dawley rats, 250 –325 g (Charles River, Wilmington, MA, USA), were lightly sedated with diethyl ether and injected s.c. with 5 ml of 5% dextrose in phosphate-buffered saline (PBS), followed by i.p. injection of 18 mg/kg kainic acid (Sigma Aldrich, St. Louis, MO, USA), dissolved at 5 mg/ml in PBS. The majority of the kainate-treated animals (16 of 25) began continuous stage V tonic– clonic seizures, according to the behavioral scale of Racine, within 70 – 80 min, while the rest of the animals began seizing shortly thereafter (within 10 –15 min). This attests to the accuracy of the injections. All animals eventually attained stage V seizure activity with an 8% (two of 25) total mortality rate. Animals were killed at 2, 6, or 24 h after start of stage V seizure, with most seizures ending within 4 –5 h. Control animals (n⫽12) were subdivided into two groups. Group 1 (n⫽8) rats were lightly sedated with diethyl ether and injected with dextrose and saline. Group 2 (n⫽4) rats were not sedated with ether prior to dextrose and saline injections. This latter group was used to eliminate any effects of ether on immunostaining patterns. Control animals were also killed at 2, 6, and 24 h post-saline injection. All animals were given a lethal dose of sodium pentobarbital, and then perfused transcardially with 0.9% saline. All experiments were conducted under a protocol approved by the University Committee for Animal Resources and conformed to NIH guidelines (NIH publication No. 85–23, revised, 1996). Brains were divided in half midsagittally, and the left halves were placed in cold 4% paraformaldehyde in PBS, pH 7.2 for 48 h followed by 20% sucrose in PBS. Right halves were quickly dissected, and the hippocampus was divided and frozen for RNA and protein analysis. Left halves were sectioned coronally at 45 ␮m on a freezing sliding microtome, into 12 wells of cryoprotectant solution (30% sucrose, 30% ethylene glycol in 0.05 M PBS) until use.

RNA and protein quantification Quantification of mRNA levels was completed using an iCycler (Bio-Rad Laboratories, Hercules, CA, USA) and real time RT-PCR with Taqman probes incorporating FAM as the fluorescent marker (Molecular Probes, Invitrogen, Carlsbad, CA, USA). Prior to PCR of the cDNA samples, PCR conditions were optimized for each mRNA to be analyzed. Standard curve reactions were performed by varying annealing temperatures, Mg2⫹ concentrations, primer concentrations, and Taqman probe concentration. Serial dilution of the starting cDNA template demonstrated linear amplification over at least five orders of magnitude. PCR reactions were performed in a volume of 25 ␮l and contain iQ super mix (BioRad Laboratories; 3 mM Mg2⫹, 0.8 mM dNTP, 0.625U Taq), 0.2– 0.6 ␮M concentrations of each primer, 10 –250 nM probe, and 1 ␮l of cDNA sample. To ensure consistency, a master mix was first prepared containing all reagents except the cDNA sample. Primers were designed using the Primer Express (Applied Biosystems, Foster City, CA, USA) and Oligo 6.89 programs (Molecular Biology Insights, Inc., Cascade, CO, USA). The upper, lower and probe primers used were: rat COX-1, 5= TCCTGTTCCGAGCCCAGTT 3=, 5= CTTGGAAGGAATCAGGCATGA 3=, and 5= CAGTATCGCAACCGCATCGCCAT 3=; rat COX-2, 5= CCCCAAGGCACAAATATGATG 3=, 5= CCTCGCTTCTGATCTGTCTTGA 3=, and 5= TTCTTTGCCCAGCACTTCACTCATCAGTT 3=; and 18s rRNA, 5= CGACCATAAACGATGCCGACT 3=, 5= GTGGTGCCCTTCCGTCAA 3=, and 5= CGGCGGCGTTATTCCCATGACC 3=. PCR reactions were carried out by denaturation at 95 °C for 3 min, followed by 40 cycles of amplification by denaturing at 95 °C for 30 s, annealing at 60 °C for 30 s and extension at 72 °C for 60 s. For each real time PCR, a standard curve was performed to insure direct linear correlation between product yield (expressed as the number of cycles to reach threshold) and the amount of starting template. The correlation was always greater than r⫽0.925. PCR reaction efficiency (e) was determined for each reaction. To correct for variations in starting RNA values, levels of 18 s rRNA were determined for all samples and used to normalize all subsequent RNA determinations. Normalized threshold cycle (Tc) values were then transformed, using the function: expression⫽(1⫹e)Tc, in order to determine the relative differences in transcript expression. For Western blot analysis, frozen tissue samples were homogenized in lysis buffer (62.5 mM Tris–HCl; 2% SDS; 10% glycerol). Protein concentration of each sample was determined in triplicate by bicinchoninic acid assay (Pierce Biotechnology, Rockford, IL, USA) and equal amounts (15 ␮g) were loaded on 10% polyacrylamide Tris–HCl gels (BioRad). Following SDS-PAGE electrophoresis and transfer to nitrocellulose membranes, blots were blocked (Roche Diagnostics Corporation, Indianapolis, IN, USA) and incubated with primary antibody overnight (monoclonal COX-1, 1:1000, and polyclonal affinity-purified COX-2, 1:500, both from Cayman Chemical, Ann Arbor, MI, USA). Blots were then treated with peroxidase-linked secondary antibody (1:5000; Amersham Biosciences, Piscataway, NJ, USA) and signals were visualized by enhanced chemiluminescence (ECL; Amersham) and exposure to film (X-OMAT; Kodak, Rochester, NY, USA). Integrated optical densities were measured using computerized imaging software (NIH Image). Densities were normalized to control values and to protein loading established by stripping the initial signals and immunoblotting using an antibody to glyceraldehye3-phosphate dehydrogenase (monoclonal G3PDH, 1:5000; Ambion, Austin, TX, USA).

Immunocytochemistry and histochemistry Free-floating tissue sections were immunostained for COX-1 and COX-2 using rabbit polyclonal antibodies, at dilutions of 1:4000 and 1:8000, respectively (Cayman Chemical). Sections were also immunostained with a neuron-specific marker, NeuN, using a mouse monoclonal antibody at a dilution of 1:10,000 (Chemicon,

S. A. Joseph et al. / Neuroscience 140 (2006) 1051–1065

1053

18

A Relative Induction

16 14 12

Control 2h 6h 24 h

*

10 8 6 4 2 0

COX-1

COX-2

B

6

C Relative Induction

5 4

Control 2h 6h 24 h

*

3

*

2

* *

1 0

COX-1

COX-2

Fig. 1. COX mRNA and protein expression following kainic acid induced seizures. Total RNA and protein were extracted from hippocampi at various times after seizure induction. Control samples were processed in parallel from animals subjected to all steps except that saline was injected instead of kainic acid, 6 h before kill. (A) Quantitative real-time RT-PCR measurement of mRNA levels for COX-1 and COX-2. Induction was set to a control value of 1 and each mRNA species was normalized to 18 s rRNA levels in the samples. N⫽4 (control), 5 (2 h), 4 (6 h), and 8 (24 h) samples for each time point, mean induction⫾S.E.M. is shown; * P⬍0.05 relative to control values. (B) Representative Western blot data. Glyceraldehyde-3-phosphodehydrogenase (G3PDH) was used as a normalizing control. (C) Quantification of Western blot signals by densitometry with control values set to 1. N⫽4 (control), 6 (2 h), 5 (6 h), 8 (24 h) samples for each data point; mean induction⫾S.E.M. is shown; * P⬍0.05 relative to control values.

Temecula, CA, USA). The microglia-specific marker, rabbit polyclonal Iba-1, was used at a dilution of 1:6000 (Wako, Richmond, VA, USA). Our c-Fos antibody was used at a dilution of 1:20,000 (Calbiochem, San Diego, CA, USA). Sections were first rinsed in

PBS followed by 3% H2O2, then incubated in a solution of 4% normal goat serum (NGS), 0.1% sodium azide, and 0.04% Triton-X in PBS for 30 min. Sections were then transferred into the appropriate primary antibody with 0.4% Triton-X, 1% bovine se-

1054

S. A. Joseph et al. / Neuroscience 140 (2006) 1051–1065

Fig. 2. Photomicrograph illustrating COX-1 immunostaining in the hippocampus of the rat brain following kainate seizures. COX-1 IR is evident in microglia of a control brain (A). At the 24 h PSI time point (B), microglial COX-1 immunostaining demonstrates glial elements in an apparent enlarged and engorged state. Similar staining profiles of microglia are depicted in control (C) and 24 h PSI (D) using Iba-1, a microglia-specific marker, thus confirming the apparent reactivity of the resident glia to a seizure environment. Note the prominent bulky processes and enlarged microglia (arrows) consistent with a reactive state following kainate-induced seizures. Scale bar⫽50 ␮m.

rum albumin, and 4% NGS then refrigerated at 4 °C for 5 days with constant agitation. Following incubation, sections were reacted using biotinylated anti-rabbit or anti-mouse antibodies at a 1:6000 dilution using rabbit or mouse Vectastain Elite ABC kits (Vector Laboratories, Burlingame, CA, USA). Nickel-enhanced 3=3=-diaminobenzidine (DAB) (Sigma Aldrich) was used for the chromogen (0.5% nickelous ammonium sulfate, 0.02% DAB, 0.00132% H2O2, in acetate–imidazole buffer). Dual ICC was performed as previously described (Joseph and Piekut, 1986). Every eighth section was stained with Cresyl Violet to define nuclear boundaries and sub-divisions and to examine patterns of cell loss.

Analysis of sections All sections were analyzed via light microscopy on an Olympus BH-2 microscope in conjunction with a Sony 9000 Color video camera and CG-7 RGB PCI Frame Grabber and Image Pro Plus software. A semiquantitative method of densiometric analysis was adopted from Pikkarainen and Pitkänen (2001). Two independent investigators in a double-blind study performed these analyses for each nuclear group. The density of staining was rated on a scale that included the following categories: ‘none,’ ‘sparse,’ ‘light,’ ‘moderate,’ and ‘dark.’

Statistical methods RNA and protein quantification data were compared by ANOVA and Tukey’s post hoc tests, and by linear regression to determine correlations using the JMP statistics program (SAS Institute, Cary, NC, USA). A probability of P⬍0.05 was considered statistically significant.

RESULTS COX expression in control versus post-seizure induction (PSI) hippocampus Total RNA and protein were extracted from hippocampi 2, 6, and 24 h PSI and subjected to real-time quantitative RT-PCR and Western blot analysis for levels of COX expression. COX-1 mRNA showed no significant changes from basal levels at any time point examined. In contrast, COX-2 mRNA was induced about 12-fold above control, unseized hippocampal levels at 2 h PSI, but was not significantly elevated at the 6 and 24 h time points (Fig. 1A). This dramatic increase in COX-2 levels seen early following seizure induction was accompanied by increased protein levels at all time points (Fig. 1B, C). Interestingly, we also detected a significant change in COX-1 protein levels 24 h PSI (Fig. 1B, C). COX-1 IR in control brains versus PSI brains COX-1 staining was observed in small glial cells throughout all brain regions and encompassing both white and gray matter areas. These cells resembled microglia morphologically, with small cell bodies and short processes (Fig. 2A). These results are consistent with previous find-

S. A. Joseph et al. / Neuroscience 140 (2006) 1051–1065 Table 1. Distribution of COX-2 immunohistochemistry Brain region

Control

2h

6h

24 h

Anterior olfactory Nu Orbital cortex Tenia tecta Olfactory tubercle Nu accumbens Piriform cortex

●● ●● ●● 䡩 ●●

●● ● ●●● ● ●● ●●●

●● ● ●●● ●● ●● ●●●

●●● ●●● ●●● ●●● ●● ●●●

䡩 ● ● ●● 䡩

䡩 ● ●● ●● 䡩

䡩 ● ●● ●● 䡩

● ●●● ●●● ●●● ●

●

●●

●●

●●●

●

●●

●●

●●●

䡩 ●● ● ●● ●● ●

●● ●● ● ●●● ●●● ●●

●●● ●●● ●● ●●● ●●● ●●

●●● ●●● ●● ●●● ●●● ●●●

Amygdala Anterior amygdaloid area Nu lateral olfactory tract Basolateral amygdala Lateral amygdaloid nu Medial amygdaloid nu posteroventral Cortical amygdaloid nu posterolateral Basomedial amygdaloid nu Hippocampal formation CA1 CA3 Hilus Dentate gyrus Subiculum Entorhinal cortex

Density of neuronal staining: -⫽none; 䡩⫽sparse; ●⫽low; ●●⫽moderate; ●●●⫽high. Damage rostrally.

ings from several laboratories that microglia express COX-1 in vivo (Yermakova et al., 1999; Schwab et al., 2000; Hoozemans et al., 2001). Although the intensity of this staining did not change dramatically following seizure induction, morphological changes observed with seizures were consistent with microglial activation (Fig. 2A, B). This was particularly evident at 24 h PSI and is more clearly revealed by staining with Iba-1, which labels the finer, ramified processes of microglia in control and kainate brains (Fig. 2C, D). COX-2 IR in control brains versus PSI brains COX-2 immunostaining was examined in control rats and kainate rats that were killed at 2, 6, and 24 PSI. A comparison of staining intensities in different brain regions is provided in Table 1. Intense, dark staining was observed in both the juxtaglomerular cells and the granule cells of the olfactory bulb in the kainate rat (Fig. 3A). Of particular note here was the dramatic induction of COX-2 in the granule cells that were completely immunonegative in the control animals (data not shown). Neurons of the anterior olfactory nucleus and the orbital cortex were COX-2 immunopositive in control rats. A dramatic increase in COX-2 IR in the anterior olfactory nucleus (medial, dorsal, lateral, and ventral subdivisions) (Fig. 3B), the olfactory tubercle (Figs. 3C, 4B–D), and the tenia tecta (Figs. 3D, E) was clearly evident, particularly at 24 h PSI. In addition, there is enhanced COX-2 IR at each subsequent time point PSI in the orbital cortex, frontal association cortex, prelimbic cortex, agranu-

1055

lar insular cortex, infralimbic cortex, cingulate cortex, motor and sensory cortices (data not shown). A dense band of immunoreactive neurons was found in superficial cortical layers II and III, with an intervening zone of little or no IR, and positive COX-2 immunoreactive cells in layer V. The number of COX-2 positive neurons in these cortical areas increased up to 24 h PSI, as did the intensity of IR in individual cells. There were diffuse, scattered, lightly stained COX-2 immunoreactive neurons in the core and shell of the nucleus accumbens, caudate putamen, and ventral pallidum in the control rat (Fig. 4A). In the nucleus accumbens, COX-2 IR was markedly enhanced at 2, 6 and 24 h PSI (Fig. 4). Some COX-2 immunoreactive neurons were scattered in the core region, with many more COX-2 positive neurons filling the shell region. At 6 and 24 h PSI, a patchy distribution of COX-2 immunostaining was seen in the ventral striatum and adjacent middle portions of the caudate putamen. Cell bridges extending from the ventral striatum into the olfactory tubercle were COX-2 immunoreactive (Fig. 4, arrows). Sparse COX-2 IR was also noted in the medial and lateral septum and the nucleus of the vertical limb of the diagonal band. Moderate COX-2 staining was evident throughout the rostrocaudal extent of the piriform cortex in the control rat (Fig. 5A). COX-2 immunostaining in the piriform cortex increased at 2 and 6 h PSI (Fig. 5B, C), however the staining appeared diminished at 24 h PSI (Fig. 5D). Staining in the piriform cortex extended throughout the rostrocaudal extent and was localized to neurons of layers II and III. Examination of cellular profiles using Nissl stain revealed significant neuronal loss at 24 h PSI (Fig. 5F) compared with control (Fig. 5E), which would explain the diminution in immunostaining. In control rats there was variability in the intensity of staining in the hippocampal formation (Fig. 6A). Only sparse COX-2 IR was localized to pyramidal cells in CA1, whereas a moderate labeling was evident in CA3 and hilus (Fig. 6A). Some granule cells of the dentate gyrus were COX-2 immunoreactive with staining of their cell bodies in the granule cell layer as well as individual dendrites labeled in the molecular layers (Fig. 6E). There were distinct changes in COX-2 immunostaining in the hippocampal formation PSI (Fig. 6). Hilar neurons and the pyramidal cells of all CA fields were darkly stained with COX-2 IR. In CA3, COX-2 immunostaining extended beyond the pyramidal cell layer to include the superficial stratum oriens and the deeper layers, stratum lucidum and stratum radiatum (Fig. 6A–D, G, H). A distinct change in immunostaining of the dentate gyrus was also apparent (Fig. 6E, F). A dense band of COX-2 IR filled the granule cell layer with intense staining in the molecular layers as well. The intensity of staining increased at later time points, peaking at 24 h PSI, concomitant with increased COX-2 protein levels found in hippocampus by Western analysis. Lightly stained COX-2 immunoreactive neurons were also found in medial and lateral entorhinal cortex, with more moderate staining of the presubiculum, parasubiculum, subiculum and postsubiculum. Increased COX-2

1056

S. A. Joseph et al. / Neuroscience 140 (2006) 1051–1065

Fig. 3. Photomicrographs of COX-2 IR in olfactory brain regions of the rat demonstrating the anterior focus of the kainate-induced seizure substrate. Intense COX-2 immunostaining delineates these olfactory structures, the olfactory bulb (A), AOD (B), OT (C), TT (D, E) and IG (D), as kainate sensitive structures important in seizure propagation. Scale bar⫽500 (A, B), 100 (C), 250 (D), and 50 (E) ␮m. Abbreviations: AOD, anterior olfactory nucleus, dorsal; AOL, anterior olfactory nucleus, lateral; AOM, anterior olfactory nucleus, medial; AOV, anterior olfactory nucleus, ventral; EPL, external plexiform layer of olfactory bulb; GL, glomerular layer; GrO, granule cell layer of olfactory bulb; IG, indusium griseum; IPL, internal plexiform layer of olfactory bulb; Mi, mitral cell layer of olfactory bulb; OT, olfactory tubercle; TT, tenia tecta; VTT, ventral tenia tecta.

staining in the subiculum, presubiculum, parasubiculum, and postsubiculum was also detected PSI. Superficial and deep cellular layers of the medial and lateral entorhinal cortex were COX-2 positive giving the region a stratified appearance. Staining extended through many more cellular layers than seen in control brains (data not shown). COX-2 IR was found in several amygdalar nuclei in the control brain and staining was increased in each of these areas post-status (Fig. 7). COX-2 immunoreactive neurons were localized to the following amygdalar divisions: anterior cortical amygdaloid nucleus, medial amygdaloid nucleus, basolateral amygdala, dorsolateral, ventrolateral, and ventromedial lateral amygdala, posterior basomedial amygdala, and posterior cortical amygdala nucleus. Staining was most intense at 24 h PSI, much of this coming from

increased COX-2 IR in neuronal processes (Fig. 7I–L). COX-2 IR was also detected in the amygdalohippocampal region and the amygdalopiriform transition area. c-Fos IR in control versus PSI In order to confirm the hypothesis that all of the aforementioned COX-2 immunopositive areas are activated during seizures, alternate sections were stained with c-Fos antibody. As can be seen in Fig. 8, areas found to be immunopositive for COX-2 including the ventral striatum, amygdala, hippocampus, and piriform cortex in the kainate rat also showed c-Fos IR (Fig. 8A–D). Furthermore, dual-ICC methodology was used to visualize the colocalization of c-Fos and COX-2. As can be seen in Fig. 8E, F, the c-Fos IR (black) was

S. A. Joseph et al. / Neuroscience 140 (2006) 1051–1065

1057

Fig. 4. Photomicrograph depicting COX-2 IR in frontal sections of the ventral forebrain at the level of the ventral striatum, nucleus accumbens, and OT of control (A) and kainate-treated rats (B–D). This micrograph depicts distinct COX-2 IR as staining becomes apparent at the 2 h time point (B) with increasing intensity in these nuclei at 6 (C) and 24 (D) h PSI. Cell bridges extending from the ventral striatum to the olfactory tubercle are evident (arrows). Scale bar⫽500 ␮m. Bregma level: ⫺2.30. Abbreviations: aca, anterior limb of anterior commissure; AcbC, accumbens nucleus core; AcbSh, accumbens nucleus shell; CP, caudate/putamen; IC, islands of Calleja; OT, olfactory tubercle.

confined to the nucleus while the COX-2 IR (brown) was throughout the cell body and occasionally spreading into the proximal portions of the neuronal processes.

DISCUSSION Cellular and molecular mechanisms underlying seizure induction, seizure spread, and subsequent neuronal injury are poorly understood. Cortical brain regions, including archicortex, paleocortex, and neocortex, transmit impulses

via fast excitatory glutamatergic activity and are prone to abnormal discharges and seizures that constitute epileptic disorders. Animal models of epilepsy have been developed to study the mechanisms of seizure disorders. Kainate administration to rats induces limbic seizures with behavioral manifestations reminiscent of complex-partial seizures (Schwob et al., 1980; Nadler, 1981; Ben-Ari, 1985; Sperk, 1994). The kainate model was used for these acute studies. Animals were killed at 2, 6, and 24 h PSI and immunocytochemically analyzed for COX-1, COX-2 and

1058

S. A. Joseph et al. / Neuroscience 140 (2006) 1051–1065

Fig. 5. High power photomicrographs of the piriform cortex depicting changes in pyramidal layers II and III following kainate-induced seizures. Compared with control (A), COX-2 immunoreactive neurons not only become more numerous but also more intensely stained 2 h (B) and 6 h (C) PSI in the kainate brain. Note that COX-2 IR extends into the neural processes filling layer I of the piriform cortex at 6 h PSI (C). At 24 h PSI, significant numbers of cells from piriform cortical layers IIb and III are lost suggesting signs of excitotoxic cell death (black arrowhead, layer IIb and III, black arrow, layer IIa) (D). Nissl-stained sections at the same level of the piriform cortex in control (E), and 24 h PSI (F) rat, documents severe cell loss in layers IIb and III at 24 h PSI (F) (black arrowhead, layer IIb and III, black arrow, layer IIa). In (F), glial infiltration is noted in areas of cell death. Scale bar⫽100 ␮m.

c-Fos expression. Seizure-induced alterations detected by COX-1 and COX-2 IR were confirmed with Western blot

analysis. COX-1 IR was localized to microglia throughout the brain. COX-2 and c-Fos immunostaining showed ex-

S. A. Joseph et al. / Neuroscience 140 (2006) 1051–1065

1059

Fig. 6. Photomicrographs of COX-2 immunostaining in the hippocampus and DG following kainate-induced seizures. Control COX-2 immunostaining (A) becomes progressively enhanced in hippocampal neuronal elements at 2 h (B), 6 h (C), and 24 h (D) PSI. The high power magnification clearly reveals that the dendritic molecular layer of the DG becomes engorged with COX-2 IR expression (E, F). At high power magnifications of CA3 pyramidal neurons, COX-2 IR is enhanced in the kainate brain (H) versus control brain (G). Scale bar⫽500 ␮m (A–D), 100 ␮m (E–F). Abbreviations: DG, dentate gyrus; GC, granule cell layer; Hil, hilus of dentate gyrus; Mol, molecular layer of dentate gyrus; S. Or, stratum oriens; S. Pyr, stratum pyramidale; S. Rad, stratum radiatum.

tensive co-localization. Our major finding is a dramatic increase of neuronal COX-2 immunostaining with increasing time points PSI. Specifically, in all animals that exhibited stage V seizures, there was enhanced COX-2 staining within neuronal perikarya of olfactory bulb, olfactory tubercle, olfactory cortex including the entire extent of the piriform and entorhinal cortices, lateral, basolateral and basomedial amygdala, ventral striatum, shell of nucleus accumbens, hippocampus and dentate gyrus, dorsal and ventral tenia tecta, and indusium griseum. This putative seizure substrate, consisting of brain regions known for their propen-

sity for plasticity, have unique feed-forward and feed-backward reciprocal connections (Neville and Haberly, 2004) that may potentiate the likelihood of seizure propagation. Rostral olfactory-limbic forebrain and seizures The observation that the entire olfactory system becomes reactive during status epilepticus is intriguing but not surprising. In the case of human temporal lobe epilepsy, auras are common whereby patients complain of an olfactory or gustatory illusion described as a disagreeable odor or

1060

S. A. Joseph et al. / Neuroscience 140 (2006) 1051–1065

Fig. 7. The effects of kainate-induced status on COX-2 IR at two distinct rostrocaudal levels of the amygdaloid complex. A progressive increase in COX-2 IR is apparent in the lateral and BLA nuclei. In control rat (A, E, I), some somal staining is apparent, with a progressive increase in intensity at 2 h (B, F, J), 6 h (C, G, K), and 24 h (D, H, L) PSI. At a more caudal level (E–H), COX-2 IR is evident in the following amygdala nuclei: lateral, basolateral, basomedial, and posterolateral cortical. High power photomicrographs of the lateral nucleus (I–L) reveal both the overall increase in intensity of immunostaining as well as extension of IR into cellular processes at later time points. At 24 h (H) PSI, COX-2 immunostaining remains intense, with some amygdala areas now devoid of staining corresponding to areas of apparent cell loss. Cell loss is most evident in the LaVL and significant portions of the BLA nucleus (black arrow). The loss of staining in the piriform cortex, evident at 24 h PSI (D, H), can also be seen in these micrographs. Scale bar⫽500 ␮m (A–H), 50 ␮m (I–L). Bregma level: ⫺2.80. Abbreviations: BLA, basolateral amygdala; BMP, basomedial amygdala, posterior; LaDL, lateral amygdala, dorsolateral; LaVL, lateral amygdala, ventrolateral; LaVM, lateral amygdala, ventromedial; PIR, piriform cortex; PLCo, cortical nucleus of amygdala, posteriolateral.

taste; this phenomenon, which we suspect emanates from olfactory structures, precedes the tonic– clonic seizure and almost always recurs with each new seizure. It is believed that the auras are simple seizures in hyperexcitable zones that subsequently spread to connected brain regions. Therefore, it follows that in kainate-induced status epilepticus there would be neural involvement within the entire olfactory system, amygdala, paleocortex, and archicortex because of their interconnections. A significant finding of this study is the activation of a widespread network, as evidenced by COX-2 up-regula-

tion as early as 2 h PSI in many interconnected brain regions including olfactory bulb, piriform cortex, ventral forebrain, amygdala and hippocampus. Previously, Lothman and Collins (1981) demonstrated early EEG changes in CA3 of the hippocampus which paralleled episodes of staring spells, whereas changes in limbic centers were correlated to the behavioral manifestations of mild convulsive activity. Furthermore, these investigators used deoxyglucose autoradiography and concluded that the CA3 was the most sensitive to metabolic changes, but also that mild limbic convulsions were associated with increased glucose

S. A. Joseph et al. / Neuroscience 140 (2006) 1051–1065

1061

Fig. 8. Photomicrographs of representative coronal sections of kainate-induced seizure rat brain depicting c-Fos IR neurons. Little to no c-Fos IR was detected in control brains as seen in a photomicrograph of the ventral forebrain (A). Single ICC reveals c-Fos IR in regions including sections at the level of ventral forebrain (B), amygdala (C), hippocampal formation (D), and piriform cortex (E) at 2 h PSI. These regions were also found to exhibit temporally increasing COX-2 IR as can be seen in Figs. 4 –7. High power photomicrographs at the levels of the pyramidal neurons in the CA3 subfield of hippocampus (F) and of pyramidal neurons in layer III of piriform cortex (G) after dual ICC was performed with c-Fos (black) and COX-2 (brown) revealing a distinct pattern of colocalization in which cells immunopositive for COX-2 were found to also be immunopositive for c-Fos. In (F) and (G), white arrowheads indicate nuclear subcellular localization of c-Fos IR while black arrowheads indicate cytoplasmic COX-2 IR. Note in (F) and (G) that all c-Fos immunopositive nuclei were seen in neurons immunopositive for COX-2. Scale bars⫽500 ␮m (A, B, D), 300 ␮m (C), 50 ␮m (E), and 30 ␮m (F, G). Abbreviations: aca, anterior limb of anterior commissure; AcbC, accumbens nucleus core; AcbSh, accumbens nucleus shell; BLA, basolateral amygdala; BMP, basomedial amygdala, posterior; DG, dentate gyrus; LaDL, lateral amygdala, dorsolateral; LaVL, lateral amygdala, ventrolateral; LaVM, lateral amygdala, ventromedial; OT, olfactory tubercle.

1062

S. A. Joseph et al. / Neuroscience 140 (2006) 1051–1065

utilization in the hippocampus, piriform cortex, entorhinal cortex, septum, and amygdala. Using deoxyglucose autoradiography to determine neuronal activity, Ben-Ari et al. (1981) found the hippocampus and the lateral septum to be affected at early time points (prior to 1 h) with increases in glucose consumption evident in other limbic structures, including nucleus accumbens, amygdala, and limbic cortex at later time points (2–5 h). These limbic structures, showing increased glucose utilization, correspond to areas in which we observed enhancing COX-2 IR at similar time points (2 and 6 h PSI). Willoughby et al. (1997) identified early changes in c-Fos expression in the hippocampus with subsequent changes in many limbic-related areas, although their kainate protocol was very different from our current study. Despite varying methodologies to determine activity, distinct protocols of kainate administration, and different time points examined, a consensus exists that a glutamatergic network of structures from the olfactory bulb to the hippocampus is integral in limbic seizure propagation. Besides being dominated by glutamatergic transmission, many neural components associated with epilepsy appear to be hard-wired through an exquisite series of anterograde–retrograde and reciprocal connections (Neville and Haberly, 2004), potentially allowing for an inherent spread of seizures. Furthermore, studies using focallyapplied kainate— either via intrabulbular injection (Araki et al., 1995) or intranasal administration (Chen and Bazan, 2004)—produce the typical behavioral manifestations of seizures and delineate a pattern of recruited olfactory/ limbic regions similar to our findings. These data add credence to the concept of a connectivity of olfactory bulb and related limbic areas whose connections encourage the propagation of seizure activity (Haberly and Price, 1977, 1978a,b). Interestingly, the piriform cortex has been singled out by numerous investigators as a key component for processing olfactory information (Haberly, 2001) and is considered remarkably ictal ‘friendly,’ playing a strong role in epileptogenesis in the rat (McIntyre and Wong, 1988; Pelletier and Carlen, 1996; Doherty et al., 2000; Schwabe et al., 2000). In fact, the piriform cortex as an epileptogenic site has been championed by Gale (Gale, 1988; Gale et al., 1992; Gale, 1992) and her colleagues for almost two decades. Output targets of the piriform cortex include orbital and insular cortices, cortex of the olfactory tubercle, and its cohort ventral striatum. In addition, the piriform cortex has reciprocal connections with amygdala, prefrontal cortex, anterior olfactory nucleus, and entorhinal and perirhinal cortices. We identified damage and necrotic cell loss appearing in the piriform cortex at 6 and 24 h PSI (Fig. 5). These data are consistent with studies by Olney (Olney and DeGubareff, 1978; Schwob et al., 1980) in which the piriform cortex showed early cell death and associated glial reactivity following kainate administration. Thus, compounding the initial trigger of kainate, the complex bidirectional connections may allow for synchronization during seizures that promote the vulnerability of piriform cortex to neuronal injury. Taken together these observations

suggest that the piriform cortex is a pivotal region in the production and propagation of seizures and may influence hyperexcitability in the hippocampus and other interconnected brain regions in epilepsy. Although several investigators have identified neuronal units and connectivities of the piriform cortex to be important in the propagation of epileptic seizures, others have demonstrated additional epileptogenic sites in the kindled model, most notably areas of the amygdala and the hippocampus (Mohapel et al., 1996). Schwabe et al. (2004) found that vigabatrin injections into the piriform cortex retards amygdala kindling. Several nuclei of the amygdala show enhanced COX-2 IR beginning at 2 h PSI with further progression at 6 and 24 h PSI. Robust staining of the amygdala was localized to nuclei known to project extensively into the hippocampus (Pikkarainen et al., 1999). Hence, our results are consistent with the elegant tracttracing studies of Pikkarainen and Pitkänen (2001) that demonstrate important reciprocal connections among the amygdala, perirhinal cortices, and hippocampus. The amygdala, especially the lateral and basal nuclei holds key positions linking olfactory brain with the hippocampus. Pronounced alterations in COX-2 IR were also detected in the hippocampal formation, with moderate staining in the control and distinct profiles evident at different time points. Of particular interest is the dentate gyrus where early and rapidly increasing COX-2 and c-Fos immunostaining is found. A dramatic increase in COX-2 IR in the granule cell layer at 2 h PSI precedes the dense immunostaining evident at 24 h PSI in the molecular layers of the dentate gyrus. An identical temporal manifestation of COX-2 expression is evident in the tenia tecta, the anterior extension of the dentate gyrus that receives glutamatergic afferents from the olfactory bulb (Nauta and Feirtag, 1986; Kratskin, 1995). Overall, it is striking that the observed enhancement of COX-2 IR corresponds to areas among which there is well-documented connectivity. In early experiments with kainate, researchers described widespread damage of forebrain structures and concluded that the toxicity of kainate relates to axonal connections and intact glutamatergic synapses (Biziere and Coyle, 1978; McGeer et al., 1978; Schwob et al., 1980). COX and seizures Expression of COX enzymes is unique in nervous tissue, such that both COX-1 and COX-2 are expressed under basal conditions (O’Banion, 1999). Further induction of COX-2 occurs in response to synaptic activity (Yamagata et al., 1993), electroconvulsive seizures (McCown et al., 1997; Tu and Bazan, 2003), chemically-induced seizures (Adams et al., 1996; Marcheselli and Bazan, 1996), and traumatic tissue damage (Dash et al., 2000; Phillis and O’Regan, 2003) in certain areas of the brain as evidenced by mRNA levels and immunostaining profiles. In this study, we provide a precise mapping of COX-2 IR that reveals an important network of excitability. Changes in COX-1 expression were limited to a modest increase in hippocampal COX-1 protein seen only 24 h PSI. This was not associated with increased COX-1 mRNA levels, which could be

S. A. Joseph et al. / Neuroscience 140 (2006) 1051–1065

due to the sensitivity of our assay, the time points examined, or evidence of posttranslational control mechanisms. Although we did not investigate COX-1 mRNA or protein levels in other brain regions, our immunohistochemical findings suggest that COX-1 expression was largely limited to microglial populations. As revealed by morphological changes, activation of microglia seen at the later time points is likely to have resulted in the observed increase in hippocampal COX-1 protein levels seen at 24 h PSI. Previous studies suggest that COX-2 activity can contribute to neuronal death induced by kainic acid administration in rats, particularly in CA1 and CA3 of the hippocampus (Kunz and Oliw, 2001; Gobbo and O’Mara, 2004; Kawaguchi et al., 2005). These results are consistent with in vitro and in vivo evidence that COX-2 activity potentiates excitotoxic and ischemic neuronal injury (Nogawa et al., 1997; Kelley et al., 1999; Hewett et al., 2000; Salzberg-Brenhouse et al., 2003). However, the effects of COX inhibition on seizure-induced injury are variable depending on such factors as the species used or timing of inhibitor administration (Baik et al., 1999; Gobbo and O’Mara, 2004). Indeed, research has demonstrated diverse effects imparted on the CNS by specific prostaglandins. For example, after administering specific COX-2 inhibitors, which provided protection against NMDA-induced excitotoxicity, it was found that administration of PGE2 and PGF2␣ could reverse the protective effects (Carlson, 2003). In contrast, protective effects of specific prostaglandins are suggested by studies in organotypic hippocampal cultures treated with NMDA and prostaglandin receptor knockout mice subject to brain ischemia (McCullough et al., 2004). Taken together, these findings suggest complex roles for COX products in seizure-associated neural toxicity.

CONCLUSION Unique interconnected components of the limbic circuit are hypothesized as a seizure substrate for initiation and propagation of excitotoxic seizure activity with obligatory consequences of inflammation and cell death. In attempts to unravel the fundamentals of how the integrated brain provides the substrate for epileptic seizures, we revealed a pathway in the forebrain that is heavily endowed with COX enzymes which become up-regulated in the epileptic brain and may influence cellular integrity by contributing to toxicity, degenerative processes, and cell death. We can hypothesize that under these conditions a ‘neurotoxic’ cyclical pathway is formed that by its very nature continues in a feed-forward mode culminating in excitotoxic damage. Acknowledgments—This work was supported by NIH grants NS38639 and NS33553.

REFERENCES Adams J, Collaco-Moraes Y, de Belleroche J (1996) Cyclooxygenase-2 induction in cerebral cortex: An intracellular response to synaptic excitation. J Neurochem 66:6 –13.

1063

Ahmad AS, Saleem S, Ahmad M, Dore S (2006) Prostaglandin EP1 receptor contributes to excitotoxicity and focal ischemic brain damage. Toxicol Sci 89:265–270. Araki T, Kato M, Kobayashi T (1995) Limbic seizures originating in the olfactory bulb: An electro-behavioral and glucose metabolism study. Brain Res 693:207–216. Babb T, Brown W (1987) Pathological findings in epilepsy. In: Surgical treatment of the epilepsies (Engel J, ed), pp 511–540. New York: Raven Press. Babb TL, Kupfer WR, Pretorius JK, Crandall PH, Levesque MF (1991) Synaptic reorganization by mossy fibers in human epileptic fascia dentata. Neuroscience 42:351–363. Baik EU, Kim EJ, Lee SH, Moon C (1999) Cyclooxygenase-2 selective inhibitors aggravate kainic acid induced seizure and neuronal cell death in the hippocampus. Brain Res 843:118 –129. Ben-Ari Y (1985) Limbic seizures and brain damage produced by kainic acid; mechanism and relevance to human temporal lobe epilepsy. Neuroscience 14:375– 403. Ben-Ari Y (2001) Cell death and synaptic reorganizations produced by seizures. Epilepsia 42(Suppl 3):5–7. Ben-Ari Y, Cossart R (2000) Kainate, a double agent that generates seizures: two decades of progress. Trends Neurosci 23:580 –587. Ben-Ari Y, Tremblay E, Ottersen OP (1980) Injections of kainic acid into the amygdaloid complex of the rat: An electrographic, clinical and histological study in relation to the pathology of epilepsy. Neuroscience 5:515–528. Ben-Ari Y, Tremblay E, Riche D, Ghilini G, Naquet R (1981) Electrographic, clinical and pathological alterations following systemic administration of kainic acid, bicuculline or pentetrazole: metabolic mapping using the deoxyglucose method with special reference to the pathology of epilepsy. Neuroscience 6:1361–1391. Biziere K, Coyle JT (1978) Influence of corticostriatal afferents on striatal kainic acid neurotoxicity. Neurosci Lett 8:303–310. Carlson NG (2003) Neuroprotection of cultured cortical neurons mediated by the cyclooxygenase-2 inhibitor APHS can be reversed by a prostanoid. J Neurosci Res 71:79 – 88. Chen C, Bazan NG (2004) Endogenous PGE2 regulates membrane excitability in hippocampal CA1 pyramidal neurons. J Neurophysiol 93:929 –941. Chen J, Marsh T, Zhang JS, Graham SH (1995) Expression of cyclooxygenase 2 in rat brain following kainate treatment. Neuroreport 6:245–248. Coyle JT, Puttfarcken P (1993) Oxidative stress, glutamate, and neurodegenerative disorders. Science 262:689 – 695. Dash PK, Mach SA, Moore AN (2000) Regional expression and role of cyclooxygenase-2 following experimental traumatic brain injury. J Neurotrauma 17:69 – 81. de Lanerolle NC, Kim JH, Robbins RJ, Spencer DD (1989) Hippocampal interneuron loss and plasticity in human temporal lobe epilepsy. Brain Res 495:387–395. Doherty J, Gale K, Eagles DA (2000) Evoked epileptiform discharges in the rat anterior piriform cortex: Generation and local propagation. Brain Res 861:77– 87. Gale K (1988) Progression and generalization of seizure discharge: Anatomical and neurochemical substrates. Epilepsia 29:S15–S34. Gale K (1992) Subcortical structures and pathways involved in convulsive seizure generation. J Clin Neurophysiol 9:264 –277. Gale K, Zhong P, Miller LP, Murray TF (1992) Amino acid neurotransmitter interactions in ‘area tempestas’: An epileptogenic trigger zone in the deep prepiriform cortex. Epilepsy Res Suppl 8:229–234. Gobbo OL, O’Mara SM (2004) Post-treatment, but not pre-treatment, with the selective cyclooxygenase-2 inhibitor celecoxib markedly enhances functional recovery from kainic acid-induced neurodegeneration. Neuroscience 125:317–327. Haberly LB (2001) Parallel-distributed processing in olfactory cortex: New insights from morphological and physiological analysis of neuronal circuitry. Chem Senses 26:551–576.

1064

S. A. Joseph et al. / Neuroscience 140 (2006) 1051–1065

Haberly LB, Price JL (1977) The axonal projection patterns of the mitral and tufted cells of the olfactory bulb in the rat. Brain Res 129:152–157. Haberly LB, Price JL (1978a) Association and commissural fiber systems of the olfactory cortex of the rat. I. Systems originating in the piriform cortex and adjacent areas. J Comp Neurol 178:711–740. Haberly LB, Price JL (1978b) Association and commissural fiber systems of the olfactory cortex of the rat. II. Systems originating in the olfactory peduncle. J Comp Neurol 181:781– 808. Hewett SJ, Uliasz TF, Vidwans AS, Hewett JA (2000) Cyclooxygenase-2 contributes to N-methyl-D-aspartate-mediated neuronal cell death in primary cortical cell culture. J Pharmacol Exp Tech 293:417– 425. Hoozemans JJM, Rozemuller AJM, Janssen I, DeGroot CJM, Veerhuis R, Eikelenboom P (2001) Cyclooxygenase expression in microglia and neurons in Alzheimer’s disease and in control brain. Acta Neuropathol 101:2– 8. Houser CR, Miyashiro JE, Swartz BE, Walsh GO, Rich JR, DelgadoEscueta AV (1990) Altered patterns of dynorphin immunoreactivity suggest mossy fiber reorganization in human hippocampal epilepsy. J Neurosci 10:267–282. Hurley SD, Olschowka JA, O’Banion MK (2002) Cyclooxygenase inhibition as a strategy to ameliorate brain injury. J Neurotrauma 19:1–15. Joseph SA, Lynd-Balta E (2001) Evidence for an anatomical substrate of hyperexcitability in human temporal lobe epilepsy: glutamate receptor alterations and reorganized circuitry. Funct Neurol 16: 347–365. Joseph SA, Piekut DT (1986) Dual immunostaining procedure demonstrating neurotransmitter and neuropeptide codistribution in the same brain section. Am J Anat 175:331–342. Kaufmann WE, Worley PF, Pegg J, Bremer M, Isakson P (1996) COX-2, a synaptically induced enzyme, is expressed by excitatory neurons at postsynaptic sites in rat cerebral cortex. Pharmacology 93:2317–2321. Kawaguchi K, Hickey RW, Rose ME, Zhu L, Chen J, Graham SH (2005) Cyclooxygenase-2 expression is induced in rat brain after kainate-induced seizures and promotes neuronal death in CA3 hippocampus. Brain Res 1050:130 –137. Kelley KA, Ho L, Winger D, Freire-Moar J, Borelli CB, Aisen PS, Pasinetti GM (1999) Potentiation of excitotoxicity in transgenic mice overexpressing neuronal cyclooxygenase-2. Am J Pathol 155:995–1004. Kim JH, Guimaraes PO, Shen MY, Masukawa LM, Spencer DD (1990) Hippocampal neuronal density in temporal lobe epilepsy with and without gliomas. Acta Neuropathol 80:41– 45. Kratskin IL (1995) Functional anatomy, central connection, neurochemistry of the mammalian olfactory bulb. In: Handbook of olfaction and gustation (Doty RL, ed), pp 103–126. New York: Marcel Dekker, Inc. Kunz T, Oliw EH (2001) The selective cyclooxygenase-2 inhibitor rofecoxib reduces kainate-induced cell death in the rat hippocampus. Eur J Neurosci 13:569 –575. Lado FA, Laureta EC, Moshe SL (2002) Seizure-induced hippocampal damage in the mature and immature brain. Epileptic Disord 4:83–97. Lothman EW, Collins RC (1981) Kainic acid induced limbic seizures: metabolic, behavioral, electroencephalographic and neuropathological correlates. Brain Res 218:299 –318. Lynd-Balta E, Pilcher WH, Joseph SA (1996) Distribution of AMPA receptor subunits in the hippocampal formation of temporal lobe epilepsy patients. Neuroscience 72:15–29. Marcheselli VL, Bazan NG (1996) Sustained induction of prostaglandin endoperoxide synthase-2 by seizures in hippocampus. J Biol Chem 271:24794 –24799. McCown TJ, Knapp DJ, Crews FT (1997) Inferior collicular seizure generalization produces site-selective cortical induction of cyclooxygenase-2 (COX-2). Brain Res 767:370 –374.

McCullough L, Wu L, Haughey N, Liang X, Hand T, Wang Q, Breyer RM, Andreasson K (2004) Neuroprotective function of the PGE2 EP2 receptor in cerebral ischemia. J Neurosci 24:257–268. McGeer EG, McGeer PL, Singh K (1978) Kainate-induced degeneration of neostriatal neurons: dependency upon corticostriatal tract. Brain Res 139:381–383. McIntyre DC, Wong RKS (1988) Cellular and synaptic properties of amygdala-kindled pyriform cortex in vitro. J Neurophysiol 55: 1295–1307. Mohapel PCD, Kelly ME, McIntyre DC (1996) Differential sensitivity of various temporal lobe structures in the rat to kindling and status epilepticus induction. Epilepsy Res 23:179 –187. Nadler JV (1981) Kainic acid as a tool for the study of temporal lobe epilepsy. Life Sci 29:2031–2042. Nauta WJ, Feirtag M (1986) Fundamental neuroanatomy, pp 235–238. New York: W.H. Freeman and Company. Neville KR, Haberly LB (2004) Olfactory cortex. In: The synaptic organization of the brain (Shepherd GM, ed), pp 415– 454. New York: Oxford University Press, Inc. Nogawa S, Zhang F, Ross ME, Iadecola C (1997) Cyclooxygenase-2 gene expression in neurons contributes to ischemic brain damage. J Neurosci 17:2746 –2755. O’Banion MK (1999) Cyclooxygenase-2: Molecular biology, pharmacology, and neurobiology. Crit Rev Neurobiol 13:45– 82. Olney JW, DeGubareff T (1978) Extreme sensitivity of olfactory cortical neurons to kainic acid toxicity. In: Kainic acid as a tool in neurobiology (McGeer EG et al., eds), pp 201–217. New York: Raven. Olney JW, Rhee V, Ho OL (1974) Kainic acid: A powerful neurotoxic analogue of glutamate. Brain Res 77:507–512. Pelletier MR, Carlen PL (1996) Repeated tetanic stimulation in piriform cortex in vitro: Epileptogenesis and pharmacology. J Neurophysiol 76:4069 – 4079. Pepicelli O, Fedele E, Berardi M, Raiteri M, Levi G, Greco A, AjmoneCat MA, Minghetti L (2005) Cyclo-oxygenases-1 and -2 differently contribute to prostaglandin E2 synthesis and lipid peroxidation after in vivo activation of N-methyl-D-aspartate receptors in rat hippocampus. J Neurochem 93:1561–1567. Phillis JW, O’Regan MH (2003) The role of phospholipases, cyclooxygenases, and lipoxygenases in cerebral ischemic/traumatic injuries. Crit Rev Neurobiol 15:61–90. Pikkarainen M, Pitkänen A (2001) Projections from the lateral, basal and accessory basal nuclei of the amygdala to the perirhinal and postrhinal cortices in rat. Cereb Cortex 11:1064 –1082. Pikkarainen M, Ronkko S, Savander V, Insausti R, Pitkänen A (1999) Projections from the lateral, basal, and accessory basal nuclei of the amygdala to the hippocampal formation in rat. J Comp Neurol 403:229 –260. Pritchard KA, O’Banion MK, Miano JM, Vlasic N, Bhatia UG, Young DA, Stemerman MB (1994) Induction of cyclooxygenase-2 in rat vascular smooth muscle cells in vitro and in vivo. J Biol Chem 269: 8504 – 8509. Salzberg-Brenhouse HC, Chen EY, Emerich DF, Baldwin S, Hogeland K, Ranelli S, Lafreniere D, Perdomo B, Novak L, Kladis T, Fu K, Basile AS, Kordower JH, Bartus RT (2003) Inhibitors of cyclooxygenase-2, but not cyclooxygenase-1 provide structural and functional protection against quinolinic acid-induced neurodegeneration. J Pharmacol Exp Ther 306:218 –228. Schwab JM, Bretchel K, Nguyen TD, Schluesener HJ (2000) Persistent accumulation of cyclooxygenase-1 (COX-1) expressing microglia/macrophages and upregulation by endothelium following spinal cord injury. J Neuroimmunol 111:122–130. Schwabe K, Ebert U, Loscher W (2000) Bilateral lesions of the central but not anterior or posterior parts of the piriform cortex retard amygdala kindling in rats. Neuroscience 101:513–521. Schwabe K, Ebert U, Loscher W (2004) Bilateral microinjections of vigabatrin in the central piriform cortex retard amygdala kindling in rats. Neuroscience 129:425– 429.

S. A. Joseph et al. / Neuroscience 140 (2006) 1051–1065 Schwob JE, Fuller T, Price JL, Olney JW (1980) Widespread patterns of neuronal damage following systemic or intracerebral injections of kainic acid: A histological study. Neuroscience 5:991–1014. Siddiqui AH, Joseph SA (2005) CA3 axonal sprouting in kainateinduced chronic epilepsy. Brain Res 1066:129 –146. Sperk G (1994) Kainic acid seizures in the rat. Prog Neurobiol 42: 1–32. Sutula T, Cascino G, Cavazos J, Parada I, Ramirez L (1989) Mossy fiber synaptic reorganization in the epileptic human temporal lobe. Ann Neurol 26:321–330. Tu B, Bazan NG (2003) Hippocampal kindling epileptogenesis upregulates neuronal cyclooxygenase-2 expression in neocortex. Exp Neurol 179:167–175.

1065

Vezzani A (2005) Inflammation and epilepsy. Epilepsy Curr 5:1– 6. Willoughby JO, Mackenzie L, Medvedev A, Hiscock JJ (1997) Fos induction following systemic kainic acid: early expression in hippocampus and later widespread expression correlated with seizure. Neuroscience 77:379 –392. Yamagata K, Andreasson KI, Kaufmann WE, Barnes CA, Worley PF (1993) Expression of a mitogen-inducible cyclooxygenase in brain neurons: Regulation by synaptic activity and glucocorticoids. Neuron 11:371–386. Yermakova AV, Rollins J, Callahan LM, Rogers J, O’Banion MK (1999) Cyclooxygenase-1 in human Alzheimer and control brain: Quantitative analysis of expression by microglia and CA3 hippocampal neurons. J Neuropathol Exp Neurol 58:1135–1146.

(Accepted 23 February 2006) (Available online 4 May 2006)