- Email: [email protected]
Enhanced expression of membrane transporter and drug resistance in keloid fibroblasts
Human Pathology (2012) 43, 2024–2032
www.elsevier.com/locate/humpath
Original contribution
Enhanced expression of membrane transporter and drug resistance in keloid fibroblasts☆ Nan Song a,b,1 , Xiaoli Wu a,b,1 , Zhen Gao a,b , Guangdong Zhou a,b,c , Wen Jie Zhang a,b,c , Wei Liu a,b,c,⁎ a
Department of Plastic and Reconstructive Surgery, Shanghai 9th People's Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai 200011, China b Shanghai Research Institute of Plastic and Reconstructive Surgery, Shanghai 200025, China c Shanghai Tissue Engineering Key Laboratory, Shanghai 200011, China Received 13 September 2011; revised 8 November 2011; accepted 15 December 2011
Keywords: Drug resistance; Keloid fibroblasts; MDR-1; Mitoxantrone; Vincristine
Summary The mechanisms of keloid resistance to therapy and high recurrence rate remain undefined. This study explored the difference in drug resistance between keloid and normal fibroblasts. Fibroblasts derived from 9 patients with keloid and 9 skin donors were randomly combined into 3 keloid cell pools (3 cases per pool) and 3 normal cell pools (3 cases per pool) and were compared for their resistance to vincristine and mitoxantrone and related molecule expression. The results revealed stronger resistance to both vincristine and mitoxantrone with a higher survival rate in keloid cells than in normal cells (P b .05). The resistance of keloid fibroblasts could be largely abrogated by verapamil treatment. In addition, messenger RNA expression levels of multiple-drug resistance-1, ABCB5 (P-glycoprotein family member), and cytochrome P450 3A4 but not ABCG2 (ATP-binding cassette transporter) were significantly higher in passage 1 keloid fibroblasts than in passage 1 normal fibroblasts; no significant difference was found in latter passages. Immunohistochemistry staining revealed significantly more multiple-drug resistance-1–positive cells (round) in keloid tissue than in normal skin (mostly spindle shaped) (P b .05) but no significant difference in the percentage of positive cells in the 2 groups. Enhanced expression of membrane transporters and increased resistance to chemotherapy agents may contribute to the keloid's resistance to therapy and the high posttherapy recurrence rate. © 2012 Elsevier Inc. All rights reserved.
1. Introduction ☆
This work was financially supported by the National Natural Science Foundation of China (Grants 30872694 and 30801194), Shanghai Natural Science Foundation (10ZR1417700), and Shanghai Health Bureau Foundation (to X. Wu). ⁎ Corresponding author. Department of Plastic and Reconstructive Surgery, Shanghai 9th People's Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai 200011, People's Republic of China. E-mail address: [email protected] (W. Liu). 1 These authors contributed equally to this work. 0046-8177/$ – see front matter © 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.humpath.2011.12.026
Keloids are difficult to cure due to their complex pathogenesis. Because of its invasion and uncontrolled growth, a keloid is considered a benign skin tumor. Despite tremendous efforts to understand their mechanism, advancement in therapy remains limited, suggesting that new investigations of the mechanism may be needed. In the past decade, progress in cancer biology study revealed that cancer stem cells may play an important role in
Keloid transporter and drug resistance
2025
Table 1
Patient information
Pool
Tissue type
Age (y)
Sex
Location
Pool
Tissue type
Age (y)
Sex
Location
1
Keloid-1 Keloid-2 Keloid-3 Keloid-4 Keloid-5 Keloid-6 Keloid-7 Keloid-8 Keloid-9
24 22 28 24 32 38 24 20 34
F F M F M F F M M
Shoulder Chest Chest Earlobe Shoulder Chest Chest Shoulder Back
1
Skin-1 Skin-2 Skin-3 Skin-4 Skin-5 Skin-6 Skin-7 Skin-8 Skin-9
18 28 32 24 20 29 33 32 28
M M M F F F F M F
Postauricle Leg Leg Abdomen Abdomen Leg Shoulder Abdomen Shoulder
2
3
2
3
Abbreviations: F, female; M, male.
disease development [1-3]. One of the challenges in cancer treatment is resistance to chemotherapeutic agents, which is mediated mainly by membrane transporters, particularly the ATP-binding cassette (ABC) transporter [4,5]. Furthermore, the discovery of cancer stem cells was based on the finding of a “side population” that does not stain strongly with Hoechst 33342 because of the activity of the membrane transporter ABCG2 [6,7]. Recently, stem cells have been discovered in keloid tissue and are believed to play a key role in keloid development, pathogenesis, and recurrence [8,9]. The purpose of this study was to investigate whether there is a drug resistance phenomenon in keloid fibroblasts by comparing their sensitivity to chemotherapeutic agents with that of normal dermal fibroblasts. In addition, we investigated whether there is differential expression of membrane transporter molecules in keloid and normal fibroblasts.
2. Patients and methods 2.1. Tissue specimens Nine patients with keloids without previous treatment and 9 donors with normal skin (all ethnically Chinese) were involved in this study (Table 1) and provided informed consent for tissue donation. All keloids were characterized by their spontaneous formation and overgrowth beyond the Table 2
original wound boundaries. The handling of human tissue was approved by the Ethics Committee of the Shanghai 9th People's Hospital.
2.2. Experimental design Keloid fibroblasts were randomly pooled into 3 populations (3 samples for each), and normal fibroblasts were likewise randomly pooled into 3 normal cell populations (3 samples for each) as detailed in Table 1. In addition, 3 cases were randomly selected from the patients with keloid and 3 from the donors to obtain tissue samples for immunohistochemical staining of multiple-drug resistance (MDR)-1 and MDR gene analysis.
2.3. Cell isolation and culture The procedure was performed as previously described [10]. Cells were cultured in Dulbecco modified Eagle medium (DMEM; GIBCO, Grand Island, NY) plus 10% fetal bovine serum (GIBCO).
2.4. MTT assay A (3-(4,5)-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was used as previously described [11]. Briefly, passage 1 keloid and normal fibroblasts were seeded in
Primers used in RT-PCR
Gene
Primer sequence (5′-3′)
Annealing temperature (°C)
Products size (base pairs)
MDR1
Sense: AGCAAAGGAGGCCAACATAC Antisense: ACTCTGCCATTCTGAAACACC Sense: GTTCCAGGATTGGCGTCTT Antisense: CAGTCATTGCTGCGGTTTC Sense: GGGTTCTCTTCTTCCTGACGACC Antisense: TGGTTGTGAGATTGACCAACAGACC Sense: CTGCTTCTCACGGGACTA Antisense: AAACAATGGGCAAAGTCA Sense: ATCATGTTTGAGACCTTCAA Antisense: CATCTCTTGCTCGAAGTCCA
58
309
55
153
63
218
55
392
55
318
ABCB5 ABCG2 CYP3A4 β-Actin
2026 Table 3 Groups
N. Song et al. Cell growth comparison between keloid and normal fibroblasts (OD reading) Day 1
Day 2
Day 3
Day 4
Day 5
Day 6
Day 7
Day 8
Keloid fibroblasts 0.132 ± 0.04 0.253 ± 0.05 0.335 ± 0.06 0.425 ± 0.03 0.404 ± 0.02 0.412 ± 0.03 0.408 ± 0.02 0.415 ± 0.04 Normal fibroblasts 0.143 ± 0.02 0.237 ± 0.03 0.314 ± 0.04 0.396 ± 0.02 0.385 ± 0.04 0.365 ± 0.04 0.354 ± 0.03 0.365 ± 0.02 P N.05 N.05 N.05 N.05 N.05 N.05 b.05 b.05
a 96-well plate (1000 cells/well) in 200 μL of DMEM; 200 μL DMEM was used to create a blank control. At the desired day postseeding, the optical density (OD) was determined at 490 nm by a microplate reader (GMBH A-1160; Dialab, Wien, Austria). Each test was repeated in 6 wells.
2.5. Drug resistance assay Three keloid and 3 normal cell populations at passages 1, 2, and 3 were tested for resistance to vincristine and mitoxantrone. Briefly, cells were seeded in 6-well plates (1 × 106 cells/well) to observe morphologic and cell density changes after drug treatment. In addition, cells from each
population were seeded in 96-well plates (1000 cells/well × 6 wells) to observe the effect of the drugs on cell proliferation using an MTT assay. At 24 hours postseeding, cells were treated with vincristine at concentrations of 1, 10, 50, or 100 nM or with mitoxantrone at 10, 50, 100, or 500 nM. After 48 hours, the cell survival percentage was determined by dividing the OD value of the drug-treated group by the value of the untreated group.
2.6. RT-PCR Total RNAs were extracted from the cells and reverse transcribed to complementary DNA using an RT kit (Takara,
Fig. 1 Keloid fibroblasts exhibit resistance to vincristine (Vcr). Cell density comparison between treated and untreated keloid and normal fibroblasts (A) and cell survival rate comparison between keloid and normal fibroblasts exposed to various drug concentrations at passage 1 (B), passage 2 (C), and passage 3 (D). *Statistically significant difference (P b .05). Bar = 100 μm.
Keloid transporter and drug resistance
2027
Fig. 2 Keloid fibroblasts exhibit resistance to mitoxantrone (MX). Cell density comparison between treated and untreated keloid and normal fibroblasts (A) and cell survival rate comparison between keloid and normal fibroblasts exposed to various drug concentrations at passage 1 (B), passage 2 (C), and passage 3 (D). *Statistically significant difference (P b .05). Bar = 100 μm.
Osaka, Japan) according to the manufacturer's protocol. Various primers were designed, as listed in Table 2, and polymerase chain reaction (PCR) was performed by initial denaturation for 5 minutes at 95°C followed by 29 cycles of 30 s at 95°C, 30 seconds at the annealing temperatures listed in Table 2, 45-second extension at 72°C, and 10-minute terminal extension at 72°C. Gene expression was analyzed by electrophoresis and semiquantified with band density analysis (Tanon, Shanghai, China) by dividing the expression of the examined gene by the β-actin level with 3 repetitions.
2.7. Immunohistochemistry staining As previously described [10], tissues were fixed in 10% formalin, embedded in paraffin, and then sectioned at 5 mm. Mouse-antihuman MDR-1 (Chemicon, Temecula, CA, USA; 1:100 in phosphate-buffered saline containing 0.1% bovine serum albumin) and horseradish peroxidase–conjugated antimouse antibody (Santa Cruz Biotechnology, Santa Cruz, CA; 1:1000 in phosphate-buffered saline) were used, and the color was developed with diaminobenzidine. Semiquantitative
analysis was performed with 10 randomly selected views per slide at high magnification (×400) to calculate the positive and negative cell numbers within a photographic area (about 0.073 mm2). Positive percentage = number of positive cells/(positive cell number + negative cell number).
2.8. Statistical analysis The unpaired Student t test was used for analyzing the difference between keloid and normal cell populations in the expression of various genes and the difference in the survival percentages of drug-treated and untreated cells.
3. Results 3.1. Comparison of keloid and normal fibroblast growth potentials As shown in Table 3, there was no significant difference between keloid and normal fibroblasts during the first 6 days
2028
N. Song et al.
(P N .05). There were significantly more keloid fibroblasts than normal fibroblasts at days 7 and 8 (P b .05) when analyzed with an MTT assay.
was seen between the groups at passage 3 no matter the drug concentration, suggesting that in vitro culture can lead to loss of drug resistance in keloid fibroblasts (Fig. 1D).
3.2. Keloid fibroblasts exhibited resistance to vincristine
3.3. Keloid fibroblasts exhibited resistance to mitoxantrone
As shown in Fig. 1, vincristine could inhibit cell growth to various degrees at different concentrations. The inhibition rate ranged from 75% to 25%, depending on drug concentrations. Interestingly, when passage 1 cells were exposed to the drug at the concentrations of 1 (Fig. 1A and B), 10, and 50 nM (Fig. 1B), a more obvious inhibitory effect was found in normal cell populations than in keloid cells after 48 hours of drug treatment (P b .05; Fig. 1B). At passage 2, only 1 nM vincristine led to a significant difference (P b .05; Fig. 1C), and no significant difference
Similarly, when passage 1 keloid fibroblasts were exposed to mitoxantrone at 50 and 100 nM, significantly more resistance was found than in normal cell populations (P b .05) (Fig. 2A and B). However, the drug resistance disappeared at passages 2 and 3 (Fig. 2C and D), and a much stronger inhibitory effect on cell growth was found in the late-passage cells than in the first-passage cells, suggesting that in keloid cells, drug resistance may rely on the in vivo environment that helps to maintain the expression and functions of drug resistance–related molecules.
Fig. 3 MDR-1 expression in keloids and normal skin and in their derived cells. A, Immunohistochemical staining of MDR-1 in keloid (K) and normal (N) skin (photograph area is about 0.073 mm2). B, Average number of MDR-1–positive cells per microscope field. C, Average percentage of MDR-1–positive cells per microscope field. D, RT-PCR analysis of MDR-1 expression. E, Semiquantitative analysis of MDR-1 gene expression. *Statistically significant difference (P b .05). KF indicates keloid fibroblasts; NF, normal fibroblasts; Fib, fibroblasts.
Keloid transporter and drug resistance
2029
Fig. 4 Verapamil (Ver) abrogated resistance to vincristine (Vcr) in keloid fibroblasts. Cell density comparison between single-drug–treated and 2-drug–treated keloid and normal fibroblasts (Fib) (A) and cell survival rate comparison between single-drug–treated and 2-drug–treated keloid and normal fibroblasts at passage 1 (B), passage 2 (C), and passage 3 (D). *Statistically significant difference (P b .05). Bar = 100 μm.
3.4. Differential expression of MDR-1 between keloid and normal skin tissues In 3 keloid tissues and 3 normal skin samples, only a few cells in the latter were positive for MDR-1 by immunohistochemical staining. In contrast, more cells in keloid tissues were found to be expressing MDR-1. These positive cells were located mainly in the peripheral areas of the tissue (Fig. 3A). Semiquantitative analysis revealed that the average number of MDR-1–positive cells was significantly higher in keloid tissue (11.6 cells per photographic area) than in normal skin (2.87 cells per photographic area; Fig. 3B; P b .05). Nevertheless, the difference in the average percentage of positive cells between keloid (4.2%) and normal skin (3.49%) was not statistically significant (Fig. 3C) because there were more cells in the former. Interestingly, the positive keloid cells usually were round, whereas the positive dermal fibroblasts remained in a spindle shape, suggesting that keloid cells may be less differentiated. To confirm the differential expression of MDR-1, these cells in passage 1 were examined for expression of MDR-1 messenger RNA. Expression was much greater in keloid than in normal fibroblasts (Fig. 3D), and semiquantitative analysis revealed a significant difference in the gene expression of the 2 groups (Fig. 3E; P b .05). In addition, expression of the
MDR-1 gene was not detected at passages 2 and 3 in either group (data not shown).
3.5. Verapamil abrogated drug resistance in keloid fibroblasts To determine the role of membrane transporters in drug resistance, the effect of verapamil on drug resistance was examined. Treatment of both keloid and normal fibroblasts with verapamil (10 μM) alone had no significant effect on cell survival (data not shown). To pursue this finding, both keloid and normal fibroblasts were treated either with 1 nM vincristine alone or with 10 μM verapamil. As shown in Fig. 4, the survival rate of keloid cells was significantly lower in cells treated with 2 drugs than in the group treated with vincristine alone, suggesting that verapamil can abrogate the resistance of keloid fibroblasts to vincristine. This difference was observed in both passage 1 (Fig. 4B) and passage 2 (Fig. 4C) (P b .05). In contrast, no significant difference was found in normal fibroblasts between single-drug and 2-drug treatment in any passage (Fig. 4). Furthermore, no such effect was observed in the third-passage keloid cells (Fig. 4D), indicating that the abrogation mediated by verapamil
2030
N. Song et al.
depends on the expression and function of membrane transporter molecules. Verapamil's effect was further tested on mitoxantronetreated cells. As shown in Fig. 5, the survival rate of passage 1 keloid cells was significantly lower in the group treated with both 50 nM mitoxantrone and 10 μM verapamil than in the population treated with mitoxantrone alone (Fig. 5B). As expected, no such effect was observed in passage 2 (Fig. 5C) or passage 3 keloid fibroblasts (Fig. 5D) or in normal fibroblasts of any passages (Fig. 5), further confirming that verapamil's effect is closely related to the expression of membrane transporter molecules.
3, neither ABCB5 nor ABCG2 was detectable (data not shown). Interestingly, the expression of cytochrome P450 3A4 (CYP3A4), a nonmembrane transporter molecule, was significantly higher in passage 1 keloid fibroblasts than in passage 1 normal fibroblasts (Fig. 6; P b .05). However, expression was significantly down-regulated at passage 2 and barely detectable at passage 3 (data not shown), indicating that down-regulated expression of these drug resistance–related molecules may lead to reduced drug resistance in keloid fibroblasts with time.
3.6. Differential expression of other membrane transporters in keloid and normal fibroblasts
Keloid formation can be initiated by minor wounding or even spontaneously in nonwounded skin and usually is characterized by uncontrolled growth beyond the original wound boundaries, invasion of normal skin, and a high recurrence rate after therapy. These characteristics render keloids similar to a benign skin tumor. Because of this, chemotherapy has been used for keloid therapy [12-14]. Drug resistance is one of the clinical challenges in neoplasm treatment, which usually leads to the failure of cancer therapy or to recurrence [4,5]. Although there is no
To further explore the relation between drug resistance and the expression of drug resistance–related molecules, the reverse transcriptase (RT) PCR assay was used. As shown in Fig. 6, the expression of ABCB5 was significantly higher in passage 1 keloid fibroblasts than in passage 1 normal fibroblasts (P b .05). Although a difference was detected in ABCG2 expression, it was not significant. At passages 2 and
4. Discussion
Fig. 5 Verapamil (Ver) abrogated resistance to mitoxantrone (MX) in keloid fibroblasts (Fib). Cell density comparison between singledrug–treated and 2-drug–treated keloid and normal fibroblasts (A) and cell survival rate comparison between single-drug–treated and 2-drug– treated keloid and normal fibroblasts at passage 1 (B), passage 2 (C), and passage 3 (D). *Statistically significant difference (P b .05). Bar = 100 μm.
Keloid transporter and drug resistance
Fig. 6 RT-PCR examination of expression of other drug resistance genes (A) and semiquantitative analysis (B). *Statistically significant difference (P b .05). KF indicates keloid fibroblasts; NF, normal fibroblasts.
report yet of drug resistance in keloid fibroblasts, it would be reasonable to expect such a phenomenon, given the similar biological behaviors observed for keloids and benign skin tumors. As shown in Figs. 1 and 2, normal dermal fibroblasts were more sensitive to anticancer drugs (vincristine and mitoxantrone) than were keloid fibroblasts, indicating the presence of drug resistance in the latter. Membrane transporters play important roles in mediating chemosensitivity and resistance of cancer cells [15]. The ABC transporters are considered the major membrane transporters responsible for cancer drug resistance. Among them, MDR-1 (also known as ABCB1 or P-glycoprotein) is one of the best characterized membrane transporters. It is highly expressed in cancer cells and can pump drugs out of the cells and, thus, reduce drug accumulation to below toxic concentrations [16]. The other important membrane transporter is ABCG2, which is well known for its role in pumping out Hoechst 33342, an effect leading to the discovery of the side population [17]. In this study, vincristine and mitoxantrone were used for resistance investigation because both drugs are common anticancer chemotherapy agents and have been used in various drug resistance studies [18,19]. More importantly, resistance to vincristine is mediated mainly by MDR-1, whereas resistance to mitoxantrone is contributed mainly by ABCG2 and partly by MDR-1 [16]. This study revealed significantly up-regulated expression of MDR-1 (ABCB1) in keloid fibroblasts compared with normal fibroblasts at the messenger RNA level (Fig. 3D and E). In addition,
2031 immunohistochemistry showed more MDR-1–positive cells in keloid tissue than in normal skin (Fig. 3A and B). Furthermore, MDR-1–positive keloid cells exhibited roundness as opposed to the usual spindle shape. Contrarily, MDR-1–positive cells in normal skin remained spindle shaped. Such a phenomenon suggests that MDR-1 positive keloid cells represent a subpopulation important in keloid pathogenesis. Thus, it is likely that these cells could behave like keloid stem cells to give rise to more keloid fibroblasts, contributing to keloid growth and overproduction of extracellular matrices while keeping a proper ratio with fully differentiated keloid fibroblasts. In addition to MDR-1, ABCB5, another MDR family molecule, was more highly expressed in keloid cell populations than in normal cells, indicating that membrane transporters are important for drug resistance. This view is supported by the findings revealed in Figs. 4 and 5, which show that drug resistance could be abrogated by treatment with verapamil, an L-type calcium channel blocker, an effect that has been reported in other studies [15,18,19]. Moreover, drug resistance gradually declined along with reduced expression of membrane transporters, indicating that drug resistance in keloids relies on the presence of these proteins. The ABCG2 protein is another important membrane transporter. Although the mean expression was slightly higher in keloid fibroblasts than in normal fibroblasts, the difference was not statistically significant (Fig. 6). A previous study showed that the enhanced resistance to mitoxantrone could be mediated by mutated ABCG2 [20]. In addition, ABCG2 was the major molecule related to the discovery of the side population, a subpopulation usually less than 2% of the total, and, thus, may become a marker for isolating cancer stem cells [21]. Recently, keloid stem cells have been discovered and were proposed to contribute to keloid pathogenesis [8,9]. Therefore, the relationship between membrane transporters and keloid stem cells, as well as their roles in keloid pathogenesis, could be an interesting area for further investigation. Our findings that drug resistance and membrane transporter expression decreased and then disappeared with passage in culture also fit the expectation that the in vivo niche is important for maintaining the function of this particular cell subpopulation. In addition, many drug substrates of MDR-1 could also be the substrates of drug-metabolizing enzymes such as CYP3A4 [22]. This study demonstrated that CYP3A4 was more highly expressed in keloid than in normal fibroblasts (Fig. 6), indicating that drug resistance in keloid fibroblasts is a complicated process that may involve many different molecules. Overall, this preliminary study revealed the presence of drug resistance in keloid fibroblasts that was closely related to the enhanced expression of related membrane transporters. Further studies in this area may unveil the mechanism of keloid resistance to therapy and high recurrence rate, particularly the contribution of membrane transporters and keloid stem cells.
2032
References [1] Polyak K, Hahn WC. Roots and stems: stem cells in cancer. Nat Med 2006;12:296-300. [2] Ponti D, Costa A, Zaffaroni N, et al. Isolation and in vitro propagation of tumorigenic breast cancer cells with stem/progenitor cell properties. Cancer Res 2005;65:5506-11. [3] Singh SK, Clarke ID, Terasaki M, et al. Identification of a cancer stem cell in human brain tumors. Cancer Res 2003;63:5821-8. [4] Donnenberg VS, Donnenberg AD. Multiple drug resistance in cancer revisited: the cancer stem cell hypothesis. J Clin Pharmacol 2005;45: 872-7. [5] Gottesman MM, Fojo T, Bates SE. Multidrug resistance in cancer: role of ATP-dependent transporters. Nat Rev Cancer 2002;2:48-58. [6] Challen GA, Little MH. A side order of stem cells: the SP phenotype. Stem Cells 2006;24:3-12. [7] Bhatt RI, Brown MD, Hart CA, et al. Novel method for the isolation and characterisation of the putative prostatic stem cell. Cytometry A 2003;54:89-99. [8] Moon JH, Kwak SS, Park G, et al. Isolation and characterization of multipotent human keloid-derived mesenchymal-like stem cells. Stem Cells Dev 2008;17:713-24. [9] Zhang Q, Yamaza T, Kelly AP, et al. Tumor-like stem cells derived from human keloid are governed by the inflammatory niche driven by IL-17/IL-6 axis. PLoS One 2009;4:e7798. [10] Gao Z, Wu X, Song N, Zhang L, Liu W. Differential expression of growth differentiation factor-9 in keloids. Burns 2010;36:1289-95. [11] Niu Q, Zhao C, Jing Z. An evaluation of the colorimetric assays based on enzymatic reactions used in the measurement of human natural cytotoxicity. J Immunol Methods 2001;251:11-9.
N. Song et al. [12] Liu W, Wu X, Gao Z, Song N. Remodelling of keloid tissue into normal-looking skin. J Plast Reconstr Aesthet Surg 2008;61:1553-4. [13] Gupta S, Kalra A. Efficacy and safety of intralesional 5-fluorouracil in the treatment of keloids. Dermatology 2002;204:130-2. [14] Chi SG, Kim JY, Lee WJ, et al. Ear keloids as a primary candidate for the application of mitomycin C after shave excision: in vivo and in vitro study. Dermatol Surg 2011;37:168-75. [15] Huang Y, Sadee W. Membrane transporters and channels in chemoresistance and -sensitivity of tumor cells. Cancer Lett 2006;239:168-82. [16] Huang Y. Pharmacogenetics/genomics of membrane transporters in cancer chemotherapy. Cancer Metastasis Rev 2007;26:183-201. [17] Goodell MA, Brose K, Paradis G, Conner AS, Mulligan RC. Isolation and functional properties of murine hematopoietic stem cells that are replicating in vivo. J Exp Med 1996;183:1797-806. [18] Ford JM, Bruggemann EP, Pastan I, Gottesman MM, Hait WN. Cellular and biochemical characterization of thioxanthenes for reversal of multidrug resistance in human and murine cell lines. Cancer Res 1990;50:1748-56. [19] Huang R, Murry DJ, Kolwankar D, Hall SD, Foster DR. Vincristine transcriptional regulation of efflux drug transporters in carcinoma cell lines. Biochem Pharmacol 2006;71:1695-704. [20] Volk EL, Schneider E. Wild-type breast cancer resistance protein (BCRP/ABCG2) is a methotrexate polyglutamate transporter. Cancer Res 2003;63:5538-43. [21] Kim JB, Ko E, Han W, Shin I, Park SY, Noh DY. Berberine diminishes the side population and ABCG2 transporter expression in MCF-7 breast cancer cells. Planta Med 2008;74:1693-700. [22] Choudhuri S, Klaassen CD. Structure, function, expression, genomic organization, and single nucleotide polymorphisms of human ABCB1 (MDR1), ABCC (MRP), and ABCG2 (BCRP) efflux transporters. Int J Toxicol 2006;25:231-59.
www.elsevier.com/locate/humpath
Original contribution
Enhanced expression of membrane transporter and drug resistance in keloid fibroblasts☆ Nan Song a,b,1 , Xiaoli Wu a,b,1 , Zhen Gao a,b , Guangdong Zhou a,b,c , Wen Jie Zhang a,b,c , Wei Liu a,b,c,⁎ a
Department of Plastic and Reconstructive Surgery, Shanghai 9th People's Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai 200011, China b Shanghai Research Institute of Plastic and Reconstructive Surgery, Shanghai 200025, China c Shanghai Tissue Engineering Key Laboratory, Shanghai 200011, China Received 13 September 2011; revised 8 November 2011; accepted 15 December 2011
Keywords: Drug resistance; Keloid fibroblasts; MDR-1; Mitoxantrone; Vincristine
Summary The mechanisms of keloid resistance to therapy and high recurrence rate remain undefined. This study explored the difference in drug resistance between keloid and normal fibroblasts. Fibroblasts derived from 9 patients with keloid and 9 skin donors were randomly combined into 3 keloid cell pools (3 cases per pool) and 3 normal cell pools (3 cases per pool) and were compared for their resistance to vincristine and mitoxantrone and related molecule expression. The results revealed stronger resistance to both vincristine and mitoxantrone with a higher survival rate in keloid cells than in normal cells (P b .05). The resistance of keloid fibroblasts could be largely abrogated by verapamil treatment. In addition, messenger RNA expression levels of multiple-drug resistance-1, ABCB5 (P-glycoprotein family member), and cytochrome P450 3A4 but not ABCG2 (ATP-binding cassette transporter) were significantly higher in passage 1 keloid fibroblasts than in passage 1 normal fibroblasts; no significant difference was found in latter passages. Immunohistochemistry staining revealed significantly more multiple-drug resistance-1–positive cells (round) in keloid tissue than in normal skin (mostly spindle shaped) (P b .05) but no significant difference in the percentage of positive cells in the 2 groups. Enhanced expression of membrane transporters and increased resistance to chemotherapy agents may contribute to the keloid's resistance to therapy and the high posttherapy recurrence rate. © 2012 Elsevier Inc. All rights reserved.
1. Introduction ☆
This work was financially supported by the National Natural Science Foundation of China (Grants 30872694 and 30801194), Shanghai Natural Science Foundation (10ZR1417700), and Shanghai Health Bureau Foundation (to X. Wu). ⁎ Corresponding author. Department of Plastic and Reconstructive Surgery, Shanghai 9th People's Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai 200011, People's Republic of China. E-mail address: [email protected] (W. Liu). 1 These authors contributed equally to this work. 0046-8177/$ – see front matter © 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.humpath.2011.12.026
Keloids are difficult to cure due to their complex pathogenesis. Because of its invasion and uncontrolled growth, a keloid is considered a benign skin tumor. Despite tremendous efforts to understand their mechanism, advancement in therapy remains limited, suggesting that new investigations of the mechanism may be needed. In the past decade, progress in cancer biology study revealed that cancer stem cells may play an important role in
Keloid transporter and drug resistance
2025
Table 1
Patient information
Pool
Tissue type
Age (y)
Sex
Location
Pool
Tissue type
Age (y)
Sex
Location
1
Keloid-1 Keloid-2 Keloid-3 Keloid-4 Keloid-5 Keloid-6 Keloid-7 Keloid-8 Keloid-9
24 22 28 24 32 38 24 20 34
F F M F M F F M M
Shoulder Chest Chest Earlobe Shoulder Chest Chest Shoulder Back
1
Skin-1 Skin-2 Skin-3 Skin-4 Skin-5 Skin-6 Skin-7 Skin-8 Skin-9
18 28 32 24 20 29 33 32 28
M M M F F F F M F
Postauricle Leg Leg Abdomen Abdomen Leg Shoulder Abdomen Shoulder
2
3
2
3
Abbreviations: F, female; M, male.
disease development [1-3]. One of the challenges in cancer treatment is resistance to chemotherapeutic agents, which is mediated mainly by membrane transporters, particularly the ATP-binding cassette (ABC) transporter [4,5]. Furthermore, the discovery of cancer stem cells was based on the finding of a “side population” that does not stain strongly with Hoechst 33342 because of the activity of the membrane transporter ABCG2 [6,7]. Recently, stem cells have been discovered in keloid tissue and are believed to play a key role in keloid development, pathogenesis, and recurrence [8,9]. The purpose of this study was to investigate whether there is a drug resistance phenomenon in keloid fibroblasts by comparing their sensitivity to chemotherapeutic agents with that of normal dermal fibroblasts. In addition, we investigated whether there is differential expression of membrane transporter molecules in keloid and normal fibroblasts.
2. Patients and methods 2.1. Tissue specimens Nine patients with keloids without previous treatment and 9 donors with normal skin (all ethnically Chinese) were involved in this study (Table 1) and provided informed consent for tissue donation. All keloids were characterized by their spontaneous formation and overgrowth beyond the Table 2
original wound boundaries. The handling of human tissue was approved by the Ethics Committee of the Shanghai 9th People's Hospital.
2.2. Experimental design Keloid fibroblasts were randomly pooled into 3 populations (3 samples for each), and normal fibroblasts were likewise randomly pooled into 3 normal cell populations (3 samples for each) as detailed in Table 1. In addition, 3 cases were randomly selected from the patients with keloid and 3 from the donors to obtain tissue samples for immunohistochemical staining of multiple-drug resistance (MDR)-1 and MDR gene analysis.
2.3. Cell isolation and culture The procedure was performed as previously described [10]. Cells were cultured in Dulbecco modified Eagle medium (DMEM; GIBCO, Grand Island, NY) plus 10% fetal bovine serum (GIBCO).
2.4. MTT assay A (3-(4,5)-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was used as previously described [11]. Briefly, passage 1 keloid and normal fibroblasts were seeded in
Primers used in RT-PCR
Gene
Primer sequence (5′-3′)
Annealing temperature (°C)
Products size (base pairs)
MDR1
Sense: AGCAAAGGAGGCCAACATAC Antisense: ACTCTGCCATTCTGAAACACC Sense: GTTCCAGGATTGGCGTCTT Antisense: CAGTCATTGCTGCGGTTTC Sense: GGGTTCTCTTCTTCCTGACGACC Antisense: TGGTTGTGAGATTGACCAACAGACC Sense: CTGCTTCTCACGGGACTA Antisense: AAACAATGGGCAAAGTCA Sense: ATCATGTTTGAGACCTTCAA Antisense: CATCTCTTGCTCGAAGTCCA
58
309
55
153
63
218
55
392
55
318
ABCB5 ABCG2 CYP3A4 β-Actin
2026 Table 3 Groups
N. Song et al. Cell growth comparison between keloid and normal fibroblasts (OD reading) Day 1
Day 2
Day 3
Day 4
Day 5
Day 6
Day 7
Day 8
Keloid fibroblasts 0.132 ± 0.04 0.253 ± 0.05 0.335 ± 0.06 0.425 ± 0.03 0.404 ± 0.02 0.412 ± 0.03 0.408 ± 0.02 0.415 ± 0.04 Normal fibroblasts 0.143 ± 0.02 0.237 ± 0.03 0.314 ± 0.04 0.396 ± 0.02 0.385 ± 0.04 0.365 ± 0.04 0.354 ± 0.03 0.365 ± 0.02 P N.05 N.05 N.05 N.05 N.05 N.05 b.05 b.05
a 96-well plate (1000 cells/well) in 200 μL of DMEM; 200 μL DMEM was used to create a blank control. At the desired day postseeding, the optical density (OD) was determined at 490 nm by a microplate reader (GMBH A-1160; Dialab, Wien, Austria). Each test was repeated in 6 wells.
2.5. Drug resistance assay Three keloid and 3 normal cell populations at passages 1, 2, and 3 were tested for resistance to vincristine and mitoxantrone. Briefly, cells were seeded in 6-well plates (1 × 106 cells/well) to observe morphologic and cell density changes after drug treatment. In addition, cells from each
population were seeded in 96-well plates (1000 cells/well × 6 wells) to observe the effect of the drugs on cell proliferation using an MTT assay. At 24 hours postseeding, cells were treated with vincristine at concentrations of 1, 10, 50, or 100 nM or with mitoxantrone at 10, 50, 100, or 500 nM. After 48 hours, the cell survival percentage was determined by dividing the OD value of the drug-treated group by the value of the untreated group.
2.6. RT-PCR Total RNAs were extracted from the cells and reverse transcribed to complementary DNA using an RT kit (Takara,
Fig. 1 Keloid fibroblasts exhibit resistance to vincristine (Vcr). Cell density comparison between treated and untreated keloid and normal fibroblasts (A) and cell survival rate comparison between keloid and normal fibroblasts exposed to various drug concentrations at passage 1 (B), passage 2 (C), and passage 3 (D). *Statistically significant difference (P b .05). Bar = 100 μm.
Keloid transporter and drug resistance
2027
Fig. 2 Keloid fibroblasts exhibit resistance to mitoxantrone (MX). Cell density comparison between treated and untreated keloid and normal fibroblasts (A) and cell survival rate comparison between keloid and normal fibroblasts exposed to various drug concentrations at passage 1 (B), passage 2 (C), and passage 3 (D). *Statistically significant difference (P b .05). Bar = 100 μm.
Osaka, Japan) according to the manufacturer's protocol. Various primers were designed, as listed in Table 2, and polymerase chain reaction (PCR) was performed by initial denaturation for 5 minutes at 95°C followed by 29 cycles of 30 s at 95°C, 30 seconds at the annealing temperatures listed in Table 2, 45-second extension at 72°C, and 10-minute terminal extension at 72°C. Gene expression was analyzed by electrophoresis and semiquantified with band density analysis (Tanon, Shanghai, China) by dividing the expression of the examined gene by the β-actin level with 3 repetitions.
2.7. Immunohistochemistry staining As previously described [10], tissues were fixed in 10% formalin, embedded in paraffin, and then sectioned at 5 mm. Mouse-antihuman MDR-1 (Chemicon, Temecula, CA, USA; 1:100 in phosphate-buffered saline containing 0.1% bovine serum albumin) and horseradish peroxidase–conjugated antimouse antibody (Santa Cruz Biotechnology, Santa Cruz, CA; 1:1000 in phosphate-buffered saline) were used, and the color was developed with diaminobenzidine. Semiquantitative
analysis was performed with 10 randomly selected views per slide at high magnification (×400) to calculate the positive and negative cell numbers within a photographic area (about 0.073 mm2). Positive percentage = number of positive cells/(positive cell number + negative cell number).
2.8. Statistical analysis The unpaired Student t test was used for analyzing the difference between keloid and normal cell populations in the expression of various genes and the difference in the survival percentages of drug-treated and untreated cells.
3. Results 3.1. Comparison of keloid and normal fibroblast growth potentials As shown in Table 3, there was no significant difference between keloid and normal fibroblasts during the first 6 days
2028
N. Song et al.
(P N .05). There were significantly more keloid fibroblasts than normal fibroblasts at days 7 and 8 (P b .05) when analyzed with an MTT assay.
was seen between the groups at passage 3 no matter the drug concentration, suggesting that in vitro culture can lead to loss of drug resistance in keloid fibroblasts (Fig. 1D).
3.2. Keloid fibroblasts exhibited resistance to vincristine
3.3. Keloid fibroblasts exhibited resistance to mitoxantrone
As shown in Fig. 1, vincristine could inhibit cell growth to various degrees at different concentrations. The inhibition rate ranged from 75% to 25%, depending on drug concentrations. Interestingly, when passage 1 cells were exposed to the drug at the concentrations of 1 (Fig. 1A and B), 10, and 50 nM (Fig. 1B), a more obvious inhibitory effect was found in normal cell populations than in keloid cells after 48 hours of drug treatment (P b .05; Fig. 1B). At passage 2, only 1 nM vincristine led to a significant difference (P b .05; Fig. 1C), and no significant difference
Similarly, when passage 1 keloid fibroblasts were exposed to mitoxantrone at 50 and 100 nM, significantly more resistance was found than in normal cell populations (P b .05) (Fig. 2A and B). However, the drug resistance disappeared at passages 2 and 3 (Fig. 2C and D), and a much stronger inhibitory effect on cell growth was found in the late-passage cells than in the first-passage cells, suggesting that in keloid cells, drug resistance may rely on the in vivo environment that helps to maintain the expression and functions of drug resistance–related molecules.
Fig. 3 MDR-1 expression in keloids and normal skin and in their derived cells. A, Immunohistochemical staining of MDR-1 in keloid (K) and normal (N) skin (photograph area is about 0.073 mm2). B, Average number of MDR-1–positive cells per microscope field. C, Average percentage of MDR-1–positive cells per microscope field. D, RT-PCR analysis of MDR-1 expression. E, Semiquantitative analysis of MDR-1 gene expression. *Statistically significant difference (P b .05). KF indicates keloid fibroblasts; NF, normal fibroblasts; Fib, fibroblasts.
Keloid transporter and drug resistance
2029
Fig. 4 Verapamil (Ver) abrogated resistance to vincristine (Vcr) in keloid fibroblasts. Cell density comparison between single-drug–treated and 2-drug–treated keloid and normal fibroblasts (Fib) (A) and cell survival rate comparison between single-drug–treated and 2-drug–treated keloid and normal fibroblasts at passage 1 (B), passage 2 (C), and passage 3 (D). *Statistically significant difference (P b .05). Bar = 100 μm.
3.4. Differential expression of MDR-1 between keloid and normal skin tissues In 3 keloid tissues and 3 normal skin samples, only a few cells in the latter were positive for MDR-1 by immunohistochemical staining. In contrast, more cells in keloid tissues were found to be expressing MDR-1. These positive cells were located mainly in the peripheral areas of the tissue (Fig. 3A). Semiquantitative analysis revealed that the average number of MDR-1–positive cells was significantly higher in keloid tissue (11.6 cells per photographic area) than in normal skin (2.87 cells per photographic area; Fig. 3B; P b .05). Nevertheless, the difference in the average percentage of positive cells between keloid (4.2%) and normal skin (3.49%) was not statistically significant (Fig. 3C) because there were more cells in the former. Interestingly, the positive keloid cells usually were round, whereas the positive dermal fibroblasts remained in a spindle shape, suggesting that keloid cells may be less differentiated. To confirm the differential expression of MDR-1, these cells in passage 1 were examined for expression of MDR-1 messenger RNA. Expression was much greater in keloid than in normal fibroblasts (Fig. 3D), and semiquantitative analysis revealed a significant difference in the gene expression of the 2 groups (Fig. 3E; P b .05). In addition, expression of the
MDR-1 gene was not detected at passages 2 and 3 in either group (data not shown).
3.5. Verapamil abrogated drug resistance in keloid fibroblasts To determine the role of membrane transporters in drug resistance, the effect of verapamil on drug resistance was examined. Treatment of both keloid and normal fibroblasts with verapamil (10 μM) alone had no significant effect on cell survival (data not shown). To pursue this finding, both keloid and normal fibroblasts were treated either with 1 nM vincristine alone or with 10 μM verapamil. As shown in Fig. 4, the survival rate of keloid cells was significantly lower in cells treated with 2 drugs than in the group treated with vincristine alone, suggesting that verapamil can abrogate the resistance of keloid fibroblasts to vincristine. This difference was observed in both passage 1 (Fig. 4B) and passage 2 (Fig. 4C) (P b .05). In contrast, no significant difference was found in normal fibroblasts between single-drug and 2-drug treatment in any passage (Fig. 4). Furthermore, no such effect was observed in the third-passage keloid cells (Fig. 4D), indicating that the abrogation mediated by verapamil
2030
N. Song et al.
depends on the expression and function of membrane transporter molecules. Verapamil's effect was further tested on mitoxantronetreated cells. As shown in Fig. 5, the survival rate of passage 1 keloid cells was significantly lower in the group treated with both 50 nM mitoxantrone and 10 μM verapamil than in the population treated with mitoxantrone alone (Fig. 5B). As expected, no such effect was observed in passage 2 (Fig. 5C) or passage 3 keloid fibroblasts (Fig. 5D) or in normal fibroblasts of any passages (Fig. 5), further confirming that verapamil's effect is closely related to the expression of membrane transporter molecules.
3, neither ABCB5 nor ABCG2 was detectable (data not shown). Interestingly, the expression of cytochrome P450 3A4 (CYP3A4), a nonmembrane transporter molecule, was significantly higher in passage 1 keloid fibroblasts than in passage 1 normal fibroblasts (Fig. 6; P b .05). However, expression was significantly down-regulated at passage 2 and barely detectable at passage 3 (data not shown), indicating that down-regulated expression of these drug resistance–related molecules may lead to reduced drug resistance in keloid fibroblasts with time.
3.6. Differential expression of other membrane transporters in keloid and normal fibroblasts
Keloid formation can be initiated by minor wounding or even spontaneously in nonwounded skin and usually is characterized by uncontrolled growth beyond the original wound boundaries, invasion of normal skin, and a high recurrence rate after therapy. These characteristics render keloids similar to a benign skin tumor. Because of this, chemotherapy has been used for keloid therapy [12-14]. Drug resistance is one of the clinical challenges in neoplasm treatment, which usually leads to the failure of cancer therapy or to recurrence [4,5]. Although there is no
To further explore the relation between drug resistance and the expression of drug resistance–related molecules, the reverse transcriptase (RT) PCR assay was used. As shown in Fig. 6, the expression of ABCB5 was significantly higher in passage 1 keloid fibroblasts than in passage 1 normal fibroblasts (P b .05). Although a difference was detected in ABCG2 expression, it was not significant. At passages 2 and
4. Discussion
Fig. 5 Verapamil (Ver) abrogated resistance to mitoxantrone (MX) in keloid fibroblasts (Fib). Cell density comparison between singledrug–treated and 2-drug–treated keloid and normal fibroblasts (A) and cell survival rate comparison between single-drug–treated and 2-drug– treated keloid and normal fibroblasts at passage 1 (B), passage 2 (C), and passage 3 (D). *Statistically significant difference (P b .05). Bar = 100 μm.
Keloid transporter and drug resistance
Fig. 6 RT-PCR examination of expression of other drug resistance genes (A) and semiquantitative analysis (B). *Statistically significant difference (P b .05). KF indicates keloid fibroblasts; NF, normal fibroblasts.
report yet of drug resistance in keloid fibroblasts, it would be reasonable to expect such a phenomenon, given the similar biological behaviors observed for keloids and benign skin tumors. As shown in Figs. 1 and 2, normal dermal fibroblasts were more sensitive to anticancer drugs (vincristine and mitoxantrone) than were keloid fibroblasts, indicating the presence of drug resistance in the latter. Membrane transporters play important roles in mediating chemosensitivity and resistance of cancer cells [15]. The ABC transporters are considered the major membrane transporters responsible for cancer drug resistance. Among them, MDR-1 (also known as ABCB1 or P-glycoprotein) is one of the best characterized membrane transporters. It is highly expressed in cancer cells and can pump drugs out of the cells and, thus, reduce drug accumulation to below toxic concentrations [16]. The other important membrane transporter is ABCG2, which is well known for its role in pumping out Hoechst 33342, an effect leading to the discovery of the side population [17]. In this study, vincristine and mitoxantrone were used for resistance investigation because both drugs are common anticancer chemotherapy agents and have been used in various drug resistance studies [18,19]. More importantly, resistance to vincristine is mediated mainly by MDR-1, whereas resistance to mitoxantrone is contributed mainly by ABCG2 and partly by MDR-1 [16]. This study revealed significantly up-regulated expression of MDR-1 (ABCB1) in keloid fibroblasts compared with normal fibroblasts at the messenger RNA level (Fig. 3D and E). In addition,
2031 immunohistochemistry showed more MDR-1–positive cells in keloid tissue than in normal skin (Fig. 3A and B). Furthermore, MDR-1–positive keloid cells exhibited roundness as opposed to the usual spindle shape. Contrarily, MDR-1–positive cells in normal skin remained spindle shaped. Such a phenomenon suggests that MDR-1 positive keloid cells represent a subpopulation important in keloid pathogenesis. Thus, it is likely that these cells could behave like keloid stem cells to give rise to more keloid fibroblasts, contributing to keloid growth and overproduction of extracellular matrices while keeping a proper ratio with fully differentiated keloid fibroblasts. In addition to MDR-1, ABCB5, another MDR family molecule, was more highly expressed in keloid cell populations than in normal cells, indicating that membrane transporters are important for drug resistance. This view is supported by the findings revealed in Figs. 4 and 5, which show that drug resistance could be abrogated by treatment with verapamil, an L-type calcium channel blocker, an effect that has been reported in other studies [15,18,19]. Moreover, drug resistance gradually declined along with reduced expression of membrane transporters, indicating that drug resistance in keloids relies on the presence of these proteins. The ABCG2 protein is another important membrane transporter. Although the mean expression was slightly higher in keloid fibroblasts than in normal fibroblasts, the difference was not statistically significant (Fig. 6). A previous study showed that the enhanced resistance to mitoxantrone could be mediated by mutated ABCG2 [20]. In addition, ABCG2 was the major molecule related to the discovery of the side population, a subpopulation usually less than 2% of the total, and, thus, may become a marker for isolating cancer stem cells [21]. Recently, keloid stem cells have been discovered and were proposed to contribute to keloid pathogenesis [8,9]. Therefore, the relationship between membrane transporters and keloid stem cells, as well as their roles in keloid pathogenesis, could be an interesting area for further investigation. Our findings that drug resistance and membrane transporter expression decreased and then disappeared with passage in culture also fit the expectation that the in vivo niche is important for maintaining the function of this particular cell subpopulation. In addition, many drug substrates of MDR-1 could also be the substrates of drug-metabolizing enzymes such as CYP3A4 [22]. This study demonstrated that CYP3A4 was more highly expressed in keloid than in normal fibroblasts (Fig. 6), indicating that drug resistance in keloid fibroblasts is a complicated process that may involve many different molecules. Overall, this preliminary study revealed the presence of drug resistance in keloid fibroblasts that was closely related to the enhanced expression of related membrane transporters. Further studies in this area may unveil the mechanism of keloid resistance to therapy and high recurrence rate, particularly the contribution of membrane transporters and keloid stem cells.
2032
References [1] Polyak K, Hahn WC. Roots and stems: stem cells in cancer. Nat Med 2006;12:296-300. [2] Ponti D, Costa A, Zaffaroni N, et al. Isolation and in vitro propagation of tumorigenic breast cancer cells with stem/progenitor cell properties. Cancer Res 2005;65:5506-11. [3] Singh SK, Clarke ID, Terasaki M, et al. Identification of a cancer stem cell in human brain tumors. Cancer Res 2003;63:5821-8. [4] Donnenberg VS, Donnenberg AD. Multiple drug resistance in cancer revisited: the cancer stem cell hypothesis. J Clin Pharmacol 2005;45: 872-7. [5] Gottesman MM, Fojo T, Bates SE. Multidrug resistance in cancer: role of ATP-dependent transporters. Nat Rev Cancer 2002;2:48-58. [6] Challen GA, Little MH. A side order of stem cells: the SP phenotype. Stem Cells 2006;24:3-12. [7] Bhatt RI, Brown MD, Hart CA, et al. Novel method for the isolation and characterisation of the putative prostatic stem cell. Cytometry A 2003;54:89-99. [8] Moon JH, Kwak SS, Park G, et al. Isolation and characterization of multipotent human keloid-derived mesenchymal-like stem cells. Stem Cells Dev 2008;17:713-24. [9] Zhang Q, Yamaza T, Kelly AP, et al. Tumor-like stem cells derived from human keloid are governed by the inflammatory niche driven by IL-17/IL-6 axis. PLoS One 2009;4:e7798. [10] Gao Z, Wu X, Song N, Zhang L, Liu W. Differential expression of growth differentiation factor-9 in keloids. Burns 2010;36:1289-95. [11] Niu Q, Zhao C, Jing Z. An evaluation of the colorimetric assays based on enzymatic reactions used in the measurement of human natural cytotoxicity. J Immunol Methods 2001;251:11-9.
N. Song et al. [12] Liu W, Wu X, Gao Z, Song N. Remodelling of keloid tissue into normal-looking skin. J Plast Reconstr Aesthet Surg 2008;61:1553-4. [13] Gupta S, Kalra A. Efficacy and safety of intralesional 5-fluorouracil in the treatment of keloids. Dermatology 2002;204:130-2. [14] Chi SG, Kim JY, Lee WJ, et al. Ear keloids as a primary candidate for the application of mitomycin C after shave excision: in vivo and in vitro study. Dermatol Surg 2011;37:168-75. [15] Huang Y, Sadee W. Membrane transporters and channels in chemoresistance and -sensitivity of tumor cells. Cancer Lett 2006;239:168-82. [16] Huang Y. Pharmacogenetics/genomics of membrane transporters in cancer chemotherapy. Cancer Metastasis Rev 2007;26:183-201. [17] Goodell MA, Brose K, Paradis G, Conner AS, Mulligan RC. Isolation and functional properties of murine hematopoietic stem cells that are replicating in vivo. J Exp Med 1996;183:1797-806. [18] Ford JM, Bruggemann EP, Pastan I, Gottesman MM, Hait WN. Cellular and biochemical characterization of thioxanthenes for reversal of multidrug resistance in human and murine cell lines. Cancer Res 1990;50:1748-56. [19] Huang R, Murry DJ, Kolwankar D, Hall SD, Foster DR. Vincristine transcriptional regulation of efflux drug transporters in carcinoma cell lines. Biochem Pharmacol 2006;71:1695-704. [20] Volk EL, Schneider E. Wild-type breast cancer resistance protein (BCRP/ABCG2) is a methotrexate polyglutamate transporter. Cancer Res 2003;63:5538-43. [21] Kim JB, Ko E, Han W, Shin I, Park SY, Noh DY. Berberine diminishes the side population and ABCG2 transporter expression in MCF-7 breast cancer cells. Planta Med 2008;74:1693-700. [22] Choudhuri S, Klaassen CD. Structure, function, expression, genomic organization, and single nucleotide polymorphisms of human ABCB1 (MDR1), ABCC (MRP), and ABCG2 (BCRP) efflux transporters. Int J Toxicol 2006;25:231-59.