Enhanced nitrate removal from surface water in a denitrifying woodchip bioreactor with a heterotrophic nitrifying and aerobic denitrifying fungus

Journal Pre-proofs Enhanced nitrate removal from surface water in a denitrifying woodchip bioreactor with a heterotrophic nitrifying and aerobic denitrifying fungus Zongbao Yao, Liu Yang, Fang Wang, Linqi Tian, Na Song, Helong Jiang PII: DOI: Reference:

S0960-8524(20)30217-0 https://doi.org/10.1016/j.biortech.2020.122948 BITE 122948

To appear in:

Bioresource Technology

Received Date: Revised Date: Accepted Date:

30 November 2019 29 January 2020 31 January 2020

Please cite this article as: Yao, Z., Yang, L., Wang, F., Tian, L., Song, N., Jiang, H., Enhanced nitrate removal from surface water in a denitrifying woodchip bioreactor with a heterotrophic nitrifying and aerobic denitrifying fungus, Bioresource Technology (2020), doi: https://doi.org/10.1016/j.biortech.2020.122948

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2020 Elsevier Ltd. All rights reserved.

Enhanced nitrate removal from surface water in a denitrifying woodchip bioreactor with a heterotrophic nitrifying and aerobic denitrifying fungus

Zongbao Yaoa, Liu Yanga, b, Fang Wanga, c, Linqi Tiana, b, Na Songa, Helong Jianga, *

a

State Key Laboratory of Lake Science and Environment, Nanjing Institute of

Geography and Limnology, Chinese Academy of Sciences, Nanjing 210008, China b

Graduate University of Chinese Academy of Sciences, Beijing 100049, China;

c

College of Biology and Environment, Nanjing Forestry University, Nanjing 210037,

China

* Corresponding author. Address: Nanjing Institute of Geography and Limnology, Chinese Academy of Sciences, 73 East Beijing Road, Nanjing 210008, PR China E-mail address: [email protected] (H.-L. Jiang).

1 / 34

Abstract A heterotrophic nitrifying and aerobic denitrifying fungus was isolated from lake water and identified as Penicillium tropicum strain IS0293. The strain exhibited efficient heterotrophic nitrification-aerobic denitrification ability and could utilize ammonium, nitrite and nitrate as a sole nitrogen source. Batch tests demonstrated that strain IS0293 can remove nitrate using variety of organic carbon compounds as carbon sources. The effect of woodchip leachate collected at different degradation times on denitrification performance of the strain was also investigated. Furthermore, two denitrifying woodchip bioreactors were constructed to assess the bioaugmention of strain IS0293 for nitrate removal from surface water. Results demonstrated that the incubation of strain IS0293 enhanced the nitrate removal efficiency of the bioreactor. In addition, the average effluent TOC content of the bioaugmention bioreactor was 38.22% lower than the control bioreactor. This study would be valuable to develop an effective technology for nitrate-laden surface water under aerobic conditions.

Keywords: Penicillium tropicum strain IS0293; Aerobic denitrification; Heterotrophic nitrification; Denitrifying woodchip bioreactor; Nitrate removal

2 / 34

Introduction Nitrate (NO3-) is one of the common nitrogenous pollutants in groundwater and surface water. Excessive NO3- discharge from the disposal of municipal and industrial wastes and agricultural drainage can cause eutrophication of receiving water such as lakes, rivers, reservoirs and coastal ocean (Howarth, 2008). High concentration of nitrate in drinking water can potentially cause health problems in people (Camargo & Alonso, 2006; Hakeem et al., 2016). In addition, in order to protect sensitive aquatic life in aquatic ecosystem, the concentration of nitrate should below 2 mg N L−1 because of its toxic effects (Camargo et al., 2005). Many physicochemical and biological approaches have been used to remove nitrate from water (Hakeem et al., 2016). As a low cost and useful technology, denitrification woodchip bioreactor is increasingly being used to remove nitrate in groundwater and surface water (Christianson et al., 2012; Jaynes et al., 2008). Heterotrophic anaerobic denitrifying bacteria in the bioreactor are usually served as the functional microorganisms that reduce nitrate to nitrogen gases using solid carbon (C) substances (typically woodchips) to serve as electron donors. However, the activity of anaerobic denitrification microorganisms could be inhibited by high concentration of dissolved oxygen in water (Gomez et al., 2002; Halaburka et al., 2017; Korner & Zumft, 1989; Tan & Ng, 2008). In addition, the organic matter decomposed from woodchips will also be used by aerobic microorganisms in the bioreactor treating surface water, result the reduction of electron donor content for heterotrophic denitrifying microorganisms. Therefore, how to attenuate the impact of DO on the 3 / 34

denitrification woodchip bioreactor is a key issue in solving the application of the bioreactor on nitrate removal from surface waters, such as stream, pond and farmland catchment. Recently, some microbes have attracted great attentions owing to the capacity of efficiently remove nitrate in water under aerobic condition, and thereby enabling them be used in nitrate removal from surface water. Aerobic denitrifying microbes can use both nitrate and oxygen as the electron accepter. A lot of aerobic denitrifying microbes have been isolated and identified from different environments, such as marine sediment (Duan et al., 2015), reservoir sediment (Huang et al., 2015), river biofilm (Lv et al., 2017), activated sludge (Guo et al., 2016). Additionally, some aerobic denitrifying microbes have the capability of heterotrophic nitrification, thus they are defined as heterotrophic nitrifying and aerobic denitrifying (HN-AD) microbes. Hitherto, researchers have isolated many heterotrophic nitrifying and aerobic denitrifying bacteria, such as Alcaligenes faecalis (Joo et al., 2005), Bacillus cereus (Kim et al., 2005), Pseudomonas stutzeri (Zhang et al., 2011), Klebsiella pneumonia (Padhi et al., 2013), and Ochrobactrum anthropic (Lei et al., 2019). Beyond the function of remove inorganic nitrogen (ammonium, nitrite, and nitrate), the HN-AD microbes remove organic matter in water. Researchers have studied the potential application of these HN-AD microbes on water pollution remediation. Nitrogen was efficient removed by Klebsiella sp. in a purification tank bioreactor treating oligotrophic domestic sewage (Jin et al., 2019). The heterotrophic nitrifier and aerobic denitrifier Klebsiella pneumoniae isolated from domestic wastewater 4 / 34

favored the removal of nitrogenous compounds from domestic wastewater (Padhi et al., 2013). Ammonium and organic carbon were simultaneously removed by Alcaligenes faecalis strain NR in a continuous bioreactor treating ammonium-rich wastewater under aerobic conditions (Zhao et al., 2017). In addition, HN-AD microbes can also be used to treat piggery wastewater (Chen et al., 2019; Joo et al., 2006), saline wastewater (Duan et al., 2015), pharmaceutical wastewater (Yang et al., 2019). Therefore, it is of great importance to isolate and identify novel HN-AD microbes and to investigate the application of the HN-AD microbes on bioremediation of nitrogen-polluted water. Nitrate and DO can be removed simultaneously by HN-AD microbes. Therefore, inoculation of the HN-AD microbes into the denitrification woodchip bioreactor might alleviate the negative effects of DO on the operation of the bioreactor. To address this hypothesis, a heterotrophic nitrifying and denitrifier was newly isolated from Xuanwu Lake and identified as Penicillium tropicum strain IS0293. The characteristics of nitrogen and organic carbon removal by Penicillium tropicum strain IS0293 under different conditions were investigated. Furthermore, two lab-scale denitrifying woodchip bioreactors were developed to evaluate the bioaugmented of nitrate removal from surface water by the strain IS0293 inoculation. The results of this study would be helpful to provide a biological reinforcement method for nitrate removal from surface water by denitrifying woodchip bioreactors.

2. Materials and methods 5 / 34

2.1 Medium The enrichment medium (EM) consisted of (per liter of distilled water): 2.0 g of KNO3, 0.1 g of KH2PO4, 1.0 g of K2HPO4, 0.2 g of MgSO4·7H2O and 5.0 g of glucose. The basal medium (BM) consisted of (per liter of distilled water): 0.39 g NH4Cl, 0.1 g of KH2PO4, 1.0 g of K2HPO4, 0.2 g of MgSO4·7H2O, 0.03 g FeSO4·7H2O, 5.0 g of glucose and 1 ml of a trace element solution, which contained the following components (per liter of distilled water): 0.35 g EDTA, 0.2 g MnSO4·7H2O, 0.2 g ZnSO4·7H2O, 0.1 g CuSO4·5H2O, 0.1 g H3BO3, 0.09 g Co(NO3)2·6H2O and 0.1 g Na2MoO4. A Bromothymol blue (BTB) medium used for bacteria isolation was prepared according to the method described by (Takaya et al., 2003) and with slight modified, consisting of (per liter of distilled water): 2.73 g sodium acetate, 1.0 g L-asparagine, 1.0 g KNO3, 0.2 g CaCl2·2H2O, 1.0 g KH2PO4, 0.006 g FeSO4·7H2O, 1.0 g MgSO4·7H2O, 16-18 g agar and 1 ml BTB solution (1% in ethanol); pH 7.0-7.3. Each medium was autoclaved for 20 min at 121 °C before use. 2.2. Isolation and taxonomic identification Lake water was collected from Xuanwu Lake, an urban lake located in Nanjing City (Jiangsu, China). The collected water sample (10 mL) was transferred to a 250 mL Erlenmeyer flask containing 90 mL of sterilized EM media. The Erlenmeyer flask was then sealed with a sterile breathable and shaken at 120 rpm at 30 °C for 2 days. Under the same conditions, the incubated suspension (10 mL) was transferred to 90 mL of fresh sterilized EM media and incubated for another 2 days. Whereafter, the 6 / 34

bacterial suspension (1 mL) was transferred to a 250 mL Erlenmeyer flask containing 100 mL of sterilized BM media for incubating heterotrophic nitrifying and denitrifying bacteria under condition of 30 °C and 120 rpm for 2 days. This inoculation culture process was repeated 3 times continuously. Finally, the bacteria solution was inoculated on the BTB solid medium by gradient dilution method, and then cultured the inoculated petri dish in a 30 °C isothermal incubator until obvious colonies were formed. Several harvested purified colonies were tested for ammonium oxidation performance using BM medium. To evaluate the aerobic denitrification capability, nitrate or nitrite were used as the sole nitrogen source instead of ammonium. Finally, the purified strains with high denitrification and ammonium oxidation efficiency were suspended in glycerol solution (25% v:v) at -80 °C for long-term storage. The genomic DNA of pure isolated fungal was extracted using Ezup Column Bacteria Genomic DNA Purification Kit (Sangon Biotech Cat. No SK8255) by following the manufacture’s instruction. The extracted DNA of the isolated strain IS0293 was used for PCR amplification by internal transcribed spacer (ITS) gene sequencing techniques using primer ITS1 (5＇TCCGTAGGTGAACCTGCGG3′) and ITS4 (5′TCCTCCGCTTATTGATATGC3′) according to previous study (Kumar et al., 2011). The PCR was carried out as follows: pre-denaturation at 94 °C for 4 min, followed by 30 cycles of denaturation at 94 °C for 0.75 min, annealing at 55 °C for 0.75 min, and extension at 72 °C for 1 min, with a final extension at 72 °C for 10 min. The amplified product was purified and sequenced by Sangon Biotech Co., Ltd., 7 / 34

(Shanghai, China). The gene sequence was compared with that of other microorganisms by BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Finally, a phylogenetic tree was constructed by the neighbor-joining method in MEGA 5.1 software. 2.3. Assessment of nitrogen removal performance In order to investigate the heterotrophic nitrification performance, strain IS0293 cell suspension was inoculated into 250 mL flasks containing 100 mL of BM and ammonium was used as nitrogen source in the batch experiment. For aerobic denitrifying activity, nitrite or nitrate were used as the sole nitrogen source instead of ammonium. The nitrogen removal experiments were carried out under the condition of 120 rpm and 30 °C with the initial pH at 7. To observe the effect of different incubation temperatures on nitrate removal and cell growth, strain IS0293 cell suspension was inoculated into 250 mL flasks containing 100 mL of BM. The medium was then incubated at six different temperatures of 4, 10, 20, 25, 30 and 35 °C. To investigate the effects of different carbon sources on the nitrate removal performance of strain IS0293, peptone (Pep), glucose (Glu), sodium propionate (SP), sodium carbonate (SC), cellulose (Cel), starch (Sta) and sodium acetate (SA) were used as a sole carbon source instead of glucose in BM. For the denitrification capacity in the woodchip leachate experiment, the leachate collected at day 0, 30, 60, 90, and 150 was used as medium. The release solutions were diluted to the same TOC concentration and then sterilized before used. The single-factor batch tests were 8 / 34

carried out at 30 °C with 100 ml BM media, and the initial pH was controlled at 7. The rotation rates of the different carbon sources and woodchip leachate experiments were set at 120 rpm. 2.4. The bioaugmented denitrifying woodchip bioreactor To investigate the enhancement of strain IS0293 to nitrate removal from surface water by denitrifying woodchip bioreactor, two denitrifying woodchip bioreactors were conducted as shown in Fig. 1. The upflow denitrifying woodchip bioreactor apparatus (DWB1, DWB2) consisted of a cylindrical vessel with an internal diameter of 8 cm and a working volume of 4 L. Mixed hardwood woodchips (1-3 mm diam) were added to the bottom of the bioreactors (half the height of the reactor). The polypropylene biofilm carriers with a diameter of 10mm filled in the up part of the bioreactor. 15 L min-1 air was blown into the biofilm carriers part to decrease the negative effect of organic matter released from woodchips on the receiving water. The columns were flushed with deionized water twice before operation of the bioreactors to minimize the first flush of dissolved organic carbon (Schipper et al., 2010) to receive water. During the first month of operation of DWB1, the strain IS0293 cell suspension (50mL) was injected into the reactor from the inlet every 5 days. DWB2 was used as the control reactor with no microbial cell suspension was injected. The bioreactors were fed with lake water and stored vertically at room temperature (30.0 ± 2.0 °C). Hydraulic retention time (HRT) of the two bioreactors was maintained at 6 h.

2.5. Analytical methods 9 / 34

The optical density (OD600) was determined by a spectrophotometer (UV-1800, Shimadzu, Japan) at 600 nm. The concentrations of NH4+-N, NO2--N, and NO3--N were determined by protocols given in the Standard Methods (APHA, 2005). The dry cell weight (DCW) was measured by weighing the strain IS0293 cell pellet after being dried at 105 °C overnight. The cell pellet was obtained by first centrifuging (6000 rpm, 10 min) the broth culture and then decanting the supernatant. The TOC and TN were analyzed using an elemental analyzer (EA3000, Euro-Vector, Milan, Italy). 2.6 Statistical analyses SPSS version 22.0 for Windows (SPSS Inc., Chicago, IL) software was used to perform the significant differences, including Pearson correlation analysis and variance (ANOVA).

3. Results and discussion 3.1. Isolation and identification The pH increase during denitrification process can cause the color change of BTB medium (Takaya et al., 2003). Eleven positive colonies were isolated from BTB medium plates. Further tests showed that five strains were able to perform denitrification under aerobic conditions. Only one strain achieved simultaneous nitrification and denitrification without nitrite accumulation and named strain IS0293. The internal transcribed spacer (ITS) sequence (586 bp) revealed that strain IS0293 was affiliated to genus Penicillium with high gene sequence similarity (100%) with 10 / 34

the fungus, Penicillium sumatraense strain CBS 127366. The phylogenetic tree constructed by neighbor-joining analysis of fungal ITS gene sequence of the strain IS0293 was shown in Fig. S1. 3.2. Assessment of heterotrophic nitrification and aerobic denitrification capability The ammonium removal and growth characteristics of strain IS0293 in the nitrification medium at 30 °C were shown in Fig. 2a. Cell growth reached a stationary phase within the first 24h, during which the OD600 increased from 0.02 to 0.49. The maximum growth rate was 0.17 h-1. NH4+ decreased from 97.62 mg N L-1 to 0.57 mg N L-1 during the 48 h culture with an average nitrification ratio of 2.02 mg N L-1 h-1. Meanwhile, TOC decreased from 509.5 mg L-1 to 45.4 mg L-1. These results showed that the strain IS0293 could use organic carbon as a carbon source for nitrification. The nitrogen removal and cell synthesis resulted in the decrease of TOC (Wang et al., 2019). About 96% TN was removed during the experiment, and the trend was similar to that of NH4+ removal. There was no obvious accumulation of nitrite and nitrate (< 1 mg L-1) during the heterotrophic nitrification process. This result was in agreement with the characteristics of the microbial strains reported in previous studies, such as Acinetobacter junii YB (Lei et al., 2015), Cupriavidus sp. S1 (Sun et al., 2016), Acinetobacter sp. JR1 (Yang et al., 2019), and Pseudomonas sp. JQ-H3 (Wang et al., 2019), but contrasts with the previously described significant accumulation peak of NO3- by Acinetobacter sp. HA2 (Yao et al., 2013). This strain can reduce NO2- or NO3- under aerobic conditions (in the results that follows). No accumulation of NO2or NO3- probably due to the NO2- or NO3- produced by NH4+ oxidation can be quickly 11 / 34

reduced in the microbial cells. This also indicates that the rate of NO2- or NO3reduction is greater than the rate of NH4+ oxidation, the latter was therefore speculated to be the rate-limiting step in simultaneous nitrification and denitrification process. Nitrate and nitrite were used as sole nitrogen sources in the tests to investigate the aerobic denitrification capability of the strain IS0293. The concentration of NO2decreased rapidly during 0-32 h and the average rate reached 1.98 mg N L-1 h-1 when NO2- severed as a sole nitrogen source (Fig. 2b). The cell density (OD600) increased to 0.49 at 24 h, and the maximum growth rate was 0.16 h-1. As shown in Fig. 2c, the concentration of NO3- decreased significantly within 24 h of incubation. About 96.9% of the NO3- was removed in 24 h and the average removal rate was 4.86 mg L-1 h-1. The highest NO3- removal rate was 23.23 mg N L-1 h-1, which was higher than aerobic denitrifying fungus Hanseniaspora uvarum strain KPL108 (9.37 mg N L-1 h-1) (Zhang et al., 2018) and aerobic denitrifying bacteria such as 8.87 mg N L-1 h-1 for Pseudomonas stutzeri strain ZF31 (Huang et al., 2015), 2.2 mg N L-1 h-1 for Klebsiella pneumoniae CF-S9 (Padhi et al., 2013) and 3.1 mg N L-1 h-1 for Rhodococcus sp. strain CPZ24 (Chen et al., 2012). The cell growth rate trend of the strain IS0293 was corresponded to the NO3- removal and with a mmax 0.13 h-1. Little accumulation of NO2- (< 0.37 mg L-1) occurred during the experiment with NO3- as the sole nitrogen source. The TN and TOC profiles in the NO3- and NO2- denitrification tests followed a pattern similar to the removal of NO3- or NO2-. The results of sole nitrogen source experiments demonstrated that the isolated strain IS0293 could utilize these three inorganic nitrogen species separately for assimilation and dissimilation. The 12 / 34

heterotrophic nitrifying and aerobic denitrifying fungus Penicillium tropicum strain IS0293 described here is expected to be useful for nitrate removal from aerobic water. The nitrate removal and cell growth characteristics of Penicillium tropicum strain IS0293 at different temperatures in the basic medium was investigated in shaking cultures, as shown in Fig. S2. The gradually increased NO3- removal rate with the temperature increased from 4 to 30 °C agrees with the cell growth rate results. Patterns of nitrate removal and cell growth at 30 and 35 °C were nearly the same. Although the cell growth and denitrification performance was limited under low temperature conditions (Zhang et al., 2011), it can be seen from Fig. S2 that Penicillium tropicum strain IS0293 can adapt to a wide temperature range (10-30 35 °C).

3.3. Aerobic denitrification performance with different carbon sources As shown in Fig. 3, different carbon sources have different effects on strain IS0293 cell growth and denitrification performance. According to the results of NO3- removal rate and cell growth rate within 24 h, strain IS0293 preferred peptone followed by glucose, sodium propionate, cellulose, starch and sodium acetate. In addition, the results showed that cellulose could be used as carbon source for strain IS0293. Result demonstrated that the strain IS0293 in this study can also use cellulose for denitrification and cell growth. As a degradation-resistant organic matter, cellulose cannot be directly used by many denitrifying microorganisms (Hellman et al., 2019; Yu et al., 2011). Therefore, the heterotrophic nitrifying and aerobic denitrifying 13 / 34

fungus isolated in this study has advantage in the utilization of refractory organic matter (such as cellulose) for the NO3- removal by denitrification. Furthermore, the strain IS0293 can use a variety of carbon sources, indicating that the strain can be used for the removal of NO3- using cellulose-containing composite organic matter as a carbon source. For example, it can be used to enhance denitrifying woodchip bioreactor. 3.4. Aerobic denitrification performance with woodchip leachate as carbon sources Woodchip is a common carbon source in solid denitrification bioreactor (Halaburka et al., 2017; Schipper et al., 2010). Aerobic denitrifying bacteria might have an application prospects for treating surface water with high dissolved oxygen concentration. Therefore, characteristics of dissolved organic matter in the woodchip leachate and aerobic denitrification performance of the isolated strain IS0293 in woodchip leachate were investigated. The 3-component parallel factor analysis (PARAFAC) model was used to verify the organic matter composition of the leachate from woodchip (Fig. 4). The spectral characteristics of the three components were corresponded to the previously reported components in aquatic environments (Kim et al., 2006). The peaks of Component 1 (Ex 220, 275/Em 337 nm), Component 2 (Ex 235, 305/Em 427 nm), and Component 3 (Ex 275, 365/Em 471 nm) were ascribed to humic acid-like substances, protein-like substances, and fulvic acid-like substances, respectively. The relative fluorescence contents of protein-like substances in woodchip leachate decreased with time (Fig. 5a). On the contrary, humic acid-like substances and fulvic acid-like substances showed the opposite trend. The plausible 14 / 34

explanation is that protein-like substances are more bioavailable than humic-like substances and fulvic acid-like substances and are therefore preferred (Abusallout & Hua, 2017). Fig. 5b presents the NO3- removal rate and cell growth rate of strain IS0293 in the culture experiment with woodchip leachate as carbon source. Although the NO3removal rate and cell growth rate of strain IS0293 gradually decreased with the woodchip degradation time, the two rates with 180th day leachate as the medium were still about 56.78% and 48.57% of the experiments performed with 1th day leachate, respectively. The results demonstrated that strain IS0293 could utilize the woodchip leachate at different stages of degradation for assimilation and dissimilation. As a recalcitrant component (Asmala et al., 2013), the proportion of humic-like substances in woodchip leachate increased with the degradation time. The results of this study indicated that even the degradation-resistant cellulose could still be used by strain IS0293 for cell growth. Therefore, although the proportion of the recalcitrant component (humic-like substances and fulvic acid-like substances) of the residue leachate gradually increases with degradation time, the strain IS0293 can still use these organic substances for cell growth. Generally, the increase in the content of more aromatic and oxidized fractions components will negatively affect the denitrification rate (Barnes et al., 2012; Findlay & Sinsabaugh, 1999). If Penicillium tropicum strain IS0293 is used in the denitrification process, we infer that the strain can alleviate this negative effect. 3.5. The bioaugmented denitrifying woodchip bioreactor by strain IS0293 15 / 34

To further investigate the feasibility of application of strain IS0293 in nitrate removal of surface water, two denitrifying woodchip bioreactors (DWB1, bioreactor inoculated with strain IS0293; and DWB2, control bioreactor) were constructed. Fig. 6 presents the long-term performance of DWB1 and DWB2. The average concentration of NO3- in the effluent of DWB1 was 1.44 mg N L-1 with an average removal efficiency of 93.99% within 180 day’s operation. The average effluent NO3concentration of DWB2 (4.80 mg N L-1) was higher than that of DWB1, and the average removal rate was 16.76% lower than that of DWB1. The results suggested that the inoculation of strain IS0293 could improve the NO3- removal rate of the reactor. Furthermore, the number of days of DWB1 operation with the effluent NO3concentration below 2 mg N L-1 was about 140 days which was greater than that of DWB2 (63 days). The concentration of NH4+ in the effluent of DWB1 was lower than that in DWB2 in 1-15 d. The plausible explanation was that the heterotrophic nitrification process was performed under the aerobic condition by biofilm on the biofilm carriers formed by the inoculation of strain IS0293 in DWB1. The effluent NH4+ concentration of the two reactors were both below 0.1 mg L-1 after day 21. The effluent NO2- profile of DWB1 and DWB2 followed a pattern similar to NH4+. In this study, the inoculation of strain IS0293 into denitrifying woodchip bioreactor showed a good performance for TOC removal in DWB1. The TOC concentrations in the effluent of DWB1 were almost all lower than DWB2 after day 21 and the average effluent TOC content of DWB1 was 38.22% lower than that in DWB2. This indicated that strain IS0293 consume part of the TOC while removing NH4+ and NO3- under 16 / 34

aerobic condition in DWB1. Unexpectedly, the content of TOC in effluent of DWB1 was lower than that in influent, the result indicating that the inoculated strain IS0293 enhanced the removal of TOC. Negative effect of high TOC concentration in the effluent of denitrifying woodchip bioreactor to receiving water has always been plagues the practical application of the bioreactor (Abusallout & Hua, 2017; Moorman et al., 2010). Even though previous studies attempted to reduce the TOC concentration in the effluent by constructing aerobic biofilms in the reactor, the aerobic biofilms that degrade TOC require long incubation time (Yao et al., 2019). The low bioavailability of organic matter released from later degradation stage of woodchips will impede the removal of TOC (Abusallout & Hua, 2017; Asmala et al., 2013). In this study, TOC can be quickly removed by strain IS0293 after the bioreactor was constructed, which reduces the negative effect of TOC concentration in the effluent of the reactor to the receiving water. Furthermore, strain IS0293 can use the recalcitrant component (humic-like substances and fulvic acid-like substances) of the residue leachate for denitrification in the later degradation stage of woodchips. Therefore, the stable operation time of the bioreactor was prolonged by the inoculation of strain IS0293. The merit of the inoculation of heterotrophic nitrifying and aerobic denitrifying strain IS0293 into woodchip includes following four aspects: firstly, strain IS0293 enhanced the removal rate of nitrate in the reactor. The high concentration of DO in the influent results in the appearance of an aerobic zone at the bottom of the reactor with the resultant formation of a biofilm on the woodchips by the inculcation of strain 17 / 34

IS0293. Compared with the control reactor, this section of aerobic denitrification zone can improve the removal capacity of nitrate in the reactor. Moreover, the inoculated strain IS0293 could utilize nitrate under aerobic conditions in the upper biofilm part of DWB1 (with aeration). Secondly, inoculation of strain IS0293 into the woodchip bioreactor can reduce the concentration of ammonium in the effluent at the initial stage of the reactor. Mineralization of dissolved organic nitrogen to ammonium (Hargreaves, 1998) and dissimilatory reduction of nitrate to ammonium (Burgin & Hamilton, 2007) may lead to the increase of ammonium concentration. Ammonium was oxidized by strain IS0293 through heterotrophic nitrification process which resulted in the ammonium concentration of DWB1 lower than the control reactor. Thirdly, the stable operation of the reactor according with the criterion of the effluent NO3- concentration below 2 mg N L-1 was prolonged by the inoculation of IS0293. With the operation of the reactor, the aerobic zone formed at the bottom of the column bioreactor will gradually expand upward (Fig. S3), thus adversely affecting the anaerobic denitrification performance of the woodchip part. It is especially encouraging that the inoculated strain IS0293 could be denitrified under aerobic conditions even if the aerobic zone at the bottom of the column bioreactor was enlarged, which ensured stability of nitrate removal of the bioreactor. Finally, TOC removal efficiency of the denitrifying woodchip bioreactor was enhanced by the inoculated strain IS0293 resulted in the effluent TOC concentration of the reactor lower than influent. Woodchips are often used as the carbon source for solid phase denitrification reactor (Addy et al., 2016; Christianson et al., 2012; 18 / 34

Schipper et al., 2010). Denitrifying microorganisms transfer electron from organic matter leached from woodchips to nitrate and reduce nitrate to nitrogen gas. In addition, strain IS0293 could grow with the recalcitrant component, such as humic-like substances and fulvic acid-like substances in the woodchip leachate. Microorganisms capable of degrading low-molecular weight organic matter will form microbial communities that can effectively degrade high-molecular-weight organic matter with those capable of degrading high-molecular-weight organic matte (Li et al., 2014). The biofilm formed on the surface of woodchips and biofilm carriers by strain IS0293 and other aerobic heterotrophic microorganisms could be beneficial to the degradation of the original DOM in lake water and the DOM leached from woodchips. Further study will focus on the analysis of the microbial community and identify the functional microorganisms degraded the refractory organic matter.

4. Conclusions Penicillium tropicum strain IS0293, isolated from lake water, can use ammonium, nitrite and nitrate as the sole nitrogen source for cell growth with efficient ability of heterotrophic nitrification-aerobic denitrification. Results demonstrated that strain IS0293 can remove nitrate using variety of organic carbon compounds and woodchip leachate as carbon sources. Nitrate and TOC removal from surface water of a denitrifying woodchip bioreactor was enhanced by the inoculation of strain IS0293. The heterotrophic nitrifying and aerobic denitrifying fungus reduced the negative effect of dissolved oxygen in surface water on the performance denitrifying woodchip 19 / 34

bioreactor.

Acknowledgements This work was supported by the National Natural Science Foundation of China (51609234), the Natural Science Foundation of Jiangsu Province (BK20161089).

References (1) Abusallout, I., Hua, G. 2017. Characterization of dissolved organic carbon leached from a woodchip bioreactor. Chemosphere, 183, 36-43. (2) Addy, K., Gold, A.J., Christianson, L.E., David, M.B., Schipper, L.A., Ratigan, N.A. 2016. Denitrifying bioreactors for nitrate removal: A meta-analysis. Journal of Environmental Quality, 45(3), 873-881. (3) APHA, A., WEF. 2005. Standard Methods for Examination of Water and Wastewater. American Public Health Association, Washington DC. (4) Asmala, E., Autio, R., Kaartokallio, H., Pitkanen, L., Stedmon, C.A., Thomas, D.N. 2013. Bioavailability of riverine dissolved organic matter in three Baltic Sea estuaries and the effect of catchment land use. Biogeosciences, 10(11), 6969-6986. (5) Barnes, R.T., Smith, R.L., Aiken, G.R. 2012. Linkages between denitrification and dissolved organic

matter

quality,

Boulder

Creek

watershed,

Colorado.

Journal

of

Geophysical

Research-Biogeosciences, 117(G1). (6) Burgin, A.J., Hamilton, S.K. 2007. Have we overemphasized the role of denitrification in aquatic ecosystems? A review of nitrate removal pathways. Frontiers in Ecology and the Environment, 5(2), 20 / 34

89-96. (7) Camargo, J.A., Alonso, A. 2006. Ecological and toxicological effects of inorganic nitrogen pollution in aquatic ecosystems: A global assessment. Environment International, 32(6), 831-849. (8) Camargo, J.A., Alonso, A., Salamanca, A. 2005. Nitrate toxicity to aquatic animals: a review with new data for freshwater invertebrates. Chemosphere, 58(9), 1255-1267. (9) Chen, P., Li, J., Li, Q.X., Wang, Y., Li, S., Ren, T., Wang, L. 2012. Simultaneous heterotrophic nitrification and aerobic denitrification by bacterium Rhodococcus sp CPZ24. Bioresource Technology, 116, 266-270. (10) Chen, S., He, S., Wu, C., Du, D. 2019. Characteristics of heterotrophic nitrification and aerobic denitrification bacterium Acinetobacter sp. T1 and its application for pig farm wastewater treatment. Journal of Bioscience and Bioengineering, 127(2), 201-205. (11) Christianson, L.E., Bhandari, A., Hailers, M.J. 2012. A practice-oriented review of woodchip bioreactors for subsurface agricultural drainage. Applied Engineering in Agriculture, 28(6), 861-874. (12) Duan, J., Fang, H., Su, B., Chen, J., Lin, J. 2015. Characterization of a halophilic heterotrophic nitrification-aerobic denitrification bacterium and its application on treatment of saline wastewater. Bioresource Technology, 179, 421-428. (13) Findlay, S., Sinsabaugh, R.L. 1999. Unravelling the sources and bioavailability of dissolved organic matter in lotic aquatic ecosystems. Marine and Freshwater Research, 50(8), 781-790. (14) Gomez, M.A., Hontoria, E., Gonzalez-Lopez, J. 2002. Effect of dissolved oxygen concentration on nitrate removal from groundwater using a denitrifying submerged filter. Journal of Hazardous Materials, 90(3), 267-278. (15) Guo, L., Zhao, B., An, Q., Tian, M. 2016. Characteristics of a novel aerobic denitrifying 21 / 34

bacterium, Enterobacter cloacae strain HNR. Applied Biochemistry and Biotechnology, 178(5), 947-959. (16) Hakeem, K.R., Sabir, M., Ozturk, M., Akhtar, M.S., Ibrahim, F.H., Ashraf, M., Ahmad, M.S.A. 2016. Nitrate and nitrogen oxides: sources, health effects and their remediation. in: Reviews of environmental contamination and toxicology, Springer, pp. 183-217. (17) Halaburka, B.J., LeFevre, G.H., Luthy, R.G. 2017. Evaluation of mechanistic models for nitrate removal in woodchip bioreactors. Environmental Science & Technology, 51(9), 5156-5164. (18) Hargreaves, J.A. 1998. Nitrogen biogeochemistry of aquaculture ponds. Aquaculture, 166(3-4), 181-212. (19) Hellman, M., Bonilla-Rosso, G., Widerlund, A., Juhanson, J., Hallin, S. 2019. External carbon addition for enhancing denitrification modifies bacterial community composition and affects CH4 and N2O production in sub-arctic mining pond sediments. Water Research, 158, 22-33. (20) Howarth, R.W. 2008. Coastal nitrogen pollution: A review of sources and trends globally and regionally. Harmful Algae, 8(1), 14-20. (21) Huang, T., Guo, L., Zhang, H., Su, J., Wen, G., Zhang, K. 2015. Nitrogen-removal efficiency of a novel aerobic denitrifying bacterium, Pseudomonas stutzeri strain ZF31, isolated from a drinking-water reservoir. Bioresource Technology, 196, 209-216. (22) Jaynes, D.B., Kaspar, T.C., Moorman, T.B., Parkin, T.B. 2008. In situ bioreactors and deep drain-pipe installation to reduce nitrate losses in artificially drained fields. Journal of Environmental Quality, 37(2), 429-436. (23) Jin, P., Chen, Y., Xu, T., Cui, Z., Zheng, Z. 2019. Efficient nitrogen removal by simultaneous heterotrophic nitrifying-aerobic denitrifying bacterium in a purification tank bioreactor amended with 22 / 34

two-stage dissolved oxygen control. Bioresource Technology, 281, 392-400. (24) Joo, H.-S., Hirai, M., Shoda, M. 2006. Piggery wastewater treatment using Alcaligenes faecalis strain No. 4 with heterotrophic nitrification and aerobic denitrification. Water Research, 40(16), 3029-3036. (25) Joo, H.S., Hirai, M., Shoda, M. 2005. Characteristics of ammonium removal by heterotrophic nitrification-aerobic denitrification by Alcaligenes faecalis no. 4. Journal of Bioscience and Bioengineering, 100(2), 184-191. (26) Kim, J.K., Park, K.J., Cho, K.S., Nam, S.W., Park, T.J., Bajpai, R. 2005. Aerobic nitrification-denitrification by heterotrophic Bacillus strains. Bioresource Technology, 96(17), 1897-1906. (27) Kim, S., Kaplan, L.A., Hatcher, P.G. 2006. Biodegradable dissolved organic matter in a temperate and a tropical stream determined from ultra-high resolution mass spectrometry. Limnology and Oceanography, 51(2), 1054-1063. (28) Korner, H., Zumft, W.G. 1989. Expression of denitrification enzymes in response to the dissolved-oxygen level and respiratory substrate in continuous culture of pseudomonas-stutzeri. Applied and Environmental Microbiology, 55(7), 1670-1676. (29) Kumar, S., Kaushik, N., Edrada-Ebel, R., Ebel, R., Proksch, P. 2011. Isolation, characterization, and bioactivity of endophytic fungi of Tylophora indica. World Journal of Microbiology & Biotechnology, 27(3), 571-577. (30) Lei, X., Jia, Y., Chen, Y., Hu, Y. 2019. Simultaneous nitrification and denitrification without nitrite accumulation by a novel isolated Ochrobactrum anthropic LJ81. Bioresource Technology, 272, 442-450. 23 / 34

(31) Yang, L., Ren, Y., Liang, X., L., Zhao, S., Wang, J., Xia, Z. 2015. Nitrogen removal characteristics of a heterotrophic nitrifier Acinetobacter junii YB and its potential application for the treatment of high-strength nitrogenous wastewater. Bioresource Technology, 193, 227-233. (32) Li, D., Alidina, M., Drewes, J.E. 2014. Role of primary substrate composition on microbial community structure and function and trace organic chemical attenuation in managed aquifer recharge systems. Applied Microbiology and Biotechnology, 98(12), 5747-5756. (33) Lv, P., Luo, J., Zhuang, X., Zhang, D., Huang, Z., Bai, Z. 2017. Diversity of culturable aerobic denitrifying bacteria in the sediment, water and biofilms in Liangshui River of Beijing, China. Scientific Reports, 7, 1-12. (34) Moorman, T.B., Parkin, T.B., Kaspar, T.C., Jaynes, D.B. 2010. Denitrification activity, wood loss, and N2O emissions over 9 years from a wood chip bioreactor. Ecological Engineering, 36(11), 1567-1574. (35) Padhi, S.K., Tripathy, S., Sen, R., Mahapatra, A.S., Mohanty, S., Maiti, N.K. 2013. Characterisation of heterotrophic nitrifying and aerobic denitrifying Klebsiella pneumoniae CF-S9 strain for bioremediation of wastewater. International Biodeterioration & Biodegradation, 78, 67-73. (36) Schipper, L.A., Robertson, W.D., Gold, A.J., Jaynes, D.B., Cameron, S.C. 2010. Denitrifying bioreactors-an approach for reducing nitrate loads to receiving waters. Ecological Engineering, 36(11), 1532-1543. (37) Sun, Z., Lv, Y., Liu, Y., Ren, R. 2016. Removal of nitrogen by heterotrophic nitrification-aerobic denitrification of a novel metal resistant bacterium Cupriavidus sp S1. Bioresource Technology, 220, 142-150. (38) Takaya, N., Catalan-Sakairi, M.A.B., Sakaguchi, Y., Kato, I., Zhou, Z.M., Shoun, H. 2003. 24 / 34

Aerobic denitrifying bacteria that produce low levels of nitrous oxide. Applied and Environmental Microbiology, 69(6), 3152-3157. (39) Tan, T.W., Ng, H.Y. 2008. Influence of mixed liquor recycle ratio and dissolved oxygen on performance of pre-denitrification submerged membrane bioreactors. Water Research, 42(4-5), 1122-1132. (40) Wang, X., Wang, W., Zhang, Y., Sun, Z., Zhang, J., Chen, G., Li, J. 2019. Simultaneous nitrification and denitrification by a novel isolated Pseudomonas sp. JQ-H3 using polycaprolactone as carbon source. Bioresource technology, 288, 121506. (41) Yang, J., Wang, Y., Chen, H., Lyu, Y. 2019. Ammonium removal characteristics of an acid-resistant bacterium Acinetobacter sp. JR1 from pharmaceutical wastewater capable of heterotrophic nitrification-aerobic denitrification. Bioresource Technology, 274, 56-64. (42) Yao, S., Ni, J., Ma, T., Li, C. 2013. Heterotrophic nitrification and aerobic denitrification at low temperature by a newly isolated bacterium, Acinetobacter sp HA2. Bioresource Technology, 139, 80-86. (43) Yao, Z., Wang, C., Song, N., Jiang, H. 2019. Development of a hybrid biofilm reactor for nitrate removal from surface water with macrophyte residues as carbon substrate. Ecological Engineering, 128, 1-8. (44) Yu, D., Yang, M., Gao, B., Liu, W. 2011. Disposal of domestic sewage by heterotrophic nitrification-aerobic denitrifier bacteria immobilized with bacterial cellulose membrane. Fresenius Environmental Bulletin, 20(2), 398-404. (45) Zhang, H., Zhao, Z., Kang, P., Wang, Y., Feng, J., Jia, J., Zhang, Z. 2018. Biological nitrogen removal and metabolic characteristics of a novel aerobic denitrifying fungus Hanseniaspora uvarum 25 / 34

strain KPL108. Bioresource technology, 267, 569-577. (46) Zhang, J., Wu, P., Bo, H., Yu, Z. 2011. Heterotrophic nitrification and aerobic denitrification by the bacterium Pseudomonas stutzeri YZN-001. Bioresource Technology, 102(21), 9866-9869. (47) Zhao, B., Tian, M., An, Q., Ye, J., Guo, J.S. 2017. Characteristics of a heterotrophic nitrogen removal bacterium and its potential application on treatment of ammonium-rich wastewater. Bioresource Technology, 226, 46-54.

26 / 34

Figure Captions Fig. 1. Schematic diagram of the denitrifying woodchip bioreactor in this study. Fig. 2. The nitrogen removal patterns and growth of strain IS0293 using the different nitrogen sources. (a) Ammonium; (b): Nitrite; (c): Nitrate. Values are means ± SD (error bars) for three replicates. Fig. 3. Effect of carbon source on ammonium removal and the growth of Penicillium tropicum strain IS0293. Pep: peptone, Glu: glucose, SP: sodium propionate, SC: sodium carbonate, Cel: cellulose, Sta: starch, SA: sodium acetate. Values are means ± SD (error bars) for three replicates. Fig. 4. EEM spectrum of woodchip leachate. Fig. 5. The relative fluorescence contents of the components in woodchip leachate (a) and nitrate removal rate and cell growth rate of Penicillium tropicum strain IS0293 in woodchip leachate (b) collected at different degradation times. Values are means ± SD (error bars) for three replicates. Fig. 6. Performance of denitrifying woodchip bioreactors. DWB1, bioreactor inoculated with strain IS0293; DWB2, control bioreactor without inoculated with strain IS0293. Profiles for (a) NO3-, (b) TOC, (c) NO2-, and (d) NH4+ concentration in the influent and effluent of denitrifying bioreactor.

27 / 34

Fig. 1.

Woodchips Screen Air bubble

sampling port

Biofilm carrier

Air pump

Cell suspension inlet

Peristaltic pump

Lake water storage tank

28 / 34

120

100

NO3-

NO2-

OD600

NH4+

TN

TOC

0.8

800

0.6

600

80

0.4

60

OD600

Nitrogen concentration (mg N L-1)

(a)

400

40 0.2

200

0.0

0

0.8

1000

TOC concentration (mg L-1)

Fig. 2.

20

0 0

8

16

24

32

40

48

140 120

NO2-

NO3-

OD600

NH4+

TN

TOC 800 0.6

100

600

80 0.4 60

OD600

Nitrogen concentration (mg N L-1)

(b)

400

40

0.2 200

TOC concentration (mg L-1)

Time (h)

20 0.0

0 0

8

16

24

32

40

0

48

Time (h)

120

0.8

NO3-

NO2-

OD600

NH4+

TN

TOC

1000

0.6

100 80

0.4 60

800

600

400 40

0.2 200

20 0.0

0 0

8

16

24

32

Time (h)

29 / 34

40

48

0

TOC concentration (mg L-1)

140

OD600

Nitrogen concentration (mg N L-1)

(c)

Fig. 3. 8

0.25

Cell growth rate 0.20

6

0.15

4 0.10

2 0.05

0

0.00

SA

SP

Glu

Sta

30 / 34

Pep

Cel

SC

Cell growth rate (h-1)

NO3- removal rate (mg N L-1 h-1)

NO3- removal rate

Fig. 4.

31 / 34

Fig. 5. (a)

70 Humic-like Protein Fulvic acids

Percent content (%)

60

50

40

30

20 0

30

60

90

120

150

180

Decomposition time of woodchip (day)

(b) 6

0.20 NO3- removal rate

Cell growth rate

0.15

Cell growth rate (h-1)

NO3- removal rate (mg N L-1 h-1)

5

4

3

0.10

2

0.05 1

0 0

30

60

90

120

Decomposition time of woodchip (day)

32 / 34

150

0.00 180

Fig. 6. 40

Influent of DWB1 Influent of DWB2

(b)

Effluent of DWB1 Effluent of DWB2

60 Influent of DWB1 Influent of DWB2

30

20

10

40

30

20

10

0

0

0

30

60

90

120

150

180

0

30

60

Time (day)

(d)

120

150

180

3 Influent of DWB1 Influent of DWB2

Effluent of DWB1 Effluent of DWB2

NH4+-N concentration (mg L-1)

Influent of DWB1 Influent of DWB2

90

Time (day)

(c) 0.8 NO2--N concentration (mg L-1)

Effluent of DWB1 Effluent of DWB2

50

TOC concentration (mg L-1)

NO3--N concentration (mg L-1)

(a)

0.6

0.4

0.2

0.0

Effluent of DWB1 Effluent of DWB2

2

1

0 0

30

60

90

120

150

180

Time (day)

0

30

60

90

120

150

180

Time (day)

CRediT author statement Enhanced nitrate removal from surface water in a denitrifying woodchip bioreactor with a heterotrophic nitrifying and aerobic denitrifying fungus

Zongbao Yao, Liu Yang, Fang Wang, Linqi Tian, Na Song, Helong Jiang*

CRediT author statement: Zongbao Yao: Writing- Reviewing and Editing, Methodology, Software, Writing Original Draft, Supervision, Project administration. Liu Yang: Data curation, Formal analysis. Fang Wang: Visualization, Investigation, Resources. Linqi Tian: Data 33 / 34

Curation. Na Song: Software, Validation. Helong Jiang: Conceptualization, Project administration

Declaration of interests √ ☒ The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

☐The authors declare the following financial interests/personal relationships which may be considered as potential competing interests:

Highlights 1. Penicillium tropicum strain IS0293 was isolated from surface water and identified. 2. The strain IS0293 can remove NO3- using variety of organic carbon substances. 3. Nitrate and TOC removal in a DWB was enhanced by strain IS0293 inoculation. 4. The strain showed capacity for prolonging the stable operation time of DWB.

34 / 34