- Email: [email protected]
Enhanced osmoregulatory ability marks the smoltification period in developing chum salmon (Oncorhynchus keta)
Comparative Biochemistry and Physiology, Part A 238 (2019) 110565
Contents lists available at ScienceDirect
Comparative Biochemistry and Physiology, Part A journal homepage: www.elsevier.com/locate/cbpa
Enhanced osmoregulatory ability marks the smoltification period in developing chum salmon (Oncorhynchus keta)
T
⁎
Marty Kwok-Shing Wonga, , Shigenori Nobatab, Susumu Hyodoa a b
Laboratory of Physiology, Atmosphere and Ocean Research Institute, The University of Tokyo, Chiba, Japan International Coastal Research Center, Atmosphere and Ocean Research Institute, the University of Tokyo, Otsuchi, Iwate, Japan
A R T I C LE I N FO
A B S T R A C T
Keywords: Seawater tolerance Sodium/potassium ATPase Sodium‑potassium-chloride cotransporter Sodium/hydrogen exchanger Cystic fibrosis transmembrane conductance regulator Plasma sodium ion Glucocorticoid receptor
The freshwater (FW) life of chum salmon is short, as they migrate to the ocean soon after emergence from the substrate gravel of natal waters. The alevins achieve seawater (SW) acclimating ability at an early developmental stage and the details of smoltification are not clear. We examined the stage-dependent SW acclimating ability in chum salmon alevins and found a sharp increase in SW tolerance during development that resembles the physiological parr-smolt transformation seen in other salmonids. Perturbation of plasma Na+ after SW exposure was prominent from the hatched embryo stage to emerged alevins, but the plasma Na+ became highly stable and more resistant to perturbation soon after complete absorption of yolk. Marker gene expression for SW-ionocytes including Na/K-ATPase (NKA α1b), Na-K-Cl cotransporter 1a (NKCC1a), Na/H exchanger 3a (NHE3a), cystic fibrosis transmembrane conductance regulators (CFTR I and CFTR II) were all upregulated profoundly at the same stage when the alevins were challenged by SW, suggesting that the stability of plasma Na+ concentration was partly a result of elevated osmoregulatory capability. FW-ionocyte markers including NKA α1a and NHE3b were consistently downregulated independent of stage by SW exposure, suggesting that embryos at all stages respond to salinity challenge, but the increase in SW osmoregulatory capability is restricted to the developmental stage after emergence. We propose that the “smoltification period” is condensed and integrated into the early development of chum salmon, and our results can be extrapolated to the future studies on hormonal controls and developmental triggers for smoltification in salmonids.
1. Introduction Smoltification is commonly referenced as the parr-smolt transformation, which is composed of morphological, physiological and behavioral changes in salmonid species for their seawater (SW) adaptability for out-migration (Hogasen, 1998; McCormick et al., 1998; Stefansson et al., 2008). Most salmonid species spend considerable time (one-half to three years) in freshwater (FW) as parr, which is characterized morphologically by the vertical stripes (also known as parr marks) on their bodies. Before downstream SW migration, the parr marks disappear and the body becomes silvery in color, which is often used as the morphological marker for smolting. The osmoregulatory and behavioral changes are synchronized with the silvering in many salmonid species. However, these changes are uncoupled processes and can be manipulated independently by environmental cues including temperature and photoperiod in Atlantic salmon (Salmo salar) (McCormick et al., 2000).
Chum salmon (Oncorhynchus keta) and pink salmon (O. gorbuscha) migrate downstream soon after emergence (Stefansson et al., 2008) and their seawater acclimating abilities appear to be higher than in other species at the same stages (McCormick, 2006). The branchial Na/KATPase (NKA) activity of chum salmon (0.4–0.5 g) in FW was twice higher than Atlantic salmon (0.2–0.4 g) in FW, suggesting that chum salmon may possess a higher intrinsic osmoregulatory ability at young age (McCormick et al., 1991). In pink salmon, SW tolerance increased before emergence of alevins and the pattern resembles the smolt window, suggesting a new pattern of smoltification in the species with short FW lives (Gallagher et al., 2012). It is intriguing whether similar smoltification pattern occurs in chum salmon, thus we develop the physiological and morphological markers to study the osmoregulatory changes in this species. In Sanriku and Hokkaido areas of Japan, hatchery release programs of chum salmon fry is an important practice for population
Abbreviations: CFTR, cystic fibrosis transmembrane conductance regulator; FW, Freshwater; GR, Glucocorticoid receptor; NHE, sodium/hydrogen exchanger; NKA, sodium/potassium ATPase; NKCC, sodium‑potassium-chloride cotransporter; SW, Seawater ⁎ Corresponding author. E-mail address: [email protected] (M.K.-S. Wong). https://doi.org/10.1016/j.cbpa.2019.110565 Received 3 June 2019; Received in revised form 29 August 2019; Accepted 30 August 2019 Available online 04 September 2019 1095-6433/ © 2019 Elsevier Inc. All rights reserved.
Comparative Biochemistry and Physiology, Part A 238 (2019) 110565
M.K.-S. Wong, et al.
Table 1 Effects of salinity transfer on the plasma sodium concentration or osmolality in chum salmonim. Body weight (developmental stages)
Salinity transfer
Plasma Na+ / osmolality changes after 24 h transfer
References
0.24–0.36 g (eye-stage)
FW → 50% SW FW → 100% SW FW → SW FW → SW FW → SW FW → SW FW → SW FW → FW FW → SW SW → SW
365 → 425 mOsm 365 → 430 mOsm 132 → 175 mM 155 → 160 mM 130 → 148 mM 155 → 175 mM 150 → 155 mM 144 → 136 mM 144 → 150 mM 158 → 156 mM
(Kaneko et al., 1995)
0.3 g (42 days after fertilization) 1.3 g (75 days after fertilization) 2.5 g (106 days after fertilization) 13.0 g (180 days after fertilization) 2.0–3.0 g (Fry) 4.0–7.0 g (Fry)
(Hasegawa et al., 1987)
(Uchida et al., 1996) (Uchida and Kaneko, 2009)
Puteaux). All animal studies were performed according to the Guideline for Care and Use of Animals approved by the Animal Experiment Committee of The University of Tokyo.
enhancement and increased adult return rate (Kitada, 2014). The release program resulted in a remarkable increase in the number of returning adults in 1990s with a peak of > 80 million returning adults, but the catch decreased to 30–40 million in recent years despite approximately constant annual releases of juveniles. SW acclimation ability of chum salmon fry is one of the major concerns in hatchery release programs and the underlying biology of osmoregulatory mechanism(s) may improve both the release quality and the consequent return rate. Historically, chum salmon embryos and fry produced from the hatchery have been a stable source of experimental materials not only in osmoregulation research (Hasegawa et al., 1987; Iwata et al., 1982; Kaneko et al., 1995; Uchida et al., 1996; Uchida and Kaneko, 2009), but also in behavioral studies on imprinting mechanisms for natal rivers (Chen et al., 2017), etc. Chum salmon exhibit SW-acclimating ability at early developmental stages and are characterized by the stable plasma Na+ levels after SW challenge in emerged fry (Table 1). However, eye-staged embryos and alevins of ~0.3 g increased significantly their plasma osmolality or Na+ levels after SW exposure, suggesting that the development of SW tolerance happens between the developmental stages of eye-staged embryos and emerged fry. This study aims to establish the timing of osmoregulatory enhancement in chum salmon embryos, alevins, and emerged fry. With a combination of a plasma indicator and transporter markers known in SW ionocytes, we propose a “smoltification period” for chum salmon, which may provide information to improve release management. Environmental triggers such as photoperiod and temperature were important for the initiation of downstream migration in Atlantic salmon (Strand et al., 2018; Vargas-Chacoff et al., 2018). The short FW life of the chum salmon could be a useful model system to shed light on how developmental triggers influence smoltification.
2.2. Salinity transfer and tissue sampling The eye-stage embryos were acclimated for one week after arrival from the hatchery. Ten individuals were transferred from FW to SW for one day. Control transfer experiment was performed with 10 individuals transferred from FW to FW. During sampling, fish were anaesthetized with 0.1% ethyl 3-aminobenzoate methanesulfonate (Sigma-Aldrich Chemicals, St Louis, MO, USA) neutralized with NaHCO3. Fish were weighed and blood samples were obtained from heart puncture using a glass needle heat-pulled from a heparinized hematocrit capillary tube (Fig. 1). The yolk sac and whole gill arch were dissected out and pooled as one sample referred as “ionocyte surface”. From week 11 onwards, only whole gill was sampled as yolk sac was completely absorbed. The tissues were snap-frozen in liquid N2 and stored at −85 °C until RNA extraction. 2.3. Plasma Na+ measurement Plasma was obtained by centrifuging the needled-hematocrit capillary. The hematocrit capillary was cut open by a diamond pen and plasma was transferred into fix-volume capillary (0.5 μL, Microcap 1–000-0005, Drummond Scientific Company, PN, USA) by capillary action. For small plasma volume in early embryonic stage, the volume was often < 0.5 μL and the actual volume was determined by the filledlength of the Microcap capillary. The plasma was diluted in 2.5 mL double-distilled water and Na+ concentration was determined by atomic absorption spectrometry.
2. Materials and methods 2.1. Animal husbandry
2.4. Gene expression of marker transporters and hormone receptors on ionocytes surface
Fertilized eggs of chum salmon [Oncorhynchus keta (Walbaum, 1792)] were obtained from Unosumai hatchery, Iwate, Japan. The eggs were fertilized artificially on 4th December 2018 and incubated at 11.0 °C for 36 days before they were transferred to the Atmosphere and Ocean Research Institute, Chiba, Japan. Upon arrival, the eggs were incubated at 12.0 °C in a recirculating freshwater (FW) system (250 individuals in 250 L water). Temperature was monitored daily. Salmon fry were fed with commercial diet after emergence. FW salinity was 0‰ with Na+ (1.10 mM), Ca2+ (0.48 mM), and Mg2+ (0.27 mM) determined by atomic absorption spectrometry (Hitachi 180–80, Japan) while Cl− was too low to be measured by a chloride meter (Labconco 4,425,000, Missouri). Natural seawater (SW) was obtained from the Kuroshio Current at Hachijō-jima and the salinity was 35‰ with Na+ (432 mM), Cl− (558 mM), Ca2+ (9.3 mM), and Mg2+ (63.1 mM). Measured osmolality values of FW and SW were 0 and 1019 mosmol/L respectively by a vapor pressure osmometer (VAPRO 5520, ELITech,
Total RNA from ionocytes surface was extracted using Isogen (Wako Pure Chemical Industries, Osaka, Japan), treated with DNase I (ThermoFisher Scientific, Waltham, MA, USA) to remove genomic DNA, and subsequently reverse transcribed into cDNA by High Capacity cDNA Reverse Transcription Kit (ThermoFisher Scientific, Waltham, MA, USA) according to manufacturer's protocols (N = 8 in each group). We developed the real time PCR assays the Na/K-ATPase alpha subunit [NKA α1a (atp1a1a), α1b (atp1a1b), and α1c (atp1a1c)], Na-KCl cotransporter [NKCC1a (slc12a2a) and NKCC1b (slc12a2b)], cystic fibrosis transmembrane conductance regulator [CFTRI (cftra) and CFTR II (cftrb)], sodium/proton exchanger 2 [NHE2 (slc9a2)], sodium/proton exchanger 3 isoforms [NHE3a (slc9a3a) and NHE3b (slc9a3b)], and glucocorticoid receptors [GR1 (nr3c1a) and GR2 (nr3c1b)] by cloning partial nucleotide sequence of each gene to provide templates to design primers and probes (see Table 2 for GenBank accession numbers). After obtaining the nucleotide sequence information, we designed 2
Comparative Biochemistry and Physiology, Part A 238 (2019) 110565
M.K.-S. Wong, et al.
Fig. 1. Effects of salinity transfer on the body weight and plasma Na+ of chum salmon at different developmental stages. (a) Representative morphologies of chum salmon embryos and alevins at different developmental stages. Blood samples were obtained from heart puncture with glass needles pulled from hematocrit capillaries. (b) Wet weight (in gram) of chum salmon embryos and alevins at various developmental stages. Important developmental transitions are indicated by the arrows. Values are expressed as box and whisker (N = 10). (c) Plasma Na+ concentration of chum salmon embryos and alevins at various developmental stages. Statistical significant groups are denoted by * (p < .05); ** (p < .01), *** (p < .001) between FW- and SWtransferred groups. Values are expressed as mean ± S.E.M. Numbers in the bars indicate the N number in each group. N.A. = not available.
scale using TaqMan 2× Universal Master Mix II (ThermoFisher Scientific, Waltham, MA, USA) with 125 nM probe. The efficiency of each real time PCR assay was determined by measuring serial diluted cDNA pooled from representative stages and salinity treatment. Elongation factor 1 alpha (EF1) was used as an internal control to normalize the gene expressions among different samples. Relative gene expression of target genes was quantified by the 2△△Ct method where △△Ct = △Ct,target - △Ct,EF1. All samples were assayed in duplicate. Primer sequences for quantitative PCR are listed in Table 2.
specific primers for quantitation of the isoform expressions according to the mismatch found in the alignment among different isoforms. Reactions were carried out in 8 μL scale using KAPA SYBR 2× PCR mix (KAPA Biosystems, Wilmington, Del, USA) and ABI 7900HT Fast Real Time PCR System (Life Technologies, CA, USA). The amplification of a single amplicon was confirmed by analyzing the melting curve after cycling. For NKCC1 and CFTR isoforms, FAM/ZEN/IBFQ-probes (Integrated DNA Technologies, Coralville, IA, USA) were designed to quantify each isoform separately. The reactions were carried out in 8 μL 3
Comparative Biochemistry and Physiology, Part A 238 (2019) 110565
M.K.-S. Wong, et al.
Table 2 Primer and probe sequences used in real time PCR. Forward primer (F); Reverse primer (R); TaqMan probe (P). GenBank accession number
Gene names
Oligo sequences (5′ to 3′)
MK989711
Elongation factor 1 α (EF1) Na/K/ATPase α1a (NKA α1a) Na/K/ATPase α1b (NKA α1b) Na/K/ATPase α1c (NKA α1c) Na/H exchanger 2 (NHE2) Na/H exchanger 3a (NHE3a) Na/H exchanger 3b (NHE3b) Na-K-Cl cotransporter 1a (NKCC1a)
F: GTGGAGACAGGCACCCTGAA R: CTTGACGGACACGTTCTTGA F: GTCCCAGGATCACTCAGTCAC R: AAGGCAAATGGGTTTAATATC F: CATCACTCTGCTGCTACATCTC R: TGCACCATCACAGTGTTCAT F: CGTTTGCATCGCTCAAGTTC R: GTCAAATGTCTTGGTTCATCATCTC F: ATGAAGTACTATGTGGAGGAGAATG R: TCCACTCGTGTTCTGTTGTTAT F: CATAACTACATGAGAGACAAGTGGC R: GATGTTGAATATGTAGTCACGGGAT F: GAGATAACTACATGAGAGACAAGTGGA R: CTTGATGTTGAGCTTGTGGAAA F: TCTGACGGAGACTCATCCAA R: CTCAACAGCGGCTTCCTT P: CCAGCCATCCAGAAAGGTGACGAT F: CAGTAACTCCTTTCCTCCATCC R: AGAAGCCTTTGGTCTGTGAG P: ACGAAGAGAAGCGCTAAGCCACTG F: AATTATCCTTCATCCGTTAGCGC R: CACCACTGAGAACTTCCTCTCT P: ACCGATGAAGGAGAATTTACGGGCC F: TGGTGGAGAAACGTAAACAGTCG R: CACGCCATCCTCGATGGTA P: AGCAACGGCACGTAAGTTCTCCTT F: AATGAAAGGGCCTGCACCC R: GCCTCTGGCTCAATGGCTTTA F: CGGATACGCGACTGGATCAG R: CCTCGGGTCTCGCCTTT F: ATGGAGCTTCTGGAATGCAAGG R: ACCATGCTTGGAGGTAGAACTGG F: AGCTTCTGGAATGCAAGGTCTC R: ACCTTGCCTGGAAGTAGAACTTT
LC482248 LC482249 LC482251 MN242822 MK890140 MK890141 MK890136
MK890137
Na-K-Cl cotransporter 1b (NKCC1b)
MK890138
Cystic fibrosis transmembrane conductance regulator I (CFTR I)
MK890139
Cystic fibrosis transmembrane conductance regulator II (CFTR II)
MK990540
Glucocorticoid (GR1a) Glucocorticoid (GR1b) Glucocorticoid (GR2a) Glucocorticoid (GR2b)
MK990541 MK990542 MK990543
receptor 1a receptor 1b receptor 2a receptor 2b
2.5. Statistical analysis
3.2. Salinity transfer and plasma Na+ concentration
Plasma Na+ levels and gene expressions of FW- and SW-transferred salmons were analyzed by two-way ANOVA followed by Fisher's LSD test on the time-dependent salinity transfer effect (GraphPad Prism Ver. 6 for Windows, San Diego, CA, USA). Significant levels were denoted by * (p < .05); ** (p < .01), *** (p < .001) between FW- and SWtransferred groups at the same developmental stage. For stage-dependent effects, Tukey's test were performed after two-way ANOVA on FWtransferred groups and different alphabets denote significant difference (p < .05) among developmental stages.
SW transfer did not affect the body weight of chum salmon embryos and fry at any of the developmental stages examined (Fig. 1b). We were not able to collect blood samples from eye-staged embryos but sampling was successful on newly hatched embryos on week 7 after fertilization (Fig. 1a). Both FW-FW and FW-SW transferred salmon fries possess high plasma Na+ concentrations between 230 and 250 mM at week 7 (Fig. 1c). Such high levels of plasma Na+ continued at week 8 and a significant reduction was observed in week 9, when the plasma Na+ of the control group was 163 mM while the that of SW-transferred group was increased significantly to 237 mM. The pattern of plasma Na+ increase after SW transfer continued up to week 10. After week 11, the SW treatment has no apparent effect on the plasma Na+ of salmon fries and stable values were obtained between 165 and 175 mM in both FWFW and FW-SW transferred groups.
3. Results 3.1. Chum salmon development According to hatchery management, the reported growth rate for chum salmon from fertilization to hatch is 480 °C days (e.g. 40 days if incubated at 12 °C). In accordance with this, most salmon hatched on 22nd Jan, 2019, which is 49 days (at 11.0–12.0 °C) after fertilization. After hatching, the salmon developed with yolk reserve and emerged three weeks after hatching. The first sampling started one week before hatching (week 6 after fertilization) and continued on a weekly basis until week 12 after fertilization. Gill blood perfusion was first observed on week 9 after fertilization. One week after emergence, the fry had absorbed most of the yolk and had started feeding on commercial diet at week 11. No mortality was observed except one SW-transferred individual died at week 9. The developmental events are summarized in Fig. 1a.
4. Gene expression of ionocyte surface Gene expressions of NKA isoforms including α1a, α1b, and α1c were measured by quantitative PCR and the effects of salinity transfer was determined stage-dependently (Fig. 2a-c). For NKA α1a, the expression increased gradually and stage-dependently in FW, while SW transfer consistently lowered the expression, and significant downregulation was noticed from week 9 onwards. NKA α1b expression also increased stage-dependently in FW, but SW transfer increased the expression further from week 11 onwards (Fig. 2b). NKA α1c was neither affected by salinity nor developmental stages (Fig. 2c). Initially in week 6, NKA α1c expression was prominent but the expression of NKA α1a and NKA α1b increased in later stages. In particular, NKA α1b expression was considerably higher than that of NKA α1a and NKA α1c, which could indicate NKA α1b to be the dominant isoform in the 4
Comparative Biochemistry and Physiology, Part A 238 (2019) 110565
M.K.-S. Wong, et al.
Fig. 3. Stage-dependent gene expressions of apical transporters including (a) NHE2, (b) NHE3a, (c) NHE3b, (d) CFTR I, and (e) CFTR II of ionocyte surface of chum salmon after salinity transfer. Statistical significant groups are denoted by ** (p < .01); *** (p < .001) between FW- and SW-transferred groups. Stagedependent changes in gene expression in FW groups are denoted by different alphabets (p < .05). Values are expressed as mean ± S.E.M.
Fig. 2. Stage-dependent gene expressions of basolateral transporters including (a) NKA α1a, (b) NKA α1b, (c) NKA α1c, (d) NKCC1a, and (e) NKCC1b of ionocyte surface of chum salmon after salinity transfer. Statistical significant groups are denoted by *** (p < .001) between FW- and SW-transferred groups. Stage-dependent changes in gene expression in FW groups are denoted by different alphabets (p < .05). Values are expressed as mean ± S.E.M.
was found at week 11, while no salinity effect was observed at other stages. A gradual increase in NKCC1b expression was found from weeks 6 to 9, and the gene was stably expressed afterwards (Fig. 2e). SW transfer has no effect on the expression of NKCC1b at any of the stages
alevins and fry. Gene expression of NKCC1a increased gradually and stage-dependently in both control- and salinity-transferred salmon (Fig. 2d). A significant increase in NKCC1a expression in the SW group 5
Comparative Biochemistry and Physiology, Part A 238 (2019) 110565
M.K.-S. Wong, et al.
(Fig. 4c). Expressions of GR1a and GR2b sharply decreased after hatching (Fig. 4a, d). SW exposure tend to inhibit the expression of GRs, with significant downregulation of GR2b at week 6 and GR1b at week 10. 5. Discussion Our results showed the ontogeny of SW tolerance in relation to osmoregulatory transporter expression in ionocyte surface of chum salmon. Chum salmon fry exhibited remarkable SW tolerance after completion of yolk absorption and initiation of feeding (week 11 onwards, > 0.4 g). Their plasma Na+ levels remained stable (~150–170 mM) after SW challenge (Fig. 1c). Previous time-course study on size-dependent salinity challenge showed that the newly-hatched chum salmon (0.3 g) increased in plasma Na+ gradually and reached maximum increase (> 40 mM from pre-transfer level) after 1 day in SW (Hasegawa et al., 1987), which is consistent with chum salmon fry until week 10 (< 0.4 g) in our study. The previous studies further reported that SW transfer increased the plasma Na+ in much smaller amplitude (~ 10 mM) in larger alevins (1.3–2.0 g) (Hasegawa et al., 1987; Uchida et al., 1996), which could maintain a much more stable plasma Na+ level. Therefore, chum salmon alevins acquire excellent SW tolerance between 0.3 g and 1.3 g. The present study clearly showed that SW tolerance was acquired much earlier than previously thought, where osmoregulatory ability drastically changed between week 10 (< 0.4 g, before start of feeding) and week 11 (> 0.4 g, after start of feeding). One unexpected result was high plasma Na+ in the FW to FW control transfer groups in weeks 7 and 8, suggesting that the handling stress may have increased the plasma Na+, possibly similar to the phenomenon where handling and confinement stresses increased the plasma osmolality in tilapia (Breves et al., 2010). If this is the case, however, the reason why the same treatment did not affect plasma Na+ after week 9 remains to be clarified. Alternatively, smaller fry with large yolk volume may have a particular mechanism that retains internal Na+ levels over 200 mM. Coincidently, the total body Na+ in pink salmon increased more than five-fold between hatching and complete yolk absorption, suggesting that there could be some unidentified mechanisms for ion retention in alevins (Gallagher et al., 2012). The surface area for ion exchange increased dramatically when the blood started to perfuse the gills at week 9, which coincided with the lowering of plasma Na+ levels in FW individuals. Whether initiation of gill perfusion has a role on the reduced plasma Na+ in week 9 requires further study. Na-binding molecules could be involved to hold Na+ in FW, which may reduce the energetic cost for transportermediated osmoregulation (Wong et al., 2017). Although plasma Na+ reached the critical levels reported for stenohaline stickleback (~250 mM) (Kusakabe et al., 2014), the chum salmon embryos and alevins did not lose body weight or show any morphological and behavioral deficit from weeks 6 to 8. Yolk-sac epithelium contains ionocytes and is the major osmoregulatory surface before the functional gill develops (Kaneko et al., 2002). In hatched fish, the osmoregulatory role of the yolk sac decreases gradually while branchial ionocytes increase their contribution reciprocally (Varsamos et al., 2005). For a collective purpose, we combined the yolk sac and whole gill to represent the total “ionocyte surface” in chum salmon embryos and alevins, to understand the transporter changes close to a whole animal model. The treatment of one day FW/SW transfer balances the known time-course salinity effects on plasma Na+ from the literature (Table 1) and allows sufficient time for gene expression changes. NKA α1a and α1b are markers for FW and SW ionocytes respectively in Atlantic salmon (McCormick et al., 2009). Our group has cloned the corresponding isoforms in chum salmon and found that the NKA α1a was consistently downregulated in SW-transferred alevins at all stages, which matches with its proposed role in FW-type ionocytes. The NKA α1a should be largely present in both yolk sac and gill, as the
Fig. 4. Stage-dependent gene expressions of glucocorticoid receptors (a) GR1a, (b) GR1b, (c) GR2a, and (d) GR2b of ionocyte surface of chum salmon after salinity transfer. Statistical significant groups are denoted by * (p < .05); ** (p < .01) between FW- and SW-transferred groups. Stage-dependent changes in gene expression in FW groups are denoted by different alphabets (p < .05). Values are expressed as mean ± S.E.M.
examined. NHE2 expression was low from weeks 6–9, and increased significantly after week 10 with a peak in week 11 (Fig. 3a). Significant upregulation by SW transfer was found in week 10 and 12. NHE3a expression was low from weeks 6–9, and increased dramatically after week 10. Significant upregulation by SW transfer was observed from weeks 10 to 12, with ~3-fold increase in week 11 (Fig. 3b). NHE3b exhibited a stage-dependent expression increase, and SW transfer slightly inhibited the expression at all stages with significant downregulation at week 12 (Fig. 3c). CFTR I and CFTR II expression followed the same pattern of stage-dependent increase and SW transfer significantly upregulated both isoforms from week 10 onwards (Fig. 3d-e). We cloned 4 GR isoforms and identified them as GR1a, GR1b, GR2a, and GR2b (Fig. 4a-d). The expression level of GR2a was highest among these isoforms, and significant upregulation was observed in week 9 6
Comparative Biochemistry and Physiology, Part A 238 (2019) 110565
M.K.-S. Wong, et al.
future efforts to raise new specific antibodies to explore further tissue and cell expression. A rise in cortisol is associated with smoltification in salmonids and the GR was upregulated in the gill during smolting in Atlantic salmon (Kiilerich et al., 2007). The GR was found to be colocalized with ionocytes in zebrafish (Danio rerio), suggesting a regulatory role of cortisol on ionocyte via GR (Cruz et al., 2013). At least two GR isoforms, GR1 and GR2, were identified in trout (Becker et al., 2008; Yada et al., 2008), and we identified additional isoforms in chum salmon, named GR1a, GR1b, GR2a, and GR2b. These complicated GR isoforms could be the combination of teleost third round whole genome duplication and rediploidization in salmonids (Lien et al., 2016). Among these four isoforms, GR2a has a higher expression level, which could be the major GR on ionocyte surface. The GR2a expression significantly increased during week 9 and the increase slightly preceded the upregulation of NKA α1b, suggesting a preparatory role of the receptor in chum salmon smoltification. The expressions of GR1a and GR2b were significantly downregulated in week 7, suggesting involvement of glucocorticoid signaling in the hatching process. Further studies are needed to elucidate the roles of these GR isoforms in different physiological processes. Although the morphological parr-smolt transformation was not well-defined in chum salmon, we propose that smoltification occurs between weeks 10 and 11 when the fish have completely absorbed the yolk and started foraging. To know the smoltification period is important for comparative studies among different salmonids and other teleosts. Previous studies may have considered chum salmon fry in FW as parr and indeed most emerged alevins possess parr-marks on their bodies, but are smolts by physiological measures. The competency to maintain perfectly stable plasma Na+ after a FW to SW transfer is fascinating and we considered that this feature is a marker of increased SW tolerance. Captive chum salmon did not lose SW acclimation ability dramatically as they survived the FW to SW transfer even after 13 months in FW (Hasegawa et al., 1987). However, chum salmon at larger size (> 2.5 g) were more sensitive to SW transfer with elevated plasma Na+ (Table 1), indicating a slight drop of SW tolerance. This “good-excellent-good” pattern of SW tolerance in chum salmon resembles the “parr-smolt-desmolt” of other salmonids. While landlocked Atlantic salmon desmoltified and cannot acclimate to SW (Stefansson et al., 2008), chum salmon is not limited physiologically. Chum salmon was not an attractive model for osmoregulation studies because the short FW life and the fry and juveniles did not behave like the parr as in other salmonids that spend years in FW. However, the present study pinned down the “smoltification period” of chum salmon and provided a basis for comparison among the physiology of salmonids. In particular, the stage-dependent increase in SW tolerance is highly resemble to that the novel pattern of smoltification in pink salmon (Gallagher et al., 2012), but it appears that chum salmon alevins are more tolerant as no major morbidity under SW exposure was observed in the present study. Phylogenetic studies showed that chum salmon and pink salmon are the most recently evolved salmonid species (Crête-Lafrenière et al., 2012), and their “parr life” could have been condensed from years into weeks, resulting in their short FW life stage. Although the short FW life of chum salmon seems to be disadvantageous for osmoregulation studies, the smoltification stages are clear and synchronized as the fertilized eggs from hatchery develop at almost the same speed before emergence. In species that have long FW life, the parr and smolt stages are somewhat ambiguous, as smolting is gradual and usually takes months to complete (McCormick et al., 1998; Stefansson et al., 2008). To screen for marker genes that are involved in the smoltification using bottom-up approaches such as RNA-seq, the short “smoltification period” of chum salmon can be advantageous since comparisons among stages are clear with testable physiological parameters such as plasma Na+ changes.
downregulation was prominent at stages when the alevins possess only yolk sac or gill (Fig. 2a). On the other hand, NKA α1b was not regulated by SW challenge until week 11 onwards, indicating that the SW-acclimating potential by this measure increased between week 10 and 11 (Fig. 2b), consistent with the increased SW tolerance revealed by the plasma Na+ levels. The difference in expression pattern between NKA α1a and α1b also suggested that the distinct transcription factors were involved to control the expressions of the two isoforms. NKA α1c expression was remarkably stable among all stages and salinity challenges, suggesting that it could be a housekeeping NKA and the normalization against EF1 was suitable in the case of developing chum salmon embryos (Fig. 2c). Besides NKA, we also examined the isoforms for NKCC1, NHE2, NHE3 and CFTR in chum salmon to provide further understanding to the ontogeny of SW tolerance, as these transporters were known to coexpress in the SW-type ionocytes (chloride cells) (Hiroi and McCormick, 2012). NKCC1a is the major isoform in terms of expression levels and responses to salinity change and developmental stages (Fig. 2d), which is similar to the case of Atlantic salmon (Handeland et al., 2014). Although there was a stage-dependent increase in NKCC1b expression at early embryonic stages, the total expression was relatively low and insensitive to salinity transfer, suggesting that NKCC1b could be a redundant isoform in the gill of chum salmon (Fig. 2e). A sharp increase in NKCC1a expression in week 11 after SW exposure coincide to the increase in NKA α1b expression, indicating that the branchial SW-type ionocytes were highly active at this stage in response to SW exposure. NHE2 and NHE3 were found on different types of ionocytes in rainbow trout (O. mykiss) and the expression of NHE2 was 30-fold higher than that of NHE3 (Ivanis et al., 2008). In chum salmon alevins, on the other hand, the NHE2 expression levels were not greatly differ from those of NHE3 isoforms (Fig. 3a-c). As the chum salmon have a short FW life while less acid-base fluctuation is expected in SW (Gilmour and Perry, 2009), the role of NHE2 could be less demanding than the case in other salmonids with longer FW life. In rainbow trout, NHE2 ionocytes are situated at the base of lamellae while NHE3 ionocytes are mostly on lamellae and the NHE2 expression increased in response to acidosis and cortisol treatment (Ivanis et al., 2008). NHE3 immunoreactivity was identified on the ionocytes in both FW and SW Atlantic salmon, but with no significant differences in expression patterns (Christensen et al., 2012). Our results suggested that NHE3a and NHE3b perform separate roles in salinity acclimation. NHE2 and NHE3a are likely to be present on SW-type ionocytes for their similar expression pattern to those of NKA α1b and NKCC1a (Inokuchi et al., 2017). NHE3b has a Na+ uptake role and acid base regulation as shown in rainbow trout (Boyle et al., 2016; Ivanis et al., 2008), and the downregulation by SW transfer in our result supports the ion uptake role in FW. It will be intriguing to study the localization of NHE2 and NHE3 isoforms as they may serve as ionocyte markers with specific functions. Unlike the case of Atlantic salmon where CFTR I and CFTR II exhibited differential regulation (Singer et al., 2002), their expression levels and pattern in chum salmon were highly similar, with stage-dependent increase as well as significant upregulation by SW treatment from week 10 onwards. The NHE3 and CFTR were found to be expressed on the same ionocyte in Atlantic salmon, and the synchronized upregulation of NHE3a, CFTR I, and CFTR II suggested that the SW-type ionocyte of chum salmon may possess a similar ion-excreting mechanism to that proposed in Atlantic salmon (Christensen et al., 2012). The sharp improvement in the stability of plasma Na+ matched with the upregulation in SW-related transporters from weeks 10 to 11, marking the enhancement in osmoregulatory ability of chum salmon in this developmental transition. Development of immunohistochemistry for specific transporter isoforms is demanding and may take years to complete. Although we have not examined the localization of the transporter isoforms in this study, the stage- and salinity-dependent changes in transporter expression were clear and inspiring, encouraging 7
Comparative Biochemistry and Physiology, Part A 238 (2019) 110565
M.K.-S. Wong, et al.
Acknowledgements
base regulation in freshwater rainbow trout (Oncorhynchus mykiss). J. Exp. Biol. 211, 2467–2477. https://doi.org/10.1242/jeb.017491. Iwata, M., Hasegawa, S., Hirano, T., 1982. Decreased seawater adaptability of chum Salmon (Oncorhynchus keta) fry following prolonged rearing in freshwater. Can. J. Fish. Aquat. Sci. https://doi.org/10.1139/f82-070. Kaneko, T., Hasegawa, S., Takagi, Y., Tagawa, M., Hirano, T., 1995. Hypoosmoregulatory ability of eyed-stage embryos of chum salmon. Mar. Biol. 122, 165–170. https://doi. org/10.1007/BF00349290. Kaneko, T., Shiraishi, K., Katoh, F., Hasegawa, S., Hiroi, J., 2002. Chloride cells during early life stages of fish and. Fish. Sci. 1–9. Kiilerich, P., Kristiansen, K., Madsen, S.S., 2007. Hormone receptors in gills of smolting Atlantic salmon, Salmo salar: expression of growth hormone, prolactin, mineralocorticoid and glucocorticoid receptors and 11β-hydroxysteroid dehydrogenase type 2. Gen. Comp. Endocrinol. 152, 295–303. https://doi.org/10.1016/j.ygcen. 2006.12.018. Kitada, S., 2014. Japanese chum salmon stock enhancement: current perspective and future challenges. Fish. Sci. 80, 237–249. https://doi.org/10.1007/s12562-0130692-8. Kusakabe, M., Ishikawa, A., Kitano, J., 2014. Relaxin-related gene expression differs between anadromous and stream-resident stickleback (Gasterosteus aculeatus) following seawater transfer. Gen. Comp. Endocrinol. 205, 197–206. https://doi.org/10. 1016/j.ygcen.2014.06.017. Lien, S., Koop, B.F., Sandve, S.R., Miller, J.R., Kent, M.P., Nome, T., Hvidsten, T.R., Leong, J.S., Minkley, D.R., Zimin, A., Grammes, F., Grove, H., Gjuvsland, A., Walenz, B., Hermansen, R.A., Von Schalburg, K., Rondeau, E.B., Di Genova, A., Samy, J.K.A., Olav Vik, J., Vigeland, M.D., Caler, L., Grimholt, U., Jentoft, S., Inge Våge, D., De Jong, P., Moen, T., Baranski, M., Palti, Y., Smith, D.R., Yorke, J.A., Nederbragt, A.J., Tooming-Klunderud, A., Jakobsen, K.S., Jiang, X., Fan, D., Hu, Y., Liberles, D.A., Vidal, R., Iturra, P., Jones, S.J.M., Jonassen, I., Maass, A., Omholt, S.W., Davidson, W.S., 2016. The Atlantic salmon genome provides insights into rediploidization. Nature 533, 200–205. https://doi.org/10.1038/nature17164. McCormick, S.D., 2006. Ontogeny and evolution of salinity tolerance in anadromous Salmonids: hormones and Heterochrony. Estuaries 17, 26. https://doi.org/10.2307/ 1352332. McCormick, S.D., Dickhoff, W.W., Duston, J., Nishioka, R.S., Bern, H.A., 1991. Developmental differences in the responsiveness of gill Na+, K+-ATPase to cortisol in salmonids. Gen. Comp. Endocrinol. 84, 308–317. https://doi.org/10.1016/00166480(91)90054-A. McCormick, S.D., Hansen, L., Quinn, T.P., Saunders, R.L., 1998. Movement, migration, and smolting of Atlantic salmon (Salmo salar). Can. J. Fish. Aquat. Sci. 55, 77–92. https://doi.org/10.1007/978-3-319-25582-8_180007. McCormick, S.D., Moriyama, S., Björnsson, B.T., 2000. Low temperature limits photoperiod control of smolting in Atlantic salmon through endocrine mechanisms. Am. J. Physiol. Regul. Integr. Comp. Physiol. 278, R1352–R1361. https://doi.org/10.1152/ ajpregu.2000.278.5.R1352. McCormick, S.D., Regish, A.M., Christensen, A.K., 2009. Distinct freshwater and seawater isoforms of Na+/K+-ATPase in gill chloride cells of Atlantic salmon. J. Exp. Biol. 212, 3994–4001. https://doi.org/10.1242/jeb.037275. Singer, T.D., Clements, K.M., Semple, J.W., Schulte, P.M., Bystriansky, J.S., Finstad, B., Fleming, I.A., McKinley, R.S., 2002. Seawater tolerance and gene expression in two strains of Atlantic salmon smolts. Can. J. Fish. Aquat. Sci. 59, 125–135. https://doi. org/10.1139/f01-205. Stefansson, S.O., Björnsson, B.T., Ebbesson, L.O.E., McCormick, S.D., 2008. Smoltification. In: Finn, R.N., Kapoor, B.G. (Eds.), Fish Larval Physiology. Science Publishers Inc, pp. 607–681. Strand, J.E.T., Hazlerigg, D., Jørgensen, E.H., 2018. Photoperiod revisited: is there a critical day length for triggering a complete parr–smolt transformation in Atlantic salmon Salmo salar? J. Fish Biol. 93, 440–448. https://doi.org/10.1111/jfb.13760. Uchida, K., Kaneko, T., 2009. Enhanced chloride cell turnover in the gills of chum Salmon fry in seawater. Zool. Sci. 13, 655–660. https://doi.org/10.2108/zsj.13.655. Uchida, K., Kaneko, T., Yamauchi, K., Hirano, T., 1996. Morphometrical analysis of chloride cell activity in the gill filaments and lamellae and changes in Na+,K +-ATPase activity during seawater adaptation in chum salmon fry. J. Exp. Zool. 276, 193–200 (doi:10.1002/(SICI)1097-010X(19961015)276:3 < 193::AIDJEZ3 > 3.0.CO;2-I). Vargas-Chacoff, L., Regish, A.M., Weinstock, A., McCormick, S.D., 2018. Effects of elevated temperature on osmoregulation and stress responses in Atlantic salmon Salmo salar smolts in fresh water and seawater. J. Fish Biol. 93, 550–559. https://doi.org/ 10.1111/jfb.13683. Varsamos, S., Nebel, C., Charmantier, G., 2005. Ontogeny of osmoregulation in postembryonic fish: a review. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 141, 401–429. https://doi.org/10.1016/j.cbpb.2005.01.013. Wong, M.K.S., Tsukada, T., Ogawa, N., Pipil, S., Ozaki, H., Suzuki, Y., Iwasaki, W., Takei, Y., 2017. A sodium binding system alleviates acute salt stress during seawater acclimation in eels. Zool. Lett. 3, 22. https://doi.org/10.1186/s40851-017-0081-8. Yada, T., Hyodo, S., Schreck, C.B., 2008. Effects of seawater acclimation on mRNA levels of corticosteroid receptor genes in osmoregulatory and immune systems in trout. Gen. Comp. Endocrinol. 156, 622–627. https://doi.org/10.1016/j.ygcen.2008.02.009.
We thanks Shigeyuki Sasaki of Unosumai Hatchery, Iwate Prefecture for providing the chum salmon fertilized eggs for the experiment. Christopher A. Loretz of the University of Buffalo has edited the English of the manuscript. Funding This work was supported by JSPS Grant-in-Aid 16K18575 awarded to M.W., 15K07544 awarded to S.N., and in part by the Tohoku Ecosystem-Associated Marine Science (TEAMS) research program of the Ministry of Education, Culture, Sports, Science and Technology (MEXT). Declaration of Competing Interest None. References Becker, H., Sturm, A., Bron, J.E., Schirmer, K., Bury, N.R., 2008. The a/B domain of the teleost glucocorticoid receptors influences partial nuclear localization in the absence of hormone. Endocrinology 149, 4567–4576. https://doi.org/10.1210/en.20071683. Boyle, D., Blair, S.D., Chamot, D., Goss, G.G., 2016. Characterization of developmental Na + uptake in rainbow trout larvae supports a significant role for Nhe3b. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 201, 30–36. https://doi.org/10.1016/j. cbpa.2016.06.027. Breves, J.P., Hirano, T., Grau, E.G., 2010. Ionoregulatory and endocrine responses to disturbed salt and water balance in Mozambique tilapia exposed to confinement and handling stress. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 155, 294–300. https://doi.org/10.1016/j.cbpa.2009.10.033. Chen, E.Y., Leonard, J.B.K., Ueda, H., 2017. The behavioural homing response of adult chum salmon Oncorhynchus keta to amino-acid profiles. J. Fish Biol. 90, 1257–1264. https://doi.org/10.1111/jfb.13225. Christensen, A.K., Hiroi, J., Schultz, E.T., McCormick, S.D., 2012. Branchial ionocyte organization and ion-transport protein expression in juvenile alewives acclimated to freshwater or seawater. J. Exp. Biol. 215, 642–652. https://doi.org/10.1242/jeb. 063057. Crête-Lafrenière, A., Weir, L.K., Bernatchez, L., 2012. Framing the Salmonidae Family phylogenetic portrait: a more complete picture from increased taxon sampling. PLoS One 7. https://doi.org/10.1371/journal.pone.0046662. Cruz, S.A., Lin, C.H., Chao, P.L., Hwang, P.P., 2013. Glucocorticoid receptor, but not mineralocorticoid receptor, mediates cortisol regulation of epidermal ionocyte development and ion transport in zebrafish (Danio rerio). PLoS One 8. https://doi.org/ 10.1371/journal.pone.0077997. Gallagher, Z.S., Bystriansky, J.S., Farrell, A.P., Brauner, C.J., 2012. A novel pattern of smoltification in the most anadromous salmonid: pink salmon (Oncorhynchus gorbuscha). Can. J. Fish. Aquat. Sci. 70, 349–357. https://doi.org/10.1139/cjfas-20120390. Gilmour, K.M., Perry, S.F., 2009. Carbonic anhydrase and acid-base regulation in fish. J. Exp. Biol. 212, 1647–1661. https://doi.org/10.1242/jeb.029181. Handeland, S.O., Imsland, A.K., Nilsen, T.O., Ebbesson, L.O.E., Hosfeld, C.D., Pedrosa, C., Toften, H., Stefansson, S.O., 2014. Osmoregulation in Atlantic salmon Salmo salar smolts transferred to seawater at different temperatures. J. Fish Biol. 85, 1163–1176. https://doi.org/10.1111/jfb.12481. Hasegawa, S., Hirano, T., Ogasawara, T., Iwata, M., Akiyama, T., Arai, S., 1987. Osmoregulatory ability of chum salmon, Oncorhynchus keta, reared in fresh water for prolonged periods. Fish Physiol. Biochem. 4, 101–110. https://doi.org/10.1007/ BF02044319. Hiroi, J., McCormick, S.D., 2012. New insights into gill ionocyte and ion transporter function in euryhaline and diadromous fish. Respir. Physiol. Neurobiol. 184, 257–268. https://doi.org/10.1016/j.resp.2012.07.019. Hogasen, H.R., 1998. Physiological Changes Associated with the Diadromous Migration of Salmonids. Canadian Special Publication of Fisheries and Aquatic Sciences. Inokuchi, M., Nakamura, M., Miyanishi, H., Hiroi, J., Kaneko, T., 2017. Functional classification of gill ionocytes and spatiotemporal changes in their distribution after transfer from seawater to freshwater in Japanese seabass. J. Exp. Biol. 220, 4720–4732. https://doi.org/10.1242/jeb.167320. Ivanis, G., Esbaugh, A.J., Perry, S.F., 2008. Branchial expression and localization of SLC9A2 and SLC9A3 sodium/hydrogen exchangers and their possible role in acid-
8
Contents lists available at ScienceDirect
Comparative Biochemistry and Physiology, Part A journal homepage: www.elsevier.com/locate/cbpa
Enhanced osmoregulatory ability marks the smoltification period in developing chum salmon (Oncorhynchus keta)
T
⁎
Marty Kwok-Shing Wonga, , Shigenori Nobatab, Susumu Hyodoa a b
Laboratory of Physiology, Atmosphere and Ocean Research Institute, The University of Tokyo, Chiba, Japan International Coastal Research Center, Atmosphere and Ocean Research Institute, the University of Tokyo, Otsuchi, Iwate, Japan
A R T I C LE I N FO
A B S T R A C T
Keywords: Seawater tolerance Sodium/potassium ATPase Sodium‑potassium-chloride cotransporter Sodium/hydrogen exchanger Cystic fibrosis transmembrane conductance regulator Plasma sodium ion Glucocorticoid receptor
The freshwater (FW) life of chum salmon is short, as they migrate to the ocean soon after emergence from the substrate gravel of natal waters. The alevins achieve seawater (SW) acclimating ability at an early developmental stage and the details of smoltification are not clear. We examined the stage-dependent SW acclimating ability in chum salmon alevins and found a sharp increase in SW tolerance during development that resembles the physiological parr-smolt transformation seen in other salmonids. Perturbation of plasma Na+ after SW exposure was prominent from the hatched embryo stage to emerged alevins, but the plasma Na+ became highly stable and more resistant to perturbation soon after complete absorption of yolk. Marker gene expression for SW-ionocytes including Na/K-ATPase (NKA α1b), Na-K-Cl cotransporter 1a (NKCC1a), Na/H exchanger 3a (NHE3a), cystic fibrosis transmembrane conductance regulators (CFTR I and CFTR II) were all upregulated profoundly at the same stage when the alevins were challenged by SW, suggesting that the stability of plasma Na+ concentration was partly a result of elevated osmoregulatory capability. FW-ionocyte markers including NKA α1a and NHE3b were consistently downregulated independent of stage by SW exposure, suggesting that embryos at all stages respond to salinity challenge, but the increase in SW osmoregulatory capability is restricted to the developmental stage after emergence. We propose that the “smoltification period” is condensed and integrated into the early development of chum salmon, and our results can be extrapolated to the future studies on hormonal controls and developmental triggers for smoltification in salmonids.
1. Introduction Smoltification is commonly referenced as the parr-smolt transformation, which is composed of morphological, physiological and behavioral changes in salmonid species for their seawater (SW) adaptability for out-migration (Hogasen, 1998; McCormick et al., 1998; Stefansson et al., 2008). Most salmonid species spend considerable time (one-half to three years) in freshwater (FW) as parr, which is characterized morphologically by the vertical stripes (also known as parr marks) on their bodies. Before downstream SW migration, the parr marks disappear and the body becomes silvery in color, which is often used as the morphological marker for smolting. The osmoregulatory and behavioral changes are synchronized with the silvering in many salmonid species. However, these changes are uncoupled processes and can be manipulated independently by environmental cues including temperature and photoperiod in Atlantic salmon (Salmo salar) (McCormick et al., 2000).
Chum salmon (Oncorhynchus keta) and pink salmon (O. gorbuscha) migrate downstream soon after emergence (Stefansson et al., 2008) and their seawater acclimating abilities appear to be higher than in other species at the same stages (McCormick, 2006). The branchial Na/KATPase (NKA) activity of chum salmon (0.4–0.5 g) in FW was twice higher than Atlantic salmon (0.2–0.4 g) in FW, suggesting that chum salmon may possess a higher intrinsic osmoregulatory ability at young age (McCormick et al., 1991). In pink salmon, SW tolerance increased before emergence of alevins and the pattern resembles the smolt window, suggesting a new pattern of smoltification in the species with short FW lives (Gallagher et al., 2012). It is intriguing whether similar smoltification pattern occurs in chum salmon, thus we develop the physiological and morphological markers to study the osmoregulatory changes in this species. In Sanriku and Hokkaido areas of Japan, hatchery release programs of chum salmon fry is an important practice for population
Abbreviations: CFTR, cystic fibrosis transmembrane conductance regulator; FW, Freshwater; GR, Glucocorticoid receptor; NHE, sodium/hydrogen exchanger; NKA, sodium/potassium ATPase; NKCC, sodium‑potassium-chloride cotransporter; SW, Seawater ⁎ Corresponding author. E-mail address: [email protected] (M.K.-S. Wong). https://doi.org/10.1016/j.cbpa.2019.110565 Received 3 June 2019; Received in revised form 29 August 2019; Accepted 30 August 2019 Available online 04 September 2019 1095-6433/ © 2019 Elsevier Inc. All rights reserved.
Comparative Biochemistry and Physiology, Part A 238 (2019) 110565
M.K.-S. Wong, et al.
Table 1 Effects of salinity transfer on the plasma sodium concentration or osmolality in chum salmonim. Body weight (developmental stages)
Salinity transfer
Plasma Na+ / osmolality changes after 24 h transfer
References
0.24–0.36 g (eye-stage)
FW → 50% SW FW → 100% SW FW → SW FW → SW FW → SW FW → SW FW → SW FW → FW FW → SW SW → SW
365 → 425 mOsm 365 → 430 mOsm 132 → 175 mM 155 → 160 mM 130 → 148 mM 155 → 175 mM 150 → 155 mM 144 → 136 mM 144 → 150 mM 158 → 156 mM
(Kaneko et al., 1995)
0.3 g (42 days after fertilization) 1.3 g (75 days after fertilization) 2.5 g (106 days after fertilization) 13.0 g (180 days after fertilization) 2.0–3.0 g (Fry) 4.0–7.0 g (Fry)
(Hasegawa et al., 1987)
(Uchida et al., 1996) (Uchida and Kaneko, 2009)
Puteaux). All animal studies were performed according to the Guideline for Care and Use of Animals approved by the Animal Experiment Committee of The University of Tokyo.
enhancement and increased adult return rate (Kitada, 2014). The release program resulted in a remarkable increase in the number of returning adults in 1990s with a peak of > 80 million returning adults, but the catch decreased to 30–40 million in recent years despite approximately constant annual releases of juveniles. SW acclimation ability of chum salmon fry is one of the major concerns in hatchery release programs and the underlying biology of osmoregulatory mechanism(s) may improve both the release quality and the consequent return rate. Historically, chum salmon embryos and fry produced from the hatchery have been a stable source of experimental materials not only in osmoregulation research (Hasegawa et al., 1987; Iwata et al., 1982; Kaneko et al., 1995; Uchida et al., 1996; Uchida and Kaneko, 2009), but also in behavioral studies on imprinting mechanisms for natal rivers (Chen et al., 2017), etc. Chum salmon exhibit SW-acclimating ability at early developmental stages and are characterized by the stable plasma Na+ levels after SW challenge in emerged fry (Table 1). However, eye-staged embryos and alevins of ~0.3 g increased significantly their plasma osmolality or Na+ levels after SW exposure, suggesting that the development of SW tolerance happens between the developmental stages of eye-staged embryos and emerged fry. This study aims to establish the timing of osmoregulatory enhancement in chum salmon embryos, alevins, and emerged fry. With a combination of a plasma indicator and transporter markers known in SW ionocytes, we propose a “smoltification period” for chum salmon, which may provide information to improve release management. Environmental triggers such as photoperiod and temperature were important for the initiation of downstream migration in Atlantic salmon (Strand et al., 2018; Vargas-Chacoff et al., 2018). The short FW life of the chum salmon could be a useful model system to shed light on how developmental triggers influence smoltification.
2.2. Salinity transfer and tissue sampling The eye-stage embryos were acclimated for one week after arrival from the hatchery. Ten individuals were transferred from FW to SW for one day. Control transfer experiment was performed with 10 individuals transferred from FW to FW. During sampling, fish were anaesthetized with 0.1% ethyl 3-aminobenzoate methanesulfonate (Sigma-Aldrich Chemicals, St Louis, MO, USA) neutralized with NaHCO3. Fish were weighed and blood samples were obtained from heart puncture using a glass needle heat-pulled from a heparinized hematocrit capillary tube (Fig. 1). The yolk sac and whole gill arch were dissected out and pooled as one sample referred as “ionocyte surface”. From week 11 onwards, only whole gill was sampled as yolk sac was completely absorbed. The tissues were snap-frozen in liquid N2 and stored at −85 °C until RNA extraction. 2.3. Plasma Na+ measurement Plasma was obtained by centrifuging the needled-hematocrit capillary. The hematocrit capillary was cut open by a diamond pen and plasma was transferred into fix-volume capillary (0.5 μL, Microcap 1–000-0005, Drummond Scientific Company, PN, USA) by capillary action. For small plasma volume in early embryonic stage, the volume was often < 0.5 μL and the actual volume was determined by the filledlength of the Microcap capillary. The plasma was diluted in 2.5 mL double-distilled water and Na+ concentration was determined by atomic absorption spectrometry.
2. Materials and methods 2.1. Animal husbandry
2.4. Gene expression of marker transporters and hormone receptors on ionocytes surface
Fertilized eggs of chum salmon [Oncorhynchus keta (Walbaum, 1792)] were obtained from Unosumai hatchery, Iwate, Japan. The eggs were fertilized artificially on 4th December 2018 and incubated at 11.0 °C for 36 days before they were transferred to the Atmosphere and Ocean Research Institute, Chiba, Japan. Upon arrival, the eggs were incubated at 12.0 °C in a recirculating freshwater (FW) system (250 individuals in 250 L water). Temperature was monitored daily. Salmon fry were fed with commercial diet after emergence. FW salinity was 0‰ with Na+ (1.10 mM), Ca2+ (0.48 mM), and Mg2+ (0.27 mM) determined by atomic absorption spectrometry (Hitachi 180–80, Japan) while Cl− was too low to be measured by a chloride meter (Labconco 4,425,000, Missouri). Natural seawater (SW) was obtained from the Kuroshio Current at Hachijō-jima and the salinity was 35‰ with Na+ (432 mM), Cl− (558 mM), Ca2+ (9.3 mM), and Mg2+ (63.1 mM). Measured osmolality values of FW and SW were 0 and 1019 mosmol/L respectively by a vapor pressure osmometer (VAPRO 5520, ELITech,
Total RNA from ionocytes surface was extracted using Isogen (Wako Pure Chemical Industries, Osaka, Japan), treated with DNase I (ThermoFisher Scientific, Waltham, MA, USA) to remove genomic DNA, and subsequently reverse transcribed into cDNA by High Capacity cDNA Reverse Transcription Kit (ThermoFisher Scientific, Waltham, MA, USA) according to manufacturer's protocols (N = 8 in each group). We developed the real time PCR assays the Na/K-ATPase alpha subunit [NKA α1a (atp1a1a), α1b (atp1a1b), and α1c (atp1a1c)], Na-KCl cotransporter [NKCC1a (slc12a2a) and NKCC1b (slc12a2b)], cystic fibrosis transmembrane conductance regulator [CFTRI (cftra) and CFTR II (cftrb)], sodium/proton exchanger 2 [NHE2 (slc9a2)], sodium/proton exchanger 3 isoforms [NHE3a (slc9a3a) and NHE3b (slc9a3b)], and glucocorticoid receptors [GR1 (nr3c1a) and GR2 (nr3c1b)] by cloning partial nucleotide sequence of each gene to provide templates to design primers and probes (see Table 2 for GenBank accession numbers). After obtaining the nucleotide sequence information, we designed 2
Comparative Biochemistry and Physiology, Part A 238 (2019) 110565
M.K.-S. Wong, et al.
Fig. 1. Effects of salinity transfer on the body weight and plasma Na+ of chum salmon at different developmental stages. (a) Representative morphologies of chum salmon embryos and alevins at different developmental stages. Blood samples were obtained from heart puncture with glass needles pulled from hematocrit capillaries. (b) Wet weight (in gram) of chum salmon embryos and alevins at various developmental stages. Important developmental transitions are indicated by the arrows. Values are expressed as box and whisker (N = 10). (c) Plasma Na+ concentration of chum salmon embryos and alevins at various developmental stages. Statistical significant groups are denoted by * (p < .05); ** (p < .01), *** (p < .001) between FW- and SWtransferred groups. Values are expressed as mean ± S.E.M. Numbers in the bars indicate the N number in each group. N.A. = not available.
scale using TaqMan 2× Universal Master Mix II (ThermoFisher Scientific, Waltham, MA, USA) with 125 nM probe. The efficiency of each real time PCR assay was determined by measuring serial diluted cDNA pooled from representative stages and salinity treatment. Elongation factor 1 alpha (EF1) was used as an internal control to normalize the gene expressions among different samples. Relative gene expression of target genes was quantified by the 2△△Ct method where △△Ct = △Ct,target - △Ct,EF1. All samples were assayed in duplicate. Primer sequences for quantitative PCR are listed in Table 2.
specific primers for quantitation of the isoform expressions according to the mismatch found in the alignment among different isoforms. Reactions were carried out in 8 μL scale using KAPA SYBR 2× PCR mix (KAPA Biosystems, Wilmington, Del, USA) and ABI 7900HT Fast Real Time PCR System (Life Technologies, CA, USA). The amplification of a single amplicon was confirmed by analyzing the melting curve after cycling. For NKCC1 and CFTR isoforms, FAM/ZEN/IBFQ-probes (Integrated DNA Technologies, Coralville, IA, USA) were designed to quantify each isoform separately. The reactions were carried out in 8 μL 3
Comparative Biochemistry and Physiology, Part A 238 (2019) 110565
M.K.-S. Wong, et al.
Table 2 Primer and probe sequences used in real time PCR. Forward primer (F); Reverse primer (R); TaqMan probe (P). GenBank accession number
Gene names
Oligo sequences (5′ to 3′)
MK989711
Elongation factor 1 α (EF1) Na/K/ATPase α1a (NKA α1a) Na/K/ATPase α1b (NKA α1b) Na/K/ATPase α1c (NKA α1c) Na/H exchanger 2 (NHE2) Na/H exchanger 3a (NHE3a) Na/H exchanger 3b (NHE3b) Na-K-Cl cotransporter 1a (NKCC1a)
F: GTGGAGACAGGCACCCTGAA R: CTTGACGGACACGTTCTTGA F: GTCCCAGGATCACTCAGTCAC R: AAGGCAAATGGGTTTAATATC F: CATCACTCTGCTGCTACATCTC R: TGCACCATCACAGTGTTCAT F: CGTTTGCATCGCTCAAGTTC R: GTCAAATGTCTTGGTTCATCATCTC F: ATGAAGTACTATGTGGAGGAGAATG R: TCCACTCGTGTTCTGTTGTTAT F: CATAACTACATGAGAGACAAGTGGC R: GATGTTGAATATGTAGTCACGGGAT F: GAGATAACTACATGAGAGACAAGTGGA R: CTTGATGTTGAGCTTGTGGAAA F: TCTGACGGAGACTCATCCAA R: CTCAACAGCGGCTTCCTT P: CCAGCCATCCAGAAAGGTGACGAT F: CAGTAACTCCTTTCCTCCATCC R: AGAAGCCTTTGGTCTGTGAG P: ACGAAGAGAAGCGCTAAGCCACTG F: AATTATCCTTCATCCGTTAGCGC R: CACCACTGAGAACTTCCTCTCT P: ACCGATGAAGGAGAATTTACGGGCC F: TGGTGGAGAAACGTAAACAGTCG R: CACGCCATCCTCGATGGTA P: AGCAACGGCACGTAAGTTCTCCTT F: AATGAAAGGGCCTGCACCC R: GCCTCTGGCTCAATGGCTTTA F: CGGATACGCGACTGGATCAG R: CCTCGGGTCTCGCCTTT F: ATGGAGCTTCTGGAATGCAAGG R: ACCATGCTTGGAGGTAGAACTGG F: AGCTTCTGGAATGCAAGGTCTC R: ACCTTGCCTGGAAGTAGAACTTT
LC482248 LC482249 LC482251 MN242822 MK890140 MK890141 MK890136
MK890137
Na-K-Cl cotransporter 1b (NKCC1b)
MK890138
Cystic fibrosis transmembrane conductance regulator I (CFTR I)
MK890139
Cystic fibrosis transmembrane conductance regulator II (CFTR II)
MK990540
Glucocorticoid (GR1a) Glucocorticoid (GR1b) Glucocorticoid (GR2a) Glucocorticoid (GR2b)
MK990541 MK990542 MK990543
receptor 1a receptor 1b receptor 2a receptor 2b
2.5. Statistical analysis
3.2. Salinity transfer and plasma Na+ concentration
Plasma Na+ levels and gene expressions of FW- and SW-transferred salmons were analyzed by two-way ANOVA followed by Fisher's LSD test on the time-dependent salinity transfer effect (GraphPad Prism Ver. 6 for Windows, San Diego, CA, USA). Significant levels were denoted by * (p < .05); ** (p < .01), *** (p < .001) between FW- and SWtransferred groups at the same developmental stage. For stage-dependent effects, Tukey's test were performed after two-way ANOVA on FWtransferred groups and different alphabets denote significant difference (p < .05) among developmental stages.
SW transfer did not affect the body weight of chum salmon embryos and fry at any of the developmental stages examined (Fig. 1b). We were not able to collect blood samples from eye-staged embryos but sampling was successful on newly hatched embryos on week 7 after fertilization (Fig. 1a). Both FW-FW and FW-SW transferred salmon fries possess high plasma Na+ concentrations between 230 and 250 mM at week 7 (Fig. 1c). Such high levels of plasma Na+ continued at week 8 and a significant reduction was observed in week 9, when the plasma Na+ of the control group was 163 mM while the that of SW-transferred group was increased significantly to 237 mM. The pattern of plasma Na+ increase after SW transfer continued up to week 10. After week 11, the SW treatment has no apparent effect on the plasma Na+ of salmon fries and stable values were obtained between 165 and 175 mM in both FWFW and FW-SW transferred groups.
3. Results 3.1. Chum salmon development According to hatchery management, the reported growth rate for chum salmon from fertilization to hatch is 480 °C days (e.g. 40 days if incubated at 12 °C). In accordance with this, most salmon hatched on 22nd Jan, 2019, which is 49 days (at 11.0–12.0 °C) after fertilization. After hatching, the salmon developed with yolk reserve and emerged three weeks after hatching. The first sampling started one week before hatching (week 6 after fertilization) and continued on a weekly basis until week 12 after fertilization. Gill blood perfusion was first observed on week 9 after fertilization. One week after emergence, the fry had absorbed most of the yolk and had started feeding on commercial diet at week 11. No mortality was observed except one SW-transferred individual died at week 9. The developmental events are summarized in Fig. 1a.
4. Gene expression of ionocyte surface Gene expressions of NKA isoforms including α1a, α1b, and α1c were measured by quantitative PCR and the effects of salinity transfer was determined stage-dependently (Fig. 2a-c). For NKA α1a, the expression increased gradually and stage-dependently in FW, while SW transfer consistently lowered the expression, and significant downregulation was noticed from week 9 onwards. NKA α1b expression also increased stage-dependently in FW, but SW transfer increased the expression further from week 11 onwards (Fig. 2b). NKA α1c was neither affected by salinity nor developmental stages (Fig. 2c). Initially in week 6, NKA α1c expression was prominent but the expression of NKA α1a and NKA α1b increased in later stages. In particular, NKA α1b expression was considerably higher than that of NKA α1a and NKA α1c, which could indicate NKA α1b to be the dominant isoform in the 4
Comparative Biochemistry and Physiology, Part A 238 (2019) 110565
M.K.-S. Wong, et al.
Fig. 3. Stage-dependent gene expressions of apical transporters including (a) NHE2, (b) NHE3a, (c) NHE3b, (d) CFTR I, and (e) CFTR II of ionocyte surface of chum salmon after salinity transfer. Statistical significant groups are denoted by ** (p < .01); *** (p < .001) between FW- and SW-transferred groups. Stagedependent changes in gene expression in FW groups are denoted by different alphabets (p < .05). Values are expressed as mean ± S.E.M.
Fig. 2. Stage-dependent gene expressions of basolateral transporters including (a) NKA α1a, (b) NKA α1b, (c) NKA α1c, (d) NKCC1a, and (e) NKCC1b of ionocyte surface of chum salmon after salinity transfer. Statistical significant groups are denoted by *** (p < .001) between FW- and SW-transferred groups. Stage-dependent changes in gene expression in FW groups are denoted by different alphabets (p < .05). Values are expressed as mean ± S.E.M.
was found at week 11, while no salinity effect was observed at other stages. A gradual increase in NKCC1b expression was found from weeks 6 to 9, and the gene was stably expressed afterwards (Fig. 2e). SW transfer has no effect on the expression of NKCC1b at any of the stages
alevins and fry. Gene expression of NKCC1a increased gradually and stage-dependently in both control- and salinity-transferred salmon (Fig. 2d). A significant increase in NKCC1a expression in the SW group 5
Comparative Biochemistry and Physiology, Part A 238 (2019) 110565
M.K.-S. Wong, et al.
(Fig. 4c). Expressions of GR1a and GR2b sharply decreased after hatching (Fig. 4a, d). SW exposure tend to inhibit the expression of GRs, with significant downregulation of GR2b at week 6 and GR1b at week 10. 5. Discussion Our results showed the ontogeny of SW tolerance in relation to osmoregulatory transporter expression in ionocyte surface of chum salmon. Chum salmon fry exhibited remarkable SW tolerance after completion of yolk absorption and initiation of feeding (week 11 onwards, > 0.4 g). Their plasma Na+ levels remained stable (~150–170 mM) after SW challenge (Fig. 1c). Previous time-course study on size-dependent salinity challenge showed that the newly-hatched chum salmon (0.3 g) increased in plasma Na+ gradually and reached maximum increase (> 40 mM from pre-transfer level) after 1 day in SW (Hasegawa et al., 1987), which is consistent with chum salmon fry until week 10 (< 0.4 g) in our study. The previous studies further reported that SW transfer increased the plasma Na+ in much smaller amplitude (~ 10 mM) in larger alevins (1.3–2.0 g) (Hasegawa et al., 1987; Uchida et al., 1996), which could maintain a much more stable plasma Na+ level. Therefore, chum salmon alevins acquire excellent SW tolerance between 0.3 g and 1.3 g. The present study clearly showed that SW tolerance was acquired much earlier than previously thought, where osmoregulatory ability drastically changed between week 10 (< 0.4 g, before start of feeding) and week 11 (> 0.4 g, after start of feeding). One unexpected result was high plasma Na+ in the FW to FW control transfer groups in weeks 7 and 8, suggesting that the handling stress may have increased the plasma Na+, possibly similar to the phenomenon where handling and confinement stresses increased the plasma osmolality in tilapia (Breves et al., 2010). If this is the case, however, the reason why the same treatment did not affect plasma Na+ after week 9 remains to be clarified. Alternatively, smaller fry with large yolk volume may have a particular mechanism that retains internal Na+ levels over 200 mM. Coincidently, the total body Na+ in pink salmon increased more than five-fold between hatching and complete yolk absorption, suggesting that there could be some unidentified mechanisms for ion retention in alevins (Gallagher et al., 2012). The surface area for ion exchange increased dramatically when the blood started to perfuse the gills at week 9, which coincided with the lowering of plasma Na+ levels in FW individuals. Whether initiation of gill perfusion has a role on the reduced plasma Na+ in week 9 requires further study. Na-binding molecules could be involved to hold Na+ in FW, which may reduce the energetic cost for transportermediated osmoregulation (Wong et al., 2017). Although plasma Na+ reached the critical levels reported for stenohaline stickleback (~250 mM) (Kusakabe et al., 2014), the chum salmon embryos and alevins did not lose body weight or show any morphological and behavioral deficit from weeks 6 to 8. Yolk-sac epithelium contains ionocytes and is the major osmoregulatory surface before the functional gill develops (Kaneko et al., 2002). In hatched fish, the osmoregulatory role of the yolk sac decreases gradually while branchial ionocytes increase their contribution reciprocally (Varsamos et al., 2005). For a collective purpose, we combined the yolk sac and whole gill to represent the total “ionocyte surface” in chum salmon embryos and alevins, to understand the transporter changes close to a whole animal model. The treatment of one day FW/SW transfer balances the known time-course salinity effects on plasma Na+ from the literature (Table 1) and allows sufficient time for gene expression changes. NKA α1a and α1b are markers for FW and SW ionocytes respectively in Atlantic salmon (McCormick et al., 2009). Our group has cloned the corresponding isoforms in chum salmon and found that the NKA α1a was consistently downregulated in SW-transferred alevins at all stages, which matches with its proposed role in FW-type ionocytes. The NKA α1a should be largely present in both yolk sac and gill, as the
Fig. 4. Stage-dependent gene expressions of glucocorticoid receptors (a) GR1a, (b) GR1b, (c) GR2a, and (d) GR2b of ionocyte surface of chum salmon after salinity transfer. Statistical significant groups are denoted by * (p < .05); ** (p < .01) between FW- and SW-transferred groups. Stage-dependent changes in gene expression in FW groups are denoted by different alphabets (p < .05). Values are expressed as mean ± S.E.M.
examined. NHE2 expression was low from weeks 6–9, and increased significantly after week 10 with a peak in week 11 (Fig. 3a). Significant upregulation by SW transfer was found in week 10 and 12. NHE3a expression was low from weeks 6–9, and increased dramatically after week 10. Significant upregulation by SW transfer was observed from weeks 10 to 12, with ~3-fold increase in week 11 (Fig. 3b). NHE3b exhibited a stage-dependent expression increase, and SW transfer slightly inhibited the expression at all stages with significant downregulation at week 12 (Fig. 3c). CFTR I and CFTR II expression followed the same pattern of stage-dependent increase and SW transfer significantly upregulated both isoforms from week 10 onwards (Fig. 3d-e). We cloned 4 GR isoforms and identified them as GR1a, GR1b, GR2a, and GR2b (Fig. 4a-d). The expression level of GR2a was highest among these isoforms, and significant upregulation was observed in week 9 6
Comparative Biochemistry and Physiology, Part A 238 (2019) 110565
M.K.-S. Wong, et al.
future efforts to raise new specific antibodies to explore further tissue and cell expression. A rise in cortisol is associated with smoltification in salmonids and the GR was upregulated in the gill during smolting in Atlantic salmon (Kiilerich et al., 2007). The GR was found to be colocalized with ionocytes in zebrafish (Danio rerio), suggesting a regulatory role of cortisol on ionocyte via GR (Cruz et al., 2013). At least two GR isoforms, GR1 and GR2, were identified in trout (Becker et al., 2008; Yada et al., 2008), and we identified additional isoforms in chum salmon, named GR1a, GR1b, GR2a, and GR2b. These complicated GR isoforms could be the combination of teleost third round whole genome duplication and rediploidization in salmonids (Lien et al., 2016). Among these four isoforms, GR2a has a higher expression level, which could be the major GR on ionocyte surface. The GR2a expression significantly increased during week 9 and the increase slightly preceded the upregulation of NKA α1b, suggesting a preparatory role of the receptor in chum salmon smoltification. The expressions of GR1a and GR2b were significantly downregulated in week 7, suggesting involvement of glucocorticoid signaling in the hatching process. Further studies are needed to elucidate the roles of these GR isoforms in different physiological processes. Although the morphological parr-smolt transformation was not well-defined in chum salmon, we propose that smoltification occurs between weeks 10 and 11 when the fish have completely absorbed the yolk and started foraging. To know the smoltification period is important for comparative studies among different salmonids and other teleosts. Previous studies may have considered chum salmon fry in FW as parr and indeed most emerged alevins possess parr-marks on their bodies, but are smolts by physiological measures. The competency to maintain perfectly stable plasma Na+ after a FW to SW transfer is fascinating and we considered that this feature is a marker of increased SW tolerance. Captive chum salmon did not lose SW acclimation ability dramatically as they survived the FW to SW transfer even after 13 months in FW (Hasegawa et al., 1987). However, chum salmon at larger size (> 2.5 g) were more sensitive to SW transfer with elevated plasma Na+ (Table 1), indicating a slight drop of SW tolerance. This “good-excellent-good” pattern of SW tolerance in chum salmon resembles the “parr-smolt-desmolt” of other salmonids. While landlocked Atlantic salmon desmoltified and cannot acclimate to SW (Stefansson et al., 2008), chum salmon is not limited physiologically. Chum salmon was not an attractive model for osmoregulation studies because the short FW life and the fry and juveniles did not behave like the parr as in other salmonids that spend years in FW. However, the present study pinned down the “smoltification period” of chum salmon and provided a basis for comparison among the physiology of salmonids. In particular, the stage-dependent increase in SW tolerance is highly resemble to that the novel pattern of smoltification in pink salmon (Gallagher et al., 2012), but it appears that chum salmon alevins are more tolerant as no major morbidity under SW exposure was observed in the present study. Phylogenetic studies showed that chum salmon and pink salmon are the most recently evolved salmonid species (Crête-Lafrenière et al., 2012), and their “parr life” could have been condensed from years into weeks, resulting in their short FW life stage. Although the short FW life of chum salmon seems to be disadvantageous for osmoregulation studies, the smoltification stages are clear and synchronized as the fertilized eggs from hatchery develop at almost the same speed before emergence. In species that have long FW life, the parr and smolt stages are somewhat ambiguous, as smolting is gradual and usually takes months to complete (McCormick et al., 1998; Stefansson et al., 2008). To screen for marker genes that are involved in the smoltification using bottom-up approaches such as RNA-seq, the short “smoltification period” of chum salmon can be advantageous since comparisons among stages are clear with testable physiological parameters such as plasma Na+ changes.
downregulation was prominent at stages when the alevins possess only yolk sac or gill (Fig. 2a). On the other hand, NKA α1b was not regulated by SW challenge until week 11 onwards, indicating that the SW-acclimating potential by this measure increased between week 10 and 11 (Fig. 2b), consistent with the increased SW tolerance revealed by the plasma Na+ levels. The difference in expression pattern between NKA α1a and α1b also suggested that the distinct transcription factors were involved to control the expressions of the two isoforms. NKA α1c expression was remarkably stable among all stages and salinity challenges, suggesting that it could be a housekeeping NKA and the normalization against EF1 was suitable in the case of developing chum salmon embryos (Fig. 2c). Besides NKA, we also examined the isoforms for NKCC1, NHE2, NHE3 and CFTR in chum salmon to provide further understanding to the ontogeny of SW tolerance, as these transporters were known to coexpress in the SW-type ionocytes (chloride cells) (Hiroi and McCormick, 2012). NKCC1a is the major isoform in terms of expression levels and responses to salinity change and developmental stages (Fig. 2d), which is similar to the case of Atlantic salmon (Handeland et al., 2014). Although there was a stage-dependent increase in NKCC1b expression at early embryonic stages, the total expression was relatively low and insensitive to salinity transfer, suggesting that NKCC1b could be a redundant isoform in the gill of chum salmon (Fig. 2e). A sharp increase in NKCC1a expression in week 11 after SW exposure coincide to the increase in NKA α1b expression, indicating that the branchial SW-type ionocytes were highly active at this stage in response to SW exposure. NHE2 and NHE3 were found on different types of ionocytes in rainbow trout (O. mykiss) and the expression of NHE2 was 30-fold higher than that of NHE3 (Ivanis et al., 2008). In chum salmon alevins, on the other hand, the NHE2 expression levels were not greatly differ from those of NHE3 isoforms (Fig. 3a-c). As the chum salmon have a short FW life while less acid-base fluctuation is expected in SW (Gilmour and Perry, 2009), the role of NHE2 could be less demanding than the case in other salmonids with longer FW life. In rainbow trout, NHE2 ionocytes are situated at the base of lamellae while NHE3 ionocytes are mostly on lamellae and the NHE2 expression increased in response to acidosis and cortisol treatment (Ivanis et al., 2008). NHE3 immunoreactivity was identified on the ionocytes in both FW and SW Atlantic salmon, but with no significant differences in expression patterns (Christensen et al., 2012). Our results suggested that NHE3a and NHE3b perform separate roles in salinity acclimation. NHE2 and NHE3a are likely to be present on SW-type ionocytes for their similar expression pattern to those of NKA α1b and NKCC1a (Inokuchi et al., 2017). NHE3b has a Na+ uptake role and acid base regulation as shown in rainbow trout (Boyle et al., 2016; Ivanis et al., 2008), and the downregulation by SW transfer in our result supports the ion uptake role in FW. It will be intriguing to study the localization of NHE2 and NHE3 isoforms as they may serve as ionocyte markers with specific functions. Unlike the case of Atlantic salmon where CFTR I and CFTR II exhibited differential regulation (Singer et al., 2002), their expression levels and pattern in chum salmon were highly similar, with stage-dependent increase as well as significant upregulation by SW treatment from week 10 onwards. The NHE3 and CFTR were found to be expressed on the same ionocyte in Atlantic salmon, and the synchronized upregulation of NHE3a, CFTR I, and CFTR II suggested that the SW-type ionocyte of chum salmon may possess a similar ion-excreting mechanism to that proposed in Atlantic salmon (Christensen et al., 2012). The sharp improvement in the stability of plasma Na+ matched with the upregulation in SW-related transporters from weeks 10 to 11, marking the enhancement in osmoregulatory ability of chum salmon in this developmental transition. Development of immunohistochemistry for specific transporter isoforms is demanding and may take years to complete. Although we have not examined the localization of the transporter isoforms in this study, the stage- and salinity-dependent changes in transporter expression were clear and inspiring, encouraging 7
Comparative Biochemistry and Physiology, Part A 238 (2019) 110565
M.K.-S. Wong, et al.
Acknowledgements
base regulation in freshwater rainbow trout (Oncorhynchus mykiss). J. Exp. Biol. 211, 2467–2477. https://doi.org/10.1242/jeb.017491. Iwata, M., Hasegawa, S., Hirano, T., 1982. Decreased seawater adaptability of chum Salmon (Oncorhynchus keta) fry following prolonged rearing in freshwater. Can. J. Fish. Aquat. Sci. https://doi.org/10.1139/f82-070. Kaneko, T., Hasegawa, S., Takagi, Y., Tagawa, M., Hirano, T., 1995. Hypoosmoregulatory ability of eyed-stage embryos of chum salmon. Mar. Biol. 122, 165–170. https://doi. org/10.1007/BF00349290. Kaneko, T., Shiraishi, K., Katoh, F., Hasegawa, S., Hiroi, J., 2002. Chloride cells during early life stages of fish and. Fish. Sci. 1–9. Kiilerich, P., Kristiansen, K., Madsen, S.S., 2007. Hormone receptors in gills of smolting Atlantic salmon, Salmo salar: expression of growth hormone, prolactin, mineralocorticoid and glucocorticoid receptors and 11β-hydroxysteroid dehydrogenase type 2. Gen. Comp. Endocrinol. 152, 295–303. https://doi.org/10.1016/j.ygcen. 2006.12.018. Kitada, S., 2014. Japanese chum salmon stock enhancement: current perspective and future challenges. Fish. Sci. 80, 237–249. https://doi.org/10.1007/s12562-0130692-8. Kusakabe, M., Ishikawa, A., Kitano, J., 2014. Relaxin-related gene expression differs between anadromous and stream-resident stickleback (Gasterosteus aculeatus) following seawater transfer. Gen. Comp. Endocrinol. 205, 197–206. https://doi.org/10. 1016/j.ygcen.2014.06.017. Lien, S., Koop, B.F., Sandve, S.R., Miller, J.R., Kent, M.P., Nome, T., Hvidsten, T.R., Leong, J.S., Minkley, D.R., Zimin, A., Grammes, F., Grove, H., Gjuvsland, A., Walenz, B., Hermansen, R.A., Von Schalburg, K., Rondeau, E.B., Di Genova, A., Samy, J.K.A., Olav Vik, J., Vigeland, M.D., Caler, L., Grimholt, U., Jentoft, S., Inge Våge, D., De Jong, P., Moen, T., Baranski, M., Palti, Y., Smith, D.R., Yorke, J.A., Nederbragt, A.J., Tooming-Klunderud, A., Jakobsen, K.S., Jiang, X., Fan, D., Hu, Y., Liberles, D.A., Vidal, R., Iturra, P., Jones, S.J.M., Jonassen, I., Maass, A., Omholt, S.W., Davidson, W.S., 2016. The Atlantic salmon genome provides insights into rediploidization. Nature 533, 200–205. https://doi.org/10.1038/nature17164. McCormick, S.D., 2006. Ontogeny and evolution of salinity tolerance in anadromous Salmonids: hormones and Heterochrony. Estuaries 17, 26. https://doi.org/10.2307/ 1352332. McCormick, S.D., Dickhoff, W.W., Duston, J., Nishioka, R.S., Bern, H.A., 1991. Developmental differences in the responsiveness of gill Na+, K+-ATPase to cortisol in salmonids. Gen. Comp. Endocrinol. 84, 308–317. https://doi.org/10.1016/00166480(91)90054-A. McCormick, S.D., Hansen, L., Quinn, T.P., Saunders, R.L., 1998. Movement, migration, and smolting of Atlantic salmon (Salmo salar). Can. J. Fish. Aquat. Sci. 55, 77–92. https://doi.org/10.1007/978-3-319-25582-8_180007. McCormick, S.D., Moriyama, S., Björnsson, B.T., 2000. Low temperature limits photoperiod control of smolting in Atlantic salmon through endocrine mechanisms. Am. J. Physiol. Regul. Integr. Comp. Physiol. 278, R1352–R1361. https://doi.org/10.1152/ ajpregu.2000.278.5.R1352. McCormick, S.D., Regish, A.M., Christensen, A.K., 2009. Distinct freshwater and seawater isoforms of Na+/K+-ATPase in gill chloride cells of Atlantic salmon. J. Exp. Biol. 212, 3994–4001. https://doi.org/10.1242/jeb.037275. Singer, T.D., Clements, K.M., Semple, J.W., Schulte, P.M., Bystriansky, J.S., Finstad, B., Fleming, I.A., McKinley, R.S., 2002. Seawater tolerance and gene expression in two strains of Atlantic salmon smolts. Can. J. Fish. Aquat. Sci. 59, 125–135. https://doi. org/10.1139/f01-205. Stefansson, S.O., Björnsson, B.T., Ebbesson, L.O.E., McCormick, S.D., 2008. Smoltification. In: Finn, R.N., Kapoor, B.G. (Eds.), Fish Larval Physiology. Science Publishers Inc, pp. 607–681. Strand, J.E.T., Hazlerigg, D., Jørgensen, E.H., 2018. Photoperiod revisited: is there a critical day length for triggering a complete parr–smolt transformation in Atlantic salmon Salmo salar? J. Fish Biol. 93, 440–448. https://doi.org/10.1111/jfb.13760. Uchida, K., Kaneko, T., 2009. Enhanced chloride cell turnover in the gills of chum Salmon fry in seawater. Zool. Sci. 13, 655–660. https://doi.org/10.2108/zsj.13.655. Uchida, K., Kaneko, T., Yamauchi, K., Hirano, T., 1996. Morphometrical analysis of chloride cell activity in the gill filaments and lamellae and changes in Na+,K +-ATPase activity during seawater adaptation in chum salmon fry. J. Exp. Zool. 276, 193–200 (doi:10.1002/(SICI)1097-010X(19961015)276:3 < 193::AIDJEZ3 > 3.0.CO;2-I). Vargas-Chacoff, L., Regish, A.M., Weinstock, A., McCormick, S.D., 2018. Effects of elevated temperature on osmoregulation and stress responses in Atlantic salmon Salmo salar smolts in fresh water and seawater. J. Fish Biol. 93, 550–559. https://doi.org/ 10.1111/jfb.13683. Varsamos, S., Nebel, C., Charmantier, G., 2005. Ontogeny of osmoregulation in postembryonic fish: a review. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 141, 401–429. https://doi.org/10.1016/j.cbpb.2005.01.013. Wong, M.K.S., Tsukada, T., Ogawa, N., Pipil, S., Ozaki, H., Suzuki, Y., Iwasaki, W., Takei, Y., 2017. A sodium binding system alleviates acute salt stress during seawater acclimation in eels. Zool. Lett. 3, 22. https://doi.org/10.1186/s40851-017-0081-8. Yada, T., Hyodo, S., Schreck, C.B., 2008. Effects of seawater acclimation on mRNA levels of corticosteroid receptor genes in osmoregulatory and immune systems in trout. Gen. Comp. Endocrinol. 156, 622–627. https://doi.org/10.1016/j.ygcen.2008.02.009.
We thanks Shigeyuki Sasaki of Unosumai Hatchery, Iwate Prefecture for providing the chum salmon fertilized eggs for the experiment. Christopher A. Loretz of the University of Buffalo has edited the English of the manuscript. Funding This work was supported by JSPS Grant-in-Aid 16K18575 awarded to M.W., 15K07544 awarded to S.N., and in part by the Tohoku Ecosystem-Associated Marine Science (TEAMS) research program of the Ministry of Education, Culture, Sports, Science and Technology (MEXT). Declaration of Competing Interest None. References Becker, H., Sturm, A., Bron, J.E., Schirmer, K., Bury, N.R., 2008. The a/B domain of the teleost glucocorticoid receptors influences partial nuclear localization in the absence of hormone. Endocrinology 149, 4567–4576. https://doi.org/10.1210/en.20071683. Boyle, D., Blair, S.D., Chamot, D., Goss, G.G., 2016. Characterization of developmental Na + uptake in rainbow trout larvae supports a significant role for Nhe3b. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 201, 30–36. https://doi.org/10.1016/j. cbpa.2016.06.027. Breves, J.P., Hirano, T., Grau, E.G., 2010. Ionoregulatory and endocrine responses to disturbed salt and water balance in Mozambique tilapia exposed to confinement and handling stress. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 155, 294–300. https://doi.org/10.1016/j.cbpa.2009.10.033. Chen, E.Y., Leonard, J.B.K., Ueda, H., 2017. The behavioural homing response of adult chum salmon Oncorhynchus keta to amino-acid profiles. J. Fish Biol. 90, 1257–1264. https://doi.org/10.1111/jfb.13225. Christensen, A.K., Hiroi, J., Schultz, E.T., McCormick, S.D., 2012. Branchial ionocyte organization and ion-transport protein expression in juvenile alewives acclimated to freshwater or seawater. J. Exp. Biol. 215, 642–652. https://doi.org/10.1242/jeb. 063057. Crête-Lafrenière, A., Weir, L.K., Bernatchez, L., 2012. Framing the Salmonidae Family phylogenetic portrait: a more complete picture from increased taxon sampling. PLoS One 7. https://doi.org/10.1371/journal.pone.0046662. Cruz, S.A., Lin, C.H., Chao, P.L., Hwang, P.P., 2013. Glucocorticoid receptor, but not mineralocorticoid receptor, mediates cortisol regulation of epidermal ionocyte development and ion transport in zebrafish (Danio rerio). PLoS One 8. https://doi.org/ 10.1371/journal.pone.0077997. Gallagher, Z.S., Bystriansky, J.S., Farrell, A.P., Brauner, C.J., 2012. A novel pattern of smoltification in the most anadromous salmonid: pink salmon (Oncorhynchus gorbuscha). Can. J. Fish. Aquat. Sci. 70, 349–357. https://doi.org/10.1139/cjfas-20120390. Gilmour, K.M., Perry, S.F., 2009. Carbonic anhydrase and acid-base regulation in fish. J. Exp. Biol. 212, 1647–1661. https://doi.org/10.1242/jeb.029181. Handeland, S.O., Imsland, A.K., Nilsen, T.O., Ebbesson, L.O.E., Hosfeld, C.D., Pedrosa, C., Toften, H., Stefansson, S.O., 2014. Osmoregulation in Atlantic salmon Salmo salar smolts transferred to seawater at different temperatures. J. Fish Biol. 85, 1163–1176. https://doi.org/10.1111/jfb.12481. Hasegawa, S., Hirano, T., Ogasawara, T., Iwata, M., Akiyama, T., Arai, S., 1987. Osmoregulatory ability of chum salmon, Oncorhynchus keta, reared in fresh water for prolonged periods. Fish Physiol. Biochem. 4, 101–110. https://doi.org/10.1007/ BF02044319. Hiroi, J., McCormick, S.D., 2012. New insights into gill ionocyte and ion transporter function in euryhaline and diadromous fish. Respir. Physiol. Neurobiol. 184, 257–268. https://doi.org/10.1016/j.resp.2012.07.019. Hogasen, H.R., 1998. Physiological Changes Associated with the Diadromous Migration of Salmonids. Canadian Special Publication of Fisheries and Aquatic Sciences. Inokuchi, M., Nakamura, M., Miyanishi, H., Hiroi, J., Kaneko, T., 2017. Functional classification of gill ionocytes and spatiotemporal changes in their distribution after transfer from seawater to freshwater in Japanese seabass. J. Exp. Biol. 220, 4720–4732. https://doi.org/10.1242/jeb.167320. Ivanis, G., Esbaugh, A.J., Perry, S.F., 2008. Branchial expression and localization of SLC9A2 and SLC9A3 sodium/hydrogen exchangers and their possible role in acid-
8