- Email: [email protected]
Enhancement of aromatase gene expression in the mediobasal hypothalamus during anestrus in the beagle bitch
Neuroscience Letters 333 (2002) 107–110 www.elsevier.com/locate/neulet
Enhancement of aromatase gene expression in the mediobasal hypothalamus during anestrus in the beagle bitch Toshio Inaba a,*, Tamaki Namura b, Hiroyuki Tani c, Satoshi Matsuyama d, Ryuzo Torii e, Noritoshi Kawate b, Hiromichi Tamada b, Shingo Hatoya a, Daijiro Kumagai a, Kikuya Sugiura a, Tsutomu Sawada b a
Laboratory of Cell Pathobiology, Graduate School of Agriculture and Biological Sciences, Osaka Prefecture University, Osaka 599-8531, Japan b Laboratory of Theriogenology, Graduate School of Agriculture and Biological Sciences, Osaka Prefecture University, Osaka 599-8531, Japan c Laboratory of Veterinary Internal Medicine, Graduate School of Agriculture and Biological Sciences, Osaka Prefecture University, Osaka 599-8531, Japan d Laboratory of Radiology, Graduate School of Agriculture and Biological Sciences, Osaka Prefecture University, Osaka 599-8531, Japan e Research Center for Animal Life Science, Shiga University of Medical Science, Shiga 520-2192, Japan Received 2 August 2002; received in revised form 30 August 2002; accepted 1 September 2002
Abstract The relationships among expression of cytochrome P450 aromatase (P450arom) mRNA in the mediobasal hypothalamus (MBH), ovarian aromatase activity, and estrogen secretion were examined throughout the estrous cycle in beagle bitches. Using polymerase chain reaction (PCR) analysis we were able to detect P450arom gene transcripts in the canine MBH. The level of hypothalamic P450arom mRNA increased during the progression of anestrus and declined thereafter. Ovarian P450arom activity, as measured by a 3H2O assay, were low in anestrus, increased in proestrus, and declined thereafter. Ovarian P450arom activity and plasma estradiol-17b levels were positively correlated (r ¼ 0:77, P , 0:05). These results suggest that enhancement of hypothalamic P450arom gene expression is associated with termination of anestrus. q 2002 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Aromatase mRNA; Aromatase; Hypothalamus; Ovary; Estrous cycle; Dog
The breeding cycle of the domestic dog is not as precisely timed as in more frequently studied species. The bitch is monoestrous, with several months of anestrus occurring between active reproductive phases. These reproductive cycles are generally described as being under endocrine control exerted by the hypothalamo-pituitary-ovarian axis [4]. However, the endocrine factors responsible for the return to estrus in the bitch are not well understood. Evidence is accumulating that estrogen is essential for the neural regulation of reproduction in female mammals [2,5]. In the anestrous bitch, treatment with estradiol increases the concentration of gonadotorpin-releasing hormone (GnRH) in the ventromedial and the arcuate nuclei of the hypothalamus [12], and induces the estrus [2]. Recent evidence from our laboratory suggests that the release of GnRH from the * Corresponding author. Tel./fax: 181 72 254 9517. E-mail address: [email protected] (T. Inaba).
canine hypothalamus increases as anestrus progresses, with a greater amplitude and a higher number of pulses as well as with enhanced expression of the hypothalamic estrogen receptor gene [16,18]. Fertile estrus has been induced prematurely in anestrous dogs by injection of a GnRH agonist [10]. These reports imply that GnRH plays a critical role in the termination of anestrus and that estrogen may activate GnRH synthesis in the bitch. Earlier work had indicated low plasma estrogen concentrations throughout anestrus in the bitch [7,17]. In estrogen biosynthesis cytochrome P450 aromatase (P450arom) catalyzes the key step of aromatization of androgen. Central aromatization has been implicated in the mechanism by which androgen regulates gonadotorpin secretion in male dogs [11]. The complete cDNA sequences of P450arom from human and rat tissues have been determined [6,8], and the expression of P450arom in the rat hypothalamus
0304-3940/02/$ - see front matter q 2002 Elsevier Science Ireland Ltd. All rights reserved. PII: S03 04 - 394 0( 0 2) 01 00 1- 7
108
T. Inaba et al. / Neuroscience Letters 333 (2002) 107–110
Fig. 1. A representative photographic record of P450arom and b-actin-specific PCR products from the canine hypothalamus during early and late anestrus. Primers were used to amplify a 307 bp fragment of P450arom cDNA (top band) and a 243 bp fragment of b-actin cDNA (bottom band) within the same PCR reaction. Products were amplified for a total of 33 PCR cycles. Polyacrylamide gel was stained with ethidium bromide.
has been examined at the mRNA level [14]. However, no attempts have been made to examine cDNA sequences and expression of P450arom from canine tissue. The present study was therefore undertaken to characterize the activity of the hypothalamo-ovarian axis during estrous cycle by investigating the hypothalamic P450arom gene, simultaneously with ovarian P450arom activity. Purebred, 2–8 year old bitches, known to be reproductively normal from previous estrous cycles, were housed and studied in accordance with NIH guidelines, the regulations of the local Institutional Animal Care and Use Committee, and with accepted veterinary medical practice. Estrus stages were monitored by vaginal smear and estrous behavior, and classified into five groups (n ¼ 4 per group) by the method of Holst and Phemister [9]. The five groups were designated: early and late anestrus; proestrus; estrus, and diestrus. The corresponding days of the estrous cycle were days 0–30 and 97–140 of anestrus, days 0–8 of proestrus, days 1–5 of estrus, and days 0–14 of diestrus. The animals were deeply anesthetized with i.v. ketamine and euthanized by transabdominal aortic transection at each stage as described by Mershon et al. [13]. The animals displayed minimal agitation during this procedure. The brain and ovaries were removed immediately, and the mediobasal hypothalamus (MBH) was excised as described by Kumar et al. [12]. The MBH and ovaries were frozen in liquid nitrogen and stored at 290 8C until analyzed. Blood samples were collected by venipuncture from a jugular vein just before aortic transection, and the plasma was stored at 220 8C until analyzed. The hypothalamic P450arom mRNA was cloned and quantified by the reverse transcription-polymerase chain reaction (RT-PCR) essentially as previously described [16]. In brief, the total RNA was extracted from individual tissues by using a TRIzol w reagent (Gibco BRL, Grand Island, NY). RNA was reverse-transcribed with oligo d(T) primer (Pharmacia, Piscataway, NJ) and used as a template in PCR. The sequences of the primers used for the PCR were
designed from conserved sequences of human and rat P450 cDNA sequences that spanned exons 3–5 and canine b-actin sequences [3,6,8], so that the expected PCR products would be 307 bp for canine P450arom and 243 bp for b-actin. bActin was used as an internal control sequence in the PCR reactions. Sense (A) and antisense (B) primers were as follows: P450arom A, ATCGGCAGTGCCTGCAATTACTACA; P450arom B, GATGCGTTATGATGGATCCAACACAA; b-actin A, CGTGGGCCGCCCTAGGCACCA; b-actin B, TTGGCCTTAGGGTTCAGGGGGG. The PCR conditions were 94 8C for 1 min, 55 8C for 1 min and 72 8C for 1 min for 33 cycles. The PCR-generated DNA was analyzed on 6% polyacrylamide gel. The RT-PCR products were subcloned into the pCR II vector (TA Cloning System; Invitrogen, San Diego, CA), and transformed into the competent Escherichia coli cell (INVaF 0 ) as supplied by the TA Cloning System (Invitrogen). Nucleotide sequences of the products were determined by using a kit for sequencing of DNA (Sequencing PRO; Toyobo, Osaka, Japan). Ovarian P450arom activity was measured by the radiometric assay that quantifies the stereospecific production of 3 H2O from [1b- 3H]androstenedione as an index of estrogen formation, as described by Abdelgadir et al. [1]. In brief, aliquots of high-speed particulate cell fraction containing microsomes were incubated for 1 h at 37 8C with 0.1 mM [1b- 3H]androstenedione in the presence of an nicotinamide adenine dinucleotide phosphate generating system. The 3 H2O generated during the incubation was quantified by liquid scintillation spectrophotometry. A linear enzyme response was observed during 1 h; the response was also linear with increasing amounts of enzyme protein up to 0.3 mg. The concentrations of estradiol-17b (E2) were quantified by radio-immunoassay as described previously [17]. The sensitivity of the assay was 0.4 pg/tube. The intra-assay coefficients of variation was less than 9%. All samples were assayed in duplicate in the same assay. Differences in P450arom mRNA, P450arom activity, and
T. Inaba et al. / Neuroscience Letters 333 (2002) 107–110
109
Fig. 2. Sequences of P450arom-specific PCR products from the canine hypothalamus are compared with corresponding cDNA sequences of the same regions of human [6] and rat [8], and variant sequences are shown. The numbers refer to the position of nucleotides. The 25–26 bases of 5 0 and 3 0 sequences are primer sequences used in the present study.
Fig. 3. Hypothalamic P450arom mRNA levels, ovarian microsomal aromatase activity and plasma estradiol-17b levels during various stages of the estrous cycle in the bitches. The data are presented as the mean ^ SEM of four bitches. Values with different letters differ significantly (P , 0:05).
in E2 levels between groups, were evaluated using ANOVA followed by Fisher’s protected least significant difference post-hoc analysis, using the Stat View w computer program (Hulinks Inc., Tokyo, Japan). The level of significance was set at P , 0:05. A representative photographic record of P450arom and bactin-specific PCR products from the canine hypothalamus is shown in Fig. 1. P450arom expression was detectable in all tissue samples, with the highest levels observed in late anestrus. The nucleotide sequence of the P450arom-specific PCR product from the canine hypothalamus was determined and was compared with the reported cDNA sequences of human and rat P450arom (Fig. 2). The nucleotide sequence of the PCR product was 307 nucleotides in length and possessed 87.0% and 79.5% homology with the cDNA sequences of human [6] and rat [8] P450arom genes, respectively. In cyclic bitches, the levels of hypothalamic P450arom mRNA increased significantly from early anestrus to late anestrus (P , 0:05; Fig. 3). Thereafter, P450arom mRNA levels decreased in proestrus and stayed low from estrus to diestrus. Ovarian P450arom activities and plasma E2 levels are also presented in Fig. 3. Ovarian P450arom activities were significantly higher in proestrus than in early and late anestrus (P , 0:05). Thereafter they declined from estrus to diestrus. Plasma levels of E2 increased significantly from late anestrus to proestrus (P , 0:01), and decreased significantly from estrus to diestrus (P , 0:05). The ovarian P450arom activities and plasma E2 levels were positively correlated during estrous cycle (r ¼ 0:77, P , 0:05). Sequence alignment and comparison of the canine
110
T. Inaba et al. / Neuroscience Letters 333 (2002) 107–110
P450arom cDNA with human [6] and rat [8] P450arom cDNA revealed a high degree of nucleotide similarity, while these cDNA sequences showed a low homology with the cDNA sequences of other steroidogenic enzyme genes. Because levels of hypothalamic P450arom mRNA were significantly higher during late than early anestrus, hypothalamic P450arom mRNA appears to be stimulated as anestrus progresses. Consistent with these observations, levels of hypothalamic ER mRNA and the GnRH release rate from the canine hypothalamus were both elevated in late anestrus [16,18]. These results were also concordant with previous observations that luteinizing hormone (LH) pulse frequencies increased during proestrus in the bitches [17]. They may represent the stimulus for development of a competent wave of follicles [15]. To our knowledge, this is the first study to evaluate P450arom activities in canine ovaries. The ovarian P450arom activities and plasma levels of E2 were significantly higher during proestrus than during late anestrus. This is probably a reflection of the enhanced LH pulse frequencies during late proestrus [17]. It has been indicated that treatment with estradiol increases the concentration of GnRH in the hypothalamus [12] and induces estrus in the anestrous bitch [2]. The present finding that levels of hypothalamic P450arom mRNA increase as anestrus progresses, together with other studies, reinforces the view that the increase in levels of hypothalamic P450arom mRNA in late anestrus appears to play a critical role in the neuroendocrine events associated with termination of anestrus during the ovarian cycle of the dog [2,12]. It remains to be determined whether the increased P450arom mRNA reflects the concomitant increase in gene transcription and protein expression of P450arom, or reduced turnover of extant message. This study was supported in part by a Grant-in-Aid for Scientific Research (B) No. 14360191 and (C) No. 10839011 from the Japan Society for the Promotion of Science. The food supply was provided by Nisshin Pet Food Co., Ltd. (Tokyo) and Iams Japan Inc. (Tokyo). [1] Abdelgadir, S.E., Roselli, C.E., Choate, V.A. and Resko, J.A., Distribution of aromatase cytochrome P450 messenger ribonucleic acid in adult rhesus monkey brains, Biol. Reprod., 57 (1997) 772–777. [2] Bouchard, G.F., Gross, S., Ganjam, V.K., Youngquist, R.S., Concannon, P.W., Krause, G.F. and Reddy, C.S., Oestrus induction in the bitch with the synthetic oestrogen diethylstilboestrol, J. Reprod. Fertil., 47 (1993) 515–516. [3] Carlyle, W.C., Toher, C.A., Vandervelde, J.R., McDonald, K.M., Homans, D.C. and Cohn, J.N., Changes in beta-actin mRNA expression in remodeling canine myocardium, J. Mol. Cell. Cardiol., 28 (1996) 53–63.
[4] Concannon, P.W., Biology of gonadotrophin secretion in adult and prepubertal female dogs, J. Reprod. Fertil., 47 (1993) 3–27. [5] Do¨ rner, G., Sexual differentiation of the brain, Vitam. Horm., 38 (1980) 325–381. [6] Harada, N., Cloning of a complete cDNA encoding human aromatase: immunochemical identification and sequence analysis, Biochem. Biophys. Res. Commun., 156 (1988) 725–732. [7] Hardley, J.C., Total unconjugated oestrogen and progesterone concentrations in peripheral blood during the oestrous cycle of the dog, J. Reprod. Fertil., 44 (1975) 445–451. [8] Hickey, G.J., Krasnow, J.S., Beattie, W.G. and Richards, J.S., Aromatase cytochrome P450 in rat ovarian granulosa cells before and after luteinization: adenosine 3 0 ,5 0 -monophosphate-dependent and independent regulation; cloning and sequencing of rat aromatase cDNA and 5 0 genomic DNA, Mol. Endocrinol., 4 (1990) 3–12. [9] Holst, P.A. and Phemister, R.D., Onset of diestrus in the beagle bitch: definition and significance, Am. J. Vet. Res., 35 (1974) 401–406. [10] Inaba, T., Tani, H., Gonda, M., Nakagawa, A., Ohmura, M., Mori, J., Torii, R., Tamada, H. and Sawada, T., Induction of fertile estrus in bitches using a sustained-release formulation of a GnRH agonist (leuprolide acetate), Theriogenology, 49 (1998) 975–982. [11] Juniewicz, P.E., Oesterling, J.E., Walters, J.R., Steele, R.E., Niswender, G.D., Coffey, D.S. and Ewing, L.L., Aromatase inhibition in the dog, I; effect on serum LH, serum testosterone concentrations, testicular secretions and spermatogenesis, J. Urol., 139 (1988) 827–831. [12] Kumar, M.S.A., Chen, C.L. and Kalra, S.P., Distribution of luteinizing hormone releasing hormone in the canine hypothalamus: effect of castration and exogenous gonadal steroids, Am. J. Vet. Res., 41 (1980) 1304–1309. [13] Mershon, J.L., Sehlhorst, C.S., Rebar, R.W. and Liu, J.H., Evidence of a corticotropin-releasing hormone pulse generator in the macaque hypothalamus, Endocrinology, 130 (1992) 2991–2996. [14] Roselli, C.E., Abdelgadir, S.E., Rønnekleiv, O.K. and Klosterman, S.A., Anatomic distribution and regulation of aromatase gene expression in the rat brain, Biol. Reprod., 58 (1998) 79–87. [15] Schallenberger, E., Schams, D., Bullermann, B. and Walters, D.L., Pulsatile secretion of gonadotrophins, ovarian steroids and ovarian oxytocin during prostaglandininduced regression of the corpus luteum in the cow, J. Reprod. Fertil., 71 (1984) 493–501. [16] Tani, H., Inaba, T., Matsuyama, S., Takamori, Y., Torii, R., Takano, H., Tamada, H. and Sawada, T., Enhancement of estrogen receptor gene expression in the mediobasal hypothalamus during anestrus in the beagle bitch, Neurosci. Lett., 227 (1997) 149–152. [17] Tani, H., Inaba, T., Nonami, M., Matsuyama, S., Takamori, Y., Torii, R., Tamada, H., Kawate, N. and Sawada, T., Increased LH pulse frequency and estrogen secretion associated with termination of anestrus followed by enhancement of uterine estrogen receptor gene expression in the beagle bitch, Theriogenology, 52 (1999) 593–607. [18] Tani, H., Inaba, T., Tamada, H., Sawada, T., Mori, J. and Torii, R., Increasing gonadotropin-releasing hormone release by perifused hypothalamus from early to late anestrus in the beagle bitch, Neurosci. Lett., 207 (1996) 1–4.
Enhancement of aromatase gene expression in the mediobasal hypothalamus during anestrus in the beagle bitch Toshio Inaba a,*, Tamaki Namura b, Hiroyuki Tani c, Satoshi Matsuyama d, Ryuzo Torii e, Noritoshi Kawate b, Hiromichi Tamada b, Shingo Hatoya a, Daijiro Kumagai a, Kikuya Sugiura a, Tsutomu Sawada b a
Laboratory of Cell Pathobiology, Graduate School of Agriculture and Biological Sciences, Osaka Prefecture University, Osaka 599-8531, Japan b Laboratory of Theriogenology, Graduate School of Agriculture and Biological Sciences, Osaka Prefecture University, Osaka 599-8531, Japan c Laboratory of Veterinary Internal Medicine, Graduate School of Agriculture and Biological Sciences, Osaka Prefecture University, Osaka 599-8531, Japan d Laboratory of Radiology, Graduate School of Agriculture and Biological Sciences, Osaka Prefecture University, Osaka 599-8531, Japan e Research Center for Animal Life Science, Shiga University of Medical Science, Shiga 520-2192, Japan Received 2 August 2002; received in revised form 30 August 2002; accepted 1 September 2002
Abstract The relationships among expression of cytochrome P450 aromatase (P450arom) mRNA in the mediobasal hypothalamus (MBH), ovarian aromatase activity, and estrogen secretion were examined throughout the estrous cycle in beagle bitches. Using polymerase chain reaction (PCR) analysis we were able to detect P450arom gene transcripts in the canine MBH. The level of hypothalamic P450arom mRNA increased during the progression of anestrus and declined thereafter. Ovarian P450arom activity, as measured by a 3H2O assay, were low in anestrus, increased in proestrus, and declined thereafter. Ovarian P450arom activity and plasma estradiol-17b levels were positively correlated (r ¼ 0:77, P , 0:05). These results suggest that enhancement of hypothalamic P450arom gene expression is associated with termination of anestrus. q 2002 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Aromatase mRNA; Aromatase; Hypothalamus; Ovary; Estrous cycle; Dog
The breeding cycle of the domestic dog is not as precisely timed as in more frequently studied species. The bitch is monoestrous, with several months of anestrus occurring between active reproductive phases. These reproductive cycles are generally described as being under endocrine control exerted by the hypothalamo-pituitary-ovarian axis [4]. However, the endocrine factors responsible for the return to estrus in the bitch are not well understood. Evidence is accumulating that estrogen is essential for the neural regulation of reproduction in female mammals [2,5]. In the anestrous bitch, treatment with estradiol increases the concentration of gonadotorpin-releasing hormone (GnRH) in the ventromedial and the arcuate nuclei of the hypothalamus [12], and induces the estrus [2]. Recent evidence from our laboratory suggests that the release of GnRH from the * Corresponding author. Tel./fax: 181 72 254 9517. E-mail address: [email protected] (T. Inaba).
canine hypothalamus increases as anestrus progresses, with a greater amplitude and a higher number of pulses as well as with enhanced expression of the hypothalamic estrogen receptor gene [16,18]. Fertile estrus has been induced prematurely in anestrous dogs by injection of a GnRH agonist [10]. These reports imply that GnRH plays a critical role in the termination of anestrus and that estrogen may activate GnRH synthesis in the bitch. Earlier work had indicated low plasma estrogen concentrations throughout anestrus in the bitch [7,17]. In estrogen biosynthesis cytochrome P450 aromatase (P450arom) catalyzes the key step of aromatization of androgen. Central aromatization has been implicated in the mechanism by which androgen regulates gonadotorpin secretion in male dogs [11]. The complete cDNA sequences of P450arom from human and rat tissues have been determined [6,8], and the expression of P450arom in the rat hypothalamus
0304-3940/02/$ - see front matter q 2002 Elsevier Science Ireland Ltd. All rights reserved. PII: S03 04 - 394 0( 0 2) 01 00 1- 7
108
T. Inaba et al. / Neuroscience Letters 333 (2002) 107–110
Fig. 1. A representative photographic record of P450arom and b-actin-specific PCR products from the canine hypothalamus during early and late anestrus. Primers were used to amplify a 307 bp fragment of P450arom cDNA (top band) and a 243 bp fragment of b-actin cDNA (bottom band) within the same PCR reaction. Products were amplified for a total of 33 PCR cycles. Polyacrylamide gel was stained with ethidium bromide.
has been examined at the mRNA level [14]. However, no attempts have been made to examine cDNA sequences and expression of P450arom from canine tissue. The present study was therefore undertaken to characterize the activity of the hypothalamo-ovarian axis during estrous cycle by investigating the hypothalamic P450arom gene, simultaneously with ovarian P450arom activity. Purebred, 2–8 year old bitches, known to be reproductively normal from previous estrous cycles, were housed and studied in accordance with NIH guidelines, the regulations of the local Institutional Animal Care and Use Committee, and with accepted veterinary medical practice. Estrus stages were monitored by vaginal smear and estrous behavior, and classified into five groups (n ¼ 4 per group) by the method of Holst and Phemister [9]. The five groups were designated: early and late anestrus; proestrus; estrus, and diestrus. The corresponding days of the estrous cycle were days 0–30 and 97–140 of anestrus, days 0–8 of proestrus, days 1–5 of estrus, and days 0–14 of diestrus. The animals were deeply anesthetized with i.v. ketamine and euthanized by transabdominal aortic transection at each stage as described by Mershon et al. [13]. The animals displayed minimal agitation during this procedure. The brain and ovaries were removed immediately, and the mediobasal hypothalamus (MBH) was excised as described by Kumar et al. [12]. The MBH and ovaries were frozen in liquid nitrogen and stored at 290 8C until analyzed. Blood samples were collected by venipuncture from a jugular vein just before aortic transection, and the plasma was stored at 220 8C until analyzed. The hypothalamic P450arom mRNA was cloned and quantified by the reverse transcription-polymerase chain reaction (RT-PCR) essentially as previously described [16]. In brief, the total RNA was extracted from individual tissues by using a TRIzol w reagent (Gibco BRL, Grand Island, NY). RNA was reverse-transcribed with oligo d(T) primer (Pharmacia, Piscataway, NJ) and used as a template in PCR. The sequences of the primers used for the PCR were
designed from conserved sequences of human and rat P450 cDNA sequences that spanned exons 3–5 and canine b-actin sequences [3,6,8], so that the expected PCR products would be 307 bp for canine P450arom and 243 bp for b-actin. bActin was used as an internal control sequence in the PCR reactions. Sense (A) and antisense (B) primers were as follows: P450arom A, ATCGGCAGTGCCTGCAATTACTACA; P450arom B, GATGCGTTATGATGGATCCAACACAA; b-actin A, CGTGGGCCGCCCTAGGCACCA; b-actin B, TTGGCCTTAGGGTTCAGGGGGG. The PCR conditions were 94 8C for 1 min, 55 8C for 1 min and 72 8C for 1 min for 33 cycles. The PCR-generated DNA was analyzed on 6% polyacrylamide gel. The RT-PCR products were subcloned into the pCR II vector (TA Cloning System; Invitrogen, San Diego, CA), and transformed into the competent Escherichia coli cell (INVaF 0 ) as supplied by the TA Cloning System (Invitrogen). Nucleotide sequences of the products were determined by using a kit for sequencing of DNA (Sequencing PRO; Toyobo, Osaka, Japan). Ovarian P450arom activity was measured by the radiometric assay that quantifies the stereospecific production of 3 H2O from [1b- 3H]androstenedione as an index of estrogen formation, as described by Abdelgadir et al. [1]. In brief, aliquots of high-speed particulate cell fraction containing microsomes were incubated for 1 h at 37 8C with 0.1 mM [1b- 3H]androstenedione in the presence of an nicotinamide adenine dinucleotide phosphate generating system. The 3 H2O generated during the incubation was quantified by liquid scintillation spectrophotometry. A linear enzyme response was observed during 1 h; the response was also linear with increasing amounts of enzyme protein up to 0.3 mg. The concentrations of estradiol-17b (E2) were quantified by radio-immunoassay as described previously [17]. The sensitivity of the assay was 0.4 pg/tube. The intra-assay coefficients of variation was less than 9%. All samples were assayed in duplicate in the same assay. Differences in P450arom mRNA, P450arom activity, and
T. Inaba et al. / Neuroscience Letters 333 (2002) 107–110
109
Fig. 2. Sequences of P450arom-specific PCR products from the canine hypothalamus are compared with corresponding cDNA sequences of the same regions of human [6] and rat [8], and variant sequences are shown. The numbers refer to the position of nucleotides. The 25–26 bases of 5 0 and 3 0 sequences are primer sequences used in the present study.
Fig. 3. Hypothalamic P450arom mRNA levels, ovarian microsomal aromatase activity and plasma estradiol-17b levels during various stages of the estrous cycle in the bitches. The data are presented as the mean ^ SEM of four bitches. Values with different letters differ significantly (P , 0:05).
in E2 levels between groups, were evaluated using ANOVA followed by Fisher’s protected least significant difference post-hoc analysis, using the Stat View w computer program (Hulinks Inc., Tokyo, Japan). The level of significance was set at P , 0:05. A representative photographic record of P450arom and bactin-specific PCR products from the canine hypothalamus is shown in Fig. 1. P450arom expression was detectable in all tissue samples, with the highest levels observed in late anestrus. The nucleotide sequence of the P450arom-specific PCR product from the canine hypothalamus was determined and was compared with the reported cDNA sequences of human and rat P450arom (Fig. 2). The nucleotide sequence of the PCR product was 307 nucleotides in length and possessed 87.0% and 79.5% homology with the cDNA sequences of human [6] and rat [8] P450arom genes, respectively. In cyclic bitches, the levels of hypothalamic P450arom mRNA increased significantly from early anestrus to late anestrus (P , 0:05; Fig. 3). Thereafter, P450arom mRNA levels decreased in proestrus and stayed low from estrus to diestrus. Ovarian P450arom activities and plasma E2 levels are also presented in Fig. 3. Ovarian P450arom activities were significantly higher in proestrus than in early and late anestrus (P , 0:05). Thereafter they declined from estrus to diestrus. Plasma levels of E2 increased significantly from late anestrus to proestrus (P , 0:01), and decreased significantly from estrus to diestrus (P , 0:05). The ovarian P450arom activities and plasma E2 levels were positively correlated during estrous cycle (r ¼ 0:77, P , 0:05). Sequence alignment and comparison of the canine
110
T. Inaba et al. / Neuroscience Letters 333 (2002) 107–110
P450arom cDNA with human [6] and rat [8] P450arom cDNA revealed a high degree of nucleotide similarity, while these cDNA sequences showed a low homology with the cDNA sequences of other steroidogenic enzyme genes. Because levels of hypothalamic P450arom mRNA were significantly higher during late than early anestrus, hypothalamic P450arom mRNA appears to be stimulated as anestrus progresses. Consistent with these observations, levels of hypothalamic ER mRNA and the GnRH release rate from the canine hypothalamus were both elevated in late anestrus [16,18]. These results were also concordant with previous observations that luteinizing hormone (LH) pulse frequencies increased during proestrus in the bitches [17]. They may represent the stimulus for development of a competent wave of follicles [15]. To our knowledge, this is the first study to evaluate P450arom activities in canine ovaries. The ovarian P450arom activities and plasma levels of E2 were significantly higher during proestrus than during late anestrus. This is probably a reflection of the enhanced LH pulse frequencies during late proestrus [17]. It has been indicated that treatment with estradiol increases the concentration of GnRH in the hypothalamus [12] and induces estrus in the anestrous bitch [2]. The present finding that levels of hypothalamic P450arom mRNA increase as anestrus progresses, together with other studies, reinforces the view that the increase in levels of hypothalamic P450arom mRNA in late anestrus appears to play a critical role in the neuroendocrine events associated with termination of anestrus during the ovarian cycle of the dog [2,12]. It remains to be determined whether the increased P450arom mRNA reflects the concomitant increase in gene transcription and protein expression of P450arom, or reduced turnover of extant message. This study was supported in part by a Grant-in-Aid for Scientific Research (B) No. 14360191 and (C) No. 10839011 from the Japan Society for the Promotion of Science. The food supply was provided by Nisshin Pet Food Co., Ltd. (Tokyo) and Iams Japan Inc. (Tokyo). [1] Abdelgadir, S.E., Roselli, C.E., Choate, V.A. and Resko, J.A., Distribution of aromatase cytochrome P450 messenger ribonucleic acid in adult rhesus monkey brains, Biol. Reprod., 57 (1997) 772–777. [2] Bouchard, G.F., Gross, S., Ganjam, V.K., Youngquist, R.S., Concannon, P.W., Krause, G.F. and Reddy, C.S., Oestrus induction in the bitch with the synthetic oestrogen diethylstilboestrol, J. Reprod. Fertil., 47 (1993) 515–516. [3] Carlyle, W.C., Toher, C.A., Vandervelde, J.R., McDonald, K.M., Homans, D.C. and Cohn, J.N., Changes in beta-actin mRNA expression in remodeling canine myocardium, J. Mol. Cell. Cardiol., 28 (1996) 53–63.
[4] Concannon, P.W., Biology of gonadotrophin secretion in adult and prepubertal female dogs, J. Reprod. Fertil., 47 (1993) 3–27. [5] Do¨ rner, G., Sexual differentiation of the brain, Vitam. Horm., 38 (1980) 325–381. [6] Harada, N., Cloning of a complete cDNA encoding human aromatase: immunochemical identification and sequence analysis, Biochem. Biophys. Res. Commun., 156 (1988) 725–732. [7] Hardley, J.C., Total unconjugated oestrogen and progesterone concentrations in peripheral blood during the oestrous cycle of the dog, J. Reprod. Fertil., 44 (1975) 445–451. [8] Hickey, G.J., Krasnow, J.S., Beattie, W.G. and Richards, J.S., Aromatase cytochrome P450 in rat ovarian granulosa cells before and after luteinization: adenosine 3 0 ,5 0 -monophosphate-dependent and independent regulation; cloning and sequencing of rat aromatase cDNA and 5 0 genomic DNA, Mol. Endocrinol., 4 (1990) 3–12. [9] Holst, P.A. and Phemister, R.D., Onset of diestrus in the beagle bitch: definition and significance, Am. J. Vet. Res., 35 (1974) 401–406. [10] Inaba, T., Tani, H., Gonda, M., Nakagawa, A., Ohmura, M., Mori, J., Torii, R., Tamada, H. and Sawada, T., Induction of fertile estrus in bitches using a sustained-release formulation of a GnRH agonist (leuprolide acetate), Theriogenology, 49 (1998) 975–982. [11] Juniewicz, P.E., Oesterling, J.E., Walters, J.R., Steele, R.E., Niswender, G.D., Coffey, D.S. and Ewing, L.L., Aromatase inhibition in the dog, I; effect on serum LH, serum testosterone concentrations, testicular secretions and spermatogenesis, J. Urol., 139 (1988) 827–831. [12] Kumar, M.S.A., Chen, C.L. and Kalra, S.P., Distribution of luteinizing hormone releasing hormone in the canine hypothalamus: effect of castration and exogenous gonadal steroids, Am. J. Vet. Res., 41 (1980) 1304–1309. [13] Mershon, J.L., Sehlhorst, C.S., Rebar, R.W. and Liu, J.H., Evidence of a corticotropin-releasing hormone pulse generator in the macaque hypothalamus, Endocrinology, 130 (1992) 2991–2996. [14] Roselli, C.E., Abdelgadir, S.E., Rønnekleiv, O.K. and Klosterman, S.A., Anatomic distribution and regulation of aromatase gene expression in the rat brain, Biol. Reprod., 58 (1998) 79–87. [15] Schallenberger, E., Schams, D., Bullermann, B. and Walters, D.L., Pulsatile secretion of gonadotrophins, ovarian steroids and ovarian oxytocin during prostaglandininduced regression of the corpus luteum in the cow, J. Reprod. Fertil., 71 (1984) 493–501. [16] Tani, H., Inaba, T., Matsuyama, S., Takamori, Y., Torii, R., Takano, H., Tamada, H. and Sawada, T., Enhancement of estrogen receptor gene expression in the mediobasal hypothalamus during anestrus in the beagle bitch, Neurosci. Lett., 227 (1997) 149–152. [17] Tani, H., Inaba, T., Nonami, M., Matsuyama, S., Takamori, Y., Torii, R., Tamada, H., Kawate, N. and Sawada, T., Increased LH pulse frequency and estrogen secretion associated with termination of anestrus followed by enhancement of uterine estrogen receptor gene expression in the beagle bitch, Theriogenology, 52 (1999) 593–607. [18] Tani, H., Inaba, T., Tamada, H., Sawada, T., Mori, J. and Torii, R., Increasing gonadotropin-releasing hormone release by perifused hypothalamus from early to late anestrus in the beagle bitch, Neurosci. Lett., 207 (1996) 1–4.