Enhancement of α-cyclodextrin product specificity by enriching histidines of α-cyclodextrin glucanotransferase at remote subsite −6

Process Biochemistry 49 (2014) 230–236

Contents lists available at ScienceDirect

Process Biochemistry journal homepage: www.elsevier.com/locate/procbio

Enhancement of ␣-cyclodextrin product specificity by enriching histidines of ␣-cyclodextrin glucanotransferase at remote subsite −6 Yang Yue a,b , Binghong Song b , Ting Xie b , Yan Sun a,∗ , Yapeng Chao b,∗∗ , Shijun Qian b a Key Laboratory for Biomechanics and Mechanobiology of Ministry of Education, School of Biological Science and Medical Engineering, Beihang University (BUAA), Beijing 100191, China b State Key Laboratories of Transducer Technology, National Engineering Lab for Industrial Enzymes, Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, China

a r t i c l e

i n f o

Article history: Received 9 September 2013 Received in revised form 15 October 2013 Accepted 3 November 2013 Available online 14 November 2013 Keywords: ␣-Cyclodextrin glucanotransferases ␣-Cyclodextrin Product specificity Site-directed mutagenesis Enzymatic properties

a b s t r a c t The industrial use of ␣-cyclodextrins (␣-CDs) has increased because their solubility is higher than those of ␤-CDs. However, improving the product specificity of ␣-cyclodextrin glucanotransferases (CGTases) remains unresolved. In this study, three mutants (Y167-deletion, Y167HH, and Y167HHH) were constructed at subsite −6 of ␣-CGTase to investigate the contribution of amino acid residue 167 to the cyclization ability of ␣-CD by comparing it with Tyr167His mutant ␣-CGTase (previously constructed based on the wild-type gene of Bacillus sp. 602-1). As expected, the ␣:␤ ratio improved with increasing number of histidine along with residue 167. The Y167HHH mutant had the highest ␣:␤ ratio of 13.2 and almost produced single type ␣-CDs. The Y167HHH mutant enzyme was subsequently purified to homogeneity. The enzymatic properties and the optimal condition of Y167HHH mutant in converting raw starch were also investigated. This study discusses product specificity improvement by inserting specific amino acid residues in the active groove. The results indicate that the histidine-rich mutant ␣-CGTase possessed better potential in producing ␣-CDs in an industrial scale. © 2013 Published by Elsevier Ltd.

1. Introduction Cyclodextrin glucanotransferase (EC 2.4.1.19, CGTase), a member of the glycoside hydrolases group, has a significant function in converting starch into cyclodextrins (CDs) through its unique cyclization. The most notable features of CDs are their hydrophilic rim and hydrophobic inside cavity [1,2], which can form inclusion complexes with small hydrophobic molecules [3]. The formation of these complexes alters the chemical, physical, and biological properties of these molecules [4]. This crucial property of CDs contributes to its wide functionality in different industries, such as those related to food, cosmetics, and pharmaceuticals [5,6]. CGTases can be classified into three groups (␣-, ␤-, and ␥-CGTases) based on the main products of its cyclization (␣-, ␤-, and ␥-CDs). The number of bacteria that can produce ␣-CGTases is less than those that can produce ␤-CGTase. Moreover, ␣-CDs have a smaller cavity and are more soluble, thereby making them more popular and in demand. All known CGTases convert starch into a mixture of cyclodextrins. Isolating pure ␣-cyclodextrins from this mixture demands a series of complex additional procedures, such

∗ Corresponding author. Tel.: +86 010 82315946. ∗∗ Corresponding author. Tel.: +86 010 64807428. E-mail addresses: [email protected] (Y. Sun), [email protected] (Y. Chao). 1359-5113/$ – see front matter © 2013 Published by Elsevier Ltd. http://dx.doi.org/10.1016/j.procbio.2013.11.002

as precipitation with organic solvents [7,8]. However, isolation procedures are costly, and the use of organic solvents limits the application of ␣-cyclodextrin for human consumption [9,10]. Hence, the production of ␣-CDs, as well as the improvement of the product specificity of ␣-CDs, is quite important. Based on X-ray structure analysis, CGTase encompasses five domains (A–E) [11,12]. Domains A and B constitute the catalytic center [13]. Moreover, the substrate-binding groove of CGTase, which is highly linked to the active center and product specificity, was elucidated. This active site, which is formed by domains A and B, is located on the enzyme’s surface and is composed of at least nine sugar binding subsites from −7 to +2 [14]. The cleavage appears between subsites +1 and −1 [15]. Furthermore, when acceptor subsites +1 and +2 and donor subsites −3, −6, and −7 bind the substrate sugars, the protein brace of CGTase may undergo small but crucial conformational changes [16]. Experiments have been carried out on these aforementioned active sites, which include chemical modification and site-directed mutagenesis, to understand the mechanism that determines product specificity [4,12]. Subsite −3 is of great importance for CGTase product specificity, and many investigations have been conducted on this subsite [17–19]. In addition, subsite −7 can create more space for the production of larger cyclodextrin because of its special structure, which also has a key effect on product specificity [8,12]. Although studies on subsite −6 (Y167, G179, G180, N193, and D196) are rare, its critical function in

Y. Yue et al. / Process Biochemistry 49 (2014) 230–236 Table 1 Sequence for site-directed mutagenesis of the three mutant ␣-CGTases. Primers

Sequence (5 –3 )

Y167-deletion Y167HH Y167HHH

CTGCTCGGCGCCAGCAATGATACG CTCGGCGCCCACCACAGCAATGATACG GGCGCCCACCACCACAGCAATGATACG

remotely regulating the cyclization of CGTase has been previously proposed [16,17]. The formation of ␣-CDs is related to subsite −6. The increasing number of hydrogen bonds at subsite −6 results in the formation of ␣-CD from only six glucose units [15]. Thus, the mechanism details and product specificity of ␣-CD were studied. A mutant with a higher ␣-CD specificity was obtained. A wild-type ␣-CD glucanotransferase from Bacillus macerans 602-1 has a high ␣-CD specificity (a proportion of ␣-CDs accounted for 77 percent of the products). In a previous study, site-saturation mutagenesis of Tyr167 at subsite −6 was conducted. Accordingly, ␣-CGTase exhibited the best ␣-CD specificity when Tyr167 was substituted by histidine. In this study, the His167 position of the enzyme was mutated via site-directed mutagenesis (Y167-deletion, Y167HH, and Y167HHH) to elucidate the effects of histidine substitution and insertion. Understanding these effects is necessary to enhance ␣-CD specificity and to demonstrate the effect of subsite −6 on the product specificity of ␣-CGTase. The ␣-CD specificity of the histidine-rich mutant (Y167HHH) was significantly enhanced. Possible mechanisms were also discussed. In addition, the enzymatic characterization and the ability of the Y167HHH mutant enzyme to convert raw starch were also investigated. 2. Materials and methods 2.1. Bacterial strains, plasmids, and chemical reagents The wild-type gene was from B. macerans 602-1 (originally obtained from the China General Microbiological Culture Collection Center, CGMCC 1.64). Recombinant plasmid that contains the cgt gene from the Y167H mutant ␣-CGTase (Y167H mutation of Bacillus sp. 602-1) constructed in our lab was used as a template for sitedirected mutagenesis. Escherichia coli DH5␣ was purchased from TransGen Biotech (Beijing, China). Mutant ␣-CGTase proteins were produced from the host strain E. coli BL 21(DE3), which was purchased from TransGen Biotech. The plasmid extraction kit was from Qiagen (Valencia, CA, USA). The Ni-NTA agarose column was purchased from GE Healthcare. Liquefying amylase, heat-resistant amylase, isoamylase, and glucoamylase were purchased from Donghua Qiangsheng Biotech Ltd. (Beijing, China). Other reagents were of analytical or biological grade. 2.2. Site-directed mutagenesis based upon the gene of Y167H mutant ˛-CGTase The following mutant genes were designed: Y167-deletion, one (Y167HH) and two (Y167HHH) histidines inserted at His167. The oligonucleotides used to produce the mutations were designed using Primer 5.0 and are shown in Table 1. The plasmid of the Y167H mutant ␣-CGTase was used as the template for the site-directed mutagenesis via PCR with the following procedure: first, the primers were diluted at 100 ␮M and phosphorylated; second, PCR was performed with the phosphorylated primers and the reaction system was 2.5 ␮L of 10× Taq buffer, 1 ␮L of Taq platinum polymerase, 2.5 ␮L of 10× Taq DNA ligase buffer, 0.5 ␮L of Taq DNA ligase, 1 ␮L of the phosphorylated primer, 1 ␮L of 10 mM dNTP, and 2 ␮L of the template to a final volume of 50 ␮L. The amplification protocol comprised one cycle at 65 ◦ C for 5 min, one cycle at 95 ◦ C for 2 min, 18 cycles at 95 ◦ C for 30 s, 54 ◦ C for 30 s, and 65 ◦ C for 8 min, and one cycle at 75 ◦ C for 8 min. After the reaction mixture was digested with DpnI for 1 h at 37 ◦ C, double-strand synthesis at 95 ◦ C was performed for 30 s, two cycles at 95 ◦ C for 30 s, 52 ◦ C for 1 min, and 70 ◦ C for 7 min. Finally, the amplified products were precipitated by 3 M CH3 COONa and absolute alcohol at −20 ◦ C overnight. The mutant plasmids were then used to transform individually the competent E. coli DH5␣. The mutants were selected in an LB medium (1 percent tryptone, 0.5 percent yeast extract, and 0.5 percent NaCl) with ampicillin (50 ␮g per mL). All mutations were confirmed using DNA sequencing. 2.3. Expression of the Y167H, Y167-deletion, Y167HH, and Y167HHH mutant ˛-CGTases The mutant enzymes were expressed by transforming the mutant plasmids to the host E. coli BL21 (DE3) cells. LB cultures of the recombinant E. coli BL21(DE3)

231

at a volume of 5 mL were grown at 37 ◦ C overnight in the presence of ampicillin (50 ␮g per mL). The cultures were then transferred to 5 mL of TB medium (1.2 percent tryptone, 2.4 percent yeast extract, and 0.4 cent glycerol) with 50 ␮g per mL ampicillin inoculated at 1 percent. The TB medium was cooled in ice for 10 min until the OD600 value reached 0.6–0.8. Subsequently, each mutant ␣-CGTase was induced with 0.01 mM isopropyl-␤-d-thio-galactoside (IPTG) at 16 ◦ C. Afterwards, 150 mM glycine and 20 mM CaCl2 were added after a 24 h cultivation period. The whole induction period lasted for 96 h. 2.4. Analysis of the converting abilities of the mutant ˛-CGTases Soluble starch with concentrations of 1 percent, 2 percent, and 5 percent was incubated with 400 U per g mutant enzymes at 40 ◦ C. About 1 mL of the reaction mixture was taken out and boiled for 10 min to terminate the reaction at 24 and 48 h intervals. The supernatant was then collected after centrifuging the mixture at 12,000 rpm for 10 min and ultrafiltered through a 0.22 ␮m filter membrane. Finally, the amount of the products converted by the mutant ␣-CGTases was analyzed via HPLC. 2.5. Structure modeling of the mutant ˛-CGTases The structural models of Y167H, Y167-deletion, Y167HH, and Y167HHH mutant ␣-CGTases were built using the SWISS-MODEL protein-modeling workstation [20–22]. The surface mode of each mutant enzyme was displayed. The Y167 and the inserted histidines at the 167 subsite were labeled yellow, and the Ser168 in Y167H mutant enzyme was marked white gray. 2.6. Purification of the Y167HHH mutant ˛-CGTase The purification process was partially based from Xue’s method [23]. First, the Y167HHH mutant ␣-CGTase was harvested. The supernatant that was obtained via centrifugation at 8000 rpm for 30 min at 4 ◦ C was then used as the crude enzyme. The crude enzyme was treated with ammonium sulfate fractional precipitation at saturation levels between 25 percent and 50 percent. The precipitate was collected via centrifugation (8000 rpm for 30 min at 4 ◦ C) and redissolved in buffer A (10 mM Na2 HPO4 , 1.8 mM KH2 PO4 , 140 mM NaCl, and 2.7 mM KCl, pH 7.0). The sample was then subjected to a 1 mL Ni-NTA column pre-equilibrated with buffer A. The column was washed with 10 mL of buffer A and 100 mL of buffer B (50 mM Na2 HPO4 , 300 mM NaCl, and 20 mM imidazole, pH 7.0). The target protein was eluted with 10 mL of buffer C (50 mM Na2 HPO4 , 300 mM NaCl, and 200 mM imidazole, pH 7.0). Finally, fractions of 2 mL were collected in each tube. 2.7. Analytical methods 2.7.1. Assay of enzymatic activity The hydrolytic activity of the reaction mixture containing 0.4 mL of 0.25 percent (w per v) soluble starch and 0.1 mL of the enzyme was spectrophotometrically determined via a modified I2 -KI method [24]. One unit of ␣-CGTase activity was determined as the amount of enzyme that exhibited a 10 percent decrease in absorbance at 700 nm per min. 2.7.2. Determination of protein concentration Protein concentration was determined based on the Bradford method [25] by using bovine serum albumin as the standard. The mixture was then investigated by measuring the absorbance at 595 nm. 2.7.3. Sodium dodecyl sulphate polyacryl amide gel electrophoresis SDS-PAGE was performed based on the method of Laemmli [26] by using 5 percent stacking gel and 12 percent separating gel. 2.7.4. Product analysis by HPLC The product ratios were analyzed via HPLC by using a Hypersil NH2 column (5 ␮m, 250 mm × 4.6 mm) at 40 ◦ C. The mobile phase of acetonitrile/water (65/35, v/v) at a flow rate of 1 mL per min was adopted. After being filtered through a 0.22 ␮m membrane, 20 ␮L of the converting product was sampled. The products were detected using a refractive index detector (Waters 2414). The retention times of each ␣-CD, ␤-CD, and ␥-CD standard were 7.2, 8.6, and 10.8 min, respectively. 2.8. Characteristics of purified Y167HHH mutant ˛-CGTase 2.8.1. Effects of temperature and pH on Y167HHH mutant ˛-CGTase The effect of temperature on the enzymatic activity of the Y167HHH mutant was examined at temperatures ranging from 30 ◦ C to 70 ◦ C. The optimum pH of the mutant was determined based on the method of Li [27]. 2.8.2. Stability of Y167HHH mutant ˛-CGTase The thermostability of the Y167HHH mutant was analyzed by incubating the enzyme at various temperatures (4 ◦ C, 30 ◦ C, 40 ◦ C, 50 ◦ C, and 60 ◦ C) for 30 min, whereas the effect of pH on mutant stability was determined by incubating the

232

Y. Yue et al. / Process Biochemistry 49 (2014) 230–236

Table 2 Activities of the Y167H mutant ␣-CGTase and three mutant ␣-CGTases. Type

Activity (U per mL)

Y167H Y167-deletion Y167HH Y167HHH

3475 2770 4250 5731

purified enzyme in the buffers with different pH values for 16 h at 4 ◦ C. The assay of enzyme activity was performed as described in Section 2.7.1. 2.8.3. Effect of EDTA and metal ions on Y167HHH mutant ˛-CGTase In the presence of 1 mM chelating agent, EDTA, and 1 mM of each of the various metal ions at final concentrations (K+ , Mn2+ , Ba2+ , Co+ , Na+ , Ca2+ , Mg2+ , Cu2+ , 2+ Fe , NH4 + , and Zn2+ ), the enzymatic activity was measured in comparison with the control sample. 2.8.4. Chemical modification of Y167HHH mutant ˛-CGTase Diethyl pyrocarbonate (DEP) is a histidine-specific modified reagent. The Y167HHH mutant enzyme was incubated with a DEP reagent (dissolved in absolute alcohol) at 25 ◦ C for 3 min to obtain final DEP concentrations of 1, 2, 4, 6, 8, and 10 mM. The Y167HHH mutant enzyme was incubated with a specific amount of nacetylimidazole (N-AI) at 25 ◦ C for 3 min and prepared to a final concentration of 1 mM. N-AI has been reported to react on both -NH2 and tyrosine but is more specific toward the latter [28]. The mutant enzyme was also treated with pnitrobenzenesulfonyl dissolved in isopropyl alcohol. The mixture was incubated in 0.1 M Tris–HCl buffer (pH 8.6) at 25 ◦ C for 1 h. The final concentrations of NBSF were 1, 2, 4, 6, 8, and 10 mM. 2.9. Ability of Y167HHH mutant ˛-CGTase to convert raw starch into ˛-CDs Based on the industrial application of the ␣-CGTases, raw starch is initially liquefied by adding the liquefying enzymes so that the ␣-CGTase will produce ␣-CDs [29]. The conversion conditions were optimized for raw starch conversion by using the purified Y167HHH mutant enzyme and by choosing potential liquefying enzymes and the amount of Y167HHH mutant ␣-CGTase. The conditions were optimized based on ␣-CD specificity and yield. The reactions were performed as follows: the flask containing 50 mL of raw corn starch was first liquefied with different liquefying enzymes (amount of each enzyme was 400 U per g starch; the samples were stirred immediately in boiling water for 10 min after the enzyme was added), then cooled to 40 ◦ C and incubated with the purified Y167HHH mutant ␣-CGTase in a shaker, and the conversion reaction was conducted at 40 ◦ C (150 rpm) for 24 h. Considering the non-solvent conversion condition (without adding a precipitating organic agent) and the viscosity of raw corn starch during the reaction [14,30,31], 6 percent (w/v) of raw corn starch was used in the test. First, different liquefying enzymes, such as liquefying amylase, heat-resistant amylase, isoamylase, and glucoamylase, were used in the pretreatment procedure. The amounts of Y167HHH mutant enzyme, namely, 200, 400, 600, and 800 U per g, were then compared with one another in terms of starch conversion.

3. Results 3.1. Construction and expression of the mutant ˛-CGTases The three mutant genes were obtained via site-directed mutagenesis, and their recombinant strains were successfully constructed. The genes were also confirmed through DNA sequencing. The expressed activities of each mutant ␣-CGTase were determined (Table 2). All of the mutant ␣-CGTases were expressed actively in experimental conditions. The Y167HHH mutant enzyme had the highest enzymatic activity of 5731 U per mL, and the enzymes were collected via centrifugation for successive conversion and product analysis. 3.2. Conversion characteristics of the mutant ˛-CGTases After a 24-h conversion reaction, the products were analyzed via HPLC. The results reveal that when a substrate concentration of 1 percent was incubated with 400 U per g of different mutant enzymes, the ␣-CD specificity was enhanced with increasing number of histidine at the 167 position. Moreover, the ␣:␤ ratios of the

Fig. 1. Comparison of ␣:␤ ratio with different mutant ␣-CGTases at 24 h of reaction.

Table 3 Starch conversion ratio with varying concentration among different mutants. Mutant

Conversion ratio of starch 1 percent

Y167H Y167-deletion Y167HH Y167HHH

39.9 41.3 29.6 29.7

± ± ± ±

1.1 1.3 0.8 0.7

2 percent 32.1 28.0 27.2 21.2

± ± ± ±

0.8 0.5 1.1 0.9

5 percent 23.2 22.6 21.4 21.3

± ± ± ±

0.8 1.0 0.5 0.6

Y167-deletion mutant ␣-CGTase and the wild type Y167H mutant ␣-CGTase were similar to each other (7.1 and 6.7, respectively). The Y167HHH mutant enzyme obtained the best product specificity for ␣-CD with the highest ␣:␤ ratio of 13.2 (Fig. 1). Nevertheless, a substrate concentration of 2 percent showed a slightly lower ␣-CD conversion ratio compared with a substrate concentration of 1 percent after 24 h of conversion. The Y167-deletion mutant enzyme and the Y167H mutant enzyme still displayed similar ␣:␤ ratios of 5.2 and 5.3. The Y167HHH mutant enzyme yielded a ratio of 11.2 (Fig. 1). Although conversion at a substrate concentration of 5 percent resulted in the lowest ␣:␤ ratio among the three substrate concentrations, the trend of the ␣:␤ ratio was still in accordance with the above reaction conditions. The ␣:␤ ratios of the Y167-deletion and Y167H mutant enzymes were similar at 3.1. The Y167HH mutant enzyme was 4.2 and the Y167HHH mutant enzyme was 5.1 (Fig. 1). The ␣:␤ ratio slightly decreased after 48 h of conversion compared with that obtained at 24 h of conversion. The ␣:␤ ratios of the Y167HHH mutant enzyme at a substrate concentration of 5 percent yielded were 5.1 and 4.8 at conversion reaction times of 24 and 48 h, respectively. Table 3 showed the starch conversion ratio with varying starch concentration among different mutant CGTases. Conversion ratios of the Y167H and Y167-deletion (39.9 and 41.3 percent, respectively) were higher than the other two mutant enzymes (29.6 and 29.7 percent, respectively) under one percent of the starch concentration. However, the starch conversion ratio was similar among the four mutant enzymes under five percent of starch concentration. In summary, the Y167HHH mutant ␣-CGTase exhibited the best ␣-CD specificity among the four mutant enzymes in all of the reaction conditions. The specificity of the ␣-CDs Y167HHH mutant produced from 1 percent soluble starch increased to 90 percent in all three products, which makes Y167HHH mutant enzyme potentially useful for the mass production of high yield ␣-CDs. In addition,

Y. Yue et al. / Process Biochemistry 49 (2014) 230–236

233

Fig. 2. Structural models of the indicated mutant ␣-CGTases. Yellow color shows the locations of the histidines; white gray color shows the location of serine168. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)

the concentration of starch and the conversion period influenced the product ratios. 3.3. Structural analysis of the mutant ˛-CGTases The surface models were established based on the SWISSMODEL workspace (Fig. 2). Subsite −6 showed a concave surface when His167 was deleted. A tinge of yellow was observed in the Y167H mutant model, which indicates that the amino acid residue His167 was located on the subsurface. The Y167HH and Y167HHH mutant ␣-CGTases exhibited obvious existence of histidines on the surface and occupied the space of S168-N169, as well as that of R146-D147 located at subsite −7, which probably led to the preference of induced-fit interaction between subsite −6 and the hydroxyl group of glucose.

at 40 ◦ C, which is slightly lower than the optimal temperature of the Y167H mutant enzyme at 50 ◦ C. The enzymatic activity significantly decreased with increasing temperature, which was almost 85 percent less than the highest activity. The pH profile of the enzyme was determined at varying pH values ranging from 4.0 to 10.0. The activity of the Y167HHH mutant enzyme was relatively high at a pH range of 6.0–7.0. It was optimally active at pH 6.6. The Y167H mutant enzyme

3.4. Purification of Y167HHH mutant ˛-CGTase The Y167HHH mutant crude enzyme was purified to homogeneity by combining ammonium sulfate precipitation with Ni-NTA agarose column affinity chromatography. The steps resulted in a 4.7-fold purification with a yield of 10 percent and a specific protein activity of 16287.7 U per mg (Table 4). Based on the SDS-PAGE profiles, the protein exhibited a single band, and the molecular mass was estimated to be 72 kDa (Fig. 3). 3.5. Effect of temperature and pH on the activity of Y167HHH mutant ˛-CGTase The activity of the Y167HHH mutant enzyme was studied at various temperatures. The enzyme exhibited maximum activity

Fig. 3. SDS-PAGE analysis of the purified Y167HHH mutant ␣-CGTase. Lane 1: marker; lane 2: crude Y167HHH mutant ␣-CGTase; lane 3: purified Y167HHH mutant ␣-CGTase.

234

Y. Yue et al. / Process Biochemistry 49 (2014) 230–236

Table 4 Purification steps of the Y167HHH mutant ␣-CGTase. Purification step

Volume (mL)

Total activity (U)

Total protein (mg)

Specific activity (U per mg)

Yield (percent)

Purification fold

Crude extract (NH4 )2 SO4 Ni-NTA

280 3 30

1,519,000 357,416 146,589

442.4 59.3 9

3433.5 6027.3 16287.7

100 23.5 10.0

1.0 1.8 4.7

Table 5 Impact of metal ions and EDTA on the activity of the Y167HHH mutant ␣-CGTase.

a

Metal ions and EDTA

Relative activity (percent)

None Ca2+ K+ Ba2+ Mn2+ Na+ NH4 + Co+ Mg2+ Zn2+ Cu2+ Fe2+ EDTA

100 150.8 121.6 115.1 111.2 104.1 94.3 62.0 27.1 23.4 9.4 3.7 1.8

± ± ± ± ± ± ± ± ± ± ± ± ±

1.3 3.5 4.8 2.0 2.8 6.5 2.1 0.7 1.7 2.8 0.2 0.3 0.2

The enzymatic activity in absence of metal ions and EDTA was taken as 100 percent.

exhibited the most activity at pH 7.4. The enzyme lost almost 60 percent of its activity at pH levels below 5.0 and above 8.0.

3.6. Thermostability and pH stability of the Y167HHH mutant ˛-CGTase The thermostability and the pH stability of the Y167HHH mutant enzyme were investigated. The thermostability of the purified Y167HHH mutant enzyme was lower than that of the Y167H mutant enzyme. When kept at 30 ◦ C for 30 min, the enzymatic activity dropped to 20 percent compared with the activity at 4 ◦ C. Moreover, the enzyme was stable at a pH range of 5.0–8.0, similar with the Y167H mutant enzyme. The effect of pH was not as notable as that of temperature. However, the crude Y167HHH mutant enzyme was much more stable than the purified enzyme (data not shown).

3.7. Effect of EDTA and metal ions on Y167HHH mutant ˛-CGTase CGTase is a metal-ion related enzyme. Thus, a series of metal ions or EDTA was used to investigate the effects on the Y167HHH mutant ␣-CGTase activity. After the soluble starch was incubated using the Y167HHH mutant at 40 ◦ C for 10 min in the presence of metal ions or EDTA, the residual activities were determined (Table 5). The result shows that Ca2+ displayed an obvious positive influence in improving enzymatic activities. The possible mechanism may be that there are two Ca2+ binding sites located at the active site of CGTase, so the addition of Ca2+ can promote the stability of substrate binding and contribute to enzymatic activity. K+ , Ba2+ , Mn2+ , and Na+ affected the promotion of the enzymatic activities to a particular extent. Nevertheless, the enzyme was moderately hampered by Co+ and NH4 + and was strongly inhibited by EDTA, Cu2+ , and Fe2+ . On the other hand, the Y167H mutant enzyme did not respond very obviously toward Ca2+ , which promoted the enzymatic activity of the Y167HHH mutant. Similarly, EDTA, Cu2+ , and Fe2+ also strongly inhibited the enzymatic activity of the Y167H mutant.

Fig. 4. Selective chemical modification of DEP and NBSF into the Y167HHH mutant ␣-CGTase.

3.8. Chemical modification of Y167HHH mutant ˛-CGTase Based on the selective modification of DEP into histidine and the tyrosine-specificity exhibited by N-AI and NBSF, the Y167HHH mutant was treated with DEP, N-AI, and NBSF. The enzymatic activity of the Y167HHH mutant could be reduced to almost half the original activity with a residual activity of 54.6 percent by DEP. However, the loss of activity was not drastic with increasing concentration. The residual activity decreased to 25.8 percent at a DEP concentration of 10 mM (Fig. 4). The histidine residue was proposed to have an important function in maintaining enzymatic activity. For N-AI and NBSF, the Y167HHH mutant enzyme retained 76.5 percent of its initial activity when incubated with 1 mM N-AI, which indicates that tyrosine may be a necessary residue. The enzymatic activity exhibited a remarkable decrease with increasing NBSF concentration. The Y167HHH mutant enzyme lost 30 percent of its activity with 1 mM of NBSF, whereas the activity was almost completely inhibited at 10 mM NBSF (Fig. 4). Thus, tyrosine residue has a key function in keeping the enzymatic activity. In summary, histidine and tyrosine were hypothesized to be crucial residues for enzymatic activity, along with Tyr195 and the three histidines (H140, H233, and H327) conserved at almost all of the CGTases. They were regarded as essential in maintaining the activities of the CGTases. 3.9. Conversion of raw starch by Y167HHH mutant ˛-CGTase The use of 6 percent raw corn starch is preferable because of the product inhibition and viscosity of the reaction system [14]. Thus, by converting 6 percent raw corn starch, glucoamylase can better enhance the ␣:␤ ratio compared with the three other liquefying enzymes through HPLC analysis (Fig. 5a). The convenience of the use of glucoamylase contributes to the production of ␣-CDs because glucoamylase is widely used in the saccharification of starch. The amount of the Y167HHH mutant enzyme added to corn starch varied from 200 to 800 U per g. The ␣:␤ ratio decreased with increasing quantity (Fig. 5b). Although the conversion at an amount of 200 U per g resulted in a higher ␣:␤ ratio, the quantity of ␣-CD

Y. Yue et al. / Process Biochemistry 49 (2014) 230–236

Fig. 5. Abilities of converting raw starch by the Y167HHH mutant ␣-CGTase: (a) the optimal liquefying enzyme for the Y167HHH mutant enzyme of converting raw starch; (b) the effect of different Y167HHH mutant enzyme units for incubating liquefied starch.

was less. Considering both the yield of ␣-CDs and the product ratio, 400 U per g is an acceptable amount in the industrial production of ␣-CDs. In summary, the preferable conditions for converting raw starch involve the use of 6 percent corn starch as the substrate, glucoamylase as the liquefying enzyme, and an enzyme amount of 400 U per g. These conditions could promote a higher product ratio (␣:␤ ratio) and can contribute to achieving up to 93 percent of ␣-CDs. Thus, these conditions were considered as optimal for industrial production. 4. Discussion Research on CGTase mainly focused on its product specificity. The active subsites linked to product specificity were also identified. Subsite −6 (167, 179, 180, 193) took up the remote position in the active catalysis domain. Uitdehaag et al. [32] highlighted the importance of subsite −6 via calculations, and their results indicated that subsite −6 is involved in substrate binding and in stabilizing the intermediary phases of the circulation steps. Leemhuis et al. also performed mutagenesis on this subsite, although the study is incomplete. At the very least, the results indicate the importance of subsite −6. Moreover, subsite −6 is conserved in almost all known CGTases, which suggests that subsite −6 significantly affects the unique characteristics of CGTases [16].

235

Currently, mutagenesis on product specificity involving the Tyr167 position appeared only once (Y167F) with ␤-CGTase from the B. circulans 251 strain [14,16]. In the current study, the ␣:␤ ratio slightly increased from 0.2 to 0.3. However, the effect of subsite −6 from the ␣-CGTase on the cyclization function has not been explored. In a previous study, which involved direct evolution and site-saturation mutagenesis of Tyr167, the function of Tyr167 position on product specificity in ␣-CD formation was evaluated, and the results showed that histidine had better ␣CD specificity than those of other amino acids. In the present study, the function of Tyr167 in the cyclization was further investigated by constructing three mutants (Y167-deletion, Y167HH, and Y167HHH) via site-directed mutagenesis. The ␣:␤ ratio was significantly enhanced by increasing the quantity of histidine at the Tyr167 position. This study determines the product specificity by inserting specific amino acid residues in the active groove. Histidine structure may inhibit the formation of larger-size products (␤-CDs and ␥-CDs). Although subsite −6 is distant from the catalytic site (subsites between −1 and +1) [15], the residue at position 167 significantly influences the cyclization process, especially in ␣-CD formation. The difference of position 167 between the wild and mutant enzyme lies on the side loop of the two amino acids. Tyrosine has a benzene ring, whereas histidine has an imidazole ring. The advantage of histidine lies in its imidazole ring, which exists in two equivalent tautomeric forms. In addition, the imidazole shows strong polarity because a proton may be located in either of the two nitrogen atoms. Thus, the interaction with the hydroxyl group of glucose is stronger. Likewise, the enrichment of histidines at position 167 took up the position of R146-D147 at subsite −7, which could be attributed to the hindered formation of larger CDs. The surface model of the mutant enzymes and the effects of chemical modification both reinforced the significant function of histidines. Hence, the conformational change (histidine enrichment) at the Tyr167 position is expected to cause greater attraction toward the catalytic site as well as glucose at subsite −6, which restricted the formation of larger CDs. These factors contribute to the improvement of ␣-CD production rate among the three mixtures during the initial conversion phase. Furthermore, by comparing the CD yields with other three mutant ␣-CGTases, the Y167HHH mutant enzyme displayed the highest converting capability with ␣-CD yields of 7.8 g per L. On the other hand, the side products of ␤- and ␥-CD yields of Y167HHH mutant were the lowest among the four mutants (1.57 and 1.26 g per L, respectively). In addition, the double mutation D372K/Y89R constructed by Li et al. [10] resulted in an improved specificity toward the production of ␣-CD (7.6–11.4 g per L) and a decreasing production of ␤-CD (9.9–5.6 g per L). Although the ␣-CD yields of the Y167HHH mutant (7.80 g per L) were less than the double mutation, the ␤-CD yields produced by the Y167HHH mutant had a more drastic decrease than the double mutation, which resulted in a higher specificity to ␣-CD. The Y89D/S146P double mutation constructed by van der Veen et al. showed a 2-fold increase in the production of ␣-CD, which resulted in a ␣-CD proportion of 30 percent [8]. Thus, the Y167HHH mutant displayed ␣-CD specificity and maintained the ␣-CD yields within the average level. Further investigation is required to improve the ␣-CD yields by using the Y167HHH mutant. Further studies including mutant enzyme crystallization, which could provide deeper insight into the cyclization mechanism, and modification based on the present mutant enzyme to improve its thermostability in food and pharmaceutical fields are under exploration. In conclusion, the ␣:␤ ratio was obviously improved with increasing number of histidine at His167, as shown by the results of the site-directed mutagenesis. The possible reason for histidine enrichment at subsite −6, which resulted in a higher ␣-CD

236

Y. Yue et al. / Process Biochemistry 49 (2014) 230–236

proportion, was also discussed. The histidine-rich mutant enzyme with high ␣-CDs specificity was prepared and its enzymatic properties were studied. The suitable conditions for converting raw starch were selected. Thus, the histidine-rich mutant enzyme can be used as a biocatalyst for industrial application. Acknowledgements This work was supported by the National Nature Science Foundation of the People’s Republic of China (Project No. 31171643), 111 Project No. B13003, and International Joint Research Center of Aerospace Biotechnology and Medical Engineering, Ministry of Science and Technology of China. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.procbio.2013. 11.002. References [1] Cheng J, Wu D, Chen S, Chen J, Wu J. High-level extracellular production of ␣-cyclodextrin glycosyltransferase with recombinant Escherichia coli BL21 (DE3). Journal of Agricultural and Food Chemistry 2011;59(8): 3797–802. [2] Zhaofeng L, Miao W, Feng W, Zhengbiao G, Guocheng D, Jing W, et al. ␥Cyclodextrin: a review on enzymatic production and applications. Applied Microbiology and Biotechnology 2007;77(2):245–55. [3] Saenger W. Cyclodextrin inclusion compounds in research and industry. Angewandte Chemie International Edition in English 1980;19(5):344–62. [4] Costa H, Distefano AJ, Marino-Buslje C, Hidalgo A, Berenguer J, Biscoglio de Jimenez Bonino M, et al. The residue 179 is involved in product specificity of the Bacillus circulans DF 9R cyclodextrin glycosyltransferase. Applied Microbiology and Biotechnology 2012;94(1):123–30. [5] Szente L, Szejtli J. Cyclodextrins as food ingredients. Trends in Food Science & Technology 2004;15(3):137–42. [6] Del Valle EM. Cyclodextrins and their uses: a review. Process Biochemistry 2004;39(9):1033–46. [7] Bender H. Production, characterization, and application of cyclodextrins. Advances in Biotechnological Processes 1986;6:31–71. [8] van der Veen BA, Uitdehaag J, Penninga D, van Alebeek GJWM, Smith LM, Loraine M, et al. Rational design of cyclodextrin glycosyltransferase from Bacillus circulans strain 251 to increase ␣-cyclodextrin production. Journal of Molecular Biology 2000;296(4):1027–38. [9] Pedersen S, Dijkhuizen L, Dijkstra BW, Jensen BF, Jorgensen ST. A better enzyme for cyclodextrins. Chemtech 1995;25(12):19–25. [10] Li Z, Zhang J, Wang M, Gu Z, Du G, Li J, et al. Mutations at subsite −3 in cyclodextrin glycosyltransferase from Paenibacillus macerans enhancing ␣cyclodextrin specificity. Applied Microbiology and Biotechnology 2009;83(3): 483–90. [11] Lawson CL, van Montfort R, Strokopytov B, Rozeboom HJ, Kalk KH, de Vries GE. Nucleotide sequence and X-ray structure of cyclodextrin glycosyltransferase from Bacillus circulans strain 251 in a maltose-dependent crystal form. Journal of Molecular Biology 1994;236(2):590–600. [12] Kelly RM, Dijkhuizen L, Leemhuis H. The evolution of cyclodextrin glucanotransferase product specificity. Applied Microbiology and Biotechnology 2009;84(1):119–33.

[13] Leemhuis H, Dijkstra BW, Dijkhuizen L. Thermoanaerobacterium thermosulfurigenes cyclodextrin glycosyltransferase. European Journal of Biochemistry 2003;270(1):155–62. [14] Leemhuis H, Kelly RM, Dijkhuizen L. Engineering of cyclodextrin glucanotransferases and the impact for biotechnological applications. Applied Microbiology and Biotechnology 2010;85(4):823–35. [15] Strokopytov B, Knegtel RMA, Penninga D, Rozeboom HJ, Kalk KH, Dijkhuizen L, et al. Structure of cyclodextrin glycosyltransferase complexed with a maltononaose inhibitor at 2.6 A˚ resolution. Implications for product specificity. Biochemistry 1996;35(13):4241–9. [16] Leemhuis H, Uitdehaag JC, Rozeboom HJ, Dijkstra BW, Dijkhuizen L. The remote substrate binding subsite −6 in cyclodextrin-glycosyltransferase controls the transferase activity of the enzyme via an induced-fit mechanism. Journal of Biological Chemistry 2002;277(2):1113–9. [17] Goh KM, Mahadi NM, Hassan O, Rahman RNZRA, Illias RM. A predominant ␤-CGTase G1 engineered to elucidate the relationship between protein structure and product specificity. Journal of Molecular Catalysis B: Enzymatic 2009;57(1):270–7. [18] van der Veen BA, Uitdehaag J, Dijkstra BW, Dijkhuizen L. The role of arginine 47 in the cyclization and coupling reactions of cyclodextrin glycosyltransferase from Bacillus circulans strain 251. European Journal of Biochemistry 2000;267(12):3432–41. [19] Wind RD, Buitelaar RM, Dijkhuizen L. Engineering of cyclodextrin product specificity and pH optima of the thermostable cyclodextrin glycosyltransferase from Thermoanaerobacterium thermosulfurigenes EM1. Journal of Biological Chemistry 1998;273(10):5771–9. [20] Arnold K, Bordoli L, Kopp J, Schwede T. The SWISS-MODEL workspace: a webbased environment for protein structure homology modelling. Bioinformatics 2006;22(2):195–201. [21] Schwede T, Kopp J, Guex N, Peitsch MC. SWISS-MODEL: an automated protein homology-modeling server. Nucleic Acids Research 2003;31(13):3381–5. [22] Guex N, Peitsch MC. SWISS-MODEL and the Swiss-Pdb Viewer: an environment for comparative protein modeling. Electrophoresis 1997;18(15):2714–23. [23] Xue ZQ, Chao YP, Wang DX, Wang MX, Qian SJ. Overexpression of a recombinant amidase in a complex auto-inducing culture: purification, biochemical characterization, and regio-and stereoselectivity. Journal of Industrial Microbiology & Biotechnology 2011;38(12):1931–8. [24] Nakamura N, Horikoshi K. Characterization and some cultural conditions of a cyclodextrin glycosyl-transferase-producing alkalophilic Bacillus sp. Agricultural and Biological Chemistry 1976;40. [25] Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry 1976;72(1):248–54. [26] Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970;227(5259):680–5. [27] Li Z, Li B, Gu Z, Du G, Wu J, Chen J. Extracellular expression and biochemical characterization of alpha-cyclodextrin glycosyltransferase from Paenibacillus macerans. Carbohydrate Research 2010;345(7):886–92. [28] Liao T, Ting R, Yeung J. Reactivity of tyrosine in bovine pancreatic deoxyribonuclease with p-nitrobenzenesulfonyl fluoride. Journal of Biological Chemistry 1982;257(10):5637–44. [29] van der Veen BA, Uitdehaag J, Dijkstra BW, Dijkhuizen L. Engineering of cyclodextrin glycosyltransferase reaction and product specificity. Biochimica et Biophysica Acta 2000;1543(336):360. [30] Szerman N, Schroh L, Rossi AL, Rosso AM, Krymkiewicz N, Ferrarotti SA. Cyclodextrin production by cyclodextrin glycosyltransferase from Bacillus circulans DF 9R. Bioresource Technology 2007;98(15):2886–91. [31] Kim TJ, Lee YD, Kim HS. Enzymatic production of cyclodextrins from milled corn starch in an ultrafiltration membrane bioreactor. Biotechnology and Bioengineering 1993;41(1):88–94. [32] Uitdehaag JCM, van Alebeek GJWM, van der Veen BA, Dijkhuizen L, Dijkstra BW. Structures of maltohexaose and maltoheptaose bound at the donor sites of cyclodextrin glycosyltransferase give insight into the mechanisms of transglycosylation activity and cyclodextrin size specificity. Biochemistry 2000;39(26):7772–80.