- Email: [email protected]
Enhancement of glomerular heme oxygenase-1 expression in diabetic rats
Diabetes Research and Clinical Practice 52 (2001) 85 – 96 www.elsevier.com/locate/diabres
Enhancement of glomerular heme oxygenase-1 expression in diabetic rats Kazuyuki Hayashi, Masakazu Haneda *, Daisuke Koya, Shiro Maeda, Keiji Isshiki, Ryuichi Kikkawa The Third Department of Medicine, Shiga Uni6ersity of Medical Science, Otsu, Shiga, Japan Received 9 August 2000; received in revised form 5 December 2000; accepted 16 December 2000
Abstract An increase in oxidative stress in diabetic subjects is implicated to play a pivotal role in diabetic vascular complications. In response to oxidative stress, antioxidant enzymes are considered to be induced and protect cellular functions to keep in vivo homeostasis. However, it remains to be clarified whether antioxidant enzymes are induced against oxidative stress especially in renal glomeruli at an early stage of diabetes. To answer this question, we examined the gene expression of a variety of antioxidant enzymes in glomeruli isolated from streptozotocin-induced diabetic rats. The mRNA expression of antioxidant enzymes such as catalase, glutathione peroxidase, and CuZn-superoxide dismutase, was unaltered in glomeruli of diabetic rats and was comparable to control rats. In contrast, the mRNA expression of heme oxygenase-1 (HO-1) was enhanced in glomeruli of diabetic rats as compared with control rats. A treatment with insulin as well as with vitamin E (40 mg/kg body weight every other day, intra-peritoneal injection) normalized the mRNA expression of HO-1 in the glomeruli of diabetic rats. Immunohistochemical analysis revealed that the up-regulated expression of HO-1 protein was localized in glomerular cells of diabetic rats. In conclusion, these results provide the first evidence that among antioxidant enzymes HO-1 expression is preferentially increased in diabetic glomeruli. © 2001 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Diabetic nephropathy; Oxidative stress; Heme oxygenase-1; Antioxidant enzymes; Vitamin E
1. Introduction Diabetic nephropathy has become one of the main causes for end-stage renal disease in Japan, as well as in western countries [1]. The mechanisms of diabetes-induced glomerular injury have * Corresponding author. Tel.: +81-77-5482222; fax: 81-775433858. E-mail address: [email protected] (M. Haneda).
been extensively studied both in vivo and in vitro and recent evidence based on epidemiological studies clearly suggests that poor glycemic control undoubtedly is the most important risk factor for the development and progression of diabetic nephropathy [2,3]. Multiple biochemical mechanisms by which the diabetic state, hyperglycemia, causes diabetic nephropathy have been proposed in the experimental diabetic animal models and cultured cells exposed to high concentrations of
0168-8227/01/$ - see front matter © 2001 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0 1 6 8 - 8 2 2 7 ( 0 1 ) 0 0 2 1 8 - 2
86
K. Hayashi et al. / Diabetes Research and Clinical Practice 52 (2001) 85–96
glucose, including activation of protein kinase C (PKC) [4,5], activation of extracellular signal-regulated protein kinase [6], enhanced polyol pathway related to myo-inositol depletion [7 – 9], overproduction of advanced glycation end products [10], enhanced production of growth factors and cytokines [11], altered redox state, and oxidative stress [12 –15]. Oxidative stress has been proposed as one major cause responsible for the development and progression of diabetic nephropathy since high concentrations of glucose may increase the generation of reactive oxygen species (ROS) [12], through nonenzymatic glycation of protein substrates [16], auto-oxidative glycation [17], PKC activation [18,19], and increased polyol pathway [19,20]. Amongst, PKC inhibitor calphostin C and antisense oligonucleotide to PKC-beta isoform were shown to inhibit high glucose-mediated oxidative stress in smooth muscle cells [18,19]. Indeed, involvement of excessive oxidative stress has been indicated by the presence of endogenous end-products of oxidative stress such as lipid peroxides [21] and 8-hydroxydeoxyguanosine [22] in the kidney of streptozotocin (STZ)-induced diabetic rats. In the recent studies, malondialdehyde, a lipid peroxidation product whose formation is accelerated by oxidative stress, has been shown to be increased in the glomerular lesions of diabetic patients with early or advanced stage of nephropathy [14,15]. Regarding the defense system to oxidative stress, antioxidant enzymes such as catalase and CuZn-superoxide dismutase (CuZn-SOD) have been shown to be enhanced in kidneys of STZ-induced diabetic rats [23]. However, it still remains elusive whether these findings are merely a common consequence of the tissue damage in diabetic kidney or ROS is having a primary role in the pathogenesis of diabetic nephropathy. Moreover, we need to focus on glomeruli in which diabetes-induced tissue damage occurs primarily, resulting in mesangial expansion responsible for the obliteration of capillary lumen leading to glomerulosclerosis and finally end-stage renal failure. Therefore, we sought to determine alterations in the expression of antioxidant enzymes including heme oxygenase-1 (HO-1), one of the most
sensitive and reliable indicators of cellular oxidative stress, in glomeruli of STZ-induced diabetic rats. We further examined the effect of vitamin E, a well-known antioxidant, on HO-1 expression in diabetic glomeruli.
2. Materials and methods
2.1. Experimental protocol Male Sprague –Dawley (SD) rats weighing 180 –200 g, purchased from Japan SLC (Shizuoka, Japan), were randomly separated into control and experimental groups. The experimental animals were given intravenous injection of streptozotocin (STZ) (50 mg/kg body weight) (Sigma, St. Louis, MO) in 0.05 mol/l citrate buffer (pH 4.5). Rats receiving injection of citrate buffer were used as control. The levels of blood glucose were determined 2 days after injection of STZ or vehicle, and rats with blood glucose higher than 16.7 mmol/l were used as diabetic rats. These animals were maintained on laboratory diet and water ad libitum for either 2 or 4 weeks after injection of STZ. Insulin pellets (Linshin, Scarborough, Ont., Canada) were implanted subcutaneously 3 days after STZ injection to normalize blood glucose levels. Some control and diabetic rats were treated with vitamin E injected intraperitoneally at the concentrations of 40 mg/kg body weight every other day (Eisai Co Ltd. Tokyo, Japan) for either 2 or 4 weeks after 3 days STZ injection. Renal glomeruli were isolated from rats in either 2 or 4 weeks group by sieving with stainless and nylon meshes, as described previously [7]. All the experiments were approved by Shiga University of Medical Science Animal Care Committees.
2.2. Northern blot analysis Northern blot analysis was performed as previously described [24]. In brief, a total RNA (12 mg per each lane) isolated from glomeruli using commercial preparation based on guanidinium and phenol extraction (TRIzol Reagent, Gibco BRL, Grand Island, NY) was electrophoratically sepa-
K. Hayashi et al. / Diabetes Research and Clinical Practice 52 (2001) 85–96
rated on a formaldehyde 1.0% agarose gel, and transferred onto a nylon membrane (NYTRAN pore size 0.45 mm, Schleicher & Schuell, Dassel, Germany). After immobilizing RNA by heating a membrane for 2 h at 80°C, hybridization was performed in a buffer (0.5 mol/l sodium phosphate, pH 7.0, 1% BSA, 7% SDS, 1 mmol/l EDTA) containing cDNA labeled with a-[32P] CTP (New England Nuclear, Boston, MA) by a random primer method (BcaBEST, TAKARA, Shiga, Japan) at 65°C for 16 h. The hybridized filter was washed in a buffer (30 mmol/l sodium chloride, 3 mmol/l sodium citrate, 0.1% SDS) at 65°C and autoradiographed with Kodak XAR film. A radioactivity of the corresponding bands was measured quantitatively by a phospho-image analyzer (Molecular analyst, Bio-Rad Lab., Hercules, CA). After stripping radio active probes off the membrane, it was re-hybridized with a radioactive probe of acidic ribosomal phosphoprotein PO (36B4) as an internal standard [25]. Rat catalase cDNA [26] was provided by Dr T. Hashimoto and Dr S. Yoshida (Shinshuu University, Matsumoto, Japan). cDNA for rat CuZn-superoxide dismutase (CuZn-SOD) and glutathione peroxidase (GPX) was cloned by RT-PCR from total RNA isolated from a rat hepatoma cell line. cDNA for rat heme oxygenase-1 (HO-1) and heme oxygenase-2 (HO-2) was cloned by RT-PCR from total RNA isolated from rat kidney. The primer pairs used for PCR reaction were as follows (forward and reverse, respectively). CuZn-SOD [27]: 5%GGCGTCATTCACTTCGAGCAGAAG3% and 5%GGCAATCCCAATCACACCACAAGC3%; GPX [28]: 5%GCACAGTCCACCGTGTATGCCTTC3% and 5%GTTGCTAGGCTGCTTGGACACCAG3%; HO-1 [29]: 5%ACTTTCAGAAGGGTCAGGTGTCC3% and 5%TTGAGCAGGAAGGCGGTCTTA3%; HO-2 [29]: 5%CCACCACTGCACTTTACTTC3% and 5%GGTCTTCATACTCAGGTCCA3%.
87
ml ice-cold buffer (20 mmol/l Tris –HCl, pH 7.4, 150 mmol/l sodium chloride, 2 mmol/l EDTA, 1% Nonidet P-40, 1% sodium deoxycholate, 0.1% SDS, 50 mmol/l sodium fluoride, 1 mmol/l dithiothreitol, 1 mmol/l sodium orthovanadate, 10 mg/ ml aprotinin, 1 mmol/l phenylmethylsulfonyl fluoride, 1 mg/ml leupeptin). After sonication at 4°C for 10 s, glomerular homogenates were centrifuged at 12 000× g at 4°C for 20 min and supernatants were used. After boiling for 5 min, samples (20 mg protein/lane) were electrophoresed on a 12% SDS-polyacrylamide gel (SDS-PAGE), as previously described [31], and transferred to a polyvinylidene difluoride filter (Immobilon, Millipore, Bedford, MA) for 1 h at 100 mA using HORIZBLOT AE6677P (ATTO, Tokyo, Japan). For blocking, the filter was incubated in 5% nonfat milk in buffer containing 10 mmol/l Tris –HCl, pH 7.6, 150 mmol/l sodium chloride, and 0.1% Tween-20 (TBS-T) at 4°C overnight. The filter was, then, washed several times over 30 min in TBS-T at room temperature and incubated with a rabbit polyclonal antibody against rat HO-1 (Stress-Gen, Victoria, Canada) for 1 h at room temperature at dilution of 1:1000 in TBS-T with 5% milk. After multiple washes in TBS-T, the filter was incubated with a horseradish peroxidase-conjugated donkey anti-rabbit IgG secondary antibody for 1 h at 1:1000 dilution in TBS-T with 5% milk. After washing the filter several times with TBS-T, the specific proteins were detected using an enhanced chemiluminescence system (Amersham, Buckinghamshire, UK). We tested the specificity of the HO-1 antibody by preincubating it with its immunogen (Stress-Gen, Victoria, Canada). Protein was measured by a Bio-Rad protein assay kit (Bio-Rad Lab., Hercules, CA). A density of the corresponding bands was measured quantitatively using NIH Image software (http://rsb.info.nih.gov/nih-image).
2.4. Immunohistochemistry 2.3. Western blot analysis The expression of HO-1 proteins was examined by an immunoblot analysis as previously described [30]. Glomeruli were homogenized in 0.5
Rats were deeply anesthetized by intraperitoneal injection of pentobarbital sodium (50 mg/ kg body weight). After inferior vena cava and abdominal aorta were exposed, an 18-gauge
88
K. Hayashi et al. / Diabetes Research and Clinical Practice 52 (2001) 85–96
needle was inserted into the former and a 22gauge needle was inserted into the latter caudal to the renal vessels. After perfusion with ice-cold Ringer solution and 10% buffered formalin, the kidney was excised, decapsulated, and immersed in 10% buffered formalin [32,33]. Formalin-fixed and paraffin-embedded kidney samples were cut into section with 2 mm thickness in a serial manner, deparaffinized in xylene and rehydrated through a series of decreasing concentrations of ethanol. As previously described [34], sections were microwaved, treated with a 99.1% methanol/ hydrogen peroxide solution to quench the internal peroxidase activity for 20 min, blocked for 1 h in TBS with 10% goat serum, and incubated overnight with a rabbit polyclonal antibody against rat HO-1 at 1:1000 dilution at 4°C. The sections were further processed according to the manufacture’s instructions for use of Histofine Simple Stain MAX PO (R) kits (Universal Immuno-peroxidase Polymar, Anti-Rabbit, Nichirei, Tokyo, Japan). Heme oxygenase-1 immunoreactive products were visualized by the use of 3,3%-diaminobenzidine tetrahydrochloride as a chromogen, and counter-stained with Mayer’s hematoxylin. To identify glomerular epithelial cells and mesangial cells, a polyclonal rabbit antibody to Wilms’ tumor (WT) protein of human origin (Santa Cruz, CA, USA) and a monoclonal antibody to rat CD90 (Thy-1.1, Cedarlane, Hornby, Ont., Canada) were used on paired section of mirror image, respectively. Immunohistochemical analysis was performed as described above. For control staining, non-immune rabbit serum and the appropriate secondary antibody were used.
2.5. Statistical analysis Results were expressed as mean9 S.D. Comparisons between two groups were analyzed by Student’s unpaired t-test. Comparisons among three or more groups were analyzed by one-way analysis of variance (ANOVA) followed by either Scheffe’s test or Bonferroni/Dunn’s test to evaluate statistical difference between two groups. P values of B0.05 were defined as statistically significant.
3. Results
3.1. Animal characteristics The levels of blood glucose were significantly higher in diabetic rats than in control rats either 2 or 4 weeks after STZ injection. Body mass was smaller and kidney mass was heavier in diabetic rats than in control rats (Table 1A). These changes in diabetic rats were normalized by the treatment with insulin (Table 1A). The treatment with vitamin E (intraperitoneally injection 40 mg/ kg body weight every other day) did not affect blood glucose levels, body weights, and kidney weights in both control and diabetic rats (Table 1B).
3.2. The expression of mRNA for antioxidant enzymes in glomeruli of diabetic rats Although the mRNA expression of catalase and CuZn-SOD has been shown to be induced in total kidneys of diabetic rats [23], it remains unclear whether these antioxidant enzymes are induced especially in glomeruli of diabetic rats. We, thus, examined mRNA expression of antioxidant enzymes such as catalase, CuZn-SOD, and GPX in glomeruli isolated from control, diabetic, and diabetic rats treated with insulin for 2 weeks after the induction of diabetes. mRNA expression of catalase and GPX was slightly increased in glomeruli of diabetic rats, but not significantly different from that in control rats or diabetic rats treated with insulin (Fig. 1A). CuZn-SOD mRNA expression did not differ among the three groups (Fig. 1A). Four weeks after the induction of diabetes, the mRNA expression of catalase, GPX, and CuZn-SOD did not differ among the three groups (Fig. 1B).
3.3. Heme oxygenase-1 mRNA and protein expression in glomeruli of diabetic rats Since previous studies have reported that HO-1 has antioxidant, anti-inflammatory, and cytoprotective functions in a variety of tissues including heart, blood vessels, and lung, implicating HO-1 as one of the most sensitive and reliable indicators
K. Hayashi et al. / Diabetes Research and Clinical Practice 52 (2001) 85–96
89
Fig. 1. The effect of diabetes on mRNA expression of catalase, GPX and CuZn-SOD in glomeruli. Glomeruli were isolated from control rats (CTR), diabetic rats (DM), and diabetic rats treated with insulin (INS), 2 (A) and 4 (B) weeks after STZ injection. A representative result of northern blot analysis for glomerular mRNA expression of catalase, GPX, CuZn-SOD, and 36B4 is shown in lower panel. A radioactivity of the corresponding band was measured quantitatively by a phospho-image analyzer and the ratio to 36B4 mRNA is shown in upper panel. Data are expressed as mean 9 S.D. (n = 3 – 4, the results were derived from six to eight rats, four kidneys from two rats were processed for each experiment).
K. Hayashi et al. / Diabetes Research and Clinical Practice 52 (2001) 85–96
90
of cellular oxidative stress [35,36], we determined the expression of HO-1 mRNA in glomeruli 2 and 4 weeks after the induction of diabetes by a northern blot analysis. As shown in Fig. 2A, mRNA expression of HO-1 was significantly enhanced by 16-fold (P B 0.01) in the glomeruli of diabetic rats 2 week after the induction of diabetes as compared with that in control rats. This enhancement of HO-1 expression was completely normalized by keeping euglycemia with insulin (Fig. 2A). The expression of HO-1 remained elevated by 13-fold (P B0.01) in the glomeruli of diabetic rats 4 weeks after the induction of diabetes (Fig. 2A). Glycemic control by insulin again prevented diabetes-induced increase in glomerular HO-1 mRNA expression (Fig. 2A). Moreover, a significant increase in protein expression of HO-1 was also observed in the glomeruli of diabetic rats in 2 (by 12-fold P B0.01) and 4 (by 10-fold P B 0.01) weeks groups as compared with that in control rats (Fig. 2B). Glycemic control by insulin prevented diabetes-induced increase in glomerular
HO-1 protein expression (Fig. 2B), consistent with the result of mRNA expression. Heme oxygenase-2 (HO-2) is biochemically and structurally distinct from HO-1 and appears to be either little regulated or constitutive [37]. Next, the mRNA expression of HO-2 was determined in glomeruli 2 weeks after the induction of diabetes. mRNA expression of HO-2 in glomeruli of diabetic rats did not differ from control rats (Fig. 3).
3.4. Effect of 6itamin E treatment on the HO-1 mRNA and protein expression in glomeruli of diabetic rats To further ascertain whether oxidative stress can cause HO-1 overexpression in glomeruli of diabetic rats, we examined the effect of treatment with a potent antioxidant, vitamin E on mRNA and protein expression of HO-1 in glomeruli of control and diabetic rats. As shown in Fig. 4A, increased HO-1 mRNA expression in glomeruli of diabetic rats was completely normalized by the
Table 1 Characterization of diabetic rats 2 weeks
Number (n)
Body weight (g)
Blood glucose (mmol/1)
Kidney weight (g/100 g body wt.)
(A) Characterization of diabetic and control rats treated with or without insulin 2 weeks Control 12 293.7 9 13.7 6.8 90.7 Diabetic 12 231.9 914.6a 24.7 9 2.2a Diabetic+insulin 12 284.7 9 12.9 5.6 9 1.7
0.75 90.06 1.16 90.09a 0.81 90.09
4 weeks Control Diabetic Diabetic+insulin
0.68 90.05 1.20 9 0.11a 0.70 90.11
10 11 10
358.79 22.2 240.9 9 28.0a 384.0 961.0
6.2 9 1.2 21.1 9 2.0a 6.6 92.5
(B) Characterization of diabetic and control rats treated with or without 6itamin E 2 weeks Control 10 306.0 9 17.1 7.5 9 0.4 Control+vitamin E 10 280.5 9 19.4 6.3 9 0.8 10 222.1 9 31.9b Diabetic 21.8 9 1.2b Diabetic+vitamin E 10 221.5 9 21.5b 22.7 9 2.4b
0.78 9 0.07 0.74 9 0.07 1.25 9 0.13b 1.19 9 0.14b
4 week Control Control+vitamin E Diabetic Diabetic+vitamin E
0.68 90.04 0.66 90.06 1.07 90.07b 1.04 90.10b
a b
9 9 9 9
349.29 15.0 345.09 25.7 280.79 27.0b 240.89 30.2b
Mean9 S.D., PB0.01 vs. other groups Mean9 S.D., PB0.01 vs. control.
7.5 9 0.4 7.2 90.4 24.1 9 1.8b 26.9 9 3.0b
K. Hayashi et al. / Diabetes Research and Clinical Practice 52 (2001) 85–96
91
Fig. 2. The effect of diabetes on the expression of mRNA (A) and protein (B) of heme oxygenase-1 (HO-1) in glomeruli. Glomeruli were isolated from control rats (CTR), diabetic rats (DM), and diabetic rats treated with insulin (INS), 2 and 4 weeks after STZ injection. (A) A representative result of northern blot analysis of glomerular mRNA expression of HO-1 and 36B4 is shown in lower panel. A radioactivity of the corresponding bands was measured quantitatively by a phospho-image analyzer and HO-1/36B4 mRNA ratio is shown in upper panel. Data are expressed as mean 9 S.D. (n =3 – 4, the results were derived from six to eight rats, four kidneys from two rats were processed for each experiment, *P B0.01 vs. other groups). (B) A representative result of immunoblot analysis of glomerular protein expression for HO-1 is shown in lower panel. Glomeruli isolated from each rat were processed for immunoblot analysis. A density of the corresponding bands was measured quantitatively using NIH Image software and the ratio to control is shown in the upper panel. Data are expressed as mean 9 S.D. (n =4 – 5, the results were derived from four to five rats and two kidneys from one rat were processed for each experiment, *PB0.01 vs. other groups).
92
K. Hayashi et al. / Diabetes Research and Clinical Practice 52 (2001) 85–96
paired sections prepared from diabetic rats of 2 weeks, the cells reactive for HO-1 corresponded to those reactive for WT (Fig. 5C and D) and to those reactive for Thy-1.1 (Fig. 5E and F). The staining for HO-1 was also observed in cells located within glomerular capillary lumen of diabetic rats (Fig. 5G).
4. Discussion
Fig. 3. A representative result of mRNA expression of heme oxygenase-2 (HO-2) and 36B4 in glomeruli. Glomeruli were isolated from control rats (CTR) and diabetic rats (DM) 2 weeks after the injection of STZ. A radioactivity of the corresponding bands was measured quantitatively by a phosphoimage analyzer and HO-2/36B4 mRNA ratio is shown in upper panel. Data are expressed as mean 9 S.D. (n= 6, the results were derived from 12 rats, four kidneys from two rats were processed for each experiment).
treatment with vitamin E. HO-1 mRNA expression in glomeruli of control rats was not affected by vitamin E (Fig. 4A). As shown in Fig. 4B, an increase in HO-1 protein expression in glomeruli of diabetic rats was again prevented by vitamin E treatment. Glomerular HO-1 protein expression of control rats was not affected by vitamin E treatment.
3.5. Immunohistochemical characterization of HO-1 in glomeruli of diabetic rats To characterize the potential source of HO-1 protein expression in glomeruli, we performed immunohistochemical analysis using an anti-HO1 antibody. Glomeruli of control rats showed few immuno-reactive cells for HO-1 (Fig. 5A), whereas intense and profound HO-1 positive cells were observed in glomeruli of diabetic rats as compared with control rats (Fig. 5B). In the
In the present study, we have clearly demonstrated an enhancement of glomerular expression of HO-1 without altering the expression of constitutive antioxidant enzymes such as catalase, GPX, and, CuZn-SOD. We have also found that mRNA and protein overexpression of HO-1 in diabetic rats was normalized by treatment with vitamin E. Furthermore, HO-1 was identified immunohistochemically to be induced in the glomerular epithelial cells, as well as mesangial cells in diabetic rats. Increased oxidative stress may occur in diabetes for reasons possibly related to an increase in glucose concentrations in plasma and tissues [4,16 –20,38,39] and may have a role in the pathogenesis of diabetic nephropathy. In response to the toxic effect of oxidative stress, antioxidant enzymes are induced to protect cellular and tissue injury [13,23,40]. Indeed, CuZn-SOD and catalase mRNA levels have been shown to be significantly induced in the total kidney of untreated diabetic rats 17 days after the induction of diabetes [23]. However, we were not able to observe any change in mRNA expression of CuZn-SOD, GPX, and catalase in glomeruli of diabetic rats 2 and 4 weeks after the induction of diabetes. The difference of mRNA preparation may explain the dissimilarity between our findings and theirs. Furthermore, the gene expression of antioxidant enzymes might be regulated in a cell-specific manner in diabetic rats. Heme oxygenase (HO), a stress response protein, is highly induced in response to various agents causing oxidative stress [35,36]. Three genetic isoforms of HO, designated HO-1, HO-2, and more recently, HO-3, have been characterized [37,41]. HO-1 is the inducible form and its expres-
K. Hayashi et al. / Diabetes Research and Clinical Practice 52 (2001) 85–96
sion is up-regulated by various stress-inducing factors [35,36]. We, thus, examined whether the expression of mRNA and protein for HO-1 is induced in glomeruli of diabetic rats. Both mRNA and protein expression of HO-1 were significantly increased in glomeruli of diabetic rats 2 and 4 weeks after the induction of diabetes, whereas control rats exhibited only a faint expression for HO-1. From the study using specific cell markers, Thy-1.1 and WT, we can identify HO-1 overexpression in both glomerular mesangial cells and glomerular epithelial cells. In addition, some cells within capillary lumen, possibly endothelial cells, were also stained by HO-1. These findings are the first demonstration of HO-1 induction in the glomeruli of diabetic rats. In these cells of diabetic rats, oxidative products might cause
93
membrane lipid peroxidation, cell proliferation, apoptosis and extracellular matrix protein production. To further ascertain the role of oxidative stress in HO-1 expression in the glomeruli of diabetic rats, we examined whether the treatment with a potent antioxidant, vitamin E could abrogate the increase in mRNA and protein expression of HO-1. Increased HO-1 mRNA and protein content in glomeruli of diabetic rats was completely normalized by the treatment with vitamin E. Since vitamin E treatment affected neither blood glucose level nor the body weight of the diabetic rats, the inhibitory effect of vitamin E on diabetes-induced glomerular overexpression of HO-1 seems to be mediated possibly through scavenging oxidative stress, but not through a change in the character of diabetic rats. Although
Fig. 4. The effect of an antioxidant treatment with vitamin E on the heme oxygenase-1 (HO-1) expression in rat glomeruli. (A) A representative result of mRNA expression of HO-1 and 36B4 in glomeruli isolated from control and diabetic rats with or without vitamin E (Vit. E) treatment for 2 and 4 weeks after the injection of STZ (n = 3 – 4, the results were derived from six to eight rats and four kidneys from two rats were processed for each experiment). (B) A representative result of immunoblot analysis of protein expression of HO-1 in glomeruli isolated from control and diabetic rats with or without vitamin E treatment (n =3 – 4, the results were derived from three to four rats and two kidneys from one rat were processed for each experiment).
94
K. Hayashi et al. / Diabetes Research and Clinical Practice 52 (2001) 85–96
Fig. 5. Immunohistochemical staining for heme oxygenase-1 (HO-1), Wilms’ tumor protein (WT), and Thy-1.1 in diabetic rat at 2 weeks. (A) HO-1 stain in control rat. (B) HO-1 stain in diabetic rat. In the normal rats glomeruli, few cells exhibited positive cytoplasmic staining for HO-1 (A). In diabetic rats, immunostaining for HO-1 was elevated (B). Paired sections of mirror image were used to investigate the spatial relationships between HO-1 (C) and WT (D) and, between HO-1 (E) and Thy-1.1 (F). HO-1 positive cells (C, arrow) were positive for WT (D, arrow), and HO-1 positive cells (E, arrowhead) were also positive for Thy-1.1 (F, arrowhead). The staining for HO-1 was also observed in cells located within glomerular capillary lumen of diabetic rats (Fig. 5G, small arrowhead). A representative is shown from the results of three to four rats. Magnification; A-F, X400; G, X1000. Scale bar; 20 mm.
K. Hayashi et al. / Diabetes Research and Clinical Practice 52 (2001) 85–96
the mechanisms by which the diabetes could induce HO-1 remains elusive, the excessive oxidative stress seems to be sufficient to enhance the expression of HO-1 in diabetes based on our observation. The biological significance of glomerular HO-1 induced by diabetes, however, is still unknown in our study. Recent attention has focused on the beneficial role of HO-1 in protecting a variety of tissues from oxidative and inflammatory injury [42 – 47]. Heme oxygenase-1 deficient animals were found to be more sensitive to oxidant stimuli, resulting in severe liver injury and increased mortality induced by in vivo administration of endotoxin [42]. The absence of HO-1 was also shown to result in right ventricular infarction under hypoxic conditions, suggesting the essential role of HO-1 in protecting cardiomyocytes from hypoxia through its antioxidant activity [43]. In contrast, HO-1 superinduction induced by hemin has been shown to inhibit neointimal development elicited by arterial injury via increasing carbon monoxide production [45]. Thus, it is likely that HO-1 induced in glomeruli of diabetic rats may have protective roles in the development of diabetic nephropathy. Further study is necessary to clarify the precise function of HO-1 in diabetic kidney disease.
Acknowledgements We thank Dr Haruhisa Sato (Department of Pathology, Otowa Hospital, Yamashina, Kyoto) for his technical supports in this study.
References [1] Renal Data System, USRDS, Annual Data Report, National Institutes of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD. (1998) NIH publication no. 98-3176. [2] The Diabetes Control and Complications (DCCT) Trial Research Group, Effect of intensive therapy on the development and progression of diabetic nephropathy in the Diabetes Control and Complications Trial, Kidney Int 47 (1995) 1703-1720.
95
[3] UK Prospective Diabetes Study (UKPDS) Group, Intensive blood-glucose control with sulphonylureas or insulin compared with conventional treatment and risk of complications in patients with type 2 diabetes (UKPDS 33), Lancet 352 (1998) 837-853. [4] F.R. DeRubertis, P.A. Craven, Activation of protein kinase C in glomerular cells in diabetes. Mechanisms and potential links to the pathogenesis of diabetic glomerulopathy, Diabetes 43 (1994) 1 – 8. [5] D. Koya, G.L. King, Protein kinase C activation and the development of diabetic complications, Diabetes 47 (1998) 859– 866. [6] M. Haneda, S. Araki, M. Togawa, T. Sugimoto, M. Isono, R. Kikkawa, Mitogen-activated protein kinase cascade is activated in glomeruli of diabetic rats and glomerular mesangial cells cultured under high glucose conditions, Diabetes 46 (1997) 847– 853. [7] R. Kikkawa, K. Umemura, M. Haneda, T. Arimura, K. Ebata, Y. Shigeta, Evidence for existence of polyol pathway in cultured rat mesangial cells, Diabetes 36 (1987) 240– 243. [8] D.A. Greene, S.A. Lattimer, A.A. Sima, Sorbitol, phosphoinositides, and sodium-potassium-ATPase in the pathogenesis of diabetic complications, New Engl. J. Med. 316 (1987) 599– 606. [9] M. Haneda, R. Kikkawa, T. Arimura, et al., Glucose inhibits myo-inositol uptake and reduces myo-inositol content in cultured rat glomerular mesangial cells, Metabolism 39 (1990) 40 – 45. [10] M. Brownlee, A. Cerami, H. Vlassara, Advanced glycosylation end products in tissue and the biochemical basis of diabetic complications, New Engl. J. Med. 318 (1988) 1315– 1321. [11] K. Sharma, F.N. Ziyadeh, Hyperglycemia and diabetic kidney disease. The case for transforming growth factorbeta as a key mediator, Diabetes 44 (1995) 1139– 1146. [12] J.R. Williamson, K. Chang, M. Frangos, et al., Hyperglycemic pseudohypoxia and diabetic complications, Diabetes 42 (1993) 801– 813. [13] Y. Nishio, A. Kashiwagi, H. Taki, et al., Altered activities of transcription factors and their related gene expression in cardiac tissues of diabetic rats, Diabetes 47 (1998) 1318– 1325. [14] K. Horie, T. Miyata, K. Maeda, et al., Immunohistochemical colocalization of glycoxidation products and lipid peroxidation products in diabetic renal glomerular lesions. Implication for glycoxidative stress in the pathogenesis of diabetic nephropathy, J. Clin. Invest. 100 (1997) 2995– 3004. [15] D. Suzuki, T. Miyata, N. Saotome, et al., Immunohistochemical evidence for an increased oxidative stress and carbonyl modification of proteins in diabetic glomerular lesions, J. Am. Soc. Nephrol. 10 (1999) 822– 832. [16] T. Sakurai, S. Tsuchiya, Superoxide production from nonenzymatically glycated protein, FEBS Lett. 236 (1988) 406– 410.
96
K. Hayashi et al. / Diabetes Research and Clinical Practice 52 (2001) 85–96
[17] S.P. Wolff, R.T. Dean, Glucose autoxidation and protein modification. The potential role of’autoxidative glycosylation’ in diabetes, Biochem. J. 245 (1987) 243–250. [18] K. Yasunari, M. Kohno, H. Kano, K. Yokokawa, M. Minami, J. Yoshikawa, Antioxidants improve impaired insulin-mediated glucose uptake and preven migration and proliferation of cultured rabbit coronary smooth muscle cells induced by high glucose, Circulation 99 (1999) 1370– 1378. [19] K. Yasunari, M. Kohno, H. Kano, M. Minami, J. Yoshikawa, Aldose reductase inhibitor improves insulin mediated glucose uptake and prevents migration of human coronary artery smooth muscle cells induced by high glucose, Hypertension 35 (2000) 1092–1098. [20] A. Ghahary, J.M. Luo, Y.W. Gong, S. Chakrabarti, A.A. Sima, L.J. Murphy, Increased renal aldose reductase activity, immunoreactivity, and mRNA in streptozotocin-induced diabetic rats, Diabetes 38 (1989) 1067–1071. [21] R. Kakkar, S.V. Mantha, J. Radhi, K. Parasad, J. Kalra, Antioxidant defense system in diabetic kidney: a time course study, Life Sci. 60 (1997) 667–679. [22] H. Ha, C. Kim, Y. Son, M.H. Chung, K.H. Kim, DNA damage in the kidneys of diabetic rats exhibiting microalbuminuria, Free Radic. Biol. Med. 16 (1994) 271–274. [23] L.A. Sechi, A. Cariello, C.A. Griffin, et al., Renal antioxidant enzyme mRNA levels are increased in rats with experimental diabetes mellitus, Diabetologia 40 (1997) 23 – 29. [24] T. Ishida, M. Haneda, S. Maeda, D. Koya, R. Kikkawa, Stretch-induced overproduction of fibronectin in mesangial cells is mediated by the activation of mitogen-activated protein kinase, Diabetes 48 (1999) 595–602. [25] A.M. Krowczynska, M. Coutts, S. Makrides, G. Brawerman, The mouse homologue of the human acidic ribosomal phosphoprotein PO: a highly conserved polypeptide that is under translational control, Nucl. Acids Res. 17 (1989) 6408. [26] S. Furuta, H. Hayashi, M. Hijikata, S. Miyazawa, T. Osumi, T. Hashimoto, Complete nucleotide sequence of cDNA and deduced amino acid sequence of rat liver catalase, Proc. Natl. Acad. Sci. USA 83 (1986) 313–317. [27] A.P. Reddy, B.L. Hsu, P.S. Reddy, et al., Expression of glutathione peroxidase I gene in selenium-deficient rats, Nucl. Acids Res. 16 (1988) 5557–5568. [28] J.M. Delabar, A. Nicole, L. D’Auriol, et al., Cloning and sequencing of a rat CuZn superoxide dismutase cDNA. Correlation between CuZn superoxide dismutase mRNA level and enzyme activity in rat and mouse tissues, Eur. J. Biochem. 166 (1987) 181–187. [29] M. Fernandez, H.L. Bonkovsky, Increased heme oxygenase-1 gene expression in liver cells and splanchnic organs from portal hypertensive rats, Hepatology 29 (1999) 1672– 1679. [30] M.S. Carraway, A.J. Ghio, J.L. Taylor, C.A. Piantadosi, Induction of ferritin and heme oxygenase-1 by endotoxin in the lung, Am. J. Physiol. 275 (1998) L583–L592.
[31] U.K. Laemmli, Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature 227 (1970) 680– 685. [32] T. Nakagawa, M. Sasahara, M. Haneda, et al., Role of PDGF B-chain and PDGF receptors in rat tubular regeneration after acute injury, Am. J. Pathol. 155 (1999) 1689– 1699. [33] D. Koya, M. Haneda, H. Nakagawa, et al., Amelioration of accelerated diabetic mesangial expansion by treatment with a PKCb inhibitor in diabetic db/db mice, a rodent model for type 2 diabetes, FASEB J. 14 (2000) 439– 447. [34] K. Mosley, D.E. Wembridge, V. Cattell, H.T. Cook, Heme oxygenase is induced in nephrotoxic nephritis and hemin, a stimulator of heme oxygenase synthesis, ameliorates disease, Kidney Int. 53 (1998) 672– 678. [35] R. Galbraith, Heme oxygenase: who needs it?, Proc. Soc. Exp. Biol. Med. 222 (1999) 299– 305. [36] A. Agarwal, H.S. Nick, Renal response to tissue injury: lessons from heme oxygenase-1 gene ablation and expression, J. Am. Soc. Nephrol. 11 (2000) 965– 973. [37] M.D. Maines, Heme oxygenase: function, multiplicity, regulatory mechanisms, and clinical applications, FASEB J. 2 (1988) 2557– 2568. [38] D. Giugliano, A. Cariello, G. Paolisso, Oxidative stress and diabetic vascular complications, Diabetes Care 19 (1996) 257– 267. [39] T. Nishikawa, D. Edelstein, X.L. Du, et al., Normalizing mitochondrial superoxide production blocks three pathways of hyperglycaemic damage, Nature 13 (2000) 787– 790. [40] P.C. Sharpe, W.H. Liu, K.K. Yue, et al., Glucose-induced oxidative stress in vascular contractile cells: comparison of aortic smooth muscle cells and retinal pericytes, Diabetes 47 (1998) 801– 809. [41] W.K.Jr McCoubrey, T.J. Huang, M.D. Maines, Isolation and characterization of a cDNA from the rat brain that encodes hemoprotein heme oxygenase-3, Eur. J. Biochem. 247 (1997) 725– 732. [42] K.D. Poss, S. Tonegawa, Reduced stress defense in heme oxygenase 1 deficient cells, Proc. Natl. Acad. Sci. USA 94 (1997) 10925– 10930. [43] S.F. Yet, M.A. Perrella, M.D. Layne, et al., Hypoxia induces severe right ventricular dilatation and infarction in heme oxygenase-1 null mice, J. Clin. Invest. 103 (1999) R23– 29. [44] A. Yachie, Y. Niida, T. Wada, et al., Oxidative stress causes enhanced endothelial cell injury in human heme oxygenase1 deficiency, J. Clin. Invest. 103 (1999) 129– 135. [45] Y. Togane, T. Morita, M. Suematsu, Y. Ishimura, J.I. Yamazaki, S. Katayama, Protective roles of endogenous carbon monoxide in neointimal development elicited by arterial injury, Am. J. Physiol. Heart Circ. Physiol. 278 (2000) H623– H632. [46] L.E. Otterbein, L.L. Mantell, A.M. Choi, Carbon monoxide provides protection against hyperoxic lung injury, Am. J. Physiol. 276 (1999) L688– L694. [47] C.D. Ferris, S.R. Jaffrey, A. Sawa, et al., Haem oxygenase1 prevents cell death by regulating cellular iron, Nat. Cell. Biol. 1 (1999) 152– 157.
Enhancement of glomerular heme oxygenase-1 expression in diabetic rats Kazuyuki Hayashi, Masakazu Haneda *, Daisuke Koya, Shiro Maeda, Keiji Isshiki, Ryuichi Kikkawa The Third Department of Medicine, Shiga Uni6ersity of Medical Science, Otsu, Shiga, Japan Received 9 August 2000; received in revised form 5 December 2000; accepted 16 December 2000
Abstract An increase in oxidative stress in diabetic subjects is implicated to play a pivotal role in diabetic vascular complications. In response to oxidative stress, antioxidant enzymes are considered to be induced and protect cellular functions to keep in vivo homeostasis. However, it remains to be clarified whether antioxidant enzymes are induced against oxidative stress especially in renal glomeruli at an early stage of diabetes. To answer this question, we examined the gene expression of a variety of antioxidant enzymes in glomeruli isolated from streptozotocin-induced diabetic rats. The mRNA expression of antioxidant enzymes such as catalase, glutathione peroxidase, and CuZn-superoxide dismutase, was unaltered in glomeruli of diabetic rats and was comparable to control rats. In contrast, the mRNA expression of heme oxygenase-1 (HO-1) was enhanced in glomeruli of diabetic rats as compared with control rats. A treatment with insulin as well as with vitamin E (40 mg/kg body weight every other day, intra-peritoneal injection) normalized the mRNA expression of HO-1 in the glomeruli of diabetic rats. Immunohistochemical analysis revealed that the up-regulated expression of HO-1 protein was localized in glomerular cells of diabetic rats. In conclusion, these results provide the first evidence that among antioxidant enzymes HO-1 expression is preferentially increased in diabetic glomeruli. © 2001 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Diabetic nephropathy; Oxidative stress; Heme oxygenase-1; Antioxidant enzymes; Vitamin E
1. Introduction Diabetic nephropathy has become one of the main causes for end-stage renal disease in Japan, as well as in western countries [1]. The mechanisms of diabetes-induced glomerular injury have * Corresponding author. Tel.: +81-77-5482222; fax: 81-775433858. E-mail address: [email protected] (M. Haneda).
been extensively studied both in vivo and in vitro and recent evidence based on epidemiological studies clearly suggests that poor glycemic control undoubtedly is the most important risk factor for the development and progression of diabetic nephropathy [2,3]. Multiple biochemical mechanisms by which the diabetic state, hyperglycemia, causes diabetic nephropathy have been proposed in the experimental diabetic animal models and cultured cells exposed to high concentrations of
0168-8227/01/$ - see front matter © 2001 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0 1 6 8 - 8 2 2 7 ( 0 1 ) 0 0 2 1 8 - 2
86
K. Hayashi et al. / Diabetes Research and Clinical Practice 52 (2001) 85–96
glucose, including activation of protein kinase C (PKC) [4,5], activation of extracellular signal-regulated protein kinase [6], enhanced polyol pathway related to myo-inositol depletion [7 – 9], overproduction of advanced glycation end products [10], enhanced production of growth factors and cytokines [11], altered redox state, and oxidative stress [12 –15]. Oxidative stress has been proposed as one major cause responsible for the development and progression of diabetic nephropathy since high concentrations of glucose may increase the generation of reactive oxygen species (ROS) [12], through nonenzymatic glycation of protein substrates [16], auto-oxidative glycation [17], PKC activation [18,19], and increased polyol pathway [19,20]. Amongst, PKC inhibitor calphostin C and antisense oligonucleotide to PKC-beta isoform were shown to inhibit high glucose-mediated oxidative stress in smooth muscle cells [18,19]. Indeed, involvement of excessive oxidative stress has been indicated by the presence of endogenous end-products of oxidative stress such as lipid peroxides [21] and 8-hydroxydeoxyguanosine [22] in the kidney of streptozotocin (STZ)-induced diabetic rats. In the recent studies, malondialdehyde, a lipid peroxidation product whose formation is accelerated by oxidative stress, has been shown to be increased in the glomerular lesions of diabetic patients with early or advanced stage of nephropathy [14,15]. Regarding the defense system to oxidative stress, antioxidant enzymes such as catalase and CuZn-superoxide dismutase (CuZn-SOD) have been shown to be enhanced in kidneys of STZ-induced diabetic rats [23]. However, it still remains elusive whether these findings are merely a common consequence of the tissue damage in diabetic kidney or ROS is having a primary role in the pathogenesis of diabetic nephropathy. Moreover, we need to focus on glomeruli in which diabetes-induced tissue damage occurs primarily, resulting in mesangial expansion responsible for the obliteration of capillary lumen leading to glomerulosclerosis and finally end-stage renal failure. Therefore, we sought to determine alterations in the expression of antioxidant enzymes including heme oxygenase-1 (HO-1), one of the most
sensitive and reliable indicators of cellular oxidative stress, in glomeruli of STZ-induced diabetic rats. We further examined the effect of vitamin E, a well-known antioxidant, on HO-1 expression in diabetic glomeruli.
2. Materials and methods
2.1. Experimental protocol Male Sprague –Dawley (SD) rats weighing 180 –200 g, purchased from Japan SLC (Shizuoka, Japan), were randomly separated into control and experimental groups. The experimental animals were given intravenous injection of streptozotocin (STZ) (50 mg/kg body weight) (Sigma, St. Louis, MO) in 0.05 mol/l citrate buffer (pH 4.5). Rats receiving injection of citrate buffer were used as control. The levels of blood glucose were determined 2 days after injection of STZ or vehicle, and rats with blood glucose higher than 16.7 mmol/l were used as diabetic rats. These animals were maintained on laboratory diet and water ad libitum for either 2 or 4 weeks after injection of STZ. Insulin pellets (Linshin, Scarborough, Ont., Canada) were implanted subcutaneously 3 days after STZ injection to normalize blood glucose levels. Some control and diabetic rats were treated with vitamin E injected intraperitoneally at the concentrations of 40 mg/kg body weight every other day (Eisai Co Ltd. Tokyo, Japan) for either 2 or 4 weeks after 3 days STZ injection. Renal glomeruli were isolated from rats in either 2 or 4 weeks group by sieving with stainless and nylon meshes, as described previously [7]. All the experiments were approved by Shiga University of Medical Science Animal Care Committees.
2.2. Northern blot analysis Northern blot analysis was performed as previously described [24]. In brief, a total RNA (12 mg per each lane) isolated from glomeruli using commercial preparation based on guanidinium and phenol extraction (TRIzol Reagent, Gibco BRL, Grand Island, NY) was electrophoratically sepa-
K. Hayashi et al. / Diabetes Research and Clinical Practice 52 (2001) 85–96
rated on a formaldehyde 1.0% agarose gel, and transferred onto a nylon membrane (NYTRAN pore size 0.45 mm, Schleicher & Schuell, Dassel, Germany). After immobilizing RNA by heating a membrane for 2 h at 80°C, hybridization was performed in a buffer (0.5 mol/l sodium phosphate, pH 7.0, 1% BSA, 7% SDS, 1 mmol/l EDTA) containing cDNA labeled with a-[32P] CTP (New England Nuclear, Boston, MA) by a random primer method (BcaBEST, TAKARA, Shiga, Japan) at 65°C for 16 h. The hybridized filter was washed in a buffer (30 mmol/l sodium chloride, 3 mmol/l sodium citrate, 0.1% SDS) at 65°C and autoradiographed with Kodak XAR film. A radioactivity of the corresponding bands was measured quantitatively by a phospho-image analyzer (Molecular analyst, Bio-Rad Lab., Hercules, CA). After stripping radio active probes off the membrane, it was re-hybridized with a radioactive probe of acidic ribosomal phosphoprotein PO (36B4) as an internal standard [25]. Rat catalase cDNA [26] was provided by Dr T. Hashimoto and Dr S. Yoshida (Shinshuu University, Matsumoto, Japan). cDNA for rat CuZn-superoxide dismutase (CuZn-SOD) and glutathione peroxidase (GPX) was cloned by RT-PCR from total RNA isolated from a rat hepatoma cell line. cDNA for rat heme oxygenase-1 (HO-1) and heme oxygenase-2 (HO-2) was cloned by RT-PCR from total RNA isolated from rat kidney. The primer pairs used for PCR reaction were as follows (forward and reverse, respectively). CuZn-SOD [27]: 5%GGCGTCATTCACTTCGAGCAGAAG3% and 5%GGCAATCCCAATCACACCACAAGC3%; GPX [28]: 5%GCACAGTCCACCGTGTATGCCTTC3% and 5%GTTGCTAGGCTGCTTGGACACCAG3%; HO-1 [29]: 5%ACTTTCAGAAGGGTCAGGTGTCC3% and 5%TTGAGCAGGAAGGCGGTCTTA3%; HO-2 [29]: 5%CCACCACTGCACTTTACTTC3% and 5%GGTCTTCATACTCAGGTCCA3%.
87
ml ice-cold buffer (20 mmol/l Tris –HCl, pH 7.4, 150 mmol/l sodium chloride, 2 mmol/l EDTA, 1% Nonidet P-40, 1% sodium deoxycholate, 0.1% SDS, 50 mmol/l sodium fluoride, 1 mmol/l dithiothreitol, 1 mmol/l sodium orthovanadate, 10 mg/ ml aprotinin, 1 mmol/l phenylmethylsulfonyl fluoride, 1 mg/ml leupeptin). After sonication at 4°C for 10 s, glomerular homogenates were centrifuged at 12 000× g at 4°C for 20 min and supernatants were used. After boiling for 5 min, samples (20 mg protein/lane) were electrophoresed on a 12% SDS-polyacrylamide gel (SDS-PAGE), as previously described [31], and transferred to a polyvinylidene difluoride filter (Immobilon, Millipore, Bedford, MA) for 1 h at 100 mA using HORIZBLOT AE6677P (ATTO, Tokyo, Japan). For blocking, the filter was incubated in 5% nonfat milk in buffer containing 10 mmol/l Tris –HCl, pH 7.6, 150 mmol/l sodium chloride, and 0.1% Tween-20 (TBS-T) at 4°C overnight. The filter was, then, washed several times over 30 min in TBS-T at room temperature and incubated with a rabbit polyclonal antibody against rat HO-1 (Stress-Gen, Victoria, Canada) for 1 h at room temperature at dilution of 1:1000 in TBS-T with 5% milk. After multiple washes in TBS-T, the filter was incubated with a horseradish peroxidase-conjugated donkey anti-rabbit IgG secondary antibody for 1 h at 1:1000 dilution in TBS-T with 5% milk. After washing the filter several times with TBS-T, the specific proteins were detected using an enhanced chemiluminescence system (Amersham, Buckinghamshire, UK). We tested the specificity of the HO-1 antibody by preincubating it with its immunogen (Stress-Gen, Victoria, Canada). Protein was measured by a Bio-Rad protein assay kit (Bio-Rad Lab., Hercules, CA). A density of the corresponding bands was measured quantitatively using NIH Image software (http://rsb.info.nih.gov/nih-image).
2.4. Immunohistochemistry 2.3. Western blot analysis The expression of HO-1 proteins was examined by an immunoblot analysis as previously described [30]. Glomeruli were homogenized in 0.5
Rats were deeply anesthetized by intraperitoneal injection of pentobarbital sodium (50 mg/ kg body weight). After inferior vena cava and abdominal aorta were exposed, an 18-gauge
88
K. Hayashi et al. / Diabetes Research and Clinical Practice 52 (2001) 85–96
needle was inserted into the former and a 22gauge needle was inserted into the latter caudal to the renal vessels. After perfusion with ice-cold Ringer solution and 10% buffered formalin, the kidney was excised, decapsulated, and immersed in 10% buffered formalin [32,33]. Formalin-fixed and paraffin-embedded kidney samples were cut into section with 2 mm thickness in a serial manner, deparaffinized in xylene and rehydrated through a series of decreasing concentrations of ethanol. As previously described [34], sections were microwaved, treated with a 99.1% methanol/ hydrogen peroxide solution to quench the internal peroxidase activity for 20 min, blocked for 1 h in TBS with 10% goat serum, and incubated overnight with a rabbit polyclonal antibody against rat HO-1 at 1:1000 dilution at 4°C. The sections were further processed according to the manufacture’s instructions for use of Histofine Simple Stain MAX PO (R) kits (Universal Immuno-peroxidase Polymar, Anti-Rabbit, Nichirei, Tokyo, Japan). Heme oxygenase-1 immunoreactive products were visualized by the use of 3,3%-diaminobenzidine tetrahydrochloride as a chromogen, and counter-stained with Mayer’s hematoxylin. To identify glomerular epithelial cells and mesangial cells, a polyclonal rabbit antibody to Wilms’ tumor (WT) protein of human origin (Santa Cruz, CA, USA) and a monoclonal antibody to rat CD90 (Thy-1.1, Cedarlane, Hornby, Ont., Canada) were used on paired section of mirror image, respectively. Immunohistochemical analysis was performed as described above. For control staining, non-immune rabbit serum and the appropriate secondary antibody were used.
2.5. Statistical analysis Results were expressed as mean9 S.D. Comparisons between two groups were analyzed by Student’s unpaired t-test. Comparisons among three or more groups were analyzed by one-way analysis of variance (ANOVA) followed by either Scheffe’s test or Bonferroni/Dunn’s test to evaluate statistical difference between two groups. P values of B0.05 were defined as statistically significant.
3. Results
3.1. Animal characteristics The levels of blood glucose were significantly higher in diabetic rats than in control rats either 2 or 4 weeks after STZ injection. Body mass was smaller and kidney mass was heavier in diabetic rats than in control rats (Table 1A). These changes in diabetic rats were normalized by the treatment with insulin (Table 1A). The treatment with vitamin E (intraperitoneally injection 40 mg/ kg body weight every other day) did not affect blood glucose levels, body weights, and kidney weights in both control and diabetic rats (Table 1B).
3.2. The expression of mRNA for antioxidant enzymes in glomeruli of diabetic rats Although the mRNA expression of catalase and CuZn-SOD has been shown to be induced in total kidneys of diabetic rats [23], it remains unclear whether these antioxidant enzymes are induced especially in glomeruli of diabetic rats. We, thus, examined mRNA expression of antioxidant enzymes such as catalase, CuZn-SOD, and GPX in glomeruli isolated from control, diabetic, and diabetic rats treated with insulin for 2 weeks after the induction of diabetes. mRNA expression of catalase and GPX was slightly increased in glomeruli of diabetic rats, but not significantly different from that in control rats or diabetic rats treated with insulin (Fig. 1A). CuZn-SOD mRNA expression did not differ among the three groups (Fig. 1A). Four weeks after the induction of diabetes, the mRNA expression of catalase, GPX, and CuZn-SOD did not differ among the three groups (Fig. 1B).
3.3. Heme oxygenase-1 mRNA and protein expression in glomeruli of diabetic rats Since previous studies have reported that HO-1 has antioxidant, anti-inflammatory, and cytoprotective functions in a variety of tissues including heart, blood vessels, and lung, implicating HO-1 as one of the most sensitive and reliable indicators
K. Hayashi et al. / Diabetes Research and Clinical Practice 52 (2001) 85–96
89
Fig. 1. The effect of diabetes on mRNA expression of catalase, GPX and CuZn-SOD in glomeruli. Glomeruli were isolated from control rats (CTR), diabetic rats (DM), and diabetic rats treated with insulin (INS), 2 (A) and 4 (B) weeks after STZ injection. A representative result of northern blot analysis for glomerular mRNA expression of catalase, GPX, CuZn-SOD, and 36B4 is shown in lower panel. A radioactivity of the corresponding band was measured quantitatively by a phospho-image analyzer and the ratio to 36B4 mRNA is shown in upper panel. Data are expressed as mean 9 S.D. (n = 3 – 4, the results were derived from six to eight rats, four kidneys from two rats were processed for each experiment).
K. Hayashi et al. / Diabetes Research and Clinical Practice 52 (2001) 85–96
90
of cellular oxidative stress [35,36], we determined the expression of HO-1 mRNA in glomeruli 2 and 4 weeks after the induction of diabetes by a northern blot analysis. As shown in Fig. 2A, mRNA expression of HO-1 was significantly enhanced by 16-fold (P B 0.01) in the glomeruli of diabetic rats 2 week after the induction of diabetes as compared with that in control rats. This enhancement of HO-1 expression was completely normalized by keeping euglycemia with insulin (Fig. 2A). The expression of HO-1 remained elevated by 13-fold (P B0.01) in the glomeruli of diabetic rats 4 weeks after the induction of diabetes (Fig. 2A). Glycemic control by insulin again prevented diabetes-induced increase in glomerular HO-1 mRNA expression (Fig. 2A). Moreover, a significant increase in protein expression of HO-1 was also observed in the glomeruli of diabetic rats in 2 (by 12-fold P B0.01) and 4 (by 10-fold P B 0.01) weeks groups as compared with that in control rats (Fig. 2B). Glycemic control by insulin prevented diabetes-induced increase in glomerular
HO-1 protein expression (Fig. 2B), consistent with the result of mRNA expression. Heme oxygenase-2 (HO-2) is biochemically and structurally distinct from HO-1 and appears to be either little regulated or constitutive [37]. Next, the mRNA expression of HO-2 was determined in glomeruli 2 weeks after the induction of diabetes. mRNA expression of HO-2 in glomeruli of diabetic rats did not differ from control rats (Fig. 3).
3.4. Effect of 6itamin E treatment on the HO-1 mRNA and protein expression in glomeruli of diabetic rats To further ascertain whether oxidative stress can cause HO-1 overexpression in glomeruli of diabetic rats, we examined the effect of treatment with a potent antioxidant, vitamin E on mRNA and protein expression of HO-1 in glomeruli of control and diabetic rats. As shown in Fig. 4A, increased HO-1 mRNA expression in glomeruli of diabetic rats was completely normalized by the
Table 1 Characterization of diabetic rats 2 weeks
Number (n)
Body weight (g)
Blood glucose (mmol/1)
Kidney weight (g/100 g body wt.)
(A) Characterization of diabetic and control rats treated with or without insulin 2 weeks Control 12 293.7 9 13.7 6.8 90.7 Diabetic 12 231.9 914.6a 24.7 9 2.2a Diabetic+insulin 12 284.7 9 12.9 5.6 9 1.7
0.75 90.06 1.16 90.09a 0.81 90.09
4 weeks Control Diabetic Diabetic+insulin
0.68 90.05 1.20 9 0.11a 0.70 90.11
10 11 10
358.79 22.2 240.9 9 28.0a 384.0 961.0
6.2 9 1.2 21.1 9 2.0a 6.6 92.5
(B) Characterization of diabetic and control rats treated with or without 6itamin E 2 weeks Control 10 306.0 9 17.1 7.5 9 0.4 Control+vitamin E 10 280.5 9 19.4 6.3 9 0.8 10 222.1 9 31.9b Diabetic 21.8 9 1.2b Diabetic+vitamin E 10 221.5 9 21.5b 22.7 9 2.4b
0.78 9 0.07 0.74 9 0.07 1.25 9 0.13b 1.19 9 0.14b
4 week Control Control+vitamin E Diabetic Diabetic+vitamin E
0.68 90.04 0.66 90.06 1.07 90.07b 1.04 90.10b
a b
9 9 9 9
349.29 15.0 345.09 25.7 280.79 27.0b 240.89 30.2b
Mean9 S.D., PB0.01 vs. other groups Mean9 S.D., PB0.01 vs. control.
7.5 9 0.4 7.2 90.4 24.1 9 1.8b 26.9 9 3.0b
K. Hayashi et al. / Diabetes Research and Clinical Practice 52 (2001) 85–96
91
Fig. 2. The effect of diabetes on the expression of mRNA (A) and protein (B) of heme oxygenase-1 (HO-1) in glomeruli. Glomeruli were isolated from control rats (CTR), diabetic rats (DM), and diabetic rats treated with insulin (INS), 2 and 4 weeks after STZ injection. (A) A representative result of northern blot analysis of glomerular mRNA expression of HO-1 and 36B4 is shown in lower panel. A radioactivity of the corresponding bands was measured quantitatively by a phospho-image analyzer and HO-1/36B4 mRNA ratio is shown in upper panel. Data are expressed as mean 9 S.D. (n =3 – 4, the results were derived from six to eight rats, four kidneys from two rats were processed for each experiment, *P B0.01 vs. other groups). (B) A representative result of immunoblot analysis of glomerular protein expression for HO-1 is shown in lower panel. Glomeruli isolated from each rat were processed for immunoblot analysis. A density of the corresponding bands was measured quantitatively using NIH Image software and the ratio to control is shown in the upper panel. Data are expressed as mean 9 S.D. (n =4 – 5, the results were derived from four to five rats and two kidneys from one rat were processed for each experiment, *PB0.01 vs. other groups).
92
K. Hayashi et al. / Diabetes Research and Clinical Practice 52 (2001) 85–96
paired sections prepared from diabetic rats of 2 weeks, the cells reactive for HO-1 corresponded to those reactive for WT (Fig. 5C and D) and to those reactive for Thy-1.1 (Fig. 5E and F). The staining for HO-1 was also observed in cells located within glomerular capillary lumen of diabetic rats (Fig. 5G).
4. Discussion
Fig. 3. A representative result of mRNA expression of heme oxygenase-2 (HO-2) and 36B4 in glomeruli. Glomeruli were isolated from control rats (CTR) and diabetic rats (DM) 2 weeks after the injection of STZ. A radioactivity of the corresponding bands was measured quantitatively by a phosphoimage analyzer and HO-2/36B4 mRNA ratio is shown in upper panel. Data are expressed as mean 9 S.D. (n= 6, the results were derived from 12 rats, four kidneys from two rats were processed for each experiment).
treatment with vitamin E. HO-1 mRNA expression in glomeruli of control rats was not affected by vitamin E (Fig. 4A). As shown in Fig. 4B, an increase in HO-1 protein expression in glomeruli of diabetic rats was again prevented by vitamin E treatment. Glomerular HO-1 protein expression of control rats was not affected by vitamin E treatment.
3.5. Immunohistochemical characterization of HO-1 in glomeruli of diabetic rats To characterize the potential source of HO-1 protein expression in glomeruli, we performed immunohistochemical analysis using an anti-HO1 antibody. Glomeruli of control rats showed few immuno-reactive cells for HO-1 (Fig. 5A), whereas intense and profound HO-1 positive cells were observed in glomeruli of diabetic rats as compared with control rats (Fig. 5B). In the
In the present study, we have clearly demonstrated an enhancement of glomerular expression of HO-1 without altering the expression of constitutive antioxidant enzymes such as catalase, GPX, and, CuZn-SOD. We have also found that mRNA and protein overexpression of HO-1 in diabetic rats was normalized by treatment with vitamin E. Furthermore, HO-1 was identified immunohistochemically to be induced in the glomerular epithelial cells, as well as mesangial cells in diabetic rats. Increased oxidative stress may occur in diabetes for reasons possibly related to an increase in glucose concentrations in plasma and tissues [4,16 –20,38,39] and may have a role in the pathogenesis of diabetic nephropathy. In response to the toxic effect of oxidative stress, antioxidant enzymes are induced to protect cellular and tissue injury [13,23,40]. Indeed, CuZn-SOD and catalase mRNA levels have been shown to be significantly induced in the total kidney of untreated diabetic rats 17 days after the induction of diabetes [23]. However, we were not able to observe any change in mRNA expression of CuZn-SOD, GPX, and catalase in glomeruli of diabetic rats 2 and 4 weeks after the induction of diabetes. The difference of mRNA preparation may explain the dissimilarity between our findings and theirs. Furthermore, the gene expression of antioxidant enzymes might be regulated in a cell-specific manner in diabetic rats. Heme oxygenase (HO), a stress response protein, is highly induced in response to various agents causing oxidative stress [35,36]. Three genetic isoforms of HO, designated HO-1, HO-2, and more recently, HO-3, have been characterized [37,41]. HO-1 is the inducible form and its expres-
K. Hayashi et al. / Diabetes Research and Clinical Practice 52 (2001) 85–96
sion is up-regulated by various stress-inducing factors [35,36]. We, thus, examined whether the expression of mRNA and protein for HO-1 is induced in glomeruli of diabetic rats. Both mRNA and protein expression of HO-1 were significantly increased in glomeruli of diabetic rats 2 and 4 weeks after the induction of diabetes, whereas control rats exhibited only a faint expression for HO-1. From the study using specific cell markers, Thy-1.1 and WT, we can identify HO-1 overexpression in both glomerular mesangial cells and glomerular epithelial cells. In addition, some cells within capillary lumen, possibly endothelial cells, were also stained by HO-1. These findings are the first demonstration of HO-1 induction in the glomeruli of diabetic rats. In these cells of diabetic rats, oxidative products might cause
93
membrane lipid peroxidation, cell proliferation, apoptosis and extracellular matrix protein production. To further ascertain the role of oxidative stress in HO-1 expression in the glomeruli of diabetic rats, we examined whether the treatment with a potent antioxidant, vitamin E could abrogate the increase in mRNA and protein expression of HO-1. Increased HO-1 mRNA and protein content in glomeruli of diabetic rats was completely normalized by the treatment with vitamin E. Since vitamin E treatment affected neither blood glucose level nor the body weight of the diabetic rats, the inhibitory effect of vitamin E on diabetes-induced glomerular overexpression of HO-1 seems to be mediated possibly through scavenging oxidative stress, but not through a change in the character of diabetic rats. Although
Fig. 4. The effect of an antioxidant treatment with vitamin E on the heme oxygenase-1 (HO-1) expression in rat glomeruli. (A) A representative result of mRNA expression of HO-1 and 36B4 in glomeruli isolated from control and diabetic rats with or without vitamin E (Vit. E) treatment for 2 and 4 weeks after the injection of STZ (n = 3 – 4, the results were derived from six to eight rats and four kidneys from two rats were processed for each experiment). (B) A representative result of immunoblot analysis of protein expression of HO-1 in glomeruli isolated from control and diabetic rats with or without vitamin E treatment (n =3 – 4, the results were derived from three to four rats and two kidneys from one rat were processed for each experiment).
94
K. Hayashi et al. / Diabetes Research and Clinical Practice 52 (2001) 85–96
Fig. 5. Immunohistochemical staining for heme oxygenase-1 (HO-1), Wilms’ tumor protein (WT), and Thy-1.1 in diabetic rat at 2 weeks. (A) HO-1 stain in control rat. (B) HO-1 stain in diabetic rat. In the normal rats glomeruli, few cells exhibited positive cytoplasmic staining for HO-1 (A). In diabetic rats, immunostaining for HO-1 was elevated (B). Paired sections of mirror image were used to investigate the spatial relationships between HO-1 (C) and WT (D) and, between HO-1 (E) and Thy-1.1 (F). HO-1 positive cells (C, arrow) were positive for WT (D, arrow), and HO-1 positive cells (E, arrowhead) were also positive for Thy-1.1 (F, arrowhead). The staining for HO-1 was also observed in cells located within glomerular capillary lumen of diabetic rats (Fig. 5G, small arrowhead). A representative is shown from the results of three to four rats. Magnification; A-F, X400; G, X1000. Scale bar; 20 mm.
K. Hayashi et al. / Diabetes Research and Clinical Practice 52 (2001) 85–96
the mechanisms by which the diabetes could induce HO-1 remains elusive, the excessive oxidative stress seems to be sufficient to enhance the expression of HO-1 in diabetes based on our observation. The biological significance of glomerular HO-1 induced by diabetes, however, is still unknown in our study. Recent attention has focused on the beneficial role of HO-1 in protecting a variety of tissues from oxidative and inflammatory injury [42 – 47]. Heme oxygenase-1 deficient animals were found to be more sensitive to oxidant stimuli, resulting in severe liver injury and increased mortality induced by in vivo administration of endotoxin [42]. The absence of HO-1 was also shown to result in right ventricular infarction under hypoxic conditions, suggesting the essential role of HO-1 in protecting cardiomyocytes from hypoxia through its antioxidant activity [43]. In contrast, HO-1 superinduction induced by hemin has been shown to inhibit neointimal development elicited by arterial injury via increasing carbon monoxide production [45]. Thus, it is likely that HO-1 induced in glomeruli of diabetic rats may have protective roles in the development of diabetic nephropathy. Further study is necessary to clarify the precise function of HO-1 in diabetic kidney disease.
Acknowledgements We thank Dr Haruhisa Sato (Department of Pathology, Otowa Hospital, Yamashina, Kyoto) for his technical supports in this study.
References [1] Renal Data System, USRDS, Annual Data Report, National Institutes of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD. (1998) NIH publication no. 98-3176. [2] The Diabetes Control and Complications (DCCT) Trial Research Group, Effect of intensive therapy on the development and progression of diabetic nephropathy in the Diabetes Control and Complications Trial, Kidney Int 47 (1995) 1703-1720.
95
[3] UK Prospective Diabetes Study (UKPDS) Group, Intensive blood-glucose control with sulphonylureas or insulin compared with conventional treatment and risk of complications in patients with type 2 diabetes (UKPDS 33), Lancet 352 (1998) 837-853. [4] F.R. DeRubertis, P.A. Craven, Activation of protein kinase C in glomerular cells in diabetes. Mechanisms and potential links to the pathogenesis of diabetic glomerulopathy, Diabetes 43 (1994) 1 – 8. [5] D. Koya, G.L. King, Protein kinase C activation and the development of diabetic complications, Diabetes 47 (1998) 859– 866. [6] M. Haneda, S. Araki, M. Togawa, T. Sugimoto, M. Isono, R. Kikkawa, Mitogen-activated protein kinase cascade is activated in glomeruli of diabetic rats and glomerular mesangial cells cultured under high glucose conditions, Diabetes 46 (1997) 847– 853. [7] R. Kikkawa, K. Umemura, M. Haneda, T. Arimura, K. Ebata, Y. Shigeta, Evidence for existence of polyol pathway in cultured rat mesangial cells, Diabetes 36 (1987) 240– 243. [8] D.A. Greene, S.A. Lattimer, A.A. Sima, Sorbitol, phosphoinositides, and sodium-potassium-ATPase in the pathogenesis of diabetic complications, New Engl. J. Med. 316 (1987) 599– 606. [9] M. Haneda, R. Kikkawa, T. Arimura, et al., Glucose inhibits myo-inositol uptake and reduces myo-inositol content in cultured rat glomerular mesangial cells, Metabolism 39 (1990) 40 – 45. [10] M. Brownlee, A. Cerami, H. Vlassara, Advanced glycosylation end products in tissue and the biochemical basis of diabetic complications, New Engl. J. Med. 318 (1988) 1315– 1321. [11] K. Sharma, F.N. Ziyadeh, Hyperglycemia and diabetic kidney disease. The case for transforming growth factorbeta as a key mediator, Diabetes 44 (1995) 1139– 1146. [12] J.R. Williamson, K. Chang, M. Frangos, et al., Hyperglycemic pseudohypoxia and diabetic complications, Diabetes 42 (1993) 801– 813. [13] Y. Nishio, A. Kashiwagi, H. Taki, et al., Altered activities of transcription factors and their related gene expression in cardiac tissues of diabetic rats, Diabetes 47 (1998) 1318– 1325. [14] K. Horie, T. Miyata, K. Maeda, et al., Immunohistochemical colocalization of glycoxidation products and lipid peroxidation products in diabetic renal glomerular lesions. Implication for glycoxidative stress in the pathogenesis of diabetic nephropathy, J. Clin. Invest. 100 (1997) 2995– 3004. [15] D. Suzuki, T. Miyata, N. Saotome, et al., Immunohistochemical evidence for an increased oxidative stress and carbonyl modification of proteins in diabetic glomerular lesions, J. Am. Soc. Nephrol. 10 (1999) 822– 832. [16] T. Sakurai, S. Tsuchiya, Superoxide production from nonenzymatically glycated protein, FEBS Lett. 236 (1988) 406– 410.
96
K. Hayashi et al. / Diabetes Research and Clinical Practice 52 (2001) 85–96
[17] S.P. Wolff, R.T. Dean, Glucose autoxidation and protein modification. The potential role of’autoxidative glycosylation’ in diabetes, Biochem. J. 245 (1987) 243–250. [18] K. Yasunari, M. Kohno, H. Kano, K. Yokokawa, M. Minami, J. Yoshikawa, Antioxidants improve impaired insulin-mediated glucose uptake and preven migration and proliferation of cultured rabbit coronary smooth muscle cells induced by high glucose, Circulation 99 (1999) 1370– 1378. [19] K. Yasunari, M. Kohno, H. Kano, M. Minami, J. Yoshikawa, Aldose reductase inhibitor improves insulin mediated glucose uptake and prevents migration of human coronary artery smooth muscle cells induced by high glucose, Hypertension 35 (2000) 1092–1098. [20] A. Ghahary, J.M. Luo, Y.W. Gong, S. Chakrabarti, A.A. Sima, L.J. Murphy, Increased renal aldose reductase activity, immunoreactivity, and mRNA in streptozotocin-induced diabetic rats, Diabetes 38 (1989) 1067–1071. [21] R. Kakkar, S.V. Mantha, J. Radhi, K. Parasad, J. Kalra, Antioxidant defense system in diabetic kidney: a time course study, Life Sci. 60 (1997) 667–679. [22] H. Ha, C. Kim, Y. Son, M.H. Chung, K.H. Kim, DNA damage in the kidneys of diabetic rats exhibiting microalbuminuria, Free Radic. Biol. Med. 16 (1994) 271–274. [23] L.A. Sechi, A. Cariello, C.A. Griffin, et al., Renal antioxidant enzyme mRNA levels are increased in rats with experimental diabetes mellitus, Diabetologia 40 (1997) 23 – 29. [24] T. Ishida, M. Haneda, S. Maeda, D. Koya, R. Kikkawa, Stretch-induced overproduction of fibronectin in mesangial cells is mediated by the activation of mitogen-activated protein kinase, Diabetes 48 (1999) 595–602. [25] A.M. Krowczynska, M. Coutts, S. Makrides, G. Brawerman, The mouse homologue of the human acidic ribosomal phosphoprotein PO: a highly conserved polypeptide that is under translational control, Nucl. Acids Res. 17 (1989) 6408. [26] S. Furuta, H. Hayashi, M. Hijikata, S. Miyazawa, T. Osumi, T. Hashimoto, Complete nucleotide sequence of cDNA and deduced amino acid sequence of rat liver catalase, Proc. Natl. Acad. Sci. USA 83 (1986) 313–317. [27] A.P. Reddy, B.L. Hsu, P.S. Reddy, et al., Expression of glutathione peroxidase I gene in selenium-deficient rats, Nucl. Acids Res. 16 (1988) 5557–5568. [28] J.M. Delabar, A. Nicole, L. D’Auriol, et al., Cloning and sequencing of a rat CuZn superoxide dismutase cDNA. Correlation between CuZn superoxide dismutase mRNA level and enzyme activity in rat and mouse tissues, Eur. J. Biochem. 166 (1987) 181–187. [29] M. Fernandez, H.L. Bonkovsky, Increased heme oxygenase-1 gene expression in liver cells and splanchnic organs from portal hypertensive rats, Hepatology 29 (1999) 1672– 1679. [30] M.S. Carraway, A.J. Ghio, J.L. Taylor, C.A. Piantadosi, Induction of ferritin and heme oxygenase-1 by endotoxin in the lung, Am. J. Physiol. 275 (1998) L583–L592.
[31] U.K. Laemmli, Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature 227 (1970) 680– 685. [32] T. Nakagawa, M. Sasahara, M. Haneda, et al., Role of PDGF B-chain and PDGF receptors in rat tubular regeneration after acute injury, Am. J. Pathol. 155 (1999) 1689– 1699. [33] D. Koya, M. Haneda, H. Nakagawa, et al., Amelioration of accelerated diabetic mesangial expansion by treatment with a PKCb inhibitor in diabetic db/db mice, a rodent model for type 2 diabetes, FASEB J. 14 (2000) 439– 447. [34] K. Mosley, D.E. Wembridge, V. Cattell, H.T. Cook, Heme oxygenase is induced in nephrotoxic nephritis and hemin, a stimulator of heme oxygenase synthesis, ameliorates disease, Kidney Int. 53 (1998) 672– 678. [35] R. Galbraith, Heme oxygenase: who needs it?, Proc. Soc. Exp. Biol. Med. 222 (1999) 299– 305. [36] A. Agarwal, H.S. Nick, Renal response to tissue injury: lessons from heme oxygenase-1 gene ablation and expression, J. Am. Soc. Nephrol. 11 (2000) 965– 973. [37] M.D. Maines, Heme oxygenase: function, multiplicity, regulatory mechanisms, and clinical applications, FASEB J. 2 (1988) 2557– 2568. [38] D. Giugliano, A. Cariello, G. Paolisso, Oxidative stress and diabetic vascular complications, Diabetes Care 19 (1996) 257– 267. [39] T. Nishikawa, D. Edelstein, X.L. Du, et al., Normalizing mitochondrial superoxide production blocks three pathways of hyperglycaemic damage, Nature 13 (2000) 787– 790. [40] P.C. Sharpe, W.H. Liu, K.K. Yue, et al., Glucose-induced oxidative stress in vascular contractile cells: comparison of aortic smooth muscle cells and retinal pericytes, Diabetes 47 (1998) 801– 809. [41] W.K.Jr McCoubrey, T.J. Huang, M.D. Maines, Isolation and characterization of a cDNA from the rat brain that encodes hemoprotein heme oxygenase-3, Eur. J. Biochem. 247 (1997) 725– 732. [42] K.D. Poss, S. Tonegawa, Reduced stress defense in heme oxygenase 1 deficient cells, Proc. Natl. Acad. Sci. USA 94 (1997) 10925– 10930. [43] S.F. Yet, M.A. Perrella, M.D. Layne, et al., Hypoxia induces severe right ventricular dilatation and infarction in heme oxygenase-1 null mice, J. Clin. Invest. 103 (1999) R23– 29. [44] A. Yachie, Y. Niida, T. Wada, et al., Oxidative stress causes enhanced endothelial cell injury in human heme oxygenase1 deficiency, J. Clin. Invest. 103 (1999) 129– 135. [45] Y. Togane, T. Morita, M. Suematsu, Y. Ishimura, J.I. Yamazaki, S. Katayama, Protective roles of endogenous carbon monoxide in neointimal development elicited by arterial injury, Am. J. Physiol. Heart Circ. Physiol. 278 (2000) H623– H632. [46] L.E. Otterbein, L.L. Mantell, A.M. Choi, Carbon monoxide provides protection against hyperoxic lung injury, Am. J. Physiol. 276 (1999) L688– L694. [47] C.D. Ferris, S.R. Jaffrey, A. Sawa, et al., Haem oxygenase1 prevents cell death by regulating cellular iron, Nat. Cell. Biol. 1 (1999) 152– 157.