Enhancement of the thermostability and the catalytic efficiency of Bacillus pumilus CBS protease by site-directed mutagenesis

Biochimie 92 (2010) 360e369

Contents lists available at ScienceDirect

Biochimie journal homepage: www.elsevier.com/locate/biochi

Research paper

Enhancement of the thermostability and the catalytic efficiency of Bacillus pumilus CBS protease by site-directed mutagenesis Bassem Jaouadi a, Nushin Aghajari b, Richard Haser b, Samir Bejar a, * a

Laboratoire d'Enzymes et de Métabolites des Procaryotes (LEMP), Centre de Biotechnologie de Sfax (CBS), B.P 1177, Route de Sidi Mansour Km 6, 3018 Sfax, Tunisia Laboratoire de BioCristallographie (LBC), Institut de Biologie et Chimie des Protéines (IBCP), UMR 5086-CNRS/Université de Lyon, 7 Passage du Vercors, F-69367, Lyon cedex 07, France b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 21 October 2009 Accepted 12 January 2010 Available online 21 January 2010

The serine alkaline protease, SAPB, from Bacillus pumilus CBS is characterized by its high thermoactivity, pH stability and high catalytic efficiency (kcat/Km) as well as its excellent stability and compatibility with an alkaline environment under harsh washing conditions. Based on sequence alignments and homologymodeling studies, the present study identified five amino acids Leu31, Thr33, Asn99, Phe159 and Gly182 being putatively important for the enzymatic behaviour of SAPB. To corroborate the role of these residues, 12 mutants were constructed by site-directed mutagenesis and then purified and characterized. The findings demonstrate that the single mutants F159T, F159S and G182S and combined double substitutions were implicated in the decrease of the optimum pH and temperature to 8.0e9.0 and 50
C, respectively, and that mutant F159T/S clearly affected substrate affinity and catalytic efficiency. With regards to the single L31I, T33S and N99Y and combined double and triple mutations, the N99Y mutation strongly improved the half-life times at 50
C and 60
C to 660 and 295 min from of 220 and 80 min for the wild-type enzyme, respectively. More interestingly, this mutation also shifted the optimum temperature from 65
C to 75
C and caused a prominent 31-fold increase in kcat/Km with N-succinylL-Ala-Ala-Pro-Phe-p-nitroanilide (AAPF). The L31I and T33S mutants were observed to improve mainly the optimum pH from 11.0 to 11.5 and from 11.0 to 12.0, respectively. Kinetic studies of double and triple mutants showed that the cumulative effect of polar uncharged substitutions had a synergistic effect on the P1 position preference using synthetic peptide substrates, which confirms the implication of these amino acids in substrate recognition and catalytic efficiency. Ó 2010 Elsevier Masson SAS. All rights reserved.

Keywords: Protease Bacillus pumilus Homology-modeling Sequence alignments Site-directed mutagenesis

1. Introduction Subtilisins (EC 3.4.21.62 belongs to the S8 family of peptidases [1]), a well-characterized family of extracellular serine proteinases, are found in various Bacillus species [2], fungi, yeasts and higher eukaryotes, such as worms, insects and plants [3]. Due to their promising applications in bio-industry, these enzymes have increasingly become a focus of research over the last few decades. In fact, subtilisins display very broad substrate specificity and are highly stable at neutral and alkaline pH, and are, therefore, used as

Abbreviations: SAPB, serine alkaline protease from Bacillus pumilus CBS; IPTG, isopropyl-thio-b-D-galactopyranoside; SDS, soduim dodecyl sulphate; PAGE, polyacrylamide gel electrophoresis; bp, base pairs; aa, amino acids; AAPF, N-succinyl-LAla-Ala-Pro-Phe-p-nitroanilide; AAPL, N-succinyl-L-Ala-Ala-Pro-Leu-p-nitroanilide; AAVA, N-succinyl-L-Ala-Ala-Val-Ala-p-nitroanilide; AAA, N-succinyl-L-Ala-Ala-Alap-nitroanilide. * Corresponding author. Tel./fax: þ216 74 87 04 51. E-mail address: [email protected] (S. Bejar). 0300-9084/$ e see front matter Ó 2010 Elsevier Masson SAS. All rights reserved. doi:10.1016/j.biochi.2010.01.008

protein-degrading additives to detergents. Accordingly, they have been one of a handful of technologically mass-produced enzymes, with a worldwide production rate that amounts to several hundred tons per year [4]. Considering their interesting properties and potential, several subtilisins have so far been extensively described and their enzymatic properties investigated [5]. Many genes encoding these proteases have also been identified and characterized, including those of subtilisin BPN' from Bacillus amyloliquefaciens, subtilisin Carlsberg from Bacillus licheniformis, subtilisin E from Bacillus subtilis and savinase from Bacillus lentus [6e8]. Subtilisins are synthesized as pre-pro-subtilisin precursors. The mature subtilisins E and BPN' display 275 residues (274 for Carlsberg) with a catalytic triad involving His64 (63 for Carlsberg), Asp32 and Ser221 (220 for Carlsberg) residues and two calcium binding sites (three for Carlsberg) which stabilize the threedimensional (3D) structure [9]. More than 40 high resolution crystal structures of subtilisins and their complexes with polypeptide inhibitors have been determined [10,11]. The refined

B. Jaouadi et al. / Biochimie 92 (2010) 360e369

3D-structures of BPN' [12], subtilisin Carlsberg [13], savinase [14] and subtilisin E [11] are available along with the 3D-structure of a complex between the prodomain and a calcium-free subtilisin mutant. The latter clarified the function of the prodomain that acts as an intramolecular chaperone, which is critical for the folding of the mature protease domain [15e17]. The structure-stability relationships have also been thoroughly approached through the comparison of the 3D-structures of enzymes from psychrophilic, mesophilic and thermophilic microorganisms [18e21]. In view of their promising potential for industrial applications, particularly in the detergent and food processing industries, subtilisins have been extensively investigated as targets for protein engineering [22,23]. The substrate or inhibitor interacting residues in subtilases have been identified from their crystal structures and by modeling [9,24], as well as from protein engineering studies of subtilisin BPN' [25,26]. Thermostability, specific activity and catalytic efficiency have always been considered among the critical factors determining the feasibility of using subtilisins for industrial applications. In fact, several studies have taken these issues into account. The specific activity of the subtilisin E I31L mutant has, for instance, been substantially increased to bring about a prominent 2e6-fold increase in the kcat/Km values [27]. The thermostability of subtilisin E has also been enhanced by substituting P239A and introducing of a disulfide bridge (Cys61/Cys98) using site-directed mutagenesis [28]. Furthermore, the thermostability and kcat/Km value of AprP, an alkaline protease from Pseudomonas sp., were enhanced by changing an amino acid (S331D) at an autoproteolytic cleavage site [29]. To the best of the authors' knowledge, and although many structureefunction relationship studies have been conducted on subtilisins, no previous reports have yet investigated the Bacillus pumilus alkaline protease family. Accordingly, the present study was undertaken with the aim of obtaining a better understanding of this area of structureefunction relationship so as to help develop new engineered proteases. We have previously reported an alkaline protease, termed SAPB, from a newly isolated B. pumilus CBS strain. This protease was highly active and stable in a pH range of 6.0e10.6 and had an optimal activity at the pH and temperature values of 10.6 and 65
C, respectively [30]. One of its interesting properties was the excellent catalytic efficiency (kcat/Km) it exhibited, which was higher than those of subtilisin Carlsberg, subtilisin BPN' and subtilisin 309 determined under the same conditions. The molecular cloning and expression of the sapB gene in Escherichia coli were further described in a previous study by the authors where the physicoechemical and kinetic properties of the recombinant enzyme

361

were identified to be similar to those of the native one [30]. In more recent studies, the authors have managed to demonstrate the excellent laundry detergent compatibility and powerful dehairing ability in the leather and poultry processing industries [31,32]. The present study combines site-directed mutagenesis and 3D molecular modeling approaches to investigate the essential role of five amino acids with respect to the enzyme's pH and temperature behaviour as well as kinetic and biochemical parameters. 2. Materials and methods 2.1. Bacterial strains, plasmids and media E. coli DH5a [F supE44 F80 dlacZ DM15 D(lacZYA-argF) U169  endA1 recA1 hsdR17 (rkˉ, mþ k ) deoR thi-1 l gyrA96 relA1] and Top10 [Fˉ mcrA D (mrr-hsdRMS-mcrBC) F80 lacZDM15 D lacX74 recA1 araD139 D(araleu) 7697 galU galK rpsL (StrR) endA1 nupG] were used in this work as protease mutant host strains and for the purification of the recombinant proteolytic enzymes. The pGEM-T Easy (Promega) and pCR-Blunt (Invitrogen) plasmids were used as cloning vectors. The pTrc99 A vector (Amersham Biosciences), containing the inducible Ptac strong promoter, was used as expression vector. The plasmid pBJ4 containing the sapB gene [30] was used for production of the SAPB protein. pBJ7, pBJ10, pBJ13, pBJ16, pBJ19, pBJ22, pBJ25, pBJ28, pBJ31, pBJ34, pBJ37 and pBJ40 (this study) are the recombinant plasmids carrying the mutated sapB genes (Table 1). The alkaline protease-producing recombinant strains were isolated using a medium that was previously described [32], supplemented, when necessary, with ampicillin (100 mg/ml) and isopropyl-thio-b-D-galactopyranoside (IPTG) (160 mg/ml). The culture of the different E. coli strains harbouring wild-type and mutated genes was conducted in Luria-broth supplemented with ampicillin (100 mg/ml) and IPTG (160 mg/ml). The media were autoclaved at 120
C for 20 min. 2.2. DNA manipulation and PCR The preparation of plasmid DNA, digestion with restriction endonucleases, and separation of fragments by agarose gel electrophoresis were performed as described by Sambrook et al. [33]. PCRs were done using an Applied Biosystems 2700 thermal cycler. The amplification reaction mixtures (100 ml) contained Pfu (Appligene) amplification buffer, 10 mM (NH4)2SO4, 10 pmol of each primer, 300 ng of DNA template, and 2 units of Pfu polymerase. The cycling parameters were 94
C for 3 min followed by 35 cycles at 94
C for 30 s, 54
C for 60 s, and 72
C for 120 s.

Table 1 Nucleotide sequences of primers used for site-directed mutagenesis and generated recombinant plasmids. Directed mutation F159T G182S F159T/G182S F159S F159S/G182S L31I T33S N99Y L31I/T33S L31I/N99Y T33S/N99Y L31I/T33S/N99Y a b c d

Primer sequencea GAAATTCAGGTTCAACTGGCTCTACTAGC GCCAATGTAAACAGTAACAATGTCAGAAAC GCCAATGTAAACAGTAACAATGTCAGAAAC GAAATTCAGGTTCATCTGGCTCTACTAGC GCCAATGTAAACAGTAACAATGTCAGAAAC CAAAGTAGCTGTCATTGATACTGGAATCCACGC GTAGCTGTCCTTGATTCTGGAATCCACGCTGCACACCC GTATTAGACCGTTATGGCGACGGACAATACAGC GTAGCTGTCCTTGATTCTGGAATCCACGCTGCACACCC GTATTAGACCGTTATGGCGACGGACAATACAGC GTATTAGACCGTTATGGCGACGGACAATACAGC GTATTAGACCGTTATGGCGACGGACAATACAGC

Plasmid b

pBJ5 pBJ8b pBJ11b pBJ14b pBJ17b pBJ20c pBJ23c pBJ26c pBJ29c pBJ32c pBJ35c pBJ38c

Nucleotide sequences corresponding to the mutated amino acids are underlined and in bold. Recombinant plasmids carrying the mutated sapB gene cloned in pGEM-T Easy vector. Recombinant plasmids carrying the mutated sapB gene cloned in pCR-Blunt vector. Recombinant plasmids carrying the mutated sapB gene cloned in pGEM-T Easy vector or in pCR-Blunt vector and then overexpressed in pTrc99 A vector.

Plasmidd pBJ7 pBJ10 pBJ13 pBJ16 pBJ19 pBJ22 pBJ25 pBJ28 pBJ31 pBJ34 pBJ37 pBJ40

362

B. Jaouadi et al. / Biochimie 92 (2010) 360e369

2.3. Construction of the mutant plasmids, expression and purification The sapB gene encoding the wild-type SAPB was previously cloned and overexpressed in E. coli DH5a [30], while the sapB mutated genes encoding the mutant SAPB were constructed by PCR mutagenesis, using a series of mutagenic primers. Accordingly, two nonmutagenic external primers, F-JB110 [50 -CCGGAATTC AGGGAAAAAGGGATGTGGAATG-30 , EcoRI site (underlined)] and RJB12 [50 -GGGAAGCTTCGAAAAAATGGAAAAGGCAG-30 , HindIII site (underlined)], and two complementary internal primers containing the desired mutation, were designed (Table 1). SAPB single mutant enzymes were generated using the sapB wild-type coding sequence in plasmid pBJ4 as template. SAPB double and triple mutant enzymes were generated using the appropriate plasmid containing the simple or double mutation as template, respectively. For each single or combined mutation, two separate PCRs were performed using pBJ4 or the first mutated plasmid, respectively, as template with the corresponding primers for each reaction. The resulting two PCR fragments were extracted separately and, then, a third amplification was carried out with a mixture containing these fragments in the presence of the external primers. The PCR products (1.2 kb) were purified using the gel band purification kit with a GFXÔ column (Amersham Biosciences). The fragments that were obtained were then ligated into the EcoRI/HindIII-linearised and dephosphorylated pGEM-T Easy or pCR-Blunt cloning vectors using E. coli DH5a or Top10 host strains, respectively. The resulting recombinant plasmids are listed in Table 1. Furthermore, all mutated genes were transferred as 1260-bp EcoRI/HindIII fragments into the pTrc99 A expressing vector previously linearized by the same restriction enzymes, giving plasmids: pBJ7-F159T, pBJ10G182S, pBJ13-F159T/G182S, pBJ16-F159S, pBJ19-F159S/G182S, pBJ22-L31I, pBJ25-T33S, pBJ28-N99Y, pBJ31-L31I/T33S, pBJ34-L31I/ N99Y, pBJ37-T33S/N99Y and pBJ40-L31I/T33S/N99Y. All the mutants were isolated on the Luria-broth-skimmed milk plates, based on the detection of cleared zones (halo-forming activity) appearing around E. coli DH5a transforming colonies. The subsequent analysis of the recombinant clones with protease activity led to the identification of the recombinant plasmids (Table 1). The presence of mutations as well as the absence of unwanted substitutions were confirmed by DNA sequencing using an automated DNA sequencer ABI PrismÒ 3100-Avant Genetic Analyser from Applied Biosystems (California, USA) using the Big-Dye terminator cycle sequencing kit as recommended by the manufacturer (Amersham Pharmacia Biotech). The E. coli strain DH5a cells containing the pBJ4 or the recombinant plasmids were cultivated with agitation (250 rpm) at 37
C in Luria-broth containing ampicillin (100 mg/ml) to an optical density of 0.6e0.8 at 600 nm. The culture was then adjusted to 0.4 mM IPTG and the incubation continued at 37
C for 8 h. At the end of the culture, the protease crude extracts were prepared from the periplasmic fraction then purified to homogeneity as previously described [30].

2.4. Protein quantification, electrophoresis and zymograms Protein concentration was determined by the Bradford method using the DC protein assay kit obtained from Bio-Rad (Hercules, USA). The purity of the samples was determined by SDS-polyacrylamide gel electrophoresis on 12% gels. 20e30 mg of protein was loaded per lane. Proteins were visualized by using Coomassie Brillant Blue staining after the electrophoretic separation. Zymogram analysis was performed as previously described [30].

2.5. Protein identification Bands of the purified wild-type SAPB and F159T mutant on SDS gels were transferred to a problott membrane and subjected to NH2-terminal sequence analysis with automated Edmann's degradation using an Applied Biosystem Model 473A gas-phase sequencer. After staining with Coomassie blue Biosafe, the extracted recombinant protein bands corresponding to the expected molecular masses were subjected to matrix assisted laser desorption ionization-time of flight analyses using a Voyager DE STR MALDITOF mass spectrometer (Applied Biosystems). 2.6. Caseinolytic activity determination The protease activity of the recombinant SAPB enzymes was assayed by a modified caseinolytic Peterson's method protocol [34] using Hammersten casein (Merck, Germany) as substrate under the optimal temperature and pH values of the respective enzymes. Unless otherwise stated, a suitably diluted enzyme solution (0.5 ml) was mixed with 2.5 ml 100 mM GlycineeNaOH buffer supplemented with 2 mM CaCl2 containing 1% (w/v) casein, and incubated for 15 min at suitable pH and temperature. The reaction was stopped by adding 2.5 ml 20% trichloro acetic acid. The mixture was left at room temperature for 30 min and the precipitated proteins (non-digested) were removed by centrifugation at 10,000  g for 20 min. After that, 0.5 ml of the clear supernatant was mixed with 2.5 ml 500 mM Na2CO3 and 0.5 ml Folin-Ciocalteu's phenol reagent, followed by incubation at room temperature for 30 min. The absorbance of the resulting supernatant was measured at 660 nm against a blank control. One unit (U) of caseinolytic activity was defined as the amount of enzyme that hydrolyzed the substrate and produced 1 mg of amino acid equivalent to tyrosine per minute under the above-mentioned conditions. Protease activity represents the mean of at least two determinations carried and for which the difference between values did not exceed 5%.

2.7. Effect of pH on protease activity and stability The optimum pH was studied over a pH range of 5.0e13.0. The pH stability was determined by incubating the purified enzymes in buffers of different pH values in the range 7.0e12.0 for 240 h at 40
C. Aliquots were withdrawn at desired time intervals and proteolytic activity was determined under standard conditions. The following buffer systems, supplemented with 2 mM CaCl2, were used at 100 mM: HEPES for pH 5.0e8.0, TriseHCl for pH 8.0e9.0, GlycineeNaOH for pH 9.0e11.0, BicarbonateeNaOH for pH 11.0e11.5, Na2HPO4eNaOH for pH 11.5e12.0, and KCleNaOH for pH 12.0e13.0.

2.8. Effect of temperature on protease activity and stability For the target proteins, the effect of temperature on protease activity was determined using casein as substrate for 15 min at a suitable pH value. The optimum temperature for protease activity was determined by measuring the reaction rate at temperature levels ranging from 30
C to 80
C under standard conditions. To determine the influence of temperature on protease stability, each purified enzyme was pre-incubated (in absence or presence of 2 mM CaCl2) in the same temperature range. Aliquots were then withdrawn at desired time intervals to test the residual activity.

B. Jaouadi et al. / Biochimie 92 (2010) 360e369

363

Fig. 1. Structure-based multiple sequence alignment of SAPB with other subtilisins. Residues invariable among sequences are typed in white on a red background, residues conserved within each group are typed in red on a yellow background, and catalytic triad residues (Asp32, His64 and Ser221) are shown in green. The residues mutated within these studies (Leu31, Thr33, Asn99, Phe159 and Gly182) are indicated in light blue. Secondary structure elements from known subtilisin 3D-structures are indicated at the top of the alignment with subtilisin E (PDB-code: 1SCJ), BPPA-BACPU, B. pumilus MS-1 (accession number BAE79641); APRP-BACPU, B. pumilus TYO-67 (accession number BAA93474); DHAPBACPU, B. pumilus UN-31-C-42 (accession number AAR19220); OSTP-BACPU, B. pumilus (accession number AAU88064); SUBT-BACPU, B. pumilus (accession number P07518, PDBcode: 1MME); SUBT-BACME, B. mesentericus (accession number 1203267A); SLSP-BACIN, B. intermedius (accession number AAX14553); SUBT-BACSP, Bacillus sp. DJ-4 (accession number AAT45900); SUBT-BACSU, B. subtilis (accession number P04189, PDB-code: 1SBI); SUBT-BACAM, B. amyloliquefaciens (accession number P00782, PDB-code: 1SBT); SUBTBACLI, B. licheniformis (accession number P00780, PDB-code: 2SEC). TTT and TT letters represent strict alpha and beta turns, respectively. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

2.9. Kinetic measurements The kinetic parameters, calculated from the initial rate activities of the purified enzymes using synthetic peptides as substrates in a concentration range of 0.25e25 mM at 50
C for 5 min in assay buffer containing 100 mM GlycineeNaOH (pH 10.0) and 2 mM CaCl2, were determined by the LineweavereBurk curves as

described in a previous work by the authors [30]. The synthetic peptides used were: N-succinyl-L-Ala-Ala-Pro-Phe-p-nitroanilide (AAPF), N-succinyl-L-Ala-Ala-Pro-Leu-p-nitroanilide (AAPL), Nsuccinyl-L-Ala-Ala-Val-Ala-p-nitroanilide (AAVA) and N-succinyl-LAla-Ala-Ala-p-nitroanilide (AAA). 1 U of protease activity was defined as the amount of enzyme that liberated 1.0 mM p-NA per minute under the experimental conditions used.

364

B. Jaouadi et al. / Biochimie 92 (2010) 360e369

2.10. Amino acid sequence analyses and homology-modeling Sequence analyses and multiple alignments were performed using the programs BLAST and CLUSTAL W [35,36] and rendering of the alignment including the superimposition of predicted secondary structures was performed with the program ESPript [37]. The automated comparative protein structure homologymodeling server, SWISS-MODEL (http://www.expasy.org/ swissmod/), was used to generate the three-dimensional model of SAPB based on the crystal structure of subtilisin E (PDB-code 1SCJ). The Deep View Swiss-PDB Viewer software from the EXPASY server (http://www.expasy.org/spdbv) and PyMOL v0.99 (http:// www.pymol.org) were used to visualize and analyse the threedimensional model. 3. Results and discussion 3.1. Design of mutations and construction of mutants A thorough comparison of the primary and secondary structures of the alkaline protease SAPB with those of previously reported homologous serine proteases was carried out (Fig. 1). The amino acid sequence of SAPB displayed a low number of differences with other bacterial alkaline proteases being 10, 9 and 8 amino acids with B. pumilus proteases BPP-A, APRP, and DHAP [38e40], respectively. These proteases had less attractive biochemical properties, compared to the higher optimal pH, temperature and catalytic efficiency of SAPB [30]. Interestingly, and if considering only the mature polypeptides, the difference in primary structure was reduced to 5 (Tyr130, Lys140, Thr159, Ser182 and Asn259), 4 (Tyr130, Thr159, Ser182 and Asn259) and 3 (Thr159, Ser182 and Asn259) amino acids with APRP, DHAP and BPP-A [38e40], respectively. Accordingly, SAPB is the unique B. pumilus protease having Phe, Gly and Asp at positions 159, 182 and 259, respectively. In fact, Phe159 was substituted with Thr159 in all B. pumilus proteases and with Ser159 for the other subtilisins, whereas, Gly182 was substituted with Ser182 in all subtilisins and Asp259 by Asn in all B. pumilus proteases. Therefore, the amino acids at positions 159 and 182 were subjected to mutagenesis experiments in SAPB by

replacing Phe159 with Thr or Ser and Gly182 with Ser, as described in Section 2, to investigate their implication on the enzyme's behaviour. In addition, the double mutants (F159T/G182S and F159S/G182S) containing these substitutions were also constructed. Though no crystal structure of SAPB exists, its three-dimensional structure is likely to be similar to that of subtilisins, namely E, BPN' and Carlsberg, due to their significant sequence identities of 68.5%, 65.7% and 64.7%, respectively. The 3D-structure of the subtilisin Epro-peptide [11] was used as template to build the model of SAPB (Fig. 2). Naturally, the overall folding of the two proteases is very similar and the root mean square deviation (RMSD) after superimposition of the Ca atoms of the two enzymes is approximately 0.5 Å. The first pair of residues, which were subjected to site-directed mutagenesis studies, was the two residues bordering the catalytic Asp32, namely Leu31 and Thr33. As can be seen from the sequence alignment (Fig. 1), leucine was substituted by an isoleucine and threonine by a serine in some of the other subtilisins. Therefore, these conserved mutations were chosen in order to probe their effect on the alkalinotolerance and the thermostability of SAPB. It is worth noting in this context that though the importance of Leu31 with regards to the specific activity has already been reported [27], there has been no study yet in the literature reporting on the implication of this residue on the enzymes' pH and temperature profile. Concerning Asn99, which is located in a turn preceding bstrand 4 in SAPB, it was chosen for mutagenesis due to its localization next to the substrate binding cleft along with its ability to perform pep interactions with the nitroanilide parts of the synthetic substrates. In addition, this amino acid was substituted by Tyr99 in some of the subtilisins as seen from the primary structure alignment (Fig. 1). Hence, Asn99 could possibly be implicated in the physicoechemical and catalytic properties of SAPB and was substituted by Tyr. In addition to all single substitutions, double(L31I/T33S, L31I/N99Y, T33S/N99Y) and triple- (L31I/T33S/N99Y) mutants were also generated and studied. 3.2. Purification and characterisation of SAPB mutants Wild-type and mutant enzymes were purified from the periplasmic fraction of a 8-h cultivation in two steps (ammonium

Fig. 2. Predicted three-dimensional structure of SAPB. Homology model generated with SWISS-MODEL based on the 3D-structure of subtilisin E (PDB-code: 1SCJ). Peptide chain is represented by a ribbon model. The catalytic triad in the active site (Asp32, His64 and Ser221) and residues (Leu31, Thr33, Asn99, Phe159 and Gly182) subjected to mutation are located as indicated herein by sticks in red and blue, respectively. The pro-peptide SAPB is indicated in yellow lemon and SAPB in shown in magenta. This figure was prepared using PyMol. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

B. Jaouadi et al. / Biochimie 92 (2010) 360e369 Table 2 Specific activities of the wild-type and mutant enzymes using casein as substrate. Enzyme

Specific activity (U/mg)a,b

WT F159T G182S F159T/G182S F159S F159S/G182S L31I T33S N99Y L31I/T33S L31I/N99Y T33S/N99Y L31I/T33 S/N99Y

25500 9500 11225 13000 15600 18320 28950 32306 35650 38500 39900 41175 46310

            

730 321 366 390 401 448 775 781 795 812 865 911 977

Relative specific activity to wild-typec 1.00 0.37 0.44 0.50 0.61 0.72 1.13 1.27 1.40 1.51 1.56 1.61 1.81

a The specific activity is defined as units (U) of activity per amount (mg) of protein. 1 U of protease activity was defined as the amount of enzyme that liberated 1 mg tyrosine per minute under the optimal temperature and pH values of the respective recombinant enzymes using casein as substrate. Proteins were estimated by Bradford method using the DC protein assay kit obtained from Bio-Rad Laboratories. b The experiments were conducted three times and standard errors are reported. c The relative activity is calculated by taking the specific activity of the wild-type as 1.00.

sulphate fractionation and gel filtration HPLC) as previously described [30]. Using casein as substrate, the specific activities of all mutants were determined and compared to that for the wild-type enzyme (Table 2). The results indicated that there were two categories of mutants, those having a specific activity lower than the wild-type (F159T, G182S, F159T/G182S, F159S and F159S/G182S) and those with a higher specific activity (L31I, T33S, N99Y, L31I/ T33S, L31I/N99Y, T33S/N99Y and L31I/T33S/N99Y). The highest specific activity of the triple mutant L31I/T33S/N99Y was found to be approximately 2-fold higher than that of the wild-type enzyme. As shown by gel filtration on HPLC and single protein band on PAGE and SDS/PAGE, these preparations were highly pure homogeneous enzymes with apparent molecular masses of 34 kDa as expected for SAPB (Fig. 3). The exact molecular masses were confirmed by MALDITOF mass spectrometry as being 34 611.27 Da for the wild-type enzyme and 34 577.11e34 652.88 Da for the mutant enzymes. The NH2-terminal sequencing of the blotted purified recombinant wild-type and F159T mutant enzymes was performed to confirm that the maturation of the recombinant enzymes in E. coli was identical to that observed for the B. pumilus CBS strain. 3.3. pH dependency of mutant enzymes The pH dependency of SAPB and the 12 mutants was determined. The results showed that F159T (Fig. 4A) and F159T/G182S

365

(Fig. 4B) mutant enzymes demonstrated a significant decrease in pH optimum to 8.0e9.0 when compared to the 9.0e10.6 range of the wild-type enzyme [30]. Furthermore, mutants G182S, F159S (Fig. 4A) and F159S/G182S (Fig. 4B) displayed similar behaviours leading to a decrease in optimum pH values to 8.5e9.5. The substitution of Phe159, which is located in a loop between bstrand 7 and b-strand 8 and surrounded by small polar residues, can be inferred to induce a significant change in the optimal pH of the enzymes. In addition, Phe159 is located on the S1 subsite (surrounding the P1 position, notation by Schechter and Berger, 1967 [41]), which was previously reported to be implicated in substrate recognition [42]. When it comes to Gly182, located in a turn proceeding b-strand 8, this feature is less significant. This particular finding can be taken to suggest that these polar uncharged substitutions could locally reduce the surface charge of the enzyme. Fig. 4 shows that while the optimum pH of N99Y slightly increased to 10.6e11.0, those of L31I (Fig. 4C) and L31I/N99Y (Fig. 4D) significantly increased to 11.0e11.5. Furthermore, for T33S (Fig. 4C), L31I/T33S, L31I/T33S/N99Y and T33S/N99Y (Fig. 4D) were observed to undergo a significant increase in optimum pH to reach 11.0e12.0 and 11.5e12.0, respectively. The latter mutant enzymes are, therefore, more efficient at alkaline pH when compared to the major currently commercialized detergent enzymes AlcalaseÔ and SavinaseÔ (Novozymes A/S) whose maximal activity is at a pH range of 8.0e9.0 and 8.0e10.0 [43], respectively. The pH stability study in buffers with pH values ranging from 7.0 to 12.0 at 40
C and after 240 h incubation showed that the L31I, T33S, N99Y, L31I/T33S, L31I/N99Y, T33S/N99Y and L31I/T33S/N99Y mutant enzymes were completely stable within a broad pH range from 9.0 to 12.0 compared to the 7.0e10.6 range of the wild-type enzyme (data not shown). Since the latter mutant enzymes meet the requirements for potential application for industrial purposes, which requires an enzyme stability in a wide pH range (9.0e11.0) [43], their strong candidacy for prospective industrial application is confirmed. 3.4. Temperature dependency of mutants It was previously reported that SAPB exhibited thermal stability and activity profiles at an optimal temperature of 60e65
C that are higher than those of the B. pumilus proteases so far described in the literature [30]. The study of the effect of temperature on the mutant enzymes indicated that, compared to that of the wild-type enzyme, mutations F159T, G182S and F159T/G182S significantly decreased the optimum temperature by 5
C and 10
C, respectively (Table 3). The decrease in optimum temperature was more pronounced with the substitutions F159S and F159S/G182S, reaching up to 45e50
C. In addition, a significant decrease in the half-life time of these SAPB mutant enzymes was observed. For example,

Fig. 3. SDS/12%-PAGE analysis of the purified wild-type and mutant proteins. (A) Lanes m1em5: F159T, G182S, F159T/G182S, F159S and F159S/G182S, respectively. (B) Lanes m6em12: L31I, T33S, N99Y, L31I/T33S, L31I/N99Y, T33S/N99Y and L31I/T33S/N99Y, respectively. Lane M, molecular mass markers (Fermentas) and lane WT, wild-type SAPB.

366

B. Jaouadi et al. / Biochimie 92 (2010) 360e369

125

B

WT F159T G182S F159S

100

Relative specific activity (%)

Relative specific activity (%)

A

75

50

25

0

4

5

6

7

8

9

10

11

125

WT F159T/G182S

100

F159S/G182S

75

50

25

0

12

4

5

6

7

8

125

D

WT L31I

Relative specific activity (%)

Relative specific activity (%)

C

T33S

100

N99Y

75

50

25

0

5

6

7

8

9

10

9

10

11

12

13

14

pH

pH

11

12

13

125

WT T33S/N99Y L31I/T33S L31I/N99Y L31IT33S/N99Y

100

75

50

25

0

14

pH

5

6

7

8

9

10

11

12

pH

Fig. 4. Effect of pH on the activity of purified SAPB wild-type and mutant enzymes: (A) WT, F159T, G182S and F159S; (B) WT, F159T/G182S and F159S/G182S; (C) WT, L31I, T33S and N99Y; and (D) WT, L31I/T33S, L31I/N99Y, T33S/N99Y and L31I/T33S/N99Y. The pH profiles were determined in different buffers by varying pH values from 5.0 to 13.0 at a suitable temperature value and the proteolytic activity was determined under the standard assay conditions. The maximum activity obtained for each enzyme, at its optimum pH, was considered as 100%. Buffer solutions used for pH activity are presented in Section 2. Each point represents the mean of three independent experiments. Vertical bars indicate standard error of the mean.

the replacement of Gly182 with a serine in the presence of 2 mM Ca2þ was observed to considerably decrease the half-life times at 50
C and 60
C from 220 to 80 min to 110 and 40 min, respectively (Table 3). These results indicated that Gly182 seemed an important determinant for SAPB thermostability. The behaviour of the five

SAPB mutant enzymes mentioned above resembled those of previously described B. pumilus proteases. In fact, the F159T mutant displayed the same optimum temperature at 55
C as protease Q from B. pumilus ATCC 202073, which has a threonine residue at this position [44]. Moreover, and as previously reported for the alkaline

Table 3 Temperature effect on wild-type and mutant enzymes. Enzyme

Optimum temperature (
C)a

Half-life time (min)b

Ca2þ

50
C

þCa2þ

Ca WT F159T G182S F159T/G182S F159S F159S/G182S L31I T33S N99Y L31I/T33S L31I/N99Y T33S/N99Y L31I/T33S/N99Y

60 55 50 50 45 45 60 60 70 60 65 65 65

65 60 55 55 50 50 65 65 75 65 70 70 70

150 100 75 85 110 90 155 141 410 153 275 287 266

2þ

60
C þCa 220 150 110 105 155 125 228 217 660 221 346 354 319

2

Ca2þ

þCa2

30 20 10 15 25 18 34 28 100 32 44 50 47

80 60 40 40 65 53 88 77 295 85 150 185 135

a Relative activities were determined at a suitable pH value using casein as substrate by measuring the reaction rate in the absence and presence of 2 mM CaCl2 at various temperature values ranging from 30
C to 80
C under the standard assay conditions. b Residual activities were measured after incubating the wild-type and mutant enzymes in the absence and presence of 2 mM CaCl2 at 50
C and 60
C and the half-life time were reported.

B. Jaouadi et al. / Biochimie 92 (2010) 360e369

protease P46 from B. pumilus DSM 5777 [45], mutants G182S and F159T/G182S were optimally active at 50
C, having the threonine and serine residues at the same position and with a rapid loss of their activity at 65
C. On the other hand, the substitutions L31I, T33S and L31I/T33S showed optimum temperature and thermostability profiles comparable to those of SAPB-WT under identical conditions (Table 3). It can be concluded that the substitutions of Leu31 and Thr33 by polar uncharged residues had no effect on the temperature dependency of the enzyme. In contrast, in the presence of 2 mM CaCl2 the substitution N99Y considerably enhanced the half-life time at 50
C and 60
C from 220 to 80 min to 660 and 295 min, respectively. Moreover, this mutation increased the

367

optimum temperature from 60 e 65
C to 70e75
C (Table 3), which concurs with that of the very heat-stable alkaline protease from Bacillus stearothermophilus F1 [46]. Also, the half-life time of this mutant protease at 60
C was 3.7 times higher than that reported for the most thermostable protease Q [44]. 3.5. Kinetic parameters determination Kinetic parameters determined from LineweavereBurk plots are given in Table 4. The findings indicate that all enzymes exhibited normal MichaeliseMenten kinetics. Using AAPF as substrate, SAPB F159T and F159T/G182S mutant enzymes displayed 10.8- and

Table 4 Kinetic parameters of purified wild-type and mutant enzymes for hydrolysis of synthetic peptide. kcat (  104 min1)

kcat/Km (  104 min1 mM1)

Relative catalytic efficiency to SAPB

4.42  1.10  2.37  1.04  1.07  1.16  104.48  56.04  721.67  113.98  146.02  124.49  120.74 

0.86 0.26 0.55 0.19 0.17 0.27 7.58 2.58 3.56 4.03 8.16 7.84 7.74

14.03 1.29 4.53 1.13 1.61 1.56 350.60 252.43 434.74 378.67 532.91 462.79 588.97

1.00 0.09 0.32 0.08 0.11 0.11 25.0 18.0 31.0 27.0 38.0 33.0 42.0

4.07  0.32 0.80  0.09 2.43  0.21 0.79  0.10 0.22  0.17 0.76  0.19 57.70  3.01 33.81  2.66 55.20  2.99 62.53  3.33 70.91  0.98 71.80  3.15 81.43  3.76

6.86 0.80 3.43 0.61 0.28 0.90 130.54 82.46 178.64 137.43 164.90 151.15 206.15

1.00 0.11 0.50 0.08 0.04 0.13 19.0 12.0 26.0 20.0 24.0 22.0 30.0

0.22 0.18 0.20 0.15 0.10 0.09 4.76 3.57 4.6 4.61 7.05 6.03 7.71

3.83 0.52 2.12 0.35 0.98 0.62 49.73 34.43 65.03 57.38 80.32 68.86 95.64

1.00 0.13 0.55 0.90 0.25 0.16 13.0 9.00 17.0 15.0 30.0 18.0 25.0

0.31 0.09 0.28 0.04 0.13 0.10 7.12 0.84 8.74 9.78 3.21 3.01 3.12

2.05 0.50 1.87 0.23 0.81 0.47 20.58 12.35 26.76 22.65 35.00 28.82 39.13

1.00 0.24 0.91 0.11 0.40 0.23 10.0 6.01 13.0 11.0 17.0 14.0 19.0

Substrate

Enzyme

Km (mM)

AAPF

SAPB F159T G182S F159T/G182S F159S F159S/G182S L31I T33S N99Y L31I/T33S L31I/N99Y T33S/N99Y L31I/T33S/N99Y

0.315 0.851 0.523 0.915 0.661 0.741 0.298 0.222 0.166 0.301 0.274 0.269 0.205

AAPL

SAPB F159T G182S F159T/G182S F159S F159S/G182S L31I T33S N99Y L31I/T33S L31I/N99Y T33S/N99Y L31I/T33S/N99Y

0.591  0.014 0.990  0.062 0.710  0.025 1.299  0.011 0.770  0.012 0.840  0.010 0.442  0.008 0.410  0.017 0.309  0.018 0.455  0.016 0.430  0.027 0.475  0.034 0.395  0.048

AAVA

SAPB F159T G182S F159T/G182S F159S F159S/G182S L31I T33S N99Y L31I/T33S L31I/N99Y T33S/N99Y L31I/T33S/N99Y

0.911 1.600 1.102 1.800 1.200 1.502 0.866 0.785 0.649 0.816 0.799 0.806 0.695

 0.030  0.015  0.022  0.045  0.065  0.046  0.067  0.033  0.048  0.053  0.025  0.072  0.013

3.49  0.84  2.34  0.64  1.18  0.94  43.07  27.03  42.21  46.83  64.18  55.50  66.47 

AAA

SAPB F159T G182S F159T/G182S F159S F159S/G182S L31I T33S N99Y L31I/T33S L31I/N99Y T33S/N99Y L31I/T33S/N99Y

1.310 1.899 1.255 2.101 1.298 1.911 0.716 0.625 0.587 0.739 0.701 0.712 0.575

 0.012  0.066  0.023  0.044  0.010  0.055  0.003  0.011  0.075  0.013  0.029  0.043  0.064

2.69  0.95  2.35  0.49  1.06  0.91  14.74  7.72  15.71  16.74  24.54  20.52  22.50 

 0.021  0.028  0.034  0.031  0.022  0.015  0.033  0.011  0.066  0.045  0.027  0.021  0.096

Assays were performed using the purified proteases in 100 mM GlycineeNaOH buffer containing 2 mM Ca2þ, 5% (v/v) dimethyl sulfoxide (DMSO), 0.1% Triton X-100 and 0.25e25 mM synthetic peptide substrates (AAPF, AAPL, AAVA and AAA) at pH 10.0. The different samples were incubated for 5 min at 50
C. Results are mean values  standard deviation from triplicate experiments. 1 U of protease activity was defined as the amount of enzyme that catalyses the transformation of 1.0 mM p-nitroanilide per min at 50
C and pH 10.0.

368

B. Jaouadi et al. / Biochimie 92 (2010) 360e369

12.3-fold decreases in catalytic efficiency (kcat/Km) as compared to the wild-type enzyme. This decrease could be strongly attributed to the ability of the aromatic Phe159 to make stacking interactions with the nitroanilide group and/or the phenylalanine of the substrate which was lacking after mutation, thus inducing this decrease in substrate affinity and catalytic efficiency illustrated in Table 4. Under similar conditions, the most considerable increase in catalytic efficiency was observed with SAPB-L31I and SAPB-N99Y mutant enzymes, which was 25-and 31-fold higher than SAPB-WT, demonstrating the essential role of Leu31 and Asn99 in the kinetic behaviour of the B. pumilus serine protease. Again, the increase in efficiency with regard to mutation N99Y can be ascribed mainly to the improved substrate affinity generated by this substitution by an aromatic residue. Besides, the catalytic efficiencies of the double mutants L31I/T33S, L31I/N99Y and T33S/N99Y and the triple mutant L31I/T33S/N99Y, displayed prominent 27-, 38-, 33- and 42fold increases, respectively. This strongly suggests a cumulative effect of polar uncharged and aromatic substitutions with a synergistic effect on the P1 position preference using synthetic peptide substrates, thus demonstrating the implication of these amino acids residues in the substrate recognition. A similar kinetic profile was observed for all mutants with AAPL, AAVA and AAA as substrates, and the order of their kcat/Km values was nearly the same as that of the wild-type i.e. AAPF > AAPL > AAVA > AAA. This remarkable increase in kcat/Km is due to the Ile31 juxtaposed to the catalytic Asp32 residue. The reverse mutation I31L that occurred in the subtilisin E exhibited the same enhancement in the specific activity and caused a prominent 2e6-fold increase in kcat/Km due to the larger kcat of the peptide substrates [27]. It can, therefore, be inferred that the substitutions of L31I and N99Y concomitantly improved the alkaline pH, thermostability, and catalytic parameters of the enzyme. 4. Conclusion Using a combined site-directed mutagenesis and 3D molecular modeling approach, the current paper presented for the first time a detailed structureefunction relationships study of the serine alkaline protease from the B. pumilus family, SAPB. The findings of this work corroborate the crucial effects of Leu31, Thr33, Asn99, Phe159 and Gly182 on the enzymatic behaviour of this family as well as the importance of the region surrounding the catalytic residue Asp32 in SAPB. They clearly demonstrate that the engineering of kinetic performances of detergent-stable enzymes is not restricted only to the amino acids of the catalytic cluster but is also intimately related to the hydrophobic environments near the active site. In addition, this work allowed the generation of seven more efficient SAPB mutant enzymes, particularly N99Y, L31I/N99Y, T33S/N99Y and L31I/T33S/N99Y. Considering their promising properties and attributes, the latter can be considered as potential strong candidates for future industrial application particularly as additives to laundry detergents to improve their cleansing power by hydrolysing protein stains. More interestingly, the findings presented in the current study could be further applied to other subtilisins in order to improve their performances. Accordingly, further studies are currently under way in our laboratories to subject wild-type SAPB and selected mutants to X-ray crystallography in order to further contribute to the current understating of the substrate affinities and thermostability of this enzyme. Acknowledgments This work was supported in part by a grant from the Tunisian government contract program CBS-LEMP/Code: RL02CBS01, the Tunisian-French program DGRS-CNRS/Code: 07/R 09-01 and the

program of the Doctoral Institute of Fundamental Sciences of the Sfax University represented by the Sfax Faculty of Science/Code: ED08FSSf01. This work is part of a Doctoral Thesis by Mr. Bassem Jaouadi. The authors would like to express their gratitude to Dr. Moez Rhimi, Dr. Michel Juy, Dr. Bassem Khemakhem and Dr. Ahmed Aloulou for their helpful discussions and suggestions. Thanks are also due to Pr. Anouar Smaoui from the Sfax Faculty of Science for constructively proofreading the present paper.

References [1]

[2] [3]

[4]

[5] [6]

[7]

[8]

[9]

[10]

[11]

[12]

[13]

[14]

[15] [16]

[17] [18] [19]

[20]

[21]

[22] [23]

[24]

N.D. Rawlings, F.R. Morton, The MEROPS batch BLAST: a tool to detect peptidases and their non-peptidase homologues in a genome. Biochimie 90 (2008) 243e259. R.J. Siezen, J.A. Leunissen, Subtilases: the superfamily of subtilisin-like serine proteases. Protein. Sci. 6 (1997) 501e523. S.C. Yadav, M.V. Jagannadham, S. Kundu, M.V. Jagannadham, A kinetically stable plant subtilase with unique peptide mass fingerprints and dimerization properties. Biophys. Chem. 139 (2008) 13e23. B. Ruan, V. London, K.E. Fisher, D.T. Gallagher, P.N. Bryan, Engineering substrate preference in subtilisin: structural and kinetic analysis of a specificity mutant. Biochemistry 47 (2008) 6628e6636. A.O. Barel, A.N. Glazer, Comparative studies of the enzymatic properties of Novo and Carlsberg subtilisins. J. Biol. Chem. 243 (1968) 1344e1348. J.A. Wells, E. Ferrari, D.J. Henner, D.A. Estell, E.Y. Chen, Cloning, sequencing, and secretion of Bacillus amyloliquefaciens subtilisin in Bacillus subtilis. Nucleic. Acids. Res. 11 (1983) 7911e7925. M.L. Stahl, E. Ferrari, Replacement of the Bacillus subtilis subtilisin structural gene with an in vitro-derived deletion mutation. J. Bacteriol. 158 (1984) 411e418. M. Jacobs, M. Eliasson, M. Uhlen, J.I. Flock, Cloning, sequencing and expression of subtilisin Carlsberg from Bacillus licheniformis. Nucleic. Acids. Res. 13 (1985) 8913e8926. C.A. McPhalen, M.N. James, Structural comparison of two serine proteinaseeprotein inhibitor complexes: eglin-c-subtilisin Carlsberg and CI2-subtilisin Novo. Biochemistry 27 (1988) 6582e6598. O. Almog, A. Gonzalez, N. Godin, M. de Leeuw, M.J. Mekel, D. Klein, S. Braun, G. Shoham, R.L. Walter, The crystal structures of the psychrophilic subtilisin S41 and the mesophilic subtilisin Sph reveal the same calcium-loaded state. Proteins 74 (2008) 489e496. S.C. Jain, U. Shinde, Y. Li, M. Inouye, H.M. Berman, The crystal structure of an autoprocessed Ser221Cys-subtilisin E-propeptide complex at 2.0 Å resolution. J. Mol. Biol. 284 (1998) 137e144. R. Bott, M. Ultsch, A. Kossiakoff, T. Graycar, B. Katz, S. Power, The threedimensional structure of Bacillus amyloliquefaciens subtilisin at 1.8 Å and an analysis of the structural consequences of peroxide inactivation. J. Biol. Chem. 263 (1988) 7895e7906. W. Bode, E. Papamokos, D. Musil, The high-resolution X-ray crystal structure of the complex formed between subtilisin Carlsberg and eglin c, an elastase inhibitor from the leech Hirudo medicinalis. Structural analysis, subtilisin structure and interface geometry. Eur. J. Biochem. 166 (1987) 673e692. C. Betzel, S. Klupsch, G. Papendorf, S. Hastrup, S. Branner, K.S. Wilson, Crystal structure of the alkaline proteinase Savinase from Bacillus lentus at 1.4 Å resolution. J. Mol. Biol. 223 (1992) 427e445. U.P. Shinde, J.J. Liu, M. Inouye, Protein memory through altered folding mediated by intramolecular chaperones. Nature 389 (1997) 520e522. X.L. Zhu, Y. Ohta, F. Jordan, M. Inouye, Pro-sequence of subtilisin can guide the refolding of denatured subtilisin in an intermolecular process. Nature 339 (1989) 483e484. T.Y. Gromova, I.V. Demidyuk, V.I. Kozlovskiy, I.P. Kuranova, S.V. Kostrov, Processing of protealysin precursor. Biochimie 91 (2009) 639e645. N. Aghajari, G. Feller, C. Gerday, R. Haser, Structural basis of alpha-amylase activation by chloride. Protein. Sci. 11 (2002) 1435e1441. N. Aghajari, F. Van Petegem, V. Villeret, J.P. Chessa, C. Gerday, R. Haser, J. Van Beeumen, Crystal structures of a psychrophilic metalloprotease reveal new insights into catalysis by cold-adapted proteases. Proteins 50 (2003) 636e647. N. Aghajari, G. Feller, C. Gerday, R. Haser, Structures of the psychrophilic Alteromonas haloplanctis alpha-amylase give insights into cold adaptation at a molecular level. Structure 6 (1998) 1503e1516. S. Davail, G. Feller, E. Narinx, C. Gerday, Cold adaptation of proteins. Purification, characterization, and sequence of the heat-labile subtilisin from the antarctic psychrophile Bacillus TA41. J. Biol. Chem. 269 (1994) 17448e17453. J.A. Wells, D.A. Estell, Subtilisin an enzyme designed to be engineered. Trends. Biochem. Sci. 13 (1988) 291e297. R.J. Siezen, W.M. de Vos, J.A. Leunissen, B.W. Dijkstra, Homology modelling and protein engineering strategy of subtilases, the family of subtilisin-like serine proteinases. Protein. Eng. 4 (1991) 719e737. P. Gros, C. Betzel, Z. Dauter, K.S. Wilson, W.G. Hol, Molecular dynamics refinement of a thermitase-eglin-c complex at 1.98 Å resolution and comparison of two crystal forms that differ in calcium content. J. Mol. Biol. 210 (1989) 347e367.

B. Jaouadi et al. / Biochimie 92 (2010) 360e369 [25]

[26] [27]

[28]

[29]

[30]

[31] [32]

[33] [34] [35]

[36]

D.A. Estell, T.P. Graycar, J.V. Miller, D.B. Powers, J.A. Wells, J.P. Burnier, P.G. Ng, Probing steric and hydrophobic effects on enzyme-substrate interactions by protein engineering. Science 233 (1986) 659e663. A.J. Russell, A.R. Fersht, Rational modification of enzyme catalysis by engineering surface charge. Nature 328 (1987) 496e500. H. Takagi, Y. Morinaga, H. Ikemura, M. Inouye, Mutant subtilisin E with enhanced protease activity obtained by site-directed mutagenesis. J. Biol. Chem. 263 (1988) 19592e19596. H. Takagi, T. Takahashi, H. Momose, M. Inouye, Y. Maeda, H. Matsuzawa, T. Ohta, Enhancement of the thermostability of subtilisin E by introduction of a disulfide bond engineered on the basis of structural comparison with a thermophilic serine protease. J. Biol. Chem. 265 (1990) 6874e6878. J.W. Jang, J.H. Ko, E.K. Kim, W.H. Jang, J.H. Kang, O.J. Yoo, Enhanced thermal stability of an alkaline protease, AprP, isolated from a Pseudomonas sp. by mutation at an autoproteolysis site, Ser-331. Biotechnol. Appl. Biochem. 34 (2001) 81e84. B. Jaouadi, S. Ellouz-Chaabouni, M. Rhimi, S. Bejar, Biochemical and molecular characterization of a detergent-stable serine alkaline protease from Bacillus pumilus CBS with high catalytic efficiency. Biochimie 90 (2008) 1291e1305. B. Jaouadi, S. Bejar, Characterization of an original serine alkaline proteinase from Bacillus pumilus CBS. J. Biotechnol. 136 (Suppl.) (2008) S305. B. Jaouadi, S. Ellouz-Chaabouni, M. Ben Ali, E. Ben Messaoud, B. Naili, A. Dhouib, S. Bejar, Excellent laundry detergent compatibility and high dehairing ability of the Bacillus pumilus CBS alkaline proteinase (SAPB). Biotechnol. Bioprocess Eng. 14 (2009) 503e512. J. Sambrook, E.F. Fritsh, T. Maniatis, Molecular Cloning: a Laboratory Manual, second ed. Cold Spring Harbor Laboratory Press, NY, USA, 1989, pp. 23e38. G.L. Peterson, A simplification of the protein assay method of Lowry et al. which is more generally applicable. Anal. Biochem. 83 (1977) 346e356. S.F. Altschul, T.L. Madden, A.A. Schaffer, J. Zhang, Z. Zhang, W. Miller, D.J. Lipman, Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic. Acids. Res. 25 (1997) 3389e3402. J.D. Thompson, D.G. Higgins, T.J. Gibson, CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence

[37]

[38]

[39]

[40]

[41] [42]

[43]

[44]

[45]

[46]

369

weighting, position-specific gap penalties and weight matrix choice. Nucleic. Acids. Res. 22 (1994) 4673e4680. P. Gouet, X. Robert, E. Courcelle, ESPript/ENDscript: extracting and rendering sequence and 3D information from atomic structures of proteins. Nucleic. Acids. Res. 31 (2003) 3320e3323. M.Y. Wan, H.Y. Wang, Y.Z. Zhang, H. Feng, Substrate specificity and thermostability of the dehairing alkaline protease from Bacillus pumilus. Appl. Biochem. Biotechnol. 159 (2009) 394e403. M. Aoyama, C. Toma, M. Yasud, M. Iwanaga, Sequence of the gene encoding an alkaline serine proteinase of Bacillus pumilus TYO-67. Microbiol. Immunol. 44 (2000) 389e393. T. Miyaji, Y. Otta, T. Nakagawa, T. Watanabe, Y. Niimura, N. Tomizuka, Purification and molecular characterization of subtilisin-like alkaline protease BPP-A from Bacillus pumilus strain MS-1. Lett. Appl. Microbiol. 42 (2006) 242e247. I. Schechter, A. Berger, On the size of the active site in proteases. I. Papain. Biochem. Biophys. Res. Commun. 27 (1967) 157e162. Z.L. Zheng, M.Q. Ye, Z.Y. Zuo, Z.G. Liu, K.C. Tai, G.L. Zou, Probing the importance of hydrogen bonds in the active site of the subtilisin nattokinase by site-directed mutagenesis and molecular dynamics simulation. Biochem. J. 395 (2006) 509e515. Q. Beg, R. Gupta, Purification and characterization of an oxidation stable, thiol-dependent serine alkaline protease from Bacillus mojavensis. Enzyme. Microb. Technol. 32 (2003) 294e304. X.Q. Han, S. Damodaran, Purification and characterization of protease Q: a Detergent- and urea-stable serine endopeptidase from Bacillus pumilus. J. Agric. Food. Chem. 46 (1998) 3596e3603. R. Vetter, D. Wilke, B. Möller, M. Lerch, I. Mücke, M. Takenberg, G. Konieczny-janda, Alkaline Proteases from Bacillus pumilus, European Patent Number EP0572992 B1. Genencor International, Inc., Palo Alto, CA, USA, 2003. R.N.Z.A. Rahman, C.N. Razak, K. Ampon, M. Basri, W.M. Zin, W. Yunus, A. B. Salleh, Purification and characterization of a heat-stable alkaline protease from Bacillus stearothermophilus F1. Appl. Microbiol. Biotechnol. 40 (1994) 822e827.