Enhancers and transcription factors in the control of gene expression

Biochimica et Biophysica Acta, 951 (1988) 17-35

17

Elsevier

BBA 91871

Review Enhancers and transcription factors in the control of gene expression Bohdan Wasylyk INSERM, U184, Laboratoire de Facult~ de Medecine, Strasbourg (France) (Received 22 August 1988)

Key words: Promoter organization; Transcriptional control; Gene expression

Contents 1.

Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

17

II.

Promoter organisation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

18

Ill. Viral enhancers - making some sense out of a pot-pourri of multiple overlapping transcription elements . . . . . . . . . . . . .

20

IV. Tissue- and development-specific control with combinations of ubiquitous and tissue-specific factors . . . . . . . . . . . . . . .

23

V.

29

A simple mechanism for communication between regulatory factors and the general transcription apparatus . . . . . . . . . .

VI. Prospects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

31

Acknowledgements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

31

References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

31

I. Introduction Gene expression in higher eukaryotes is controlled at multiple levels, including the accessibility of genes to regulatory factors in open as opposed to inactive condensed chromatin [1,2], mod-

Abbreviations: TE, transcription element; TF, transcription factor; MAR, matrix attachment region; DMS, dimethyl sulphate; LPS, lipopolysaccharide; pol. B, RNA polymerase B; Ad, Adenovirus. Correspondence: B. Wasylyk, Laboratoire de Grnetique Moleculaire des Eukaryotes du CNRS, Facult~ de Medecine, 11 rue Humann, 67085 Strasbourg Cedex, France.

ulation on accessible promoters of the rate of specific initiation of transcription [3-6] and subsequently post-transcriptionally at various steps [7-9]. In recent years, due to the development of methods for (1) the manipulation of DNA, (2) studying transcription by either reintroducing DNA into living cells and animals or in cell extracts, and (3) the purification of transcription factors and the cloning of their genes [10], we have learnt a great deal about the control of initiation of transcription. This review concerns the DNA sequence elements of RNA polymerase B p r o m o ters, the transcription factors with which they interact, and some current views on the mechanism by which transcription initiation is regulated in higher eukaryotes.

0167-4781/88/$03.50 © 1988 Elsevier Science Publishers B.V. (Biomedical Division)

!!. Promoter organisalion The sequences required for the precise and regulated initiation of transcription on m R N A coding genes in higher eukaryotes are composed of discrete elements which may be dispersed over a large region of DNA, 60000 basepairs (bp) or more upstream or downstream from the startsite of RNA transcription (see Fig. 1). The most severe positional restraints are on the 'start-site selection' sequences, which are located between about - 4 0 and + 3 0 bp relative to the start-site ( + 1) and which determine the position of RNA chain initiation. There are often closely linked ' u p s t r e a m promoter elements' located between about - 4 0 and - 200 bp, which in many cascs do not have to be close to the start-site to be active but may be there because this is the most efficient arrangement to form an active promoter [11.12]. More distally located promoter elements are called enhancer sequences in higher eukaryotes and upstream activator elements (UAS) in yeast. Enhancers and the more proximal upstream elements share many properties, and the mechanism by which they regulate transcription may be indistinguishable. Enhancers can stimulate transcription from promoters located up to 30000 bp away [13]. The absolute distance over which enhancers may act is unknown, although there may be functional do-

mains ~hich delimit their operating range in cis (see Ref. 14). However, in some situations the',' might even be able to trans-activatc between homologous chromosomes (sce Ref. 15). Enhancerlike (long range) promotcr elements are also present in prokaryotes [16 18]: however they appear to occur less frequently, presumably becausc of selection for a compact genome organization in these rapidly dividing organisms. Small a,fimal viruses, such as SV40, have a compact promoter organisation (see below) which also may result from the selection for efficient use of a minimum amount of I)NA. In contrast, the more dispersed promoter organization found in cellular genes may allow more complex patterns of interaction than would be possible with a "linear" array of promoter elements (see Ref. 19 for review). In the majority of pol. B promoters studied so far, the start-site selection region contains sequences which are highly conserved, the ' T A T A box' sequence located about 30 bp upstream from the RNA start-site and the sequence CA with A at +1 [20]. These sequences are part of the - 4 0 to + 3 0 interaction site on the D N A for general transcription factors, so called because they may be required for transcription from all RNA polymerase B promoters. These general factors perform the fine tuning which determines both the precise sites of initiation of transcription and the final efficiency of transcription. In higher

BTF2 BTF3 RNA pol B STF BTF1

IT*TAI IC"I ST, m"

_1_ - ,

SITE

/~ / II~

~

~.NHANCER

-45

I O.A,oop

k(.o-.,ooo,,,,) j

I

I

I

o,A loop

I

Fig. 1. Promoter for R N A polymerase B: hypothetical representation of promoter organization, with interacting transcription factors (TF) forming a protein-DNA complex. The start-site selection, upstream element and enhancer are parts of a promoter (see Sections 11 and Ili). They contain specific sequences (transcription elements, TEs) which interact with T F s (see Section It). There are probably both specific interactions between the T F s as well as more general types of interaction with the general transcription apparatus (see Section V). The general factors BTFI (TFIID), BTF2 ( T r i t E ) , BTF3 (TFIIB), STF ( T F i l A ) and R N A polymerase B ( R N A pol B or l i d interact with the conserved T A T A and CA elements of the start site selection region (see Section II). D N A intervening between promoter elements is shown to be looped out. This representation does not take into account m a n y observations described in the text.

19 eukaryotes there are at least four different general transcription factors in addition to RNA polymerase B. They participate in the formation of a stable preinitiation complex on the start-site selection region (see Fig. 1 and Refs. 21-23). In vitro, these factors can remain bound to the DNA for multiple rounds of initiation by RNA polymerase B [21-23]. In vivo, they may be stably bound to the DNA in an inactive state (e.g., the Drosophila hsp70 gene in the uninduced state [24]) or the protein-DNA complex may form during activation [25,26]. Some promoters, such as those for many housekeeping genes, lack discernable TATA motifs. There is some evidence that the same general transcription factors may also interact with these promoters, although with a lower affinity than consensus-TATA promoters (Ref. 27 and Tamura, T. and Egly, J.M., personal communications). However, there is also indirect evidence for the existence of different general factors which bind to different TATA-like sequences [28,29]. Regulation can be exerted directly through the start-site selection region promoter. The AdEIa and herpes simplex virus immediate early gene products directly affect the activity of general transcription factors [30-32]. In addition, in some cases, the start-site region is sufficient for fully regulated transcription, such as, for example, for herpes simplex virus late gene transcription [33]. However, in most cases, the start-site selection region requires additional sequence elements both for efficient transcription and for regulation. Upstream elements and enhancers are composed of transcription elements (TE), short sequences of about 10-20 bp, which specifically interact with transcription factors (TF). Although in general it is assumed that one factor interacts with one sequence, there is evidence that several different factors may recognise the same or very closely related sequences (hormone receptors [34]; 'CAAT-box' factors [35-40]; 'OCT' motif, see for example Ref. 41 and below), or one TF may interact with two completely different TEs (see, for example Ref. 42). Upstream elements generally have a simple organization and contain one or several TEs (see reviews, Refs. 3-5), whilst enhancers have a more complex organization with multiple TEs (see Sections III, IV, below). Many observations suggest that multiple TEs are required

to generate an element which can function efficiently at distant locations. For example, in promoter reconstruction experiments, an individual TE can be sufficient to activate transcription from a proximal promoter [43-45], whilst multiple elements (2 to 4) are generally required to generate an enhancer [46-48]. The simplest interpretation is that the combined activity of several elements may often be necessary to form an enhancer. The implication for promoter organisation is that a functional promoter cannot be composed of distantly located individual TEs, but rather requires several TEs grouped in an enhancer(s), the position of which, relative to the transcribed sequences, may be quite flexible. TFs bound to their TEs are generally thought to interact by protein-protein contacts, to form a large multiprotein-DNA complex (schematically represented in Fig. 1, see also Section V, below). This has been inferred from experiments in which it was shown that stereospecific alignment of the factors on the DNA is required to generate a fully functional promoter [11]. Two types of promoter organisation can be considered. In a linear complex, when the factors are bound next to each other along the DNA, the DNA may remain in the classical B conformation [11]. However, the DNA in a linear complex may also have a different conformation, since some transcription factors can induce bending of the DNA around their binding site [49-51]. In the second type of organisation, in which there are larger distances between the binding sites (more than 60 bp) the factors interact by looping out the intervening DNA. For short loops, stereospecific alignment can be an important constraint for efficient factor interactions. However, for larger loops (over 300 bp) [52,53] the inherent flexibility of the DNA greatly reduces the importance of stereospecific alignment. The way in which transcription is regulated from a promoter will depend upon its sequence organisation and upon the factors which are present in the cell. The number and types of TE in a promoter will determine how many and which TF interact with it. The positions of the TE relative to one another may influence the way in which these TF interact with each other, because of stereospecific constraints. The state of DNA methyl-

20

ation may affect the affinity of TFs for the DNA [54,55]. The factors themselves can be either positively or negatively acting. Finally, different TFs may interact with each other with different affinities, so that particular combinations of TFs may be more effective than others. Changes in promoter activity can occur in many ways. One possibility is that either the amount or the specific activity of each T F may vary. The specific activity of transcription factors is controlled by a variety of mechanisms such as phosphorylation, or their interaction with other factors including regulatory proteins, hormones, metal ions, etc. This complexity of control permits, using just a limited number of TFs, the precise regulation of transcription during either the viral cycle, the lifespan of a cell, or during development. Specific examples of these types of control are illustrated in the following sections.

structurally and functionally. The\' contain a large numbcr of TEs, many of which are overlapping. Some of these TEs are functionally redundant. This is particularly evident when cell extracts arc analysed, since they contain many different factors which can bind specifically to a largc numbcr of sequence elements in the SV40 enhancer. In vivo functional assays show that only some of these factors contribute significantly to enhancer activity, at least in the test systems used, although others may have an unknown role during thc viral life cycle. This section will describe the factors which interact with the SV40 enhancer, anti the different structural constraints which exist for the formation of an active cnhancer. Thc SV40 virus origin region contains, con> pacted in about 400 bp of DNA, the control sequences for initiation of early and late transcription and for DNA replication. The SV40 early promoter contains a start-site selection region with a TATA-like sequence, an upstream clement composed of six repetitions of a G-(" motif within 21 bp repeats, and an enhancer with multiple TEs (see Fig. 2). Early in infection, transcription from the early promoter produces T antigen. T antigen binds both to thc early region DNA (see I II1,

!11. Viral e n h a n c e r s - making s o m e .sense out u f a pot-pourri of multiple overlapping transcription elements

Enhancers, and in particular viral enhancers such as those from SV40, are highly complex, both

REPLICATION ORIGIN III T ANTIGEN

I

ENHANCER

II

UPSTREAM ELEMENT

I

TRANSCRIPTION ELEMENTS

EES

rcrce,hS,hP ...-..----.:

oCOCOCC, CaCGC

II

Vl V IV III II I

G:

I Ill

II I

TA

LATE REGION

I

346 (Hplll)

I

START-SITE SELECTION

OCT r-"1 or

I

I I

EARLY REGION

I

294 (Kpnl)

I

270

250 (170)

I

179 (107)

!

0/5243

I

5171 (Hlndlll)

Fig. 2. SV40 early promoter: orgamzation of the origin region of the SV40 virus. The origin regaon contains the sequences required for early transcription, including the early-early start sites (EES) and T A T A element (TA) in the start-site selection region, the GC elements in the upstream element, and various other TEs in the enhancer. The 21 bp repeats and the 72 bp sequence, which is repeated in 776 wild-type SV40, are also shown. Also shown are the T-antigen-binding sites and the replication origin.

21 Fig. 2), and to at least one transcription factor (AP2) which binds to the enhancer [56[. It inhibits early transcription and stimulates both replication and late transcription. The replication origin overlaps the start-site selection region. Some nucleotides in the replication origin are important both for transcription and for replication. For example, the TATA sequence is important for the efficiency of both transcription from the early-early RNA start-sites (EES) and for DNA replication [57,58]. Similarly, the 21 bp repeats are promoter elements for early and late transcription [59-61] and they have an auxilliary role in replication [62]. There are different factors which bind to this sequence at different times in infection. The G-C TEs (see Fig. 2) bind the transcription factor Spl, which is required for early transcription [59,60]. However, a different binding factor may be required for late transcription [63]. These sequences also bind T antigen and another unidentified factor [64]. An analogous compaction and possibly overlap of functional domains may be found in the enhancer. Our understanding of how the SV40 enhancer works results from three experimental approaches:

(1) experiments designed to regenerate active enhaneers from inactive mutated or deleted enhancers; (2) transfection assays with reporter recombinants which measure the effects of scanning point-mutagenesis across the enhancer on its activity, and (3) purification of enhancer TFs and the study of their activity in in-vitro transcription assays. An example of the first type of approach was the engineering of deleterious point mutations in different parts of the enhancer of the SV40 virus, followed by selection for viable viral revertants. The revertants contained duplications of one of three separate 'domains', A, B or C, shown in Fig. 3 [47,48,65,66]. The duplications were shown to generate active transcriptional enhancers from inactive domains [47,48]. The A, B and C elements display different cell-specific enhancer activities, suggesting that they interact with cell-specific as well as ubiquitous TFs [46-48]. The second elegant approach was to use scanning mutagenesis, in which three nucleotides at a time were mutated systematically across the enhancer, and enhancer activity was measured in

OCT MO~FS :

GT-II

GT-I

TC-II

TC-I

Sphll

Sphl

p

290 270 250 230 210 I J I I I I I CTGAGG•GGAAAGAACCAGCTGTGGAATGTGTGTCAGTTAGGGTGTGGA•AGT•CC•AGGCT•••CAG•AGGCAGAAGTATG•AAAG•ATG•ATCT•AATTAGTCAG•AACc• ~///~GT-IIC ileal

.....

........... GT-IC

TC-IIB

110 I

Sph . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 ;:::~::~.i~:~:' OCT-BIA (NFA1) OCT-B3

~ i i i i i , i i i : : : i i i i : i ~ : ~ OT-IIA GT-IC

GT-IIC

L-. ~.-. x ~.\ ~.\ %%1TC.II B iii~"~i~iiii~"'i,

GT-IIA r~\\ \\~.~\\\~

MPCl I

iiiiiiiii~:

I : ....................

TC-IIA

OCT-B2 (NFA2) OCT-B3

~ GT-IIA **************

2HELA I 3

AP4

] OCT-BIB (NFA1) -']

[

GT-IIB

XXXXXXX

AP3

XXXXXXXXXXXXXI/IIII//II/IIIIIIIII/

R A T LIVER

A

AP2 AP2

+ + + + + + + AP1

EaP20

DOMAINS 4

(CVl)

i

A

~

~

C

i,

9

B

*

Fig. 3. Transcription factors which bind to the SV40 enhancer. The description of the motifs, and the factors in part 1 are taken from Refs. 41, 67-69, 76, 84, 85. For a description of the factors in part 2 see Refs. 56, 79, 86, and in part 3 see Ref. 80. The domains A, B and C (part 4) are derived initially from studies on viable revertants of SV40 viruses with mutated enhancers [47,48].

22 transfection assays. The original analysis in human HeLa cells suggested that essentially three repeated sequence motifs, Sph-I + It, TC-I + II and GT-I + II, contribute to enhancer activity (Ref. 67, Fig. 2). Subsequent in vivo studies, coupled with in vitro experiments, have led to a detailed picture of the factors which functionally interact with the enhancer, and have revealed many unexpected aspects of enhancer organisation. Broadly speaking, the genetically defined domains overlap with the binding sites for enhancer factors. The first domain upstream from the early startsites, the B domain, contains two Sph motifs (Sphl and SphII, Fig. 3) which interact with Sph factors ( T E F - I ) and an overlapping octamer motif, which interacts with the octamer factors (Refs. 41, 68, 69; see Fig. 2). In HeLa and F9 cells, the Sph motifs determine domain activity, whilst in myeioma cells, the octamer motif is functional [68]. There are up to four distinguishable octamer binding factors, at least one is ubiquitous, whilst one or two others are B-cell-specific (see Ref. 41 and references therein). The non-lymphoid cell octamer binding factor is active in HeLa and F9 cells and is required for the activity of a number of different promoters which are active in many cell types [70--74]. However, it does not significantly contribute to SV40 enhancer activity [41]. These results show that the presence in the cell of an active T F and its cognate recognition sequence does not imply that a functional complex will be formed. The predominance of the Sph ( T E F - I ) factor activity may result either from its more efficient competition for enhancer binding, or from a better ability to interact with other enhancer factors. However it cannot be excluded that the octamer factor is active in a subpopulation of transcription complexes on the SV40 early promoter, or that it has another role in the viral cycle, e.g., in replication (see Section IV below). It is interesting to note that overlapping Sph and octamer motifs are found in several other transcription units (see, for example, Ref. 75). The second domain upstream from the early startsites, the C domain, contains two motifs. In non-lymphoid cells these motifs bind the factors G T - I C and TC-IIB (Ref. 76, see Fig. 3). The effects of mutations in the TEs for either factor

suggest that the activity of one of the factors can compensate for loss of activity of the other [68]. In addition, they suggest that in HeLa cells TC-IIB has a greater effect on enhancer activity than GT-IC. whilst the converse is truc in F9 cells [68]. Thus in contrast to the results with the Sph and octamer motifs, in this part of the enhancer the effects of competing factors are detectable. In myeloma cells, the G T - I C factor is absent, and a lymphoid-specific factor, TC-IIA, which binds to the same sequences as TC-IIB, accounts for the activity of this region [68,76]. T C - I I A is probably the same factor as NF-•B, which controls cellsspecific immunoglobulin light-chain (lg~) gene enhancer activity [77] and contributes to the activity of several other enhancers (see Section IV). TC-IIB is most likely identical to H 2 T F I (KBF1), which binds to the H-2K b promoter which is active in a wide range of cell-types [78]. In EleLa cells, NF-~B (TCII-A) activity is inducible by TPA treatment [77]. It is possible that in different conditions of cell-culture, or in different sublines of HeLa cells, this factor is induced, and that it contributes significantly, or even predominantly, to SV40 enhancer activity. Recently, a gone has been cloned which codes for the D N A binding domain of a protein which binds to the TCII recognition sequence [10]. This is a single copy gene, suggesting that T C I I - A (N F-K B) and TCII-B (H2TFI, KBFI) may be closely related. Three factors which bind to the C domain have been purified to homogeneity, two from HeLa cells (AP2, AP3 [56,791) and one from rat liver (EBP20 [80]). Surprisingly, the purified factors AP2 and AP3 may not correspond to TC-IIB and GT-IC, since they do not have the same sequence requirements for binding (see Fig. 3). In addition, it appears that AP2 does not contribute significantly to enhancer activity in HeLa cells, since mutations just outside the AP2 binding site and which only disrupt TC-IIB binding decrease enhancer activity in transfection assays (see mutations in nucleotides 244 246) [67,68]. AP2 and AP3 are active transcription factors, since the pure proteins can activate transcription in vitro [56,79] and a multimerised AP2 binding sequence is active in vivo [79]. AP2 also interacts with the Iraman metallothionein-llA, human growth hormone, human c-rove, BPV, and H-2K b promoters 179]. It

23 remains to be seen what is the precise role of AP2 and AP3 in HeLa cells. The third purified factor, EPB20, is a liver specific protein which binds to the G T motifs of the SV40, murine sarcoma and polyoma virus [80]. From its binding specificity it appears to be different from the other identified C domain binding TFs. Recent results suggest that this factor contributes to liver specific transcription of the albumin as well as the a-antitrypsin, and transthyretin promoters [81-83]. There is little sequence similarity between the different binding sites for this factor, suggesting that either the sequence features to which it binds are not readily discernable, or that a family of related proteins exists. It remains to be seen if it trans-activates the SV40 enhancer in rat liver. The third enhancer domain upstream from the early start-sites, domain A, contains the GT-II motif (Fig. 3). The functional trans-acting factor for this domain in HeLa cells appears to be GTI1C, which is also present in F9 cells but absent in myeloma cells [84]. It has recently been shown that GT-IIC is most probably the same factor as the Sph factor (now called TEF-1 [85]) showing that this factor binds specifically to two enhancer motifs of unrelated sequence. The GT-II motif overlaps with specific binding sequences for several other factors (GT-IIA, GT-IIB [84], AP4 [86]). These factors apparently have only a small effect on enhancer activity [84]. The GT-I motif in domain C and the GT-II motifs in domain A contain AAA the enhancer core motif G T G G T T T G, which is present in many promoters [87,88], yet they bind different factors. In contrast, apparently completely different sequences can bind the same factor (e.g., TEF-1). In addition, even when both a factor and its recognition sequence are present in a particular cell types, the factor may not contribute significantly to enhancer activity (AP2, octamer factor, AP1, see above). These results suggest that at the present time, extreme caution must be exercised in ascribing an in vivo function to a protein present in a cell extract which binds to even a fairly well-defined sequence motif which is functional in vivo. What is the relationship between the domains defined by genetic studies and the enhancer motifs identified by the mutagenesis and in vitro work? Domains (or proto-enhancers [89]) by definition

are inactive sequences which generate a functional element either when multimerized or associated with other domains. In contrast, only some motifs generate enhancers when they are multimerised (see Refs. 89, 90 for references), whilst others do not require multimerisation to generate an enhancer. For example, a single hormone-receptor motif is sufficient to generate an enhancer [89]. Multimerized octamer motifs generate an enhancer which is active in B lymphoid cells. In contrast, the 21 bp repeats (six G-C motifs), or multimerised GT-IIC motifs, do not generate enhancers. A G-C motif can contribute to enhancer activity in association with other motifs. For the GT-IIC motifs, either tandem duplication of the motifs, or association of GT-IIC and GT-I generates a domain. At the present time, the mechanistic requirement for the generation of a domain is not known. For TEF-1, this may result from its ability to bind cooperatively to a tandem repeat of its recognition sequences [85], in contrast to other factors which preform dimers prior to binding. In contrast, cooperative DNA-binding of the corresponding factors is not observed with associated GT-I and GT-IIC motifs [85] suggesting that other mechanisms operate in this case. How does the domain structure of the SV40 enhancer contribute to the evolution of the virus? The minimum SV40 enhancer is duplicated in wild-type virus, either as a 72 bp repeat in the 776 strain, or as various other repeats ranging from 64 to 93 bp in length in other isolates [91-94]. However, tandem duplication is not essential for SV40 virus viability [95] and serves only to double enhancer strength [67]. It seems likely that the redundancy resulting from duplication extends the viral host range by increasing the number of celltypes in which a minimum number of functional domains are present which are sufficient to generate an active enhancer. Redundancy may also help in the evolution of efficient enhancers, because there are spare domains which can change without compromising the viability of the virus.

IV. Tissue- and development-specific control with combinations of ubiquitous and tissue-specific factors Tissue-specific gene expression is in part regulated at the transcriptional level. The immuno-

24 globulin heavy (IgH) and light (lg~) chain gene (IgH) promoters (upstream elements and enhancer), whose expression is restricted to the Blymphoid cell lineage, are particularly interesting examples because they have been analyzed in detail. The promoter sequences which interact with proteins in vivo and in vitro have been mapped by genomic footprinting and by analyses using cell extracts, respectively. The effects of mutations on promoter activity have been analyzed by transfeetion assays. The surprising finding for the lgH enhancer is that many cell types contain TFs which can activate it. Negative factors in nonspecific cells (i.e., cells which do not express immunoglobulin genes) appear to repress the activity of these 'nonspecific' factors. In specific Blymphoid cells, there are several different tissuespecific factors which increase the activity of the enhancer. In the case of the lgx light chain promoter, one 'key' positive factor has been proposed to account for induction of gent transcription during differentiation of pre-B cells. Several models will be discussed to explain how a key factor, combined with several nonspccific factors, generates a specific promoter.

PROMOTER

-iOOu;.,'OCT[]

ENHANCER

_ V DJ

I

TA[] i ~ + I

The Ig genes in B-lymphocytcs are assembled from muhiplc germ-line segments. For the lgH genes, a variable (V) gene segment is joined to one of the diversity (D) and joining (J) segments, and to a C~ constant segment (Fig. 4). Later in development during class switching, ('p, is replaced by other constant (C) regions by rearrangements between switch (S) regions. The intron between .I and S is normally not deleted during these rearrangements. It contains the lgH enhancer, which is specifically active in B-lymphoid cells. [.Jpstream from each V gene segment lies a tissuespecific promoter element. The proteins which interact with the mouse IgH enhancer in vivo have been identified by genomic footprinting [96,97]. From the pattern of sensitivity of () residues to DMS methylation it was suggested that there is a specific factor which is present only on the B lymphocyte and which interacts with four similar E motifs (El-4. Fig. 5; the filled and open circles represent enhanced or protected G residues, respectively). Subsequent studies, using in vitro extracts, have shown that there arc at least four different factors which interact with the enhancer. The factors NF-/tE1

S

1

'lr

i

INI

]~Nx\\\\\NNN\\\\\\\\x~---{

........

Xb,al EcoRI Xbal ............... -,el-el.,,e.,=1

Xbal

IN2

Pstl

""'"-.. "'": 992

EcoRI

Xbal

IgH e n h a n c e r +--

5' MAR

•

3'MAR

-4

,)

~) •

Am

MAR sequence hornologtes in vitro ~otem I~nding sites universally i~otected G

D,m

Ee

x ~ Fig. 4. Representation of the mouse i m m u n o g l o b u l i n

~

~

~

topo II consensus

~

soecific inhibitor s

heavy chain gene. The upstream p r o m o t e r d e m e n t and the enhancer are shown.

as well as the variable (V) and constant (C) regions, and the diversity (D). joining (J) and switch (S) regions involved in rearrangement. The upstream promoter element contains a T A T A (TA) and an octamer (OCT) motif, as well as two other motifs which are not illustrated (see Section IV). The enhancer is contained on a 1000 bp X b a l fragment, which also has matrix attachment regions ( M A R s [134]), topoisomerase II and M A R consensus sequences [134], tissue-specific inhibitory sequences [1301, as well as sites outside the enhancer which specifically bind proteins, as shown by both in vitro binding studies [102] and in vivo footprinting [96.97]. The shaded part of the enhancer indicates the region which activates transcription in nonspecific cells.

25 345 I

o

oo

o

o

o

o

o

400 o,

o

o o.

GAGT C~AGAT GG~CGATCAGAACCAGAACAC CTGCA~CAGCTGGC~GGAAGCAG G~CATGTG GC l CTCAqTTCTAC C ~GoCTAGTCTTGG TCTTGTGGACGTC~T C GACCG~CCT TCGTC C~GTACAC CG ] E1

E2

NF-pEI¢

~

NF-~E2~

E3

= NF-~E3¢ LN1+20LC191

,~

IgPE-14 ~l'S oo

•

~1'C1

[

451 I

o

AAGGCTATTTGGGGAAGGGAAAA~AAAAC CAC~AG GTAAAC TTGTAGCT~T GGT TT G~AGAA TTCCGATAAACCCCTTCCCTTTT~TTTTGGT~ATCCATTTGAACATCG~CACCAAAC~TCTT O C1

~ LNI+2,LC1

C2

~IgPE-1

E 501

o I o GTGGTTT~A~M~CACTCTGTCCAGCCCCACC~ACCGA~GTCCAGGCTGAGCA~.AC

CACCAAA~CTTTGTGAGACAGGTCGGGGTGGTTTGGCTTTCAGGTCCGACTCGTTTTG O C3 LN4,LC2 ~ IgPE-2

o

o

•

551

590

I

I

AC CAC CTG~GTA~TTTGCAT~TC TAAAATAAGTTGAGGATTCAG CC GAAAC TG GAGAGGTC C GGTGGAC~CAT~AAACGTA~AGATTTTATTCAACTCCTAAGTCGGCTTTGACCTCTCCAGG oo oo E4

OC

,11

~- NFA

,11

~ LN5,LC3 ,11

~ IgPE-3

~8 Fig. 5. Sequence and specific protein binding sites on the immunoglohulin heavy chain enhancer. The sequence of the 345-590 nt fragment of the lgH enhancer is shown. The results from in vivo footprinting experiments are shown above and below the sequence [96,97]. Gs with enhanced or diminished reactivity towards dimethyl sulfate modification are shown by filled or open circles, respectively. Sequence motifs (El-E4, C1-3 and OC) are described in the text (Section IV). Sequences which are specifically recognized by proteins present in in vitro extracts are also shown (NF-#E1-3, NFA: see Ref. 98; LN1-5, LC1-3: Ref. 100; IgPE-1-3: Ref. 101: B, C1-3, 8: Ref. 102). The labelled and unlabelled brackets are exonuclease III stops described in Ref. 102, whilst the double-headed arrows represent the extent of protection against DNAase I digestion.

(#EBP-B), NF-/tE2 (C1) and NF-~E3 (C2) interact with the motifs El-3, respectively [98,99], whilst a fourth factor, NFA or OCT-B, interacts with the octamer (OCT) motif [41]. In contrast, a distinct E4 binding factor has not be identified in cell extracts at the present time. There is also evidence for proteins binding to several other sites, including a region between E3 and a 'core-like' motif C1 (see LN1 + 2, LC1 [100]; IgPE-1; C3 [101], Fig. 5), to sequences around nucleotide 500 (LN4, LC2 [100]; IgPE-2 [101], Fig. 5) as well as outside the 340-560 sequences [99,102] normally associated with enhancer activity (see A, E, D and universally protected G, Fig. 4). Non-lymphoid cell extracts contain proteins binding to all the enhancer

motifs [99-101]. The most clearly identified differences between specific and nonspecific cell extracts is for the octamer binding factors. B-cellspecific and ubiquitous octamer factors have been identified (see below). The IgH enhancer is specifically active in Blymphoid cells. Surprisingly, it was found that a central subfragment of the IgH enhancer is active in many non-lymphoid cells, whilst flanking sequences are tissue-specific (see unshaded part of enhancer in Fig. 4 [103-105]). Several approaches have been used to study the contribution of factors which bind to these fragments to enhancer activity. In one approach, the effects of specific mutations in the enhancer motifs on enhancer

26 activity were measured in transfection assays. Enhancer activity in B-lymphocytes is decreased by mutations in El, E2, E3, CI, C2, C3 and OCT, and in some cases in E4 [98,106-109]. In addition to the sequences inside the classical enhancer, other sequences outside the enhancer have also been studied. Site E, but not sites A and D (Fig. 4). contributes to enhancer activity' [108]. In contrast, in non-lymphoid cells, mutations in E2, E3 and C2 decrease enhancer activity [98,107,109]. These results, taken together with the data from cell extracts, show that some of the factors which interact with the IgH enhancer are active in many cell types. They' also suggest that more than one positive factor contributes to the cell-type specificity of the IgH enhancer. An alternative approach has been to purify proteins which, when injected into fibroblasts, stimulate expression of a rearranged human IgH gene previously introduced into their genome. The B-cell-specific factor isolated by this technique bind to sequences in the human lgH enhancer equivalent to the region between E3 and CI in the mouse enhancer [110]. Experiments with cell extracts also support the idea that this factor is B-cell-specific [100,111]. The IgH upstream promoter contains an octamer motif, as well as two other sequences (called the heptamer- and pyrimidine-rich sequences, respectively) which are highly conserved in many heavy chain promoters [112]. The octamcr motif is sufficient in itself to confer cell-specific activity [106]. The role of the other sequences in determining cell-specificity is not known at present (see Refs. 113, 114). The octamer motif appears to be particularly important for establishing tissue specific transcription of the IgH gene; since it is present in two promoter elements, and mutation of this motif has a dramatic effect on enhancer activity [109]. A functional octamer motif has been identified in a number of promoters that are active in a wide range of cell-types (e.g., the UI, U2 and U4 s n R N A genes, the human histone H2B gene, the herpes simplex virus thymidine kinase gene, all of which are transcribed by RNA polymerase B, and the U6 and 7SK genes which are transcribed by R N A polymerase C, see Refs. 70-74 and 41 for references). Two octamer-binding proteins have been purified, N F - A I and NF-A2. NF-A1 is found

in extracts from all cell types, whilst NF-A2 ix detected only in B cell extracts. Ahhough they have indistinguishable r)NA binding characteristics [41,115J. they have different molecular weights (NF-AI ( O T F - I . OBP100), --90000 [116-11~]; NF-A2 (()TF-2). ~ 61 000 [119]) and are encoded bv distinct genes, one of which is transcribed in a B-cell-specific fashion [120]. The interesting question is why does the ubiquitous octamer factor not stimulate Ig transcription in non-B cells? One possibility is that it does, but only weakly. For example, in both in vivo transfection assays, and in specific in vitro transcription assa~.s, there is a low level of (.)CTA-dependent transcription from Ig promoters in non-B cells (Refs. 44, 121, 122: our unpublished results). A simple explanation is that there is more octamer-factor-derived activity in B cells than in non-B cells. In addition, the context of other factors on other promoters may determine how efficiently the octamer factor stimulates transcription. These factors may help the ubiquitous NF-A1 factor to function efficiently in non-lymphoid cells. Apparently, the lymphoid-specific factor does not require additional elements upstream of the T A T A box to act as a B-cell-specific promoter [44,121], suggesting that it does not require additional factors to activate transcription efficiently. It is clear that much remains to be leanat about how the octamer factors accomplish their different roles and, in addition, to explain how NF-A1 functions in processes as diverse as transcription bv RNA polymerase (" [123.124]. the cell-cycle regulation of transcription [125]. D N A replication [126]. as well as being a target for virion trans-activation [127,128]. There is considerable evidence for negative regulation of IgH enhancer activity in non-lymphoid cells. (1) In hybrids between myeloma cells and either fibroblasts or T cells, IgH and lg~ gene transcription is inhibited and IgH enhancer activity is decreased [129 131]. (2) In fibroblasts, transcription of an introduced rearranged lgH gene is stimulated by the protein synthesis inhibitor cycloheximide. Deletion of the enhancer lowers induction. These results suggest that a short-lived repressor(s) inhibits lgH enhancer activity in fibroblasts [132]. (3) 1,1 transfection experiments in fibroblasts the specific activity of the lgH

27 I

1KB

I

DNase I L VJ .~m

Ci,

1

1

I

I

1

J t

/

-lOOf L,

OCT []

TA", '1 m

PROMOTER

',1-"

NF-KE1 NF-KE2 "-.

Alu I ,'"

NF-dB ENHANCER

475

NF-dE3", Alu I v

NF-xB:5'-GGGGACTTTCC- 3' NF-KEI:5'-GCCATCTGGC- 3' NF-KE2:5'-GGCAGGTGGC- 3' NF-KE 3:5'-CCATGTGGT- 3'

Fig. 6. Schematic representation of a rearranged mouse immunoglobulin x light chain gene. The upstream promoter and enhancer sequences are shown, as well as the leader (L), variable and constant regions (V and C~¢)and the joining (J) segments. DNAase I indicates the location of the hypersensitivesite induced during differentiationfrom preB to B cells. The upstream promoter contains TATA (TA) and octarner(OCT) motifs, and the enhancer the NF-xB and NF-KE1-3motifs [98].

enhancer can be increased by either adding an excess of competitor IgH enhancer, or by increasing the quantity of DNA transfected [103,104,130]. (4) In vitro extracts contain factors which inhibit both transcription activation by the IgH enhancer [100,133] and transcription f a c t o r - D N A interactions [41]. These results suggest that repressors interact with sequences in the IgH enhancer (see central inhibitor, Fig. 4). However there is some evidence for additional fibroblast-specific inhibitors which are located on both sides of the enhancer (IN1, IN2, Fig. 4 [130]), in matrix attachment regions (5' and 3' MARs, Fig. 4 [134]), suggesting that matrix attachment may be involved in determining the tissue specificity of the IgH enhancer. Taken together, these results strongly suggest that IgH enhancer activity is negatively regulated in non-B cells. It appears that positive cell-type-specific factors lead to high enhancer activity in myeloma cells, and that negative control leads to a complete shut down of a relatively lower level of activity in nonspecific cells. Control of tissue specificity by a combination of negative regulation in nonspecific tissues and positive regulation in specific cells is also found in

other cases (see Refs. 135-139). What advantage might the presence of inhibitors in all but the specific cells confer to an organism? Genes which have evolved in differentiated multicellular organisms can be expected to have been expressed at first in all cells, with the help of ubiquitous factors. Acquiring negative tissue specific control would be a simple process for achieving tissuespecific expression in one step. Perhaps, the interaction of tissue-specific enhancers with nonspecific factors may be a relic of an early ubiquitous transcriptional stage. In contrast to the multifactorial control of the cell-specificity of the IgH gene, the induction of Igr gene transcription during the pre-B to B cell step in differentiation appears to depend upon one 'key' factor. The IgK gene, like the IgH gene, contains a cell-type-specific enhancer in the large intron between the variable and constant regions, and a cell-type-specific upstream promoter element (see Fig. 6). The IgK promoter upstream element contains an octamer motif, which interacts with the same factor as the IgH promoter upstream element and the IgH enhancer [41,98], and which confers cell-

28 type specificity [140]. The Ig~ enhancer contains three E-type motifs which are similar to the E motifs in the IgH enhancer (Figs. 5, 6) and a B motif which resembles the G T I - T C I I motif of the SV40 enhancer (Figs. 3, 6, Ref. 67). ('ell extracts contain distinct TFs which bind to E2 and E3 (NF-KE2, NF-~:E3) and which are similar to the factors which bind to E2 and E3, respectively, in the IgH enhancer. In pre-B cells the Ig~: upstream element is active, whereas the enhancer is silent [98]. In some pre-B cell lines, K gene transcription can be activated by inducers such as LPS or phorbol esters (TPA). Induction activates the enhancer, but not the promoter [98]. Mutations in El-3 do not impair inducibility, whereas mutations in the B motif prevent activation. NF-KE2 and NF-KE3 bind the enhancer in vitro before and after induction. In contrast, NF-~:B binding activity increases [98]. These results suggest that NF-~:B plays a causative role in differentiation. In vivo footprinting experiments on the mouse Ig~: enhancer support this conclusion. The G residues in the NF-KB binding site acquire an altered reactivity to DMS upon induction of differentiation of the pre-B cell line 70Z with LPS [141]. A similar predominant role for one factor may account for the tissue-specific transcription of a number of different genes (see Refs. 81, 82, 142, 143) and the regulation of transcription by inducers (see, for example, Refs. 55, 144-151). The dramatic effects caused by 'key" factors may result from either properties which are unique to these factors, or from synergistic interactions with other TFs. A unique property may be the ability to organise chromatin structure. In the case of the light chain gene, induction of transcription is accompanied by the formation of a DNAase-l-hypersensitive site over the enhancer (see Ref. 152). There are many other examples of transcription activation accompanied by changes in DNAase I hypersensitivity (see Ref. 153 for an example). Transcription of the M M T V promoter is induced by glucocorticoid hormones [26]. During activation the hormoneactivated receptor displaces a protein complex (probably a nucleosome) from the promoter [154]. This is accompanied by the formation of a multifactor complex on the promoter which contains other factors besides the receptor [26]. Nucleosomes often inhibit f a c t o r - D N A interactions

(see.for example, Ref. 155). The.,,e results suggest that tile ability to displace nucleosomes could be a unique property of some "lFs. Key TFs could have a dramatic role if the',' trigger synergistic interactions. Studies with D N A multimers suggest that many combinations of TFs may interact synergistically (see above and Refs. 156, 157). An attractive feature of this model is that the "key" role may be played by many different factors under different regulatory conditions. Two models can be imagined for how a key' I ' F triggers enhancer activity. Firstly, it is possible that the other factors can bind the enhancer, but cannot interact to generate an active multiprotein complex. Binding of the 'key" factor may permit interactions between D N A bound factors which lead to activation. Secondly, TFs may act independently once bound, but cooperativity with the 'key" factor is required to achieve efficient occupancy of the promoter. The second type of mechanism applies in the case of the yeast transcriptional activator, GAL4, which binds to four sites in the G A L upstream activating sequence (UAS) and stimulates transcription from the adjacent G A L l and GAl.10 genes. It was found that binding to the UAS was c(~)perative, and that the activity of a G A L UAS was roughly proportional to the number of bound G A L 4 molecules [158], showing that synergistic interactions lead to increased occupancy of the promoter. A comparable mechanism may apply to the ILK enhancer. In vivo footprinting data suggest that NF-KB and NF-KE2 bind to the enhancer only after differentiation [141]. In cell extracts, NF-KE2, but not NF-~:B. is present before differentiation [98,141], suggesting that induction of NF-~B leads to increased binding of NF-KE2 to the enhancer. Activation of a key' factor (NF-~:B) appears to be sufficient to generate an active enhancer during differentiation. However, this activation is not sufficient in itself to account for the tissue-specific activity of the lg~: enhancer. NF-~B activity is induced in a number of different cell types by various mitogens, and for example, an increase in its activity may account for increased transcription of the interleukin-2 receptor ~ gene in T cells [159]. However, even though the ubiquitous factors and NF-KB are present after induction, the lg~ enhancer is not activated in these conditions

29 [121]. The explanation may be that either the N F - r B induced in these cells is different from the NF-KB in B cells, or that other unknown factors or interactions also contribute to the tissue specific activity of the lgr enhancer.

V. A simple mechanism for communication between regulatory factors and the general tran~ription apparatus As we have seen in the preceding sections, promoters can have a complex organisation requiring interactions between many transcription factors and the common basic transcription machinery. Evidence is emmerging that there may be a general mode of interaction between transcription activators and the general transcription factors. In this section I will consider how these interactions are thought to occur. The first eukaryotic transcription factors to be isolated, and to be studied in detail, were from yeast. More recently, several transcription factors from higher eukaryotes have been purified and their genes have been cloned. From the comparisons of their sequences, and the properties of these factors, it is increasingly apparent that the basic mechanisms of transcription activation have been conserved between yeast and man. The primary structure of the large subunit of RNA polymerase B has been highly conserved from yeast to man [160,161]. There is amino-acid sequence homology in the DNA binding domains of the transcription factors GCN4 from yeast and AP1 (c-jun) from humans, and these factors bind specifically to a similar DNA sequence [162-165]. Both the general transcription factors and transcription activators have been shown to be functionally interchangeable between yeast and man. A yeast protein can functionally substitute for the mammalian TATA box binding protein (BTF1, TFIID, see Fig. 1 and Section I) for accurate initiation of transcription from a mammalian promoter in a mammalian cell extract [166,167]. In addition, in the in vitro system, a mammalian upstream transcription factor can stimulate transcription whether the human or yeast T A T A factors are used in the reaction [166]. Yeast transcription activators function in mammalian cells. GAL4, when expressed in a mammalian cell, can activate

a mammalian promoter linked to the GAL4-binding site [168,169]. Furthermore, the region of the yeast protein that is required for activation in yeast is also required in mammalian cells [169]. A minimal promoter, bearing only GAL4 binding sites and a TATA box, is activated by GAL4 expression [169], suggesting that the yeast activation domain can interact with the mammalian general transcription apparatus. Mammalian transcription activators can function in yeast cells. The human oestrogen receptor, when expressed in yeast, stimulates transcription in a hormone-dependent manner [170]. The mammalian fos oncoprotein, a transcription activator, will stimulate transcription in yeast when fused to the DNA binding domain of a yeast transcription factor (below). Multisubunit activators have conserved their mechanism of interaction. The CCAAT box binding activators are heterodimeric complexes in yeast as well as in man [171-173]. The interactions between these subunits have been conserved, since hybrid complexes composed of yeast (HAP2 or HAP3) and mammalian subunits (CP1A or CP1B) reconstitute a specific DNA-binding complex [174]. These results suggest that the mechanisms involved in transcription activation have been highly conserved between yeast and man during evolution. Transcription factors have a distinct modular design, being composed basically of autonomous domains with specific functions. The yeast transcription factors G C N 4 and GAL4 have been shown to contain DNA binding domains of less than 100 amino acids linked to separable activator domains [175-177]. The activator domains from these proteins, when fused to a heterologous DNA binding domain from the bacterial DNA binding protein, lexA, can activate transcription from promoters containing the lexA specific DNA-binding sites [176,177]. The transcription activation domains are relatively short regions of acidic nature that do not appear to have rigid sequence requirements [176,178,179]. The activation regions of G C N 4 and GAL4 have no sequence homology, the most obvious homology being their acidic nature. Different portions of an acidic region can activate transcription, suggesting functional redundancy. Furthermore, a relatively large number of random protein segments from E. coli can act

3O

as transcriptional activators when linked to the GAL4 DNA-binding domain [180]. The basic activating unit appears to be an amphipathic t~ helix, with an acidic negatively charged face and a hydrophobic face [181]. It has been proposed that several such helices, interacting through their hydrophobic regions, may be required for the formation of a functional unit [182]. The negatively charged regions may interact with other proteins, possibly directly with the general transcription factors [183]. The regions of the bacteriophage ), and 434 repressors are known from X-ray crystallographic studies to have negatively charged amphipathic a helices, which, it was argued, contact RNA polymerase [181]. However, amphipathic ~ helices cannot account for the activation properties of either an activating peptide from the E. colt encoded activating segments [180] or for one of the functional regions of GAL4 [181]. The most extensively characterized transcription factors in higher eukaryotes are the steroid hormone receptors, whose activity is dependent on the binding of specific ligands. The protein can be divided, according to sequence conservation and function, into three domains, an N terminal region required for the efficient activation of transcriplion from some promoters, a central DNA-binding domain and a C-terminal hormone-binding domain. The domains are apparently linked by flexible 'hinge' regions (for reviews see Refs. 34, 184). The D N A - b i n d i n g d o m a i n and the hormone-binding domain can function independently. The DNA-binding domains of different receptors can be functionally exchanged, resulting in chimeric receptors which activate transcription through the corresponding transcription elements (hormone responsive elements, Refs. 185-193). Linking the DNA-binding domain from the human estrogen receptor with the activating regions from GAL4 or G C N 4 results in a protein which stimulates transcription through the estrogen responsive element in human cells [169]. The DNAbinding domain is rich in basic amino acids, and contains two putative 'zinc fingers', protein structures which are thought to be involved in specific DNA recognition (for a review see Ref. 194). The C-terminal domain is indispensable for hormone binding. Hormone binding appears to have several distinct effects on the receptor. It

somehow "unmasks" the DNA-binding domain, thereby permitting specific binding to the DNA (Refs. 34. 195-198 fl~r references). It also resulls in nuclear localization of the receptor, and it induces transcriptional activation. There are several regions which are important for transcriptional activation. Truncated receptors lacking both the hormone-binding domain and the N-terminal domain retain some ability to activate transcription, suggesting that there is a constitutive activation domain in or near the DNA-binding domain (see Refs. 34, 195 198). Fhe hormone-binding domain also has transcription-activating properties. since this domain linked to a heterologous I)NAbinding domain, functions in hormone inducible transcription activation [197]. Lastly. the N terminal domain is also required for transcription activation in some cases [186,189--191]. Several other mammalian transcription factor genes have been cloned recently, and their structure and function have been analyzed. The human AP1 (mouse PEA1) TF is closely related to the oncogene v-/un, and its activity is regulated by serum components, tumor promoters, and the expression of a large number of different ontogenes [162-165,199,200]. The oncogene has been divided into two functional domains, an N-terminal domain which activates transcription, and a C-terminal domain required for DNA binding. The activation domain contains two short acidic regions required for transcription activation in yeast [201]. v-jun is inactive when expressed in some mammalian cells, and serum components can increase its activity [202]. It remains to be seen both how its activity is regulated in higher eukaryotes and how the acidic regions are involved in lhis process. The (_'-terminal domain does not contain features required for the formation of zinc fingers or helix-turn-helix motifs [203], suggesting that this domain may adopt another unknown conformation which specifically interacts with DNA. Another transcription factor whose gene has been cloned recently is Spl. This transcription factor has been shown to contain two domains, one of which is required only for DNA binding [204]. The sequences required for activation remain to be identified. Some transcription regulators do not bind di-

31 rectly to DNA. Recent results suggest that they may interact with promoters through p r o t e i n - p r o tein interactions with other transcription factors. A number of oncogenes are localized in the nucleus and regulate transcription, but apparently they do not bind specifically to D N A (e.g., fos, myc, EIA, VP16). Some recent results with fos and VP16 trans-activators will be considered. The v-los (or v-myc) oncogene can activate transcription in yeast when fused to the D N A binding domain of the bacterial repressor lexA [205], suggesting that it has transcription activation domains which may be functional in higher eukaryotes. Fos binds to the AP1 D N A recognition sequence probably through protein-protein interactions with AP1 [206,207]. Finally, expression of los in mammalian cells activates transcription through the APl-binding site [200]. These results suggest that AP1 provides the D N A binding function for los. It remains to be seen whether other transcription factors associate with fos, and how these interactions are governed. VP16 is a trans-activator from the herpes simplex virus, which stimulates viral immediate early gene transcription. VP16 appears to have two domains, an N-terminal domain which may be involved in protein-protein contacts, and a C-terminal domain with acidic regions which may be involved in transcription activation [208]. VP16 forms ternary complexes with immediate early gene transcription elements and specific D N A binding proteins [209,210]. These results suggest that trans-acting factors which do not directly bind to D N A may achieve promoter specificity via protein-protein interactions with other transcription factors, whereas transcription activation may be directed by an evolutionary conserved acidic domain, which interacts with the general transcription apparatus. Some factors have been found to contain a structural feature, called a 'leucine zipper', which is thought to be involved in the interactions between transcription factors [211]. The leucine zipper is composed of a periodic repetition of leucine residues every seventh amino acid, so that if these amino acids are placed on an a helix, the leucine side-chains project out of one face of the helix. The leucine side-chains are proposed to penetrate and interdigitate, like the heads of the

teeth of a zip. The presence of such structures in the los and AP1 (jun) proteins suggests a way in which these two proteins may interact. VI. Prospects Despite the considerable progress in recent years much remains to be learnt. The current techniques will lead to the identification, purification and cloning of the genes for many transcription factors. They will allow us to study the interactions which lead to the control of transcription in many different situations during the life of an organism. However, the most exciting prospects are the ones that we just cannot imagine.

Acknowledgements I am extremely grateful to J. Richards and J.L. Imler for critically reading the manuscript, the other members of the laboratory for providing a stimulating scientific environment, the secretarial staff for typing, C. Werl6 and F. Hugonot for preparing the figures, A. Landmann for photographs, and the CNRS, I N S E R M and A R C for financial assistance.

References 1 Gross, D.S. and Garrard, W.T. (1987) Trends Biochem. Sci. 12, 293-297. 2 Gasser, S.M. and Laemmli, U.K. (1987) Trends Genet. 3, 16-22. 3 Jones, N.C., Rigby, P.W.J. and Ziff, E.B. (1988) Genes Devel. 2, 267-281. 4 Hatzopoulos, A.K., Schlokat, U. and Gruss. P. (1988) in Frontiers in Transcription and Splicing, IRL press, in press. 5 Wasylyk, B, (1988) CRC Crit. Rev. Biochem. 23.77-120. 6 Struhl, K. (1987) Cell 49, 295-297. 7 Brawerman, G. (1987) Cell 45, 5-6. 8 Fink, G.R. (1986) Cell 45, 155-156. 9 Kozak, M. (1987) Nucleic Acids Res. 15, 8125-8148. 10 Singh, H., LeBowitz, J.H., Baldwin, A.S., Jr. and Sharp, P.A. (1988) Cell 52, 415-423. 11 Takahashi, K., Vigneron, M., Matthes, H., Wildeman, A., Zenke, M. and Chambon, P. (1986) Nature 319, 121-126. 12 Wasylyk, B., Wasylyk,C. and Chambon, P. (1984) Nucleic Acids Res. 12, 5589-5608. 13 Kripenfort, P., De Jong, R., Uematsu, Y., Dembic, Z., Ryser, S., von Boehmer, H., Steinmetz, M. and Berns, A. (1988) EMBO J. 7, 745-750.

32 14 Grosveld. F., Van Assendelft. G.B.. Greavcs, I).R. and Kollias, G. (19871 Cell 51,975-985. 15 Judd. B.H. (19881 Cell 53, 841 ..843. 16 Ninta, A.J.. Reitzer, L.J. and Magasanik. B. (1987) ('ell 50. 1039-1(146. 17 Kr~.mer, H., NiemCfller. M.. Amouyal, M.. Revet, B., Von Wilcken-Bergmann, B. and Mialler-Hill. B. (1987) EMB() J. 6, 1481- 1491. 18 Dandanell. G., Valentin-llansen, P., Larsen, J.E.I,. and Hammer, K. (19871 Nature 325. 823-826. 19 Schleif, R. (19881 Science 270. 127-128. 2{1 Bucher, P. and Trifonov, E.N. (19861 Nucleic Acids Res. 14, 10009-10(126. 21 Reinberg, D. and Roeder, R.{}. (1987) J. Biol. Chem. 262. 3310-3321. 22 Reinberg, D., ttorikoshi. M. and Roeder. R.(}. (19871 J. Biol. {'hem. 262, 3322-3330. 23 Zheng, X.-M., Moncollin, V.. Egly, J.M. and {'hambon, P. (19871 Cell 50, 361-368. 24 Wu, {'. 11984) Nature 3{}9. 229-235. 25 Selleck. S.B. and Majors. J.E. (19871 Mol. Cell. Biol. 7. 3260 3267. 26 Cordingley, M.G., Riegel, A.T. and Hager, {i.L. (1987) ('ell 48. 261-270. 27 Boeuf. H.. Zajchowski, D.A., Tamura, T.. ltauss, C. and K6dinger, C. (1987) Nucleic Acids Res. 15, 509-527. 28 Simon, M.C., Fisch. T.M., Benecke, B.J., Nevins. J.R. and lteintz, N. (1988) Cell 52, 723 729. 29 ('hen, W. and Struhl, K. (19881 Proc. Natl. Acad. Sci. USA 85. 2691-2695. 30 Wu, L., Rosser. D.S.E.. Schmidt, M.C. and Berk. A. (1987) Nature 326. 512--515. 31 ('oen, D.M., Weinheimer. S.P. and McKnight, S.L. (19861 Science 234, 53-59. 32 Abmayr. S.M., Workman. J L . and Roeder. R.G. (19881 Genes Devel. 2, 542-553. 33 Homa, F.L., Glorioso, J.C. and I,evine, M. (1988) Genes Devel. 2, 40-53. 34 Evans, R.M. (19881 Science 240, 889-895. 35 Oikarinen, J., Hatamochi, A. and De Crombrugghe. B. (19871 J. Biol. Chem. 262, 11064-11070. 36 Dorn. A.. Bollekens. J., Staub. A., Benoist, C. and Mathis. I). (19871 Cell 50, 863-872. 37 Goding. C . R . Temperley, S.M. and Fisher. F. (1987) Nucleic Acids Res. 15, 7761-7780. 38 Jones, K.A., Kadonaga, J.T., Rosenfeld. P.J.. Kelly. l . J . and Tjian, R. (1987) Cell 48, 79-89. 39 ('/raves. B.J.. Johnson, P.F. and McKnight. S.L. (19861 (_'ell 44, 565-576. 40 Miksicek, R., Borgmeyer, U. and Now~x:k, J. (19871 EMBO J. 6. 1355-1360. 41 Rosales, R.. Vigneron, M., Macchi, M., Davidson, Xiao. J.H. and Chambon, P. (1987) EMBO J. 6, 3015-3025. 42 Pfeifer, K., Prezant, T. and Guarente, L. (19871 Cell 49. 19-27. 43 Klt~k, G., Strfihle, U. and SchLitz, G. (19871 Nature 329, 734-736.

44 I)reyfu~,. M.. l)o,~en. N. and Rougeon, t'. (IL)87) EMB().I. 6. 1685 1690. 45 Wirth, T., Staudt. L. and Baltimore. 1). 1987) Nature 329. I74-178. 46 Schirm. S.. Jiricny, J. and Sehaffner W 11987) Genes Dcvel. 1.65-74. 47 Ondck. B., Shepard. A. and Herr, W. 19871 EMB() J. 6. 11117-1025. 48 ('larke, .I. and Herr, W. (19871 J. Virol. 61, 3536-3542. 49 Robertson, M. (19871 Nature 327. 464-466. 50 Richmond, "l-.J. (19871 Nature 326, 18 19. 51 l'ravers, A. and Klug. A. (19871 Nature 327. 280-281. 52 Ptashne. M. (19861 Nature 322. 697-701. 53 Mix. A.{,'. (19871 Nature 327. 3711. 54 kuria, S.. Gross. G., Itorowitz, M. and Givol. 1). (19871 EMB(I J. 6. 3307-3312. 55 Kovcsdi, l., Reichel. R. and Nevins. J.R. (19871 Proc. Natl. A c a d Sci. USA 84, 2180-2184. 56 Mitchell, P.J., Wang. C. and Tjian, R. (19871 Cell 51). 847 861. 57 Wasylyk. B., Wasylyk, ('., Matthes. H.. Wintzerith. M. and C h a m b o n , P. (19831 EMBO J. 2, 1605-1611. 58 Deh. S., DeLucia, A.I,.. Koff. A., Tsui. S. and Tegtmeyer, P. 119861 Mol. Cell. Biol. 6. 4578-4584. 59 Barrera-Saldana, H.. Takahashi, K., Vigneron. M.. Wildeman, A., Davidson, I. and Chambon, P. (19851 EMBO J. 4. 3839 3849. 60 Gidoni, D., Kadonaga, J r . , Barrera-Saldana, I-I., Takahashi, K., C h a m b o n , P. and Tjian, R. (19851 Science 23(I, 511-517. 61 Ernoult-Lange, M., Omilli, F. and May, E. (19871 Nucleic Acids Res. 15, 8177-8193. 62 15. J.J.. Peden. K.W.('., Dixon, R.A.F. and Kelly. T. (19861 Mol. Cell. Biol. 6, 1117- 1128. 63 Kim. C . H , Heath, C.. Bertuch. A. and Hansen, U. (1987) Proc. Natl. Acad. Sci. USA 84, 6025-6029. 64 Buchanan, R.I,. and Gralla, J.D. (19871 Mol. Cell. Biol. 7, 1554-1558. 65 Herr, W. and Gluzman, Y. (19851 Nature 313, 711-714. 66 Iterr, W. and Clarke, J. (19861 Cell 45, 461-47(I. 67 Zenke, M., Grundstr~:m, T., Matthes, tt.. Wintzerith. M.. Schatz, C., Wildeman, A. and Chambon. P. (1986) t-MBO J. 5, 387-397. 68 Nomiyama, H., Fromental, C., Xiao. J.H. and ('hambon. P. (19871 Proc. Natl. Acad. Sci. USA 84, 7881-7885. 69 I)avidson. 1.. Fromental, C.. Augereau, P., Wildeman, A., Zenke. M. and C h a m b o n . P. (19861 Nature 323. 544-548. 70 Kemler. I. and Busslinger, M. (19861 Mol. ('ell. Biol. 6. 3746- 3754. 71 Mattaj, I.W., Lienhard, S., Jiricny. J. and l)e Robertis, E.M. (19851 Nature 316, 163-167. 72 Parslow, T.G., Blair, D.I,.. Murphy, W.E. and Granner. D.K. (1984) Proc. Natl. Acad. Sci. USA 81, 2650-2654. 73 Sive, H.E., Heintz, N. and Roeder. R.G. (19861 Mol. ('ell. Biol. 6, 3329-3340. 74 Westin. G., Lund, E., Murphy. J.T., Pettersson. LI. and Dahlberg, J.E. (19841 EMBO J. 3, 3295 3301.

33 75 Roebuck, K.A., Walker, R.J. and Stumph, W. (1987) Mol. Cell. Biol. 7, 4185-4193. 76 Xiao, J.H., ,Davidson, I., Macchi, M., Rosales, R., Vigneron, M., Staub, A. and Chambon, P. (1987) Qenes Devel. 1,794-807. 77 Sen, R. and Baltimore, D. (1986) Cell 46, 705-716. 78 Baldwin, A.S. and Sharp, P.A. (1987) Mol. Cell. Biol. 7, 305-313. 79 lmagawa, M., Chiu, R. and Karin, M. (1987) Cell 51, 251-260. 80 Johnson, P.F., Landschulz, W.H., Graves, B.J. and McKnight, S.L. (1987) Genes Devel. 1, 133-146. 81 Heard, J.M., Herbomel, P., Ott, M.O., Mottura-Rollier, A., Weiss, M. and Yaniv, M. (1987) Mol. Cell. Biol. 7. 2425-2434. 82 Cereghini, S., Raymondjean, M., Carranca, A.G., Herbomel, P. and Yaniv, M. (1987) Cell 50, 627-638. 83 Costa, R.H., Grayson, D.R., Xanthopoulos, K.G. and Darnel, J.E., Jr. (1988) Proc. Natl. Acad. Sei. USA 85, 3840-3844. 84 Xiao, J.H., Davidson, I., Ferrandon, D., Rosales, R., Vigneron, M., Macchi, M., Ruffenach, F. and Chambon, P. (1987) EMBO J. 6, 3005-3013. 85 Davidson, I., Xiao, J.H., Rosales, R., Staub, A. and Chambon, P. (1988) Cell, in press. 86 Mermod, N., Williams, T.J. and Tjian, R. (1988) Nature 332, 557-561. 87 Laimins, L.A., Khoury, G., Gorman, C., Howard, B. and Gruss, P. (1982) Proc. Natl. Acad. Sci. USA 79, 6453-6457. 88 Sas~neoCorsi, P. and Borrelli, E. (1986) Trends Genet. 2, 215-219. 89 Fromental, C., Karmo, M., Nomiyama, H. and Chambon. P. (1988) Cell, in press. 90 Ondek, B., Gloss, L. and Herr, W. (1988) Nature 333, 40-45. 91 Been, M.D., Burgess, R.R. and Champoux, J.J. (1984) Nucleic Acids Res. 12, 3097-3114. 92 Benoist, C. and Chambon, P. (1981) Nature 290, 304-310. 93 Ghosh, P.K., Roy, P., Barkan, A., Mertz, J.E., Weissman, S.M. and Lebowitz, P. (1981) Proc. Natl. Acad. Sei. USA 78, 1386-1390. 94 Reddy, V.B., Thimmappaya, B., Dahr, R., Subramanian, K.N., Zain, B.S., Pan, J., Ghosh, P.K., Celma, M.L. and Weissmann, S.M. (1978) Science 200, 494-502. 95 Van Heuverswyn, H. and Fiers, W. (1979) Eur. J. Biochem. 100, 51-60. 96 Ephrussi, A., Church, G.M., Tonegawa, S. and Gilbert, W. (1985) Science 227, 134-140. 97 Church, G.M., Ephrussi, A., Gilbert, W. and Tonegawa, S. (1985) Nature 313, 798-801. 98 Lenardo, M., Pierce, J.W. and Baltimore, D. (1987) Science 236, 1573-1577. 99 Peterson, C.L. and Calame, K.L. (1987) Mol. Cell. Biol. 7, 4194-4203. 100 Augereau, P. and Chambon, P. (1986) EMBO J. 5, 1791 - 1797. 101 Sehlokat, U., Bohmann, D., Sch~51er, H. and Gruss, P. (1986) EMBO J. 5, 3251-3258.

102 Peter~n, C.L., Orth, K. and Calame, K.L. (1986) Mol. Cell. Biol. 6, 4168-4178. 103 Wasylyk, C. and Wasylyk, B. (1986) EMBO J. 5, 553-560. 104 Kadesch, T., Zervos, P. and Ruezinsky. D. (1986) Nucleic Acids Res. 14, 8209-8221. 105 Weinberger, J., Jar, P.S. and Sharp, P.A. (1988) Mol. Cell. Biol. 8, 988-992. 106 Gerster, T.. Matthias, P., Thali, M., Jiricny, J. and Schaffner. W. (1987) EMBO J. 6, 1323-1330. 107 Kiledjian, M., Su, L.-K. and Kadesch. T. (1988) Mol. Cell. Biol. 8, 145-152. 108 Tsao, B.P., Wang, X.F., Peterson, C.L. and Calame. K. (19883 Nucleic Acids Res. 16, 3239-3253. 109 Perez-Mutul, J., Macchi, M. and Wasylyk, B. (1988) Nucleic Acids Res. 16, 6085-6096. 110 Araki, K., Maeda, H., Wang, J.. Kitamura, D. and Watanabe, T. (1988) Cell 53, 723-730. 111 Maeda, H., Araki, K., Kitamura, D., Wang, J. and Watanabe, T. (1987) Nucleic Acids Res. 15, 2851-2869. 112 Falkner, F.G. and Zachau, H.G. (1984) Nature 310, 71-74. 113 Eaton, S. and Calame, K. (1987) Proc. Natl. Acad. Sci. USA 84, 7634-7638. 114 Landolfi, N.F., Yin, X.M., Capra, J.D. and Tucker, P.W. (1988) Nucleic Acids Res. 16, 5503-5514. 115 Staudt, L.M., Singh, H., Sen, R., Wirth, T.. Sharp, P.A. and Baltimore, D. (1986) Nature 323, 640-643. 116 Fletcher, C., Heintz, N. and Roeder, R.G. (1987) Cell 51. 773-781. 117 Wang, J., Nishiyama, K., Araki, K., Kitamura, D. and Watanabe, T. (1987) Nucleic Acids Res. 15, 10105-10116. 118 Sturm, R., Baumruker, T., Franza, B.R., Jr. and Herr, W. (1987) Genes Devel. 1, 1147-1160. 119 Scheidereit, C., Heguy, A. and Roeder, R.G. (1987) Cell 51,783-793. 120 Staudt, L.M., Clerc, R.G., Singh, H.. LeBowitz, J.H., Sharp, P.A. and Baltimore, D. (1988) Science 241,577-580. 121 Wirth, T., Staudt, L. and Baltimore, D. (1987) Nature 329, 174-177. 122 Sen, R. and Baltimore, D. (1987) Mol. Cell. Biol. 7, 1989-1994. 123 Solner-Webb, B. (1988) Cell 52, 153-154. 124 Folk, W.R. (1988) Genes Devel. 2, 373-375. 125 LaBella, F., Sive, H.L., Roeder, R.G. and Heintz, N. (1988) Genes Devel. 2, 32-39. 126 Pruijn, G.J.M., Van Driel, W., Van Miltenburg, R.T. and Van der Vliet, P.C. (1987) EMBO J. 6, 3771-3778. 127 O'Hare, P. and Goding, C.R. (1988) Cell 52, 435-445. 128 Preston, C.M., Frame, M.C. and Campbell. M.E.M. (1988) Cell 52, 425-434. 129 Greenberg, A., Bet, R., Kra-Oz, Z. and Laskov, R. (1987) Mol. Cell. Biol. 7, 936-939. 130 Imler, J.L., Lemaire, C., Wasylyk, C. and Wasylyk, B. (1987) Mol. Cell. Biol. 7, 2558-2567. 131 Zaller, D.M., Yu, H. and Eckhardt, L.A. (1988) Mol. Cell Biol. 8, 1932-1939. 132 Kitamura, D., Maeda, H., Araki, K., Kudo, A. and Watanabe, T. (1987) Eur. J. Immunol. 17, 1249-1256.

34 133 Sen. R. and Baltimore, D. (19871 Mol. ( e l l Biol. 7. 1989.- 1994. 134 Cockerill, P.N.. Yuen, M.H. and Garrard. W.T. (1987).I. Biol. Chem. 262, 5394-5397. 135 Petit, C., kevilliers, J., Ott, M.O. and Weiss, M.C. (19861 Proc. Natl. Acad. Sci. USA 83. 2561-2565. 136 Chin, A.C. and Fournier. R . E K . (19871 Pr~x:. Natl. A c a d Sci. USA 84. 1614-1618. 137 I,aimins. I,.. Holmgren-KiSnig, M. and Khoury, G. (19861 Pr~:. Natl. Acad. Sci. USA 83. 3151-3155. 138 Nir. U., Walker. M.D. and Rutter, W.J. (19861 Proc. Natl. Acad. Sci. USA 83, 3180-3184. 139 Colantuoni, V., PirozzJ, A., Blance. ('. and Cortese, R. (1987) EMBO J. 6, 631-636. 14(1 Picard. D. and Schaffner. W. (19851 EMBO J. 4, 2831-2838. 141 Hromas, R., Pauli, U., Marcuzzi, A., l,afrenz, D., Nick, H.. Stein, J., Stein, G. and Van Ness. B. (1988) Nucleic Acids Res. 16, 953-967. 142 Becker, P.B., Rupperts. S. and Schtitz, G. (19871 Cell 51, 435-443. 143 Lefevre, C., Imagawa, M., Dana, S., Grindlay, J., Bodner. M. and Karin. M. (1987) EMBO J. 6, 971 -981. 144 Hayes, T.E., Kitchen. A.M. and Cochran, B.H. (19871 Proc. Natl. Acad. Sci. USA 84, 1272-1276. 145 Mohun, T., Garrett, N. and Treisman, R. (19871 EMBO J. 6. 667-673. 146 llayes. T.E., Kitchen, A.M. and Cochran, B.H. (19871 Proc. Natl. Acad. Sci. USA 84, 1272-1276. 147 Lee. W.. Mitchell, P. and Tjian. R. (1987) Cell 49, 741-752. 148 Angel, P., Imagawa, M., Chiu. R.. Stein. B., Imbra, R.J., Rahmsdorf. H.J.. Jonat, C.. Herrlich, P. and Karin, M. (19871 Cell 49, 729-739. 149 Montmin','. M.R. and Bilezikjian. L.M. (19871 Nature 328, 175-178. 150 Andersen, R.D.. Taplitz, S.J., Wong. S., Bristol. C., Larkin, B. and Herschman, H.R. (19871 Mol. Cell. Biol. 7, 3574 -3581. 151 Brady, J.. Jeang, K.T., Duvall, J. and Khoury. G. (1987) J. Virol. 61, 2175-2181. 152 Nelson, K.J., Kelley, D.E. and Perry, R.P. (19851 Prcx:. Natl. Acad. Sci. USA 82. 5305-. 5309. 153 Kemper, B., Jackson, P.D. and Felsenfeld, G. (19871 Mol. (.'ell. Biol. 7, 2059-2069. 154 Richard-Foy, H. and Hager, G.L. (19871 EMBO J. 6, 2321-2328. 155 Lorch, Y., LaPointe, J.W. and Kornberg, R. (1987) Cell 49, 203-.210. 156 Jalinot, P. and K6dinger, C. (1986) Nucleic Acids Res. 14. 2651-2669. 157 Bienz. M. and Pelham. H.R.B. (1986) Cell 45, 753-760. 158 Giniger, E. and Ptashne, M. (1988) Pro.:. Natl. Acad. Sci. USA, 85. 382-386. 159 Bi3hnlein. E., Lowenthal, J.W., Siekevitz. M., Ballard, I).W.. Franza, B.R. and Greene. W.C. (1988) Cell 53, 827-836. 160 Cordon, J.L.. Cadena, D.I,., Abeam, J.M. and Dahmus, M. (1985) Proc. Natl. Acad. Sci. USA 82. 7934-7938.

161 Allis~m. L..A., Moyle. M., Shales, M. and Ingles, ( ' . 1 (19851 Cell 42, 599.-610. 162 Vogt, P.K.. Bos, T.J. and Doolittle. R.F. (19871 Proc. Natl. Acad. Sci. USA 84, 3316-3319. 163 Struhl, K. (19871 ('ell 50, 841-846. 164 Bohmann. D., Bos, T.J.. Admon, A.. Nishimura, T.. Vogt, R.K. and T lian, R. (19871 Science 238, 1386-1392. 165 Angel. P.. Allegretto, ['.. ()kino, S.. Hattori, K., Boyle, W.J., Hunter. T. and Karin. M. (19881 Nature 332, 166.- 171. 166 Buralowski, S., Hahn, S., Sharp, P.A. and Guarente, 1,. (19881 Nature 334, 37-42. 167 Cavallini. B., Huet, J., Plassat, J.I,., Sentenac, A., Egly, J.M. and C h a m b o n , P. (1988) Nature 334, 77-80. 168 Kakidani, H. and Ptashne, M. (1988) Cell 52, 161-167. 169 Webster, N., Jin, J.R.. Green, S., Hollis, M. and Chambon. P. (1988) Cell 52, 169. 178. 170 Metzger. D., White, J.H. and Chambon, P. (19881 Nature 334, 31-36. 171 Oleson, J., tlahn, S. and Guarente. I,. (1987) ('ell 51. 953 961. 172 (.'hodosh. L.A.. Baldwin, A.S.. Carthew. R.W. and Sharp, P.A. (1988) ('ell 53. 11 • 24. 173 llahn. S. and Guareme, L. (19881 Science 240, 317-.321. 174 ('hodosh, L.A., Olesen, J., Hahn. S.. Baldwin, A.S., Guarente. L. and Sharp, P.A. (1988) Cell 53.25- 35. 175 Keegan. 1,., Gill. G. and Ptashne, M. (19861 Science 231. 699-704. 176 Hope, I.A. and Struhl, K. (1986) Cell 46, 885-894. 177 Brent, R. and Ptashne, M. (19851 Cell 43, 729--736. 178 Struhl, K. (1987) ('ell 49, 295-297. 179 Ma, J. and Ptashne, M. (19871 Cell 48, 847-853. 180 Ma. J. and Ptashne, M. (19871 Cell 51, 113-119. 181 Giniger, E. and Ptashne, M. (19871 Nature 330. 670-672. 182 Hope, [.A. Mahadevan, S. and Struhl, K. (19881 Nature 333, 635-640. 183 (.'hen. W., Tabor. S. and Struhl, K. (1987) Cell 50, 1047-1 (155. 184 Gronemeyer, H.. Green, S., Kumar, V.. Jeltsch, J.M. and Chambon,P. (1988) in Steroid Receptors and Disease: Cancer, Bone and Circulatory Disorders (Sheridan. P.J., Blum. K. and Trachtenberg. M.C., eds.), pp. 153-187, Marcel Dekker, New York. 185 Green, S. and C h a m b o n , P. (1987) Nature 325, 75-78. 186 Kumar, V., Green, S.. Stack, G.. Berry, M.. Jin, J.R. and Chambon, P. (19871 Cell 51,941-951. 187 Petkovich, M., Brand, N.J., Krust. A. and Chambon, P. (1987) Nature 330, 444-45(I. 188 Rusconi, S. and Yamamoto, K.R. (19871 EMBO J. 6. 1309-1315. 189 Gigu~re. V., Hollenberg, S.M., Rosenfeld, M.G. and Evans, R.M. (1986) Cell 46. 645-652. 190 I)anielsen. M., Northrop. J.P.. Jonklass, J. and Ringold, G.M. (1987) Mol. Endocrinol. 1,816-822. 191 Miesfeld, R., Godowski, P.J., Maler, B.A. and Yamamoto, K.R. (19871 Science 236, 423-427. 192 Gronemeyer, H., Turcotte, B., Quirin-Stricker, C.. Bocquel. M.T.. Meyer. M.E., Krozowski, Z.. Jeltsch, J.M.. Lerouge.

35

193

194 195 196 197 198

199 200

T., Gamier, J.M. and Chambon, P. (1987) EMBO J. 6, 3985-3994. Carson, M.A., Tsai, M.J., Conneely, O.M.. Maxwell, B.L., Clark, J.H., Dobson, A.D.W., Elbrecht, A., Tort, D.O., Schrader, W.T. and O'Malley, B.W. (1987) Mol. Endocrinol. 1, 791-801. Klug, A. and Rhodes, D. (1987) Trends Biochem. Sci. 12, 464-469. Godowski, P.J., Rusconi, S., Miesfeld, R. and Yamamoto, K.R. (1987) Nature 325, 365-368. Hollenberg, S.M., Gigu~re, V., Segui, P. and Evans, R.M. (1987) Cell 49, 39-46. Webster, N.J.G., Green, S., Jin, J.R. and Chambon, P. (1988) Cell 54, 199-207. Pratt, W.B., Jolly, D.J., Pratt, D.V., Hollenberg, S.M., Gigu6re, V., Cadepond, F.M., Schweizer-Groyer, G., Catelli, M.G., Evans, R.W. and Baulieu, E.E. (1988) J. Biol. Chem. 263, 267-273. Imler, J.L., Schatz, C., Wasylyk, C., Chatton, B. and Wasylyk, B. (1988) Nature 332, 275-278. Wasylyk, C., Imler, J.L. and Wasylyk, B. (1988) EMBO J. 7, 2475-2483.

201 Struh], K. (1988) Nature 332, 649-650. 202 Imler, J.L., Ugarte, E., Wasylyk, C. and Wasylyk, B. (1988) Nucleic Acids Res. 18, 3005-3012. 203 Pabo, C.O., Sauer, R.T., Sturtevant, J.M. and Ptashne, M. (1979) Proc. Natl. Acad. Sci. USA 76, 1608-1612. 204 Kadonaga, J.T., Carner, K.R., Masiarz, F.R. and Tjian, R. (1987) Cell 51, 1079-1090. 205 Lech, K., Anderson, K. and Brent, R. (1988) Cell 52. 179-184. 206 Rauscher Ili, F.J., Sambucetti, L.C., Curran, T.. Distel, R.J. and Spiegelman, B.M. (1988) Cell 52, 471-480. 207 gauscher III, F.J., Cohen, D.R., Curran, T., Bos, T.J., Vogt, P.K., Bohmann, D., Tjian, R. and Franza, B.R. (1988) Science 240, 1010-1016. 208 Triezenberg, S.J., Kingsbury, R.C. and McKnight, S.L. (1988) Genes Devel. 2, 718-729. 209 McKnight, J.L.C., Kristie, T.M. and Roizman, B. (1987) Proc. Natl. Acad. Sci. 84, 7061-7065. 210 Preston, C.M., Frame, M.C. and Campbell, M.E.M. (1988) Cell 52, 425-534. 211 Landschulz, W.H., Johnson, P.F. and McKnight, S.L. (1988) Science 240, 1759-1764.