Enhancing succinic acid productivity in the yeast Yarrowia lipolytica with improved glycerol uptake rate

Journal Pre-proofs Enhancing succinic acid productivity in the yeast Yarrowia lipolytica with improved glycerol uptake rate Khai Lun Ong, Patrick Fickers, Carol Sze Ki Lin PII: DOI: Reference:

S0048-9697(19)34903-4 https://doi.org/10.1016/j.scitotenv.2019.134911 STOTEN 134911

To appear in:

Science of the Total Environment

Received Date: Revised Date: Accepted Date:

6 July 2019 7 October 2019 8 October 2019

Please cite this article as: K. Lun Ong, P. Fickers, C. Sze Ki Lin, Enhancing succinic acid productivity in the yeast Yarrowia lipolytica with improved glycerol uptake rate, Science of the Total Environment (2019), doi: https://doi.org/10.1016/j.scitotenv.2019.134911

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2019 Elsevier B.V. All rights reserved.

Enhancing succinic acid productivity in the yeast Yarrowia lipolytica with improved glycerol uptake rate

Khai Lun Ong1, Patrick Fickers2, Carol Sze Ki Lin1*

1

School of Energy and Environment, City University of Hong Kong, Tat Chee Avenue,

Kowloon, Hong Kong, China 2

Microbial Processes and Interactions, TERRA Teaching and Research Center, University of

Liège - Gembloux Agro-Bio Tech, Av. De la Faculté, 2B, 5030 Gembloux, Belgium

*Corresponding author E-mail:[email protected] Telephone number: +852-3442 7497

1

Abstract Development of cost effective and highly efficient process for bio-based succinic acid (SA) production is a main concern for industry. The metabolically engineered Y. lipolytica strain PGC01003 was successfully used for SA production with high titre. However, this strain possesses as main drawback with a low growth rate when glycerol is used as a feedstock. Herein, gene GUT1, encoding glycerol kinase, was overexpressed in strain PGC01003 with the aim to improve glycerol uptake capacity. In the resulting strain RIY420, glycerol uptake was 13.5% higher than for the parental strain. GUT1 gene overexpression also positively influences SA production. In batch bioreactor, SA titre, yield and productivity were 32%, 39% and 143% higher, respectively, than for the parental strain PGC01003. Using a glycerol feeding strategy, SA titre, yield and productivity were further improved by 11%, 5% and 10%, respectively. Moreover, the process duration to yield the highest concentration of SA in the culture supernatant was reduced by 9%. This demonstrated the contribution of metabolically engineered strain RIY420 to lower SA process cost and increase the efficiency of bio-based SA production.

Keywords Glycerol, Glycerol kinase, Overexpression, Productivity, Succinic acid, Yarrowia lipolytica

2

1. Introduction Succinic acid (SA) is one of the top twelve platform-chemicals listed by the US Department of Energy (Zhang et al., 2016). It is used in the chemical industry for the synthesis of cleansers, surfactants and lubricants (Carlson et al., 2016); as antimicrobial agent, flavoring agent and pH regulator in the food industry (Saxena et al., 2017); as an additive in antibiotic and vitamin formulation in the pharmaceutical industry (Akhtar et al., 2014) and even as a chelating agent in the metal industry (Akhtar et al., 2014). The global market for SA reached USD 131.7 million in 2018 and is expected to increase up to USD 182.8 million by 2023 mainly due to the development

of

applications

in

pharmaceuticals,

agro-food

and

coating

industries

(Marketsandmarkets, 2019). SA could be obtained from petroleum-based chemistry through hydrogenation of maleic anhydride or maleic acid (Cok et al., 2014). It could be also obtained by bio-based processes involving

wild-type

or

metabolically

Anaerobiospirillum succiniciproducens,

engineered Actinobacillus

bacteria,

namely

succinogenes,

Mannheimia succiniciproducens, Basfia succiniciproducens and recombinant Escherichia coli (Nghiem et al., 2017; Salvachúa et al., 2016) or Yarrowia lipolytica (Gao et al., 2016; Kamzolova et al., 2009, 2012, 2014a , 2014b; Li et al., 2019; Ong et al., 2019). Kamzolova et al. (2009, 2012, 2014a, 2014b) first developed the high effective processes of succinic acid production by yeast Yarrowia lipolytica with high concentration and the product yield from a wide range of carbon sources such as ethanol, n-alkane and rapeseed oil. Actually, the production cost of bio-based SA is still too high to compete with the petrochemical based method as exemplified by the bankruptcy of several succinic acid firms worldwide, namely BioAmber in Canada, Succinity GmbH in Germany and Myriant in the US

3

(PR Newswire, 2019; Research and Markets, 2018). SA is a low added value compound and therefore its production process must be of low cost to be profitable. Productivity is an important criterion in these bio-based processes since a high productivity contributes to process-cost reduction (Paulová et al., 2013; Shay et al., 1987). It could be increased through fermentation technology (e.g. immobilized cell technology) and/or by optimization of the SA anabolic pathway of the producing cells by metabolic engineering (e.g. overexpression of key metabolic genes). We report recently on Y. lipolytica PGC01003 obtained by metabolic engineering of the Krebs cycle, namely disruption of gene SDH5 (YALI0F09075g) encoding succinate dehydrogenase (Gao et al., 2016). The SA productivity of the disrupted strain reached 0.4 g/L.h in fed-batch bioreactor and was further improved using an in situ fibrous bed bioreactor (isFBB) with glycerol as a feedstock. In isFBB, cells are immobilized on a solid support (in that case a cotton towel), which allows reaching high cell densities and thus higher SA productivity. Also, it allows shortening the lag phase. With such a process, SA productivity achieved 0.84 g/L.h for a reduction of process time by 110 % (Li et al., 2017). The main drawback of Y. lipolytica PGC01003 is its weak ability to metabolize glycerol (qglycerol: 0.01 g/gCDW.h). In Y. lipolytica, glycerol is first converted into glycerol-3P by a glycerol kinase encoded by gene GUT1 (YALI0F00484g). This intermediate is then converted into dihydroxyacetone phosphate, an intermediate of glycolysis by a glycerol-3-P dehydrogenase encoded by gene GUT2 (YALI0B13970g). Overexpression of these genes, alone or in combination, has been shown to improve glycerol uptake rate and thus metabolic activity. Mirończuk et al. (2016) has cooverexpressed GUT1 and GUT2 in Y. lipolytica strain A101 to optimize an erythritol production process. When GUT1 was overexpressed, erythritol productivity increased by 24%. Furthermore,

4

co-overexpression of GUT1 and GUT2 resulted in a 35% increase in erythritol productivity as compared to the parental strain. Besides this, Carly et al. (2017) also overexpressed genes GUT1 and GUT2 into a Y. lipolytica PO1 derivatives strain (i.e. PO1d). They found that the specific glycerol consumption rate and specific erythritol production rate for the recombinant strain that overexpressed gene GUT1 were 20% and 45% higher than the control strain, respectively. When both GUT1 and GUT2 were overexpressed, only a slight increase in specific glycerol consumption rate and specific erythritol production rate could be observed as compared to mutant that overexpressed only GUT1. In this study, overexpression of gene GUT1 in Y. lipolytica PGC01003 (a PO1f derivative) was performed to improve the glycerol uptake rate and, thus, the SA productivity. Gene GUT1 was overexpressed under the control of the strong constitutive pTEF promoter in Y. lipolytica PGC01003. Then, the kinetics and yield of SA synthesis in batch and glycerol fed-batch processes were determined in a 2.5-L benchtop bioreactor.

2. Materials and methods 2.1 Microorganism and culture conditions The Escherichia coli strain FCE202 (FCP202, pTEF-GUT1, Carly et al. 2017) was grown at 37 °C in Luria-Bertani medium supplemented with kanamycin sulfate (100 μg/mL). The Y. lipolytica strains were PGC01003 (MatA, xpr2-322, axp-2, leu2-270, ura3-302, Δsdh5::URA3) and RIY420 (MatA, xpr2-322, axp-2, leu2-270, ura3-302, Δsdh5::URA3, pTEF-GUT1). They were grown in YPG10 medium (10 g/L glycerol, 10 g/L yeast extract, 20 g/L tryptone and 50 mM phosphate buffer pH 6.0) at 28 °C with 250 rpm. YNBG medium (6.7 g/L YNB, 10 g/L of glycerol, 5 g/L of ammonium sulfate and 50 mM of citrate buffer pH7) supplemented for

5

auxotrophy requirements (Barth & Gaillardin, 1996) was used for transformant selection. The fermentation medium (YPG100) contained 100 g/L glycerol, 10 g/L yeast extract, 20 g/L tryptone and 50 mM phosphate buffer at pH 6.0.

2.2 Molecular biology techniques and strains construction Standard media and techniques were used for E. coli (Sambrook, Fritsch & Maniatis, 1989), and those used for Y. lipolytica have been described elsewhere (Barth and Gaillardin, 1996). The restriction enzymes were supplied from New England Biolabs. ExTaq DNA polymerase (Takara, France) was used for genotype characterization. Genomic DNA of Y. lipolytica was extracted according to the method of Querol et al. (1992). Plasmid extraction was performed using Wizard® Plus SV Minipreps DNA Purification kit (Promega, US). The primers, listed in Table 1, were synthetized by Eurogentec (https://secure.eurogentec.com/). DNA fragment were purified from agarose gels using Monarch DNA purification kit (NEB). Transcriptional quantification of GUT1 gene was performed as described in Sassi et al. (2016) with primer pair GUT1-L-qPCR and GUT1-R-qPCR (Table 1). The reference actin gene (ACT) was amplified using primers ActF and Act-R (Table 1). Difference in gene expression were calculated as described elsewhere (Livak & Schmittgen, 2001). To construct strain RIY420, plasmid FCP202 was first NotI digested. The 4.6 kb DNA fragment containing the pTEF-GUT1 expression cassette was then gel purified and used to transform strain PGC01003 as described in Le Dall et al. (1994). Transformants were selected on YNBG medium and correctness of their genotype was verified by analytical PCR using primers Leu2-P-R1 and pTEF-EYK-R2-EcoR1 (Table 1).

6

2.4 Analytical methods Cell growth was monitored either by optical density at 600 nm (OD600) or dry cell weight (DCW) as previously described (Gao et al., 2016). Glycerol, succinic acid and acetic acid concentration were determined by isocratic RID-HPLC (Waters, USA, RID set at 35 °C) using an Aminex HPX-87H column (300×7.8 mm, Bio-Rad, USA) and 5 mM H2SO4 as a mobile phase at a flow rate of 0.6 mL/min at 60 °C. The specific glycerol uptake (rgly, g/gDCW.h) rate was expressed as the amount of glycerol (in gram) consumed per gram of dry cell weight (DCW) per hour. The specific SA production rate (rSA, g/gDCW.h) was expressed as the amount of SA produced (in gram) per gram of dry cell weight (DCW) per hour. The SA yield was expressed as the amount of SA produced (in gram) per amount of glycerol consumed (in gram). The SA productivity was expressed as the amount of SA produced (in g/L) per hour.

2.5 Culture in bioreactor All cultures were performed in a BIOSTAT®B 2.5-L benchtop bioreactor (Sartorius, Germany) containing 1 L of YPG100 medium. Seed cultures were performed in YPG10 medium for 24 h. Bioreactors were inoculated at an initial OD600 of 0.7. Temperature, agitation speed and aeration rate were set at 28 °C, 600 rpm and 2.0 L/min, respectively. Antifoam 204 (Sigma-Aldrich, US) was added when necessary and pH was controlled at 6 using 5 M NaOH. For fed-batch bioreactor, 100 mL of glycerol solution (800 g/L) was added when its concentration was below 20 g/L. All other culture conditions were similar to that of batch bioreactor. For in situ fibrous bed bioreactor (isFBB), the cultures were performed as previously described (Li et al., 2017). For the immobilization stage, Y. lipolytica strain RIY420 was grown until a biomass of 20 gDCW/L

7

was reached, then the culture broth was transferred to isFBB to initiate the immobilization process. When the biomass reached a stable value (i.e. 20 g/L), the culture medium was replaced by fresh YPG100 medium (with an initial glycerol concentration of 100 g/L). This corresponded to the starting point of the isFBB batch culture.

3. Results and Discussion 3.1 Strain construction Figure 1 shows the metabolic pathway of succinic acid production from glycerol through overexpression of gene GUT1 in strain PGC01003. Despite the strain PGC01003 yielded to a significantly increased SA productivity, it showed a lower growth rate on glycerol medium as compared to the parental strain Po1g (0.40 and 0.53 h-1, respectively; Gao et al., 2016). Therefore, GUT1 gene was overexpressed under the control of the strong pTEF promoter in strain PGC01003 (Figure S1 in Supplementary file). As the integration locus of the pTEF-GUT1 expression cassette in yeast genome is random, the GUT1 expression level was determined for five transformants and compared to that of the strain PGC01003. As shown in Figure 2, all the transformants tested showed a significantly higher GUT1 expression level as compared to that of strain PGC01003 (6.6-fold in average). Among them, transformant T5 was selected for further investigation and was named RIY420. Growth ability of strains RIY420 and PGC01003 were compared via shake-flask cultures in YPG10 medium (from an initial glycerol concentration of 10 g/L). The specific glycerol uptake rate of strain RIY420 was 13.5% higher than that of strain PGC01003 (0.042 g/gDCW.h and 0.037 g/gDCW.h respectively; data not shown). This higher glycerol uptake rate also positively affects cell growth. Strain RIY420 grew faster than the parental strain PGC01003 (Figure 3), with specific growth rates equal to 0.37 h-1 and 0.30 h-1, respectively. 8

3.2 Production of succinic acid in batch bioreactor The ability of strain RIY420 to produce SA was first investigated in batch bioreactor in YPG100 medium (i.e. with an initial glycerol concentration of 100 g/L) and compared to that of strain PGC01003 (Figure 4). The kinetic of cell growth was different for the two strains. For strain PGC01003, two growth phases were observed. Within the first 30 h, cells grew at a low growth rate (0.07 h-1) while a significantly higher cell growth was observed after 45 h of process (0.17 h-1,

Fig 4a). The kinetic of glycerol consumption showed also two phases. During the first 45 h,

glycerol was consumed at a rate of 0.40 g/L.h, then consumption rate increased to 2.87 g/L.h. Glycerol depletion in the medium occurred after 72 h of culture. In contrast, the kinetics of cell growth and glycerol uptake for strain RIY420 showed only one phase. The exponential growth phase started after 4 h of culture and ended after 38 h after glycerol depletion (Fig 4b). In those conditions, cell growth rate and glycerol uptake rate were equal to 0.12 h-1 and 2.37 g/L.h, respectively. The maximal biomass value obtained for strains RIY420 and PGC01003 were equal to 23.8 and 26.2 gCDW. L-1, respectively (Table 2). For strain PGC01003, SA production also showed two phases. During the first 45 h, it was produced with a rate of 0.06 g/L.h. and it increased to a rate of 0.50 g/L.h afterwards. At the end of the culture (after 72 h), SA titre was 16.2 g/L, while SA productivity and specific productivity were 0.22 g/L.h and 0.009 g/gDCW.h, respectively (Table 2). The overall SA yield was 0.18 g/g. Production of SA for strain RIY420 started after 5 h with almost a constant rate of 0.62 g/L.h until 35 h when glycerol concentration started to be limiting (9.4 g/L). After glycerol depletion, SA production rate was low (0.13 g/L.h). As compared to strain PGC01003, SA productivity and specific production rate were 59 % (0.22 and 0.56 g/L.h) and 60 % (0.009 and

9

0.024 g/gDCW.h) higher for strain RIY420, respectively. The SA yield was also higher (28%) for strain overexpressing GUT1. The final SA titre was 21 g/L (Table 2). During these batch cultures, both strains coproduced also acetic acid (Fig 4) with the same kinetic profile as SA production. It was not reconsumed by cells even after glycerol depletion. Moreover, the final acetic acid titre seems to be correlated to the SA production level. The SA productivity for strain RIY420 was 143% higher than for PGC01003 in those experimental conditions. In Gao et al. (2016), strain PGC01003 was shown to perform better in isFBB batch fermentation. Therefore, strain RIY420 was grown in the same experimental condition and SA production was determined and compared to that of the parental strain (i.e. PGC01003). As shown in Table 3, strain PGC01003 performed better than strain RIY420 in terms of SA titre, yield and productivity. RIY420 performed only slightly better in term of specific production rate (0.034 versus 0.028 g/gDCW.h). The yield of strain PGC01003 was 4 % higher than strain RIY420. The resultant SA productivity was also higher (38%) for strain PGC01003 as compared to strain RIY420. Cell dry weight of strain RIY420 was significantly lower (40 %) than that of strain PGC01003 negatively affecting the SA titre (25.7 versus 21.0 g/L).

3.3 Production of succinic acid in fed-batch bioreactor For strain RIY420, batch cultures showed that isFBB did not yield to increase SA titre and a high SA production rate seems to depend on the presence of glycerol in the culture medium. Therefore, fed-batch cultures were performed with the strain RIY420 with an aim to enhance SA titre and productivity. They started at an initial glycerol concentration of 100 g/L and glycerol (80 g in 100 mL solution) was fed when its concentration was below 20 g/L in the bioreactor (Figure 5). During the batch phase (i.e. before the first glycerol addition), almost all glycerol

10

(remaining concentration 14.5 g/L) was consumed within 35 h. At this stage, SA and biomass were equal to 22.7 g/L and 25.4 g/L, respectively, thus confirming the results obtained in batch bioreactor. Then, seven glycerol additions were performed with an average period of 52 h. During the fed-batch phase (i.e. between 35 h and 400 h of process), biomass did not increase significantly as shown in Fig 5. In contrast, SA concentration increased almost linearly during that period with a rate of 0.44 g/L.h. After 400 h of culture, SA titre was 178 g/L, a 11 % higher value than that reported for strain PGC01003 (160 g/L) in similar experimental conditions (Gao et al. 2016). As shown in Table 4, SA yield, productivity and specific production rate were higher for strain RIY420; especially for the specific production rate that was increased by two folds. Within the first 125 h, acetic acid accumulated in the culture medium to a maximal concentration of 17.4 g/L. It was then re-consumed by yeast cells and could not be detected anymore in the medium after 250 h of process. This increase significantly the SA yield (46 %) as compared to batch culture (25%). In comparison with data of fed-batch cultures of strain PGC01003 (Gao et al., 2016), SA titre, yield and productivity for strain RIY420 were increased by 11%, 5% and 10%, respectively. Besides this, SA titre of RIY420 reached 160.2 g/L at 366 h while the same SA titre is reached after 400 h for strain PGC01003; thus reducing the process duration by 9%. Fed-batch fermentation of glycerol by Actinobacillus succinogenes (Carvalho et al., 2014) and Y. lipolytica H222-AZ2 (Jost et al., 2015) produced 49.6 g/L and 25 g/L of SA respectively, whereas 178 g/L of SA was produced from glycerol by Y. lipolytica strain RIY420 in this study. The pH of bioreactor fermentation was controlled at pH 6 using 5 M NaOH. The RIY420 strain was derived from the PGC01003 strain, similarly it could not tolerate low pH. When the PGC01003 strain was cultivated at low pH, low SA titer was produced (Cui et al., 2017). Acetic acid was the main by-product obtained from glycerol in this study.

11

According to Cui et al. (2017), deletion of Co-A transferase gene effectively eliminated acetic acid production and thus enhanced SA production. Glycerol is a waste by-product in biodiesel production. This is also a low-cost carbon source that can be utilised to synthesize SA, which is a value-added product. Further study will be conducted to calculate the production cost of SA through techno-economic analysis. The aim of this study is to improve the SA productivity through shorten the fermentation time, which also leads to reduction in production cost.

4. Conclusions The overexpression of GUT1 gene in strain PGC01003 increased the flux in glycerol catabolism as demonstrated by the significant increase in glycerol uptake rate. This positively influence cell growth capacity of the strain RIY420 together with its ability to produce succinic acid. The fedbatch strategy developed for strain RIY420 yielded to a 2-fold increase in specific production rate as compared to strain PGC01003. The succinic acid productivity was also increased by 10 %. This demonstrated that the strategy developed herein contributed to an increased SA productivity, which could lead to the subsequent reduction of production cost in bio-based SA process.

Acknowledgements This work is supported by Strategic Research Grant from City University of Hong Kong [Project No. 7004922]. The authors are also grateful to Prof. Qingsheng Qi from State Key Laboratory of Microbial Technology, School of Life Science, Shandong University, China for his kind providence of Yarrowia lipolytica PGC01003.

12

References Akhtar, J., Idris, A., Abd. Aziz, R. 2014. Recent advances in production of succinic acid from lignocellulosic biomass. Applied Microbiology and Biotechnology, 98(3), 987-1000. Barth, G., Gaillardin, C. 1996. Yarrowia lipolytica. in: Nonconventional Yeasts in Biotechnology: A Handbook, Springer Berlin Heidelberg. Berlin, Heidelberg, pp. 313-388. Carlson, A., Coggio, B., Lau, K., Mercogliano, C., Millis, J. 2016. Industrial Production of Succinic Acid. Chemicals and Fuels from Bio‐Based Building Blocks. (Eds.) F. Cavani, S. Albonetti, F. Basile and A. Gandini). doi:10.1002/9783527698202.ch7 Carly, F., Vandermies, M., Telek, S., Steels, S., Thomas, S., Nicaud, J.-M., Fickers, P. 2017. Enhancing erythritol productivity in Yarrowia lipolytica using metabolic engineering. Metabolic Engineering, 42, 19-24. Cok, B., Tsiropoulos, I., Roes, A.L., Patel, M.K. 2014. Succinic acid production derived from carbohydrates: An energy and greenhouse gas assessment of a platform chemical toward a bio-based economy. Biofuels, Bioproducts and Biorefining, 8(1), 16-29. Cui, Z., Gao, C., Li, J., Hou, J., Lin, C.S.K., Qi, Q. 2017. Engineering of unconventional yeast Yarrowia lipolytica for efficient succinic acid production from glycerol at low pH. Metabolic Engineering, 42, 126-133. Gao, C., Yang, X., Wang, H., Rivero, C.P., Li, C., Cui, Z., Qi, Q., Lin, C.S.K. 2016. Robust succinic acid production from crude glycerol using engineered Yarrowia lipolytica. Biotechnology for Biofuels, 9(1), 179. Kamzolova, S.V., Yusupova, A.I., Vinokurova, N.G., Fedotcheva, N.I., Kondrashova, M.N., Finogenova, T.V., Morgunov, I.G. 2009. Chemically assisted microbial production of succinic acid by the yeast Yarrowia lipolytica grown on ethanol. Applied Microbiology and Biotechnology, 83(6), 1027-1034. Kamzolova, S.V., Vinokurova, N.G., Yusupova, A.I., Morgunov, I.G. 2012. Succinic acid production from n-alkanes. Engineering in Life Sciences, 12(5), 560-566. Kamzolova, S.V., Vinokurova, N.G., Shemshura, O.N., Bekmakhanova, N.E., Lunina, J.N., Samoilenko, V.A., Morgunov, I.G. 2014. The production of succinic acid by yeast Yarrowia lipolytica through a two-step process. Applied Microbiology and Biotechnology, 98(18), 7959-7969. Kamzolova, S.V., Vinokurova, N.G., Dedyukhina, E.G., Samoilenko, V.A., Lunina, J.N., Mironov, A.A., Allayarov, R.K., Morgunov, I.G. 2014. The peculiarities of succinic acid production from rapeseed oil by Yarrowia lipolytica yeast. Applied Microbiology and Biotechnology, 98(9), 4149-4157. Le Dall, M.T., Nicaud, J.M., Gaillardin, C. 1994. Multiple-copy integration in the yeast Yarrowia lipolytica. Current Genetics, 26(1), 38-44. Li, C., Ong, K.L., Yang, X., Lin, C.S.K. 2019. Bio-refinery of waste streams for green and efficient succinic acid production by engineered Yarrowia lipolytica without pH control. Chemical Engineering Journal, 371, 804-812. Li, C., Yang, X., Gao, S., Wang, H., Lin, C.S.K. 2017. High efficiency succinic acid production from glycerol via in situ fibrous bed bioreactor with an engineered Yarrowia lipolytica. Bioresource Technology, 225, 9-16. Livak, K.J., Schmittgen, T.D. 2001. Analysis of Relative Gene Expression Data Using RealTime Quantitative PCR and the 2−ΔΔCT Method. Methods, 25(4), 402-408. 13

Marketsandmarkets. 2019. Succinic acid market by type (bio-based succinic acid, petro-based succinic acid), end-use industry (industrial, food & beverage, coatings, pharmaceutical), and region (APAC, European, North America, South America, Middle East & Africa)forecast to 2023. https://www.marketsandmarkets.com/Market-Reports/succinic-acidmarket-402.html.[Accessed on 14 June 2019] Mirończuk, A.M., Rzechonek, D.A., Biegalska, A., Rakicka, M., Dobrowolski, A. 2016. A novel strain of Yarrowia lipolytica as a platform for value-added product synthesis from glycerol. Biotechnology for Biofuels, 9(1), 180. Nghiem, N., Kleff, S., Schwegmann, S. 2017. Succinic acid: Technology development and commercialization. Fermentation, 3(2), 26. Ong, K.L., Li, C., Li, X., Zhang, Y., Xu, J., Lin, C.S.K. 2019. Co-fermentation of glucose and xylose from sugarcane bagasse into succinic acid by Yarrowia lipolytica. Biochemical Engineering Journal 148, 108-115. Paulová, L., Patáková, P., Brányik, T. 2013. Advanced Fermentation Processes. 1st ed. in: Engineering Aspects of Food Biotechnology, (Eds.) J.A. Teixeira, A.A. Vicente, CRC Press. Boca Raton, pp. 89-110. PR Newswire. 2019. Global Succinic Acid Market Forecast to 2023: Increased use in industrial and coating & food & beverage industries driving demand. https://www.prnewswire.com/news-releases/global-succinic-acid-market-forecast-to2023-increased-use-in-industrial-and-coating--food--beverage-industries-drivingdemand-300772445.html [14 May 2019] Querol, A., Barrio, E., Huerta, T., Ramón, D. 1992. Molecular monitoring of wine fermentations conducted by active dry yeast strains. Applied and Environmental Microbiology, 58(9), 2948. Research and Markets. 2018. Succinic acid market by type, end-use industry, and region forecast to 2023. https://www.researchandmarkets.com/research/cd4p92/global_succinic?w=5. [Accessed on 14 May 2019] Salvachúa, D., Mohagheghi, A., Smith, H., Bradfield, M.F.A., Nicol, W., Black, B.A., Biddy, M.J., Dowe, N., Beckham, G.T. 2016. Succinic acid production on xylose-enriched biorefinery streams by Actinobacillus succinogenes in batch fermentation. Biotechnology for Biofuels, 9(1), 28. Saxena, R.K., Saran, S., Isar, J., Kaushik, R. 2017. 27 - Production and Applications of Succinic Acid. in: Current Developments in Biotechnology and Bioengineering, (Eds.) A. Pandey, S. Negi, C.R. Soccol, Elsevier, pp. 601-630. Shay, L.K., Hunt, H.R., Wegner, G.H. 1987. High-productivity fermentation process for cultivating industrial microorganisms. Journal of Industrial Microbiology, 2(2), 79-85.

14

Figure captions Figure 1. Metabolic pathway of succinic acid production from glycerol through overexpression of gene GUT1 in strain PGC01003. Figure 2. Expression level of gene GUT1 in strain RIY420. Samples were collected after 18 h of growth in YPG10 medium. The data were normalized to that of strain PGC01003. Values are means and standard deviations calculated from two independent experiments. T1, T5, T9 and T11 represent transformant strain RIY420 no. 1, no. 5, no. 9 and no. 11, respectively. Figure 3. Cell growth of strains RIY420 and PGC01003 during shake flask culture in YPG10 medium. Values are means and standard deviations calculated from two independent experiments. Figure 4. Kinetics of cell growth, glycerol uptake, succinic acid and acetic acid production during culture of strain PGC01003 (a) and RIY420 (b) in bioreactor batch culture. Values are means and standard deviations calculated from two independent experiments.

Figure 5. Kinetics of cell growth, glycerol uptake, succinic acid and acetic acid production during culture of strain RIY420 in fed-batch bioreactor. Values are means and standard deviations calculated from two independent experiments. Red arrow represents glycerol feed in time.

15

Figure captions Figure 1. Metabolic pathway of succinic acid production from glycerol through overexpression of gene GUT1 in strain PGC01003. Figure 2. Expression level of gene GUT1 in strain RIY420. Samples were collected after 18 h of growth in YPG10 medium. The data were normalized to that of strain PGC01003. Values are means and standard deviations calculated from two independent experiments. T1, T5, T9 and T11 represents transformant strain RIY420 no. 1, no. 5, no. 9 and no. 11, respectively. Figure 3. Cell growth of strains RIY420 and PGC01003 during shake flask culture in YPG10 medium. Values are means and standard deviations calculated from two independent experiments. Figure 4. Kinetics of cell growth, glycerol uptake, succinic acid and acetic acid production during culture of strain PGC01003 (a) and RIY420 (b) in bioreactor batch culture. Values are means and standard deviations calculated from two independent experiments.

Figure 5. Kinetics of cell growth, glycerol uptake, succinic acid and acetic acid production during culture of strain RIY420 in fed-batch bioreactor. Values are means and standard deviations calculated from two independent experiments. Red arrow represents glycerol feed in time.

16

Figure 1

17

Figure 2

18

Figure 3

19

Figure 4 (a)

(b)

20

Figure 5

21

Table 1. Primers applied in this study. Primer name LEU2-P-R1 pTEF-EYK-R2-EcoR1 GUT1-L-qPCR GUT1-R-qPCR ACT-F ACT-R

Sequence (5’→3’) CTCAAGTTCTCTCTTAACATGAAGCCC AGCAGGAATTCATTCGATTTGTCTTAGAGGAACGC CCCTGTCCACCTACTTTGCC TTGGAGGTGTCGGTGATGTG GGCCAGCCATATCGAGTCGCA TCCAGGCCGTCCTCTCCC

22

Table. 2 Comparison of SA production by Y. lipolytica strains RIY420 and PGC01003 in free cell batch bioreactor. Values are means and standard deviations calculated from two independent experiments. Strain

Fermentation time (h)

DCW (g/L)

SA titre (g/L)

SA yield SA (g/g) productivity (g/L.h)*

PGC01003

72

26.2±2.4

16.2±0.8

0.18±0.0

0.22±0.0

Specific SA production rate (g/gDCW.h)* 0.009±0.001

RIY420

38

23.8±0.7

21.4±0.1

0.25±0.0

0.56±0.0

0.024±0.001

* The values are the average at 72 h and 38 h of culture for strain PGC01003 and RIY420, respectively.

23

Table. 3 Comparison of SA production by Y. lipolytica strains RIY420 and PGC01003 in isFBB. Values are means and standard deviations calculated from two independent experiments. Data for stain PGC01003 are from Li et al. 2017. strain

DCW (g/L)

SA titre (g/L)

SA yield (g/g)

SA productivity (g/L.h)

PGC01003

31.5±1.0

25.7±1.0

0.26±0.01

0.91±0.01

RIY420

19.1±0.5

21.0±0.6

0.25±0.00

0.66±0.02

24

Specific SA production rate (g/gDCW.h) 0.028±0.001

Reference

0.034± 0.000

This study

Li et al. 2017

Table 4. Comparison of SA production by Y. lipolytica strains RIY420 and PGC01003 in fedbatch fermentation. Values are means and standard deviations calculated from two independent experiments. Strain

Time (h)

SA titre (g/L)

SA yield (g/g)

SA productivity (g/L.h)

PGC01003

400

160

0.42

0.40

Specific SA production rate (g/gDCW.h) 0.01

RIY420

408

178±1

0.46±0.02

0.44±0.00

0.02±0.00

25

Reference

Gao et al. 2016 This study

Highlights Low productivity caused expensive production cost of biobased succinic acid (SA) High productivity contributes to reduction in process cost Increasing glycerol uptake rate and SA productivity by overexpression of gene GUT1 The process duration to yield the highest concentration of SA was reduced by 9% Overexpression strain developed cost effective and efficient SA production process

26

Graphical abstract

27

Declaration of interests

☒ The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

☐The authors declare the following financial interests/personal relationships which may be considered as potential competing interests:

28