Enzymatic activity and gene expression changes in zebrafish embryos and larvae exposed to pesticides diazinon and diuron

Accepted Manuscript Title: Enzymatic activity and gene expression changes in zebrafish embryos and larvae exposed to pesticides diazinon and diuron Authors: Mirna Velki, Henriette Meyer-Alert, Thomas-Benjamin Seiler, Henner Hollert PII: DOI: Reference:

S0166-445X(17)30307-7 https://doi.org/10.1016/j.aquatox.2017.10.019 AQTOX 4781

To appear in:

Aquatic Toxicology

Received date: Revised date: Accepted date:

9-9-2017 23-10-2017 24-10-2017

Please cite this article as: Velki, Mirna, Meyer-Alert, Henriette, Seiler, ThomasBenjamin, Hollert, Henner, Enzymatic activity and gene expression changes in zebrafish embryos and larvae exposed to pesticides diazinon and diuron.Aquatic Toxicology https://doi.org/10.1016/j.aquatox.2017.10.019 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Aquatic Toxicology

Enzymatic activity and gene expression changes in zebrafish embryos and larvae exposed to pesticides diazinon and diuron

Mirna Velki1,2*, Henriette Meyer-Alert1, Thomas-Benjamin Seiler1, Henner Hollert1

1

Department of Ecosystem Analysis, Institute for Environmental Research, RWTH Aachen University,

Worringerweg 1, 52074 Aachen, Germany 2

Department of Biology, Josip Juraj Strossmayer University of Osijek, Cara Hadrijana 8/A, 31000

Osijek, Croatia

Dipl.-Biol. Henriette Meyer-Alert, [email protected] Dr. rer. nat. Thomas-Benjamin Seiler, [email protected] Prof. Dr. rer. nat. Henner Hollert, [email protected]

*Corresponding author Mirna Velki, PhD, assistant professor Josip Juraj Strossmayer University in Osijek Department of Biology Cara Hadrijana 8/A, 31000 Osijek Croatia E-mail: [email protected] ; [email protected]

Highlights •

Suborganismic responses of zebrafish early life stages to diazinon and diuron.

•

Significant effects on enzymatic responses and gene expression changes. 1

•

Different sensitivity of different developmental stages of zebrafish.

•

Partial recovery of enzyme activity 48 h after the end of exposure.

Abstract The zebrafish as a test organism enables the investigation of effects on a wide range of biological levels from molecular level to the whole-organism level. The use of fish embryos represents an attractive model for studies aimed at understanding toxic mechanisms and the environmental risk assessment of chemicals. In the present study, a zebrafish (Danio rerio) in vivo model was employed in order to assess the effects of two commonly used pesticides, the insecticide diazinon and the herbicide diuron, on zebrafish early life stages. Since it was previously established that diazinon and diuron cause effects at the whole-organism level, this study assessed the suborganismic responses to exposure to these pesticides and the enzymatic responses (biochemical level) and the gene expression changes (molecular level) were analyzed. Different exposure scenarios were employed and the following endpoints measured: acetylcholinesterase (AChE), carboxylesterase (CES), ethoxyresorufin-O-deethylase (EROD), glutathione-S-transferase (GST), catalase (CAT) and glutathione peroxidase (GPx) activities; and gene expressions of the corresponding genes: acetylcholinesterase (ache), carboxylesterase (ces2), cytochrome P450 (cyp1a), glutathione-S-transferase (gstp1), catalase (cat), glutathione peroxidase (gpx1a) and additionally glutathione reductase (gsr). Significant changes at both the biochemical and the molecular level were detected. In addition, different sensitivities of different developmental stages of zebrafish were determined and partial recovery of the enzyme activity 48 h after the end of the exposure was observed. The observed disparity between gene expression changes and alterations in enzyme activities points to the necessity of monitoring changes at different levels of biological organization. Different exposure scenarios, together with a comparison of the responses at the biochemical and molecular level, provide valuable data on the effects of diazinon and diuron on low organizational levels in zebrafish embryos and larvae.

Keywords: Danio rerio; diazinon; diuron; enzymatic activity; gene expression

1. Introduction Intensive use of pesticides worldwide leads to extensive production and application of compounds of diverse modes of action. Around 131,000 tons of herbicides and 21,000 tons of insecticides were sold in the EU in 2014 (Eurostat, 2016). But despite the benefits that result from 2

pesticide usage (e.g. protection of crop plants and increased production of food, prevention of spoilage of stored foods, control of the populations of disease vector organisms), their usage can also lead to the contamination of the environment to a considerable extent (Aktar et al., 2009). Pesticides enter the environment via periodic inputs from accidental or controlled sources (urban and industrial discharges) and from diffuse sources originating from domestic and agricultural activities (Akcha et al., 2012). Depending on their chemical properties, nature of the soil and method of application, the compounds can contaminate the soil or become subject to leaching due to runoff from rain water, which consequently leads to contamination of surface and ground water (Domagalski and Dubrovsky, 1992). Consequently, pesticides pose a potential hazard to a number of non-target organisms not only in terrestrial ecosystems, but also in the aquatic ecosystems. In recent years, the usage of the zebrafish (Danio rerio) embryo test has gained increasing popularity as a valuable model in aquatic ecotoxicology for the assessment of the effects of various pollutants. Among various practical advantages, such as relatively easy maintenance and breeding, the embryos are transparent and fully develop most organ systems within 96 h post-fertilization (hpf), making them an ideal vertebrate model system (Jaja-Chimedza et al., 2012). The usage of zebrafish embryos is in accordance with the 3Rs principle of animal research (Replacement, Reduction and Refinement) (Russell and Burch, 1959) and protocol using fish eggs under short-term exposure has replaced the former mandatory acute fish test for the toxicity evaluation of wastewater in Germany (DIN, 2001). In addition to being accepted as a tool in waste water monitoring, zebrafish embryos are being used for the assessment of adverse effects of various groups of substances, including pesticides. The utilization of zebrafish as a test organism enables the investigation of effects on a wide range of biological levels – from the molecular to the whole-organism level – and the use of fish embryos represents an attractive model for studies aimed at understanding toxic mechanisms and environmental risk assessment of chemicals (Scholz et al., 2008). In the present study, a zebrafish in vivo model was employed in order to investigate the toxic mechanisms of two commonly used pesticides – the insecticide diazinon and the herbicide diuron – 3

on zebrafish early life stages. With respect to the current study, the zebrafish embryos and larvae have been used previously to investigate the effects of these pesticides and it was determined that both diazinon and diuron significantly affect behavioral endpoints (Velki et al., 2017). Since the effects on the whole-organism level were established, the current study assessed the suborganismic responses in order to gain more knowledge on the mechanisms of action and to enable a better characterization of the impacts of these pesticides on zebrafish. To obtain a detailed insight into the effects of the investigated pesticides, the responses at the biochemical (enzymatic responses) and molecular (gene expression changes) level were analyzed. The quantification of enzyme responses and analyses of gene expression in homogenates of embryos/larvae enabled a relatively fast screening since in both types of samples (i.e. for enzyme activities and for gene expression) multiple endpoints could be assessed. The endpoints for both enzymatic responses and gene expression were chosen based on the main mode of action of the investigated pesticides. The organophosphate diazinon inhibits the enzyme acetylcholinesterase (AChE) leading to the inactivation of the neurotransmitter acetylcholine which is essential for the onward transmission of stimuli (Ecobichon and Joy, 1994). Diuron is a phenylurea herbicide that blocks the electron transfer to the photosystem II which inhibits photosynthetic oxygen and energy production in plants and algae (Wessels and Van der Veen, 1956), and it was determined that in aquatic organisms diuron can cause an increased production of reactive oxidative species (ROS) and oxidative stress (Behrens et al., 2016). Therefore, the following enzyme responses were measured: AChE activity (biomarker of organophosphate exposure), carboxylesterase (CES) activity (biomarker of organophosphate exposure and phase I detoxification enzyme), ethoxyresorufin-O-deethylase (EROD) activity (phase I detoxification enzyme), glutathioneS-transferase (GST) activity (phase II detoxification enzyme and oxidative stress biomarker), catalase (CAT) activity (oxidative stress biomarker) and glutathione peroxidase (GPx) activity (oxidative stress biomarker). Regarding the gene expression, the following corresponding genes were selected: acetylcholinesterase (ache), carboxylesterase (ces2), cytochrome P450 (cyp1a), glutathione-S4

transferase (gstp1), catalase (cat), glutathione peroxidase (gpx1a) and additionally glutathione reductase (gsr). An additional goal in this study was to assess the sensitivity of different developmental stages and the possible recovery after exposure. In order to achieve this goal different exposure scenarios were employed. Considering the previously determined effects of investigated pesticides on whole-organism level and taking into account the main mode of actions, it was expected that diazinon and diuron would cause changes in measured parameters in zebrafish on both enzymatic and gene expression level. The implemented experimental setup, together with a comparison of the responses at biochemical and molecular level, provide valuable data on the effects of diazion and diuron on low organizational levels in zebrafish embryos and larvae.

2. Materials and methods 2.1. Chemicals The following chemicals were used in this study and purchased from Sigma-Aldrich (Sigma Aldrich Chemie GmbH, Steinheim, Germany): O,O-diethyl-O-[2-isopropyl-4-methyl-6-pyrimidyl] phosphorothioate (diazinon 100 %, CAS Number: 333-41-5); N-(3,4-dichlorophenyl)-N,N-dimethylurea (diuron ≥98 %, CAS Number: 330-54-1); dimethyl sulfoxide (DMSO) (CAS Number: 67-68-5); calcium chloride dihydrate (CAS Number: 10035-04-8); magnesium sulfate heptahydrate (CAS Number: 10034-99-8); sodium hydrogen carbonate (CAS Number: 144-55-8); potassium chloride (CAS Number: 7447-40-7); 5,5′-dithiobis(2-nitrobenzoic acid) (DTNB) (CAS Number: 69-78-3); acetylthiocholine iodide (CAS Number: 1866-15-5); hydrogen peroxide (CAS Number: 7722-84-1); 4nitrophenyl acetate (CAS Number: 830-03-5); acetonitrile (CAS Number: 75-05-8); resorufin (CAS Number: 635-78-9); 7-ethoxyresorufin (CAS Number: 5725-91-7); methanol (CAS Number: 67-56-1); β-Nicotinamide adenine dinucleotide 2′-phosphate reduced tetrasodium salt hydrate (β-NADPH) (CAS Number: 2646-71-1); ethylenediaminetetraacetic acid (EDTA) (CAS Number: 60-00-4); sodium azide (CAS Number: 26628-22-8); glutathione reductase from baker's yeast (S. cerevisiae) (CAS 5

Number: 9001-48-3); L-glutathione reduced (GSH) (CAS Number: 70-18-8); 1-chloro-2,4dinitrobenzene (CDNB) (CAS Number: 97-00-7); bicinchoninic acid (BCA) kit for protein determination (BCA1). For the gene expression analysis the following kits/chemicals were purchased: NucleoSpin RNA Isolation Kit (Macherey and Nagel, Düren, Germany); M-MuLV reverse transcriptase, random primers mix, dNTPs (New England Biolabs, Frankfurt a.M., Germany); Power SYBR Green PCR Master Mix (Life Technologies/Thermo Fisher Scientific, Darmstadt, Germany). Diazinon and diuron stock solutions were prepared by dilution in DMSO of up to 2 mg mL-1 and stored at 4 °C.

2.2. Test organism Zebrafish maintenance and egg production was performed according to standard procedures (description available in Lammer et al., 2009) and is described in detail in a previous study (Velki et al., 2017). In short, zebrafish adults were kept at 26 ± 1 °C and light-dark cycle of 14:10 hours at the Fraunhofer IME Institute (Aachen, Germany). The eggs were obtained from community mating and only fertilized eggs undergoing cleavage and showing no obvious irregularities during cleavage (e.g., asymmetry, vesicle formation) or injuries of the chorion were selected for the exposure tests (OECD, 2013). The selected fertilized eggs were placed at 27 ᵒC in pre-aerated artificial water (294.0 mg/L CaCl2 · 2H2O; 5.5 mg/L KCl; 123.3 mg/L, magnesium sulfate MgSO4 · 7 H2O; 63.0 mg/L NaHCO3; after aeration the pH was adjusted to 7.8) which was prepared according to ISO standards (ISO, 2007) and exposures were conducted when the embryos were in a 32-cell-stage (ca. 2 hpf). The usage of zebrafish was in accordance with the German law for Animal Protection (“Tierschutzgesetz”) and EU Directive on the protection of animals used for scientific purposes (EU D2010/63/EU). Namely, in the experiments zebrafish embryos and larvae of up to 98 hpf were used and since zebrafish younger than 120 hpf are not considered animals (Strähle et al., 2012) no animal test authorization was

6

required according to German legislation. The used term “larva” refers to 98 hpf hatched embryos that are using up the yolk-sac reserves and still do not feed externally.

2.3. Exposure experiments for the assessment of enzymatic activity and gene expression For the assessment of pesticide effects on enzymatic activities and the determination of sensitivity and recovery of different developmental stages, fertilized zebrafish eggs were exposed to diazinon and diuron applying 4 exposure scenarios: 1) fertilized eggs were exposed for 48 h – “early exposure” (2 hpf – 50 hpf exposure), 2) fertilized eggs were exposed for 96 h – “prolonged exposure” (2 hpf – 98 hpf exposure), 3) fertilized eggs were first placed in artificial water for 48 h and then exposed for 48 h – “late exposure” (50 hpf – 98 hpf exposure), 4) fertilized eggs were exposed for 48 h and then placed in artificial water for 48 h recovery – “recovery exposure” (2 hpf – 50 hpf exposure, 50 hpf – 98 hpf recovery). The pesticides were tested in five different concentrations prepared as dilutions of respective DMSO stock solution in artificial water, with all conditions containing a final DMSO concentration of 0.1 %. The exposure concentrations were sublethal and were selected based on the no-observableeffect-concentration (NOEC) determined in a previous study (Velki et al., 2017). Namely, NOEC for both pesticides was 2 mg L-1, equaling 6.6 µM diazinon and 8.6 µM diuron, and this was chosen as the highest exposure concentration. Besides NOEC, four additional concentrations were assessed for both pesticides, i.e. 6.6, 3.3, 1.65, 0.33 and 0.066 µM diazinon, and 8.6, 4.3, 2.15, 0.43 and 0.086 µM diuron were tested. Exposure scenarios were conducted in borosilicate glass vessels with 50 embryos exposed in 50 mL of solution at 26 ± 1°C and 14 h photoperiod. In order to determine the effects of the pesticides on gene expression and to compare it to the enzyme responses, additional sets of exposures were conducted. Specifically, for the assessment of gene expression changes, fertilized zebrafish eggs were exposed to diazinon and diuron employing the early (48 h exposure, 2 hpf – 50 hpf) and the prolonged (96 h exposure, 2 hpf – 98 hpf) exposure scenarios. Zebrafish were exposed to three concentrations of diazinon and diuron, i.e. to 6.6, 1.65 7

and 0.066 µM diazinon and to 8.6, 2.15 and and 0.086 µM diuron (the lowest, middle and the highest concentration used in assessment of enzyme responses). Again, pesticides were prepared as dilutions of respective DMSO stock solutions in artificial water (the final DMSO concentration was 0.1 %). Exposures were conducted in borosilicate glass vessels with 30 embryos exposed in 30 mL of solution at 26 ± 1°C and 14 h photoperiod. In all experiments the semi-static renewal technique was applied, i.e. the pesticide test solutions were regularly renewed every 24 h to ensure the maintenance of the pesticide concentrations. Since DMSO was used as a solvent, the analyses of pesticide effects on both enzymatic activity and gene expression were made in comparison to the DMSO solvent control condition. For that it was ensured that the same DMSO concentration of 0.1% was kept in all pesticide exposures and solvent control conditions (hereinafter abbreviated as “control”). Experiments were repeated five times and repetitions were conducted as independent experiments (for every repetition zebrafish embryos from different batches were used).

2.4. Sample preparation At the end of each exposure scenario, embryos/larvae (50 for the enzyme activity and 30 for the gene expression) were transferred in a glass vessel containing benzocaine (saturated solution in water). After ca. 30 s in benzocaine, embryos/larvae were washed twice in phosphate buffered saline. Embryos/larvae were then transferred to 2 mL tubes and the excess of phosphate buffered saline was removed. For enzyme activity measurements, 600 μL of buffer (1.8 L 0.1 M Na2HPO4 adjusted with 0.5 L 0.1 M NaH2PO4 to pH 7.8) in tubes with 50 embryos/larvae was added. Samples were snap frozen in liquid nitrogen and stored at –80 °C until homogenization. When all sample replicates were collected, they were thawed on ice, homogenized for ca. 20 s (homogenizer VDI 12, S12N-5S, VWR International GmbH, Darmstadt, Germany) and centrifuged at 10000 g, 15 min, 4 °C. Supernatants were aliquoted and used for enzyme activity measurements. 8

In the case of samples for gene expression measurements, tubes with 30 embryos/larvae were snap frozen in liquid nitrogen and stored at -80 °C. When all sample replicates were collected, they were thawed on ice and used for isolation of RNA.

2.5. Enzyme activity measurements 2.5.1. Measurement of acetylcholinesterase (AChE) activity The measurement of the AChE activity was conducted according to the method of Ellman et al. (1961) and was adapted for measurement in 96-well plate. The reaction medium consisted of 180 μL of sodium phosphate buffer (0.1 M, pH 7.2), 10 μL of DTNB (1.6 mM), 10 μL of acetylthiocholine iodide (156 mM) and 7.5 μL of sample. The increase in absorbance was measured as triplicates at 412 nm for 5 min in 10 s steps at 25°C by using an Infinite® 200 micro plate reader (Tecan, Männedorf, Switzerland). The enzymatic activity was expressed as nmol of acetylthiocholine hydrolysed per min per mg of protein and for calculations the molar extinction coefficient of 13600 M-1 cm-1 was used.

2.5.2. Measurement of carboxylesterase (CES) activity The activity of CES was measured according to Hosokawa and Satoh (2002) with some modifications and was adapted for measurement in 96-well plate. The reaction medium was comprised of 15 µL of sample and 150 μL of 4-nitrophenyl acetate (1 mM). The increase in absorbance was measured as triplicates at 405 nm for 3 min in 10 s steps at 25°C by using an Infinite® 200 micro plate reader (Tecan, Männedorf, Switzerland). The enzymatic activity was expressed as nmol of 4-nitrophenol formed per min per mg of protein and for calculations the molar extinction coefficient of 16400 M−1 cm−1 was used.

2.5.3. Measurement of ethoxyresorufin-O-deethylase (EROD) activity The measurement of the EROD activity was conducted based on the methodology described by Schiwy et al. (2015) with some modifications. First, 35 μL of sample (or resorufin in the case of 9

standard curve) and 60 μL of 7-ethoxyresorufin (0.6 μM in methanol) were added to 96-well plate and incubated for 10 min at 28 °C in darkness to allow the enzyme to attach to its substrate. Then 45 μL of β-NADPH (3.35 mM) was added and incubated for 2 min at room temperature in darkness. The increase in fluorescence was measured as triplicates at 530 nm excitation and 590 nm emission for 30 min in 30 s steps at 25°C by using an Infinite® 200 micro plate reader (Tecan, Männedorf, Switzerland). The enzymatic activity was calculated based on the standard curve with resorufin and expressed as fmol of resorufin formed per min per mg of protein.

2.5.4. Measurement of glutathione-S-transferase (GST) activity The measurement of the GST activity was conducted following the method of Habig et al. (1974) and adapted for the measurement in 96-well plate. The reaction medium consisted of 180 μL of CDNB (1 mM), 12.5 µL of sample and 50 µL of GSH (25 mM). The increase in absorbance was measured as triplicates at 340 nm for 3 min in 10 s steps at 25°C by using an Infinite® 200 micro plate reader (Tecan, Männedorf, Switzerland). The enzymatic activity was expressed as nmol of conjugated GSH in one minute per mg of proteins and for calculations the molar extinction coefficient of 9600 M1

cm-1 was used.

2.5.5. Measurement of catalase (CAT) activity The measurement of CAT activity was conducted following the method of Claiborne (1985). The reaction medium contained 400 μL of hydrogen peroxide (0.02 M, prepared in sodium phosphate buffer (0.1 M, pH 7.2)) and 40 µL of sample. The decrease in absorbance was measured as triplicates at 240 nm for 2 min in 10 s steps at 25°C by using an Infinite® 200 micro plate reader (Tecan, Männedorf, Switzerland). To calculate hydrogen peroxide concentration, a molar extinction coefficient of 42.6 M-1 cm-1 was used and the activity was expressed as μmol of degraded hydrogen peroxide per min per mg of protein.

10

2.5.6. Measurement of glutathione peroxidase (GPx) activity The activity of GPx was measured according to the method of Wendel (1980) and adapted for the measurement in 96-well plate. The reaction cocktail contained sodium azide (1 mM), β-NADPH (120 mM), glutathione reductase and GSH (200 mM). In each microplate well 160 µL of reaction cocktail was mixed with 40 µL of sample. After stabilization of this mixture for 5 min, 20 µL of hydrogen peroxide (50 mM) was added and the increase in absorbance was measured as triplicates at 340 nm for 5 min in 10 s steps at 25°C by using an Infinite® 200 micro plate reader (Tecan, Männedorf, Switzerland). The enzymatic activity was expressed as nmol of NADPH oxidized per min per mg of protein and for calculations the molar extinction coefficient of 6220 M−1 cm−1 was used.

2.5.7. Measurement of protein concentration For calculation of the specific enzyme activities (activity expressed as amount of used substrate per min per mg of protein), the respective protein concentrations in all samples were measured using the BCA kit. The standard curve was made using the bovine serum albumin (BSA) standard provided in the kit. Protein concentrations of the samples were determined in a 96-well plate by adding 200 µL of a working solution (prepared according to the kit instructions) to 10 µL of the sample. After incubation for 30 min at 37 °C, the absorbance was recorded at 562 nm by using an Infinite® 200 micro plate reader (Tecan). The protein concentrations were then determined by comparison to a standard curve and used for the calculation of the specific enzyme activities. The calculated specific activities were then expressed relative to the average value of the controls (i.e. making control equal to 1).

2.6. Gene expression measurements 2.6.1. RNA isolation and cDNA synthesis

11

For the gene expression analysis total RNA from zebrafish embryos/larvae was extracted using the NucleoSpin RNA kit. In tubes with zebrafish embryos/larvae 450 µL of lysis buffer (provided in the kit) was added and the samples were homogenized for ca. 20 s (VDI 12, S12N-5S, VWR International GmbH, Darmstadt, Germany). The obtained homogenate was centrifuged at 14000 g, 10 min, 4 °C. The supernatant was used in the following steps and the extraction was further performed according to the kit instructions. The RNA concentration and purity were determined spectrophotometrically using BioDrop-µLITE (BioDrop Ldt., Cambridge, UK). The average RNA yield was 400 ng/µL, while the A260/A280 ratio ranged from 2.05 to 2.1. For the cDNA synthesis, 1 µg of total RNA from each sample was reverse transcribed into cDNA in a 20 µL reaction mixture containing the random primer mix, reverse transcriptase M-MuLV RT and dNTPs according to the supplier’s instructions.

2.6.2. Quantitative real-time PCR analysis (qRT-PCR) Gene specific primers for ache, ces2, cyp1a, gstp1, cat, gpx1a, gsr, eef1a1l2 and actb2 were either designed using the Primer-BLAST or previously published sequences were used. The qRT-PCR was performed on StepOnePlus Real-Time PCR System (Applied Biosystems) using the Power SYBR Green PCR Master Mix according to the supplier’s instructions for quantification of gene expression. After denaturation at 95 °C for 10 min, 40 cycles of amplification were carried out with denaturation at 95 °C for 15 s, annealing and elongation at 61 °C for 1 min. To ensure that a single product was amplified, melt curve analysis was performed on the PCR products and polyacrylamide gel electrophoresis was performed for each gene. Samples were analyzed in technical triplicates and for determination of PCR efficiencies, composite cDNA samples were serially diluted and run in a qPCR reaction. The average PCR efficiencies were the following: 109 % for ache; 101 % for ces2; 102 % for cyp1a; 91 % for gstp1; 109 % for cat; 102 % for gpx1a; 108 % for gsr; 97 % for eef1a1l2 and 96 % for actb2. Expression of the target genes was quantified according to the model reported by Pfaffl (2001). The expression level of the target gene was normalized to the two reference genes – eef1a1l2 12

and actb2 (for all target genes geometric mean of the expression of these two reference genes was used as a normalization factor). The levels of gene expression were expressed relative to the average value of the controls (i.e. making control equal to 1).

Table 1. Primer sequences, amplicon sizes, accession numbers and annealing temperatures used in qPCR reaction. Gene

Primer sequence (5’ – 3’) F

CATACGCACAATACGCTGCC

R

TACACAGCACCATGCGAGTT

F

GTGGAGCTTGCATGTTTAAGG

R

GCTGATCTCCTGTGCTGAAGTA

cyp1a

F

AAAGACACCTGCGTGTTTGTAA

*

R

GAGGGATCCTTCCACAGTTCT

gstp1

F

TGGTGCTGTTTCAGTCCAAG

**

R

AGCCTCACTGTCGTTTTTGC

F

TCTCCTGATGTGGCCCGATA

R

GGTTTTGCACCATGCGTTTC

F

GAGGCACAACAGTCAGGGATT

R

CTTCATTCTTGCAGTTCTCCTGGT

F

CGGCCTCAACCTCAGTCAAA

R

TGCTTCATCAGGTGTCAGAAGG

eef1a1l2

F

GTGGTAATGTGGCTGGAGAC

***

R

TGTGAGCAGTGTGGCAATC

actb2

F

GAAGATCAAGATCATTGCCCCAC

****

R

TCGGCGTGAAGTGGTAACAG

ache

ces2

cat

gpx1a

gsr

Amplicon size (bp)

Accession number

Annealing temperature

118

NM_131846.2

61 °C

129

NM_001077252.1

61 °C

68

NM_131879.2

60 °C

80

NM_131734.3

60 °C

169

NM_130912.2

61 °C

126

NM_001007281.2

60 °C

142

NM_001020554.1

60 °C

138

NM_001039985.1

59 °C

179

NM_181601.4

59 °C

Gene abbreviations: ache – acetylcholinesterase; ces2 – carboxylesterase 2; cyp1a – cytochrome P450, family 1, subfamily A; gstp1 – glutathione S-transferase pi 1; cat – catalase; gpx1a – glutathione peroxidase 1a; gsr – glutathione reductase; eef1a1l2 – eukaryotic translation elongation factor 1 alpha 1, like 2; actb2 – actin, beta 2. * Bräunig et al. (2015) ** designed within the DanTox project at Institute for Environmental Research, RWTH Aachen University *** Kühnert (2015) **** Primers were designed at Institute for Environmental Research, RWTH Aachen University by Sina Volz using the NCBI Primer Blast BeaconPrimer and NetPrimer.

13

2.7. Data analysis Data analyses and plotting were performed using the software R version 3.1.2. (normality testing) and GraphPad Prism 5 (other analyses and plotting). The data were checked for normality prior to further analysis (Shapiro-Wilk normality test). The enzymatic responses were normally distributed (in several cases data were log-transformed to obtain normality) and in order to determine the significance level reached between the control and treatment groups, one-way analysis of variance (ANOVA) was applied followed by Dunnett’s multiple comparison test. For the gene expression results the distribution of some response variables departed significantly from normality, so the non-parametric statistics were considered adequate for the statistical analysis of the data obtained. Gene expression data were therefore analyzed using the non-parametric Kruskal– Wallis one-way analysis of variance by ranks followed by Dunn´s multiple comparison test. The probability level for statistical significance was set to p<0.05 throughout the study. The data analyzed using ANOVA (enzymatic responses) are presented as mean ± standard deviation, whereas data analyzed using Kruskal–Wallis (gene expression responses) are presented using the Tukey's boxplot (the bottom and the top of the box are 25th and 75th percentile, the horizontal line in the box is the median and the ends of the whiskers represent 1.5 times of the interquartile distance).

3. Results 3.1. Enzyme activity results 3.1.1. Enzyme activities measured in embryos after early exposure (2 hpf – 50 hpf exposure) The measurement of enzyme activities in zebrafish embryos exposed to diazinon and diuron for 48 h showed significant differences in CES, EROD and GST activities (Fig. 1) compared to the control. The changes of EROD and GST activity were observed in only one concentration – the induction of EROD at 0.33 µM diazinon and the decrease of GST at 0.086 µM diuron. Regarding the CES activity, the significant inhibition was observed in all diazinon concentrations applied and the

14

activity decreased up to 51 % (at 6.6 µM). AChE, CAT and GPx activity showed no significant changes after the exposures to diazinon and diuron.

Figure 1. Relative enzyme activity measurements in zebrafish embryos exposed to diazinon (DIA) and diuron (DIU) for 48 h (“early exposure”; 2 hpf – 50 hpf exposure). Bars represent means ± standard 15

deviations (N=5). Significant differences compared to control are labelled with * (p<0.05), ** (p<0.01) and *** (p<0.001).

3.1.2. Enzyme activities measured in larvae after prolonged exposure (2 hpf – 98 hpf exposure) Measurement of enzyme activities in zebrafish larvae exposed to diazinon and diuron for 96 h showed significant differences in AChE and CES activities when compared to the control (Fig. 2). Specifically, diazinon caused significant inhibition of AChE activity of 31 and 49 % at the two highest concentrations, i.e. at 3.3 and 6.6 µM, respectively. Regarding the CES activity, the significant inhibition was observed for all diazinon concentrations, and the activity decreased up to 61 % (at 6.6 µM). For the CES activity, significant changes were detected also after diuron exposure. At all diuron concentrations a tendency of an increase in CES activity was observed, even though only at two concentrations (0.086 and 2.15 µM) significant increase in CES activity was recorded. Other measured enzyme activities showed no significant changes after the exposures to diazinon and diuron.

16

Figure 2. Relative enzyme activity measurements in zebrafish larvae exposed to diazinon (DIA) and diuron (DIU) for 96 h (“prolonged exposure”; 2 hpf – 98 hpf exposure). Bars represent means ± standard deviations (N=5). Significant differences compared to control are labelled with * (p<0.05), ** (p<0.01) and *** (p<0.001).

17

3.1.3. Enzyme activities measured in larvae after late exposure (50 hpf – 98 hpf exposure) The measurement of enzyme activities in zebrafish larvae exposed from 50 hpf to 98 hpf are shown in Fig. 3. Similar to the prolonged exposure (2 hpf – 98 hpf), significant differences in AChE and CES activities were detected. Namely, diazinon caused significant inhibition of AChE activity of 31 % at the highest concentration applied (6.6 µM). Regarding the CES activity, the significant inhibition was observed for all diazinon concentrations, and the activity decreased down to 42 %. In contrast to the prolonged exposure (2 hpf – 98 hpf), where an increase in CES was observed after diuron exposure (Fig. 2), here at all applied diuron concentrations showed lower activity and a significant decrease was obtained at 0.086 and 4.3 µM. The significant changes in other measured enzymes could not be detected.

18

Figure 3. Relative enzyme activity measurements in zebrafish larvae exposed to diazinon (DIA) and diuron (DIU) for 48 h (“late exposure”; 50 hpf – 98 hpf exposure). Bars represent means ± standard deviations (N=5). Significant differences compared to control are labelled with * (p<0.05), ** (p<0.01) and *** (p<0.001).

19

3.1.4. Enzyme activities measured in larvae after recovery exposure (2 hpf – 50 hpf exposure, 50 hpf – 98 hpf recovery) The measurement of enzyme activities in zebrafish larvae exposed for 48 h and then placed in artificial water for 48 h are shown in Fig. 4. Significant changes were observed only for CES activity after exposure to diazinon. Specifically, significant inhibition of CES activities was determined at 0.33, 1.65, 3.3 and 6.6 µM diazinon. Compared to CES inhibition in zebrafish embryos after early exposure (2 hpf – 50 hpf, Fig. 1), here the significant inhibition was not detected at the lowest concentration applied, i.e. at 0.066 µM, so partial recovery can be noticed. The level of CES inhibition was similar as in embryos exposed for 48 h; it reached 57 % at 6.6 µM of diazinon. Significant changes in other measured enzymes could not be detected.

20

Figure 4. Relative enzyme activity measurements in zebrafish larvae exposed to diazinon (DIA) and diuron (DIU) for 48 h followed by 48 h recovery (“recovery exposure”; 2 hpf – 50 hpf exposure, 50 hpf – 98 hpf recovery). Bars represent means ± standard deviations (N=5). Significant differences compared to control are labelled with * (p<0.05), ** (p<0.01) and *** (p<0.001).

21

3.2. Gene expression results 3.2.1. qRT-PCR results measured in embryos after early exposure (2 hpf – 50 hpf exposure) Results of the measurement of the gene expression in zebrafish embryos exposed to diazinon and diuron for 48 h are shown in Fig. 5. Significant changes were observed in the case of ces2, cyp1a, cat and gpx1a. Namely, diazinon caused an increase in the expression of ces2 (Fig. 5) while at the enzymatic level the activity of the enzyme was inhibited (Fig. 1). Diuron also caused an increase in the expression of ces2 (Fig. 5), even though at the enzymatic level no significant changes could be observed (Fig. 1). Regarding the cyp1a expression, a significant increase after exposure to diuron was detected (Fig. 5), even though at the enzymatic level no significant changes could be observed (Fig. 1). Changes in CAT and GPX activity were not recorded after exposure to the investigated pesticides (Fig. 1), however the expression of cat was significantly decreased after exposure to diazinon whereas the expression of gpx1a was significantly increased after exposure to diuron (Fig. 5).

22

Figure 5. qRT-PCR results of selected genes measured in zebrafish embryos exposed to diazinon (DIA) and diuron (DIU) for 48 h (“early exposure”; 2 hpf – 50 hpf exposure). The results are expressed as 23

normalized gene expression and presented using Tukey's boxplot (N=5). Significant differences compared to control are labelled with * (p<0.05), ** (p<0.01) and *** (p<0.001).

3.2.2. qRT-PCR results measured in larvae after prolonged exposure (2 hpf – 98 hpf exposure) The results of the gene expression measurements in zebrafish larvae exposed to diazinon and diuron for 96 h are shown in Fig. 6. Significant changes were observed in all measured target genes. Specifically, diazinon caused an increase in the expression of ache and ces2 (Fig. 6), while at the enzymatic level the activities of these enzymes were decreased (Fig. 2). Diuron also caused an increase in the expression of ces2 (Fig. 6), which is in accordance with the increase in CES activity (Fig. 2). Regarding the cyp1a expression, same as for the 48 h, a significant increase after the exposure to diuron was detected (Fig. 6), even though at the enzymatic level no significant changes could be observed (Fig. 2). Changes in GST, CAT and GPX activity were not recorded after the exposure to the pesticides (Fig. 2), however the expression of gstp1 was significantly increased after exposure to diazinon, and the expression of cat, gpx1a and gsr were significantly increased after exposure to diazinon and diuron (Fig. 6).

24

Figure 6. qRT-PCR results of selected genes measured in zebrafish larvae exposed to diazinon (DIA) and diuron (DIU) for 96 h (“prolonged exposure”; 2 hpf – 98 hpf exposure). The results are expressed 25

as normalized gene expression and presented using Tukey's boxplot (N=5). Significant differences compared to control are labelled with * (p<0.05), ** (p<0.01) and *** (p<0.001).

4. Discussion In the present study, the effects of the insecticide diazinon and the herbicide diuron on zebrafish embryos and larvae were investigated by assessing the responses at the biochemical (enzymatic responses) and molecular (gene expression changes) level. The modes-of-action of these pesticides are naturally different, and even though it would be expected that an exposure to the insecticide diazinon targeting the nervous system would result in more pronounced adverse effects in zebrafish compared to effects of herbicide diuron targeting photosystem II, a previous study showed that both pesticides have similar acute toxicity on zebrafish larvae and cause changes in behavior (Velki et al., 2017). Regarding the assessment of other effects, studies investigating effects of diuron on zebrafish are very scarce and besides evaluation of developmental toxicity using the fish embryo test (Padilla et al., 2012), no data is available. Effects of diazinon on zebrafish have been investigated in several studies and it was shown that besides behavioral effects diazinon also causes morphological and physiological effects, inhibits AChE activity and increases the abundance of stress protein (Hsp70) (Modra et al., 2011; Yen et al., 2011; Watson et al., 2014). In the present study it was shown that the exposure of zebrafish embryos and larvae to diazinon and diuron leads to changes in enzyme activities and gene expression. Measurements of enzyme activities were conducted after applying four different exposure scenarios which enabled the comparison of sensitivity of different developmental stages and the assessment of possible recovery. The early exposure of 48 h (2 hpf – 50 hpf) to diazinon showed the inhibition of CES activity. Considering that diazinon is an organophosphate, the inhibition was expected due to the mode of action. Surprisingly, there was no change in the activity of AChE. Both AChE and CES are inhibited by organophosphates and AChE activity is commonly used as a biomarker of exposure to organophosphate compounds (e.g. Rickwood and Galloway, 2004; Assis et al., 2011; 26

Ghazala et al., 2014). However, it has been previously established that CES is frequently more sensitive to organophosphate inhibition than AChE (Escartin and Porte, 1997; O’Neill et al., 2004; Wheelock et al., 2005; Collange et al., 2010, etc.) and the higher sensitivity of CES was also confirmed in the present study. Both AChE and CES are inhibited by the same class of pesticide compounds, but these enzymes have different roles in the organism. Namely, AChE is involved in the termination of impulse neurotransmission, whereas CES is a phase I detoxification enzyme. So due to their different roles, as well as different sensitivities to particular compounds, the activities of both enzymes should be always assessed. Regarding the other measured enzyme activities, a significant change in EROD and GST activity was recorded. However, since variances in the responses were high and significant changes were recorded at only one concentration applied, no conclusions could be made. The prolonged exposure (for 96 h, 2 hpf – 98 hpf) revealed a similar response of CES activity after diazinon exposure, i.e. again the inhibition was recorded and longer exposure caused higher level of inhibition compared to early exposure. Also, the prolonged exposure led to a significant inhibition of AChE activity at the two highest concentrations of diazinon. The observed 49 % AChE inhibition at 6.6 μM is in accordance with the inhibition recorded in the study of Yen et al. (2011) where an exposure to 10 μM diazinon for 5 days caused over 50 % AChE inhibition in zebrafish larvae. A comparison of AChE and CES inhibition again revealed the higher inhibition and sensitivity of CES activity. Regarding diuron, the prolonged exposure lead to an increase in CES activity compared to control (which was not observed after early exposure). It is known that CES enzymes play a significant role in the metabolism and subsequent detoxification of many agrochemicals and pharmaceuticals (Redinbo and Potter 2005; Potter and Wadkins 2006). Thus, prolonged exposure to diuron likely induces detoxification mechanisms leading to an increase in CES activity. The late exposure (50 hpf – 98 hpf) enabled the comparison of the response with an early exposure (2 hpf – 50 hpf) and determination of the difference in sensitivity between stages. The obtained results showed that even though the duration of exposure was the same (48 h), different stages of development of the zebrafish embryos gave different responses. In the case of the late 27

exposure, a significant inhibition of both AChE and CES activity was observed. Since after the early exposure for 48 h no inhibition of AChE activity could be detected and the inhibition of CES was lower, it can be concluded that the later stage had a higher sensitivity to diazinon exposure. So the later zebrafish life stage was more susceptible to the pesticide exposure, and the response resembled the one of the prolonged exposure more to. The possible explanation for the difference in susceptibility can be ascribed to the difference in the ontogenetic stage. Namely, several investigations support the idea that fish early stages are commonly most sensitive to chemicals exposure (e.g. Luckenbach et al., 2001; Hallare et al., 2004) and Léonard et al. (2005) reported that the eleutheroembryo may be more sensitive than the embryo. Our results also showed that larvae were more vulnerable to the pesticide exposure than the embryo stage. Similar results have been obtained in studies assessing effects of other pesticides. For example, it was determined that the larval stage of zebrafish had a higher sensitivity compared to the embryo stage after exposure to the organophosphate insecticides phoxim and chlorpyrifos (Wang et al., 2016), acetanilide herbicide butachlor (Wang et al., 2016) and aryloxyphenoxypropionate herbicide cyhalofop-butyl (Cao et al., 2016), and triazole fungicide difenoconazole (Mu et al., 2013). The sensitivity of the larval stage may be due to the fact that the embryonic membrane and chorion prevent the transmission of chemicals into the embryo (e.g. Xu et al. 2008; Embry et al. 2010), while larvae lack the chorion protection (e.g. Fent and Meier, 1992). So in the early exposures, embryos were still protected by the chorion, whereas in the post-hatch life-stage which was used for the late exposure, the lack of a chorion could lead to higher susceptibility to pesticide exposure. Also, as reviewed in Embry et al. (2010), in comparison to the juvenile and adult fish, early life stages may not have the fully developed metabolic pathways to degrade xenobiotics, e.g. lower levels of some cytochrome P450 enzymes in trout embryos compared to adult fish have been recorded (Buhler et al., 1997). Likewise, the late exposure to diuron led to a significant decrease in CES activity, whereas at the early exposure no changes could be detected. This result also points to the different susceptibility of different life stages. More interestingly, the prolonged exposure (2 hpf – 98 hpf) to 28

diuron caused a significant increase in CES which is in contrary to the observed decrease in the late exposure (50 hpf – 98 hpf). The possible explanation for the observed changes could be in the different amounts of pesticide that could entered in zebrafish depending on different developmental stage. In particular, due to the protection of chorion at the early stage, the transmission of pesticide was limited and no significant effect could be observed. Still, the low amounts of diuron could enter even in the embryo stage and the gradual increase of diuron intake in prolonged exposure possibly triggers the stronger metabolizing processes and consequently increase in activity. On the other hand, in the late exposure the absence of chorion led to a rapid intake of diuron which likely caused a decrease in enzyme activity. The involved mechanisms for the observed effect are unknown, even though the obtained results could indicate some form of an adaptive response. For example, one of these responses is hormesis, a phenomenon by which adaptive responses to low doses of otherwise harmful conditions improve the functional ability of organisms (Calabrese, 2008). Even though in this study the characteristic low dose stimulation and high dose inhibition typical for hormetic effects were not observed, differences in uptake of pesticide may have actually led to different exposure concentrations in applied exposure scenarios. The phenomena of hormesis and toxicity thresholds are likely related to activation of adaptive pathways responsible for cellular and physiological homeostasis (Zhang et al., 2008) and it was shown that hormetic effect can be time dependent (Zhang et al., 2013). This further confirms the possibility that similar adaptive mechanism caused observed effects. The last applied exposure scenario was the recovery exposure where 48 h exposure to the pesticides (2 hpf – 50 hpf exposure) was followed by a removal of the pesticide and placement of zebrafish in artificial water for an additional 48 h (50 hpf – 98 hpf recovery). Changes were observed only after the exposure to diazinon where the CES activity was inhibited. Compared to the early exposure (2 hpf – 50 hpf), it could be observed that the level of CES inhibition was lower in the recovery exposure, and at the lowest concentration of diazinon the CES activity reached the control level (whereas at the same concentration after the early exposure significant inhibition was 29

recorded). However, the CES activity was still inhibited at other diazinon concentrations, so only a partial recovery of this enzyme activity occurred during the 48 h in artificial water. The slow recovery of CES is in accordance with other studies which generally showed slow recovery of AChE and CES activities (e.g. Coeurdassier et al., 2001; Collange et al., 2010). Besides the enzymatic responses, the changes in gene expression were also assessed by applying the early exposure (2 hpf – 50 hpf) and prolonged exposure (2 hpf – 98 hpf) scenario. In the early exposure significant changes were observed for ces2, cyp1a, cat and gpx1a expression, whereas after the prolonged exposure significant changes were observed for all measured target genes, i.e. ache, ces2, cyp1a, gstp1, cat, gpx1a and gsr. Even though the dose responses were not observed, recorded changes point to the involvement of this genes in the responses to exposure to investigated pesticides. Regarding the mechanisms involved in the gene expression changes, induction of cyp1a is dependent on the response of AhR (aryl hydrocarbon receptor) that has been consistently observed in most species (Denison and Nagy, 2003). Dioxins and dioxin-like compounds (e.g., planar halogenated aromatic hydrocarbons (HAH) and polycyclic aromatic hydrocarbons (PAH)) represent ligands for the AhR. Additionally, it has been shown that there is a relatively large number of AhR ligands whose structure and physiochemical characteristics are dramatically different than that of the “classical” HAH and PAH ligands (Denison et al., 1998; Denison and Heath-Pagliuso, 1998). In our study exposure to diuron caused significant induction in cyp1a expression and in the study of Takeuchi et al. (2008) diuron showed AhR-mediated transcriptional activity in mouse cell lines. Some of the same mechanisms of induction and inhibition of cytochrome p450 enzymes affect the expression of carboxylesterases. The regulation appears to be influenced by the pregnane x receptor (PXR) and constitutive androstane receptor (CAR) proteins, which upon activation, move to the nucleus and bind to DNA response elements in promoters to induce the expression of many phase I and phase II metabolizing enzymes (Staudinger et al., 2010). Results of ces2 expression revealed disparity between the responses at the molecular and biochemical level. Specifically, both the early and prolonged exposures to diazinon showed an inhibition of CES activity, whereas the gene 30

expression analysis showed an increase in ces2. On the other hand, after the prolonged exposure to diuron both CES activity and ces2 expression were increased. Even though opposite effects were observed, both results can be potentially explained. In particular, diazinon inhibits the CES activity and therefore stimulates a higher expression of ces2 since there is a need for a higher amount of CES to replace the inhibited enzyme. On the other hand, an exposure to diuron induces the detoxification and stimulates the expression of ces2 which leads to an increase in CES activity. This is only one possible explanation, but the obtained results point to the need for the assessment of responses at different levels of biological organization, and it is advisable to include higher-level responses. Further, similar results were observed in the case of cat and gpx1a expression. While CAT and GPx activities remained unchanged after exposure to the investigated pesticides, the expression of cat and gpx1a were significantly affected in both exposure scenarios. The changes in expression of cat, gpx1a and gsr indicate the involvement of oxidative stress in the toxicity mechanism of these pesticides. Even though there are no studies in zebrafish, it was shown that diazinon caused changes in the activities of antioxidative enzymes in carp (Cyprinus carpio) (Oruc and Usta, 2007) and that exposure of oysters (Crassostrea gigas) to diuron and exposure of goldfish (Carassius auratus) to a mixture of herbicides including diuron led to an increased production of ROS and caused oxidative stress (Fatima et al., 2007; Behrens et al., 2016). For the genes involved in antioxidative responses, NF‐E2‐related factor 2 (Nrf2) regulates the expression of multiple antioxidant genes and protects against oxidative damage triggered by contaminants exposure, injury and inflammation (e.g. Osburn and Kensler, 2008). Thus Nrf2 plays a crucial role in the process of dealing with oxidative stress and quenching of reactive oxygen species (ROS) derived from the metabolism of environmental pollutants (Bao et al., 2017). It was shown that some redox-sensitive proteins, which can undergo reversible oxidative and reductive reactions, can activate or delay downstream signaling pathways, including antioxidant enzyme systems (Den Hertog et al., 2005; Hongjun et al., 2005). This is a possible reason for observed changes in expression of measured antioxidant genes. Specifically, the expression of gpx1a and gsr was increased, whereas the expression of cat was reduced after 31

early exposure scenario and increased after the prolonged exposure. The difference between the responses of antioxidative enzymes is not uncommon and at the enzymatic level, the decrease in CAT can be caused by high concentration of superoxide radicals which are known to inhibit CAT activity (Kono and Fridovich, 1982). Regarding the observed down-regulation of cat and up-regulation of gpx1a, similar trends were obtained also in other studies, e.g. after toxicity assessment of chlorpyrifos in two different life stages of zebrafish (Jeon et al., 2016) and safflower Carthamus tinctorius L. to zebrafish embryos/larvae (Xia et al., 2017). The disparity between mRNA abundance and enzyme activity was observed also in the study of Glanemann et al. (2003) who concluded that it is wrong to assume that responses at the mRNA level reflect the response at the protein level or at the level of active enzyme, i.e. that there is a static correlation between levels of mRNA, protein, and active enzyme. Moreover, few studies showed evidence for the existence of disparity between transcriptome and proteome (Anderson and Seilhamer, 1997; Gygi et al., 1999). The disparity should not be surprising since the level of gene expression is determined by different factors and numerous factors may be responsible for the observed discrepancy between the measured gene expression and enzyme activity levels. Inferring enzymatic activity from transcriptome data is hindered by complexity of the relationship between RNA levels and enzyme activities (e.g. differences in protein stability, post-translational modifications, regulation of enzyme activity) (Glanemann et al., 2003). Similar results on the discrepancies between the gene expression and enzyme activity were also observed in other studies with zebrafish. For example, Craig et al. (2007) determined that in zebrafish exposed to cooper there was no association between increased transcription and antioxidant enzyme activities. Also, in the study of Jin et al. (2010) the mRNA induction patterns in zebrafish exposed to herbicide atrazine were not in accordance with the changes in levels of antioxidant enzymes. This all suggests that some enzymes are not controlled by transcriptional means, yet by other some other mechanisms at the enzymatic level. As suggested by Jin et al. (2010) it is possible that mRNA levels represent a snapshot of the cell activity at any given time, and the protein activity might be regulated at the post32

translational level. Therefore, the issue of disparity between enzyme activities and mRNA data should be taken into account when assessing the toxic effects of pesticides (and other pollutants) at a molecular level. In conclusion, the obtained results show that both diazinon and diuron cause changes at a biochemical and molecular level in zebrafish embryos and larvae. Moreover, the sensitivity of different developmental stages of zebrafish differed notably and zebrafish larvae proved to be more susceptible to pesticide exposure compared to the embryo stage which is probably due to a protective role of the chorion. Since various factors (e.g. life stage, duration of the exposure, etc.) affect the detoxification processes and final effects of pesticides, it is crucial to include various aspects of exposure in the toxicity assessment. A comparison of enzyme responses revealed that CES is more sensitive to organophosphate exposure than AChE which is valuable information for future monitoring and risk assessment studies. Moreover, 48 h of recovery yielded only a partial recovery of CES activity. Given the differences between the enzyme responses and gene expression changes, the assessment of toxic effects should be conducted at different levels of biological organization in order to obtain comprehensive data that will enable realistic prediction of final toxic effects of pesticides to aquatic organisms.

Acknowledgments The research stay of Mirna Velki at Department of Ecosystem Analysis, Institute for Environmental Research, RWTH Aachen University was supported by Alexander von Humboldt Foundation (Research Fellowship for postdoctoral researchers). The DanioVision system was purchased thanks to the 2015 RWTH Dean’s Seed Fund grant to the project “Behavioral consequences of neurotoxicity and potential adverse effects”. The authors thank Tecan Group Ltd. and Nikon Instruments Germany for their contribution to this study as a partner of the Students Lab "Fascinating Environment" at Aachen Biology and Biotechnology (ABBt).

33

References Akcha, F., C. Spagnol and J. Rouxel (2012). Genotoxicity of diuron and glyphosate in oyster spermatozoa and embryos. Aquatic Toxicology 106-107: 104–113. Aktar, Md.W., D. Sengupta and A. Chowdhury (2009) Impact of pesticides use in agriculture: their benefits and hazards. Interdisciplinary Toxicology 2: 1–12. Anderson, L. and J. Seilhamer (1997). A comparison of selected mRNA and protein abundances in human liver. Electrophoresis 18: 533–537. Assis, C.R.D., R.S. Bezerra and L.B.Jr. Carvalho (2011). Fish cholinesterases as biomarkers of organophosphorus and carbamate pesticides. In: Stoytcheva, M. (Ed.), Pesticides in Modern World – Book 5. Intech, Rijeka, Croatia. Bao, S., X. Nie, R. Ou, C. Wang, P. Ku and K. Li (2017). Effects of diclofenac on the expression of Nrf2 and its downstream target genes in mosquito fish (Gambusia affinis). Aquatic Toxicology 188: 43– 53. Behrens, D., Rouxel, J., Burgeot T. and F. Akcha (2016). Comparative embryotoxicity and genotoxicity of the herbicide diuron and its metabolites in early life stages of Crassostrea gigas: Implication of reactive oxygen species production. Aquatic Toxicology 175: 249–259. Bräunig, J., S. Schiwy, O. Broedel, Y. Müller, M. Frohme, H. Hollert and S.H. Keiter (2015) Timedependent expression and activity of cytochrome P450 1s in early life-stages of the zebrafish (Danio rerio). Environmental Science and Pollution Research International 22: 16319–16328. Buhler, J.L., X. Zhao, Y.H. Yang, C.L. Miranda and D. Buhler (1997). Expression of a constitutive cytochrome P450 (CPK2K1) in livers of rainbow trout (Oncorhynchus mykiss) embryo and sac fry. Aquatic Toxicology 37: 237–251. Calabrese, E.J. (2008). Converging concepts: adaptive response, preconditioning, and the Yerkes– Dodson law are manifestations of hormesis. Ageing Research Reviews 7: 8–20.

34

Cao, F.J., X.S. Liu, C.J. Wang, M.Q. Zheng, X.F. Li and L.H. Qiu (2016). Acute and short-term developmental toxicity of cyhalofop-butyl to zebrafish (Danio rerio). Environmental Science and Pollution Research 23, 10080–10089. Claiborne, A. (1985). Catalase activity. In: Greenwald, R.A. Ed., CRC Handbook of methods in oxygen radical research. CRC Press, Boca Raton, FL. pp 283–284. Coeurdassier, M., A. Gomot-de Vaufleury, M. Saint-Denis, D. Ribera, J.F. Narbonne and P.M. Badot (2002). Effects of dimethoate on snail B-esterase and growth as a function of dose, time and exposure route in a laboratory bioassay. Biomarkers 7: 138–150. Collange, B., C.E. Wheelock, M. Rault, C. Mazzia, Y. Capowiez and J.C. Sanchez-Hernandez (2010). Inhibition, recovery and oxime-induced reactivation of muscle esterases following chlorpyrifos exposure in the earthworm Lumbricus terrestris. Environmental Pollution 158: 2266–2272. Craig, P.M., C.M. Wood and G.B. McClelland (2007). Oxidative stress response and gene expression with acute copper exposure in zebrafish (Danio rerio). American Journal of Physiology Regulatory, Integrative and Comparative Physiology 293: R1882–R1892.Denison, M.S. and S. Heath-Pagliuso (1998). The Ah receptor: a regulator of the biochemical and toxicological actions of structurally diverse chemicals. Bulletin of Environmental Contamination and Toxicology 61: 557–568. Den Hertog, J., A. Groen and T. Van Der Wijk (2005). Redox regulation of protein-tyrosine phosphatases. Archives of Biochemistry and Biophysics 434: 11–15. Denison, M.S. and S.R. Nagy (2003). Activation of the aryl hydrocarbon receptor by structurally diverse exogenous and endogenous chemicals. Annual Review of Pharmacology and Toxicology 43: 309–334. Denison, M.S., S.D. Seidel, W.J. Rogers, M. Ziccardi, G.M. Winter and S. Heath-Pagliuso (1998). Natural and synthetic ligands for the Ah receptor. In Molecular Biology Approaches to Toxicology, ed. Puga, A. and K.B. Wallace, pp. 393–410. Philadelphia: Taylor & Francis.

35

DIN (2001). German standard methods for the examination of water, wastewater and sludge – subanimal testing (group T) – Part 6: Determination of the Non-acute-poisonous Effect of Wastewater to Fish Eggs by Dilution Limits. DIN 38415-6. Beuth Verlag, Berlin, Germany. Domagalski, J. L. and N. M. Dubrovsky (1992). Pesticide residues in ground water of the San Joaquin Valley, California. Journal of Hydrology 130: 299–338. Ecobichon, D. J. and R. M. Joy (1994). Organophosphorus Ester Insecticides in Pesticides and Neurological Diseases. CRC Press: 171-249. Ellman, G.L., K.D. Courtney, V. Andreas Jr. and R.M. Featherstone (1961). A new and rapid colorimetric determination of acetyl cholinesterase activity. Biochemical Pharmacology 7: 88–95. Embry, M.R., S.E. Belanger, T.A. Braunbeck, M. Galay-Burgos, M. Halder, D.E. Hinton, M.A. Leonard, A. Lillicrap, T. Norberg-King and G. Whale (2010). The fish embryo toxicity test as an animal alternative method in hazard and risk assessment and scientific research. Aquatic Toxicology 97, 79–87. Escartin E. and C. Porte (1997) The use of cholinesterase and carboxylesterase activities from Mytilus galloprovincialis in pollution monitoring. Environmental Toxicology and Chemistry 16: 2090–2095. EU Directive 2010/63/EU of the European parliament and of the council of 22 September 2010 on the protection of animals used for scientific purposes. Off J EU 2010; L 276: 33–79. Eurostat (2016). "Pesticide sales statistics." http://ec.europa.eu/eurostat/statisticsexplained/index.php/Pesticide_sales_statistics. Accessed 7 August 2017 Fatima, M., Mandiki, S. N., Douxfils, J., Silvestre, F., Coppe, P. and P. Kestemont (2007). Combined effects of herbicides on biomarkers reflecting immune-endocrine interactions in goldfish. Immune and antioxidant effects. Aquatic Toxicology 81: 159–167. Fent, K. and W. Meier (1992). Tributyltin-induced effects on early life stages of minnows Phoxinus phoxinus. Archives of Environmental Contamination and Toxicology 22, 428–438.

36

Ghazala, S. Mahboob, L. Ahmad, S. Sultana, K. Al-Ghanim, F. Almisned and Z. Ahmed (2014). Fish cholinesterases as biomarkers of sublethal effects of organophosphorus and carbamates in tissues of Labeo rohita. Journal of Biochemical and Molecular Toxicology 28: 137–142. Glanemann, C., A. Loos, N. Gorret, L.B. Willis, X.M. O'Brien, P.A. Lessard and A.J. Sinskey (2003). Disparity between changes in mRNA abundance and enzyme activity in Corynebacterium glutamicum: implications for DNA microarray analysis. Applied Microbiology and Biotechnology 61: 61–68. Gygi, S.P., Y. Rochon, B.R. Franza and R. Aebersold (1999). Correlation between protein and mRNA abundance in yeast. Molecular and Cellular Biology 19: 1720–1730. Habig, W.H. and W.B. Jakoby (1981). Assays for differentiation of glutathione S-transferases. Methods in Enzymology 77: 398–405. Hallare, A.V., H.-R. Kohler and R. Triebskorn (2004). Developmental toxicity and stress protein responses in zebrafish embryos after exposure to diclofenac and its solvent, DMSO. Chemosphere 56: 659–666. Hongjun, L., R. Colavitti, I.I. Rovira and T. Finkel (2005). Redox dependent transcriptional regulation. Circulation Research 97: 967–974. Hosokawa, M. and T. Satoh, T. (2002). Measurement of carboxylesterase (CES) activities. Current Protocols in Toxicology 10, 4.7.1–4.7.14. http://dx.doi.org/0471140856.tx0407s10. ISO (2007) International Standard Water Quality – Determination of the acute toxicity of waste water to zebrafish eggs (Danio rerio). ISO 15088:2007. Jaja-Chimedza, A., M. Gantar, G.D. Mayer, P.D.L. Gibbs and J.P. Berry (2012). Effects of Cyanobacterial Lipopolysaccharides from Microcystis on Glutathione-Based Detoxification Pathways in the Zebrafish (Danio rerio) Embryo. Toxins 4: 390–404. Jeon, H.J., Y.H. Lee, M.J. Kim, S.D. Choi, B.J. Park and S.E. Lee (2016). Integrated biomarkers induced by chlorpyrifos in two different life stages of zebrafish (Danio rerio) for environmental risk assessment. Environmental Toxicology and Pharmacology 43: 166–174. 37

Jin, Y., X. Zhang, L. Shu, L. Chen, L. Sun, H. Qian, W. Liu and Z., Fu (2010). Oxidative stress response and gene expression with atrazine exposure in adult female zebrafish (Danio rerio). Chemosphere 78: 846–852. Kono, Y., Fridovich, I., 1982. Superoxide radical inhibits catalase. Journal of Biological Chemistry 257: 5751–5754. Kühnert, A. (2015). Time course analyses for understanding internal exposure and toxicokinetic processes in fish embryos. PhD thesis, RWTH Aachen University. Léonard, M., M. Vanpoucke, V. Petit-Poulsen and J.M. Porcher (2005). Evaluation of the fish embryo test as a potential alternative to the standard acute fish toxicity test OECD 203. In: International Symposium on Toxicology Assessment, Skathios, Greece. Luckenbach, T., M. Kilian, R. Triebskorn and O.J. Oberemm (2001). Fish early life stage tests as a tool to assess embryotoxic potentials in small streams. Journal of Aquatic Ecosystem Stress and Recovery 8: 355–370. Modra, H., Vrskova, D., Macova, S., Kohoutkova, J., Hajslova, J., Haluzova, I. And Z. Svobodova (2011). Comparison of diazinon toxicity to embryos of Xenopus laevis and Danio rerio; degradation of diazinon in water. Bulletin of Environmental Contamination and Toxicology 86: 601–604. Mu, X.Y., S. Pang, X.Z. Sun, J.J. Gao, J.Y. Chen, X.F. Chen, X.F. Li and C.J. Wang (2013). Evaluation of acute and developmental effects of difenoconazole via multiple stage zebrafish assays. Environmental Pollution 175, 147–157. O’Neill, A.J., T.S. Galloway, M.A. Browne, A. Dissanayake and M.H. Depledge (2004). Evaluation of toxicity in tributaries of the Mersey estuary using the isopod Asellus aquaticus (L.). Marine Environmental Research 58: 327–331. OECD (2013). Guidelines for the Testing of Chemicals—Test No. 236. Fish Embryo Toxicity (FET) Test. Paris, France.

38

Oruc, E.O. and D. Usta (2007). Evaluation of oxidative stress responses and neurotoxicity potential of diazinon in different tissues of Cyprinus carpio. Environmental Toxicology and Pharmacology 23: 48–55. Osburn, W.O. and T.W. Kensler (2008). Nrf2 signaling: An adaptive response pathway for protection against environmental toxic insults. Mutation Research 659: 31–39. Osterauer, R. and H.R, Köhler (2008). Temperature-dependent effects of the pesticides thiacloprid and diazinon on the embryonic development of zebrafish (Danio rerio). Aquatic Toxicology 86: 485–494. Padilla, S., Corum, D., Padnos, B., Hunter, D. L., Beam, A., Houck, K. A., Sipes, N., Kleinstreuer, N., Knudsen, T., Dix, D. J. and D. M. Reif (2012). Zebrafish developmental screening of the ToxCast™ Phase I chemical library. Reproductive Toxicology 33: 174–187. Pfaffl, M.W. (2001). A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research 29(9): e45. Potter, P.M. and R.M. Wadkins (2006). Carboxylesterases: detoxifying enzymes and targets for drug therapy. Current Medicinal Chemistry 13: 1045–1054. Redinbo, M.R. and P.M. Potter (2005). Mammalian carboxylesterases: from drug targets to protein therapeutics. Drug Discovery Today 10: 313–325. Rickwood C.J. and T.S. Galloway (2004). Acetylcholinesterase inhibition as a biomarker of adverse effect. A study of Mytilus edulis exposed to the priority pollutant chlorfenvinphos. Aquatic Toxicology 67: 45–56. Russell W.M.S. and R.L. Burch (1959). The Principles of Humane Experimental Technique. London: Methuen and Co. Ltd. Scheil, V., C. Kienle, R. Osterauer, A. Gerhardt and H.-R. Köhler (2009). Effects of 3,4-dichloroaniline and diazinon on different biological organisation levels of zebrafish (Danio rerio) embryos and larvae. Ecotoxicology 18: 355–363.

39

Schiwy, S., J. Bräunig, H. Alert, H. Hollert and S.H. Keiter (2015). A novel contact assay for testing aryl hydrocarbon receptor (AhR)-mediated toxicity of chemicals and whole sediments in zebrafish (Danio rerio) embryos. Environmental Science and Pollution Research International 22: 16305– 16318. Scholz, S., S. Fischer, U. Gündel, E. Küster, T. Luckenbach and D. Voelker (2008). The zebrafish embryo model in environmental risk assessment — Applications beyond acute toxicity testing. Environmental Science and Pollution Research 15: 394–404. Staudinger, J.L., C. Xu, Y.J. Cui, and C.D. Klaassen (2010) Nuclear receptor-mediated regulation of carboxylesterase expression and activity. Expert Opinion on Drug Metabolism & Toxicology 6: 261–271. Strähle, U., S. Scholz, R. Geisler, P. Greiner, H. Hollert and S. Rastegar (2012). Zebrafish embryos as an alternative to animal experiments - a commentary on the definition of the onset of protected life stages in animal welfare regulations. Reproductive Toxicology 33: 128–132. Takeuchi, S., M Iida, H. Yabushita, T. Matsuda and H. Kojima H (2008). In vitro screening for aryl hydrocarbon receptor agonistic activity in 200 pesticides using a highly sensitive reporter cell line, DR-EcoScreen cells, and in vivo mouse liver cytochrome P450-1A induction by propanil, diuron and linuron. Chemosphere 74: 155–165. Velki, M., C. Di Paolo, J. Nelles, T.-B. Seiler and H. Hollert (2017). Diuron and diazinon alter the behavior of zebrafish embryos and larvae in the absence of acute toxicity. Chemosphere 180: 65– 76. Xia, Q., M. Zhiqiang, X. Mei, J. Luo, Y. Wang, T. Li, Y. Feng, Y. Ni, Q. Zou and R. Lin (2017). Assay for the developmental toxicity of safflower (Carthamus tinctorius L.) to zebrafish embryos/larvae. Journal of Traditional Chinese Medical Sciences, In Press http://dx.doi.org/10.1016/j.jtcms.2017.05.004 Wang, Y., L. Lv, Y. Yu, G. Yang, Z. Xu, Q. Wang and L. Cai (2016). Single and joint toxic effects of five selected pesticides on the early life stages of zebrafish (Denio rerio). Chemosphere 170, 61–67. 40

Watson, F. L., H. Schmidt, Z. K. Turman, N. Hole, H. Garcia, J. Gregg, J. Tilghman and E. A. Fradinger (2014). Organophosphate pesticides induce morphological abnormalities and decrease locomotor activity and heart rate in Danio rerio and Xenopus laevis. Environmental Toxicology and Chemistry 33: 1337–1345. Wendel, A. (1980). Enzymatic Basis of Detoxication, Volume 1, p. 333, Academic Press, NY. Wessels, J. S. C. and R. Van der Veen (1956). The action of some derivatives of phenylurethan and of 3-phenyl-1,1-dimethylurea on Hill reaction. Biochemical and Biophysical Research Communications: Acta 19, 548–549. Wheelock, C.E., K.J. Eder, I. Werner, H. Huang, P.D. Jones, B.F. Brammell, A.A. Elskus and B.D. Hammock (2005). Individual variability in esterase activity and CYP1A levels in Chinook salmon (Oncorhynchus tshawytscha) exposed to esfenvalerate and chlorpyrifos. Aquatic Toxicology 74: 172–192. Xu, C., J. Wang, W. Liu, G.D. Sheng, Y. Tu and Y. Ma (2008). Separation and aquatic toxicity of enantiomers of the pyrethroid insecticide lambdacyhalothrin. Environmental Toxicology and Chemistry 27: 174–181. Yen, J., S. Donerly, E. D. Levin and E. A. Linney (2011). Differential acetylcholinesterase inhibition of chlorpyrifos, diazinon and parathion in larval zebrafish. Neurotoxicology and Teratology 33: 735– 741. Zhang, Q., J. Pi, C.G. Wood, A.M. Jarabek, H.J. Clewell and M.E. Andersen (2008). Hormesis and adaptive cellular control systems. Dose–Response 6: 196–208. Zhang, J., S.S. Liu, Z.Y. Yu, H.L. Liu and J. Zhang (2013). The time-dependent hormetic effects of 1alkyl-3-methylimidazolium chloride and their mixtures on Vibrio qinghaiensis sp. -Q67. Journal of Hazardous Materials 258-259: 70–76.

41