Enzymologic Mechanism of Replicative DNA Polymerases in Higher Eukaryotes

Enzy mo Iog ic M e cha nism of Replicative DNA Polymerases in Higher Eukaryotes PAULA. FISHER Department of Pharmacological Sciences Health Sciences Center State Uniuersity of New York at Stony Brook Stony Brook, New York 11794

I. Catalytic Core of DNA Polymerase Q ............................

11. Holoenzyme of DNA Polymerase Q ............................. 111. Interaction of DNA Polymerase Q with Template-Primers Containing

Chemically Damaged Nucleotides .............................. IV. DNA Polymerase 6 ........................................... V. Conclusions and Prospects for Future Research . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

372 380 386 390 394 396

Over the past several years, it has become clear that at least two different DNA polymerases are responsible for replicative DNA synthesis in higher eukaryotes. DNA polymerase ci (pol a), along with its associated DNA primase, is thought to be largely responsible for lagging-strand synthesis. DNA polymerase 6 (pol a), along with its auxiliary factor, proliferating cell nuclear antigen (PCNA), is believed to be largely responsible for leading-strand synthesis. Recent genetic studies in the lower eukaryote, Saccharomyces cereuisiae, suggest that a third enzyme, DNA polymerase E (pol ~ ) , 1is essential for complete nuclear DNA synthesis (1).The precise roles of pol E are not yet clear. This essay reviews results of enzymologic experiments performed originally with the pol-a catalytic core, subsequently with the pol-a holoenzyme, and most recently with the pol-6 catalytic core. Comparable studies of pol E have not yet been performed. Results of experiments with pol ci and pol 6 have provided fundamental and presumably general information regarding the basic mechanisms of replicative DNA polymerases as well as novel insights into the fidelity of DNA replication, the interaction of DNA poly1 Re: DNA polymerase c, see P. M. J. Burgers et al., E f B 191, 617 (ISSO), and Ref. 22. [Eds.]

Progress in Nucleic Acid Research and Molecular Biology, Vot. 47

371

Copyright 0 1994 by Academic Press, Inc. All rights of reproduction in any form reserved.

372

PAUL A. FISHER

merases with template-primers containing chemically modified or damaged bases, and the mechanism of polymerase translocation along templates. Further experiments, particularly detailed physical studies of cDNA cloneencoded DNA polymerases, remain to be performed to either corroborate or modify existing hypotheses and to extend current models where appropriate,

1. Catalytic Core of DNA Polymerase a Initially, the catalytic core of human pol a was purified to nearhomogeneity and found to be a 14O-kDa, 7.1-S protomer consisting of two dissimilar subunits; this protomer had the potential to dimerize (2;see also 3). Monoclonal antibodies raised against this catalytic core (4) were used subsequently for immunoaf€inity purification of human pol-a holoenzyme, at which time it was recognized that the core catalytic subunit of human pol cx is a single polypeptide of approximately 180 kDa (5). Presumably, the pol-a core enzyme prepared initially had been proteolyzed during purification. Nevertheless, extensive enzymologic studies (6-11) of the partially proteolyzed pol-a catalytic core led to a detailed model for substrate recognition and binding by the enzyme. This model was later shown to apply in all of its features to an undegraded pol-a holoenzyme preparation from human cells (5);hence, details of this model are presented here. [Many aspects of this model were reviewed in a previous volume in this series (12).]

A. Template Recognition and Binding Human pol-a catalytic core follows an ordered sequential terreactant2 mechanism of substrate recognition and binding (8).This mechanism is represented diagrammatically in Fig. 1. The first step involves template, the only substrate for which free pol a has any detectable a n i t y . Elucidation of this feature of pol-a mechanism was the result primarily of enzyme inhibition studies, conclusions from which were substantiated by direct semiquantitative sedimentation binding analyses (6). Representative data from both sorts of assay are shown in Figs. 2 and 4. Of all the nonsubstrate DNA molecules tested, only single-stranded DNA inhibits pol a when the activity of the enzyme on an activated DNA substrate is determined (Fig. 2). This inhibition is competitive with respect to t h t activated DNA substrate (6), noncompetitive with respect to dNTP, and is observed with both heteropolymeric and homopolymeric single2

Terreactaiit (originally ter-reactant) indicates an enzyme having three substrates (26).

[Eds.]

MECHANISM OF REPLICATIVE

DNA POLYMERASES

A

B

C

Template

Primer

Correct dNTP

1 1 1

E

€A

€A0

373 PPi

P+Q+R + Primer + Template

(EABC +EPQR)

t

E

DNA Polymerase a

FIG. 1. The ordered sequential terreactant mechanism of substrate recognition and binding by KB cell pol-a catalytic core enzyme; a diagrammatic representation. Information on the order of product release is not available. All products (P, Q , and R) are therefore shown as being released in a single step.

stranded DNA (6, 11).The fact that inhibition of pol a by single-stranded DNA is competitive with the activated DNA substrate implies that the site on the enzyme that binds inhibitor is the same site that binds DNA during catalysis. The essential features of a sedimentation binding assay, devised to com-

120

1

100

20 0 0

25

50

75

100 125 150 175 200

CI DNA1 ( P W

FIG.2. Inhibition of KB cell pol-a catalytic core enzyme by nonsubstrate DNA molecules of defined structure. Concentration of competitive inhibitor (in nucleotide) and DNA polymerase activity are as shown. Competitor (I) DNAs were supercoiled circular duplex PM2 DNA (+), relaxed circular duplex PM2 DNA (O), blunt-ended duplex PM2 DNA fragments generated with HaeIII restriction endonuclease (A),and single-stranded circular M13 DNA (m).

374

PAUL A. FISHER

plement enzyme inhibition studies, are shown diagrammatically in Fig. 3. Pol a alone sediments at 7.1 S, near the top of the gradient. DNA alone migrates much further down the gradient. The exact S-value varies, depending on the particular DNA molecule being analyzed. When pol a and DNA are mixed together before centrifugation, the results depend on the nature of the DNA used. If pol CY cannot bind to the DNA, the sedimentation profiles are identical with those observed when pol a and DNA are sedimented separately. If, on the other hand, pol CY binds to the DNA, a fraction of the pol-a activity is shifted down the gradient, away from the peak of free enzyme. At least a portion of this shifted activity cosediments with the DNA. Data from a sedimentation binding experiment are shown in Fig. 4. These data show that pol CY binds to single-stranded circular 4x174 DNA but not to either supercoiled or relaxed circular duplex DNA, corroborating results of enzyme inhibition studies (Fig. 2). In enzyme inhibition studies, it was noted that the interaction of the pol-a catalytic core protomer with single-stranded circular DNA displays greater than first-order dependence on DNA concentration (6, 11). Linear Hill plots with slopes (Hill coefficients) between 1.5 and 1.8, suggested that there are at least two interacting template binding sites per molecule of pol a. To date, there is no evidence that both sites can be active simultaneously in the synthesis of DNA. Indeed, the fact that the two sites have only been identified in the context of activity inhibition studies argues against simultaneous synthesis of DNA at both. Nevertheless, it remains an intriguing possibility that these two sites somehow filnction coordinately in DNA replication by pol a.

+

FIG. 3. .4 semiquantitative sedimentation binding assay to study the interaction of pol a with nonsubstrate DN.4 molecules. Positions of pol a alone and DNA alone are as indicated. Before ultracentrifugation. pol a and individual DNAs were mixed together under polymerase reaction conditions and sedimented as described (see 6, 8, 9).

MECHANISM OF REPLICATIVE

U

p)

-w

0

DNA

E

A

I

10000 -.’

10000

I

8000

8000

0

6000

6000

c -

4000

4000

2000

2000

Q L

0

a

TI a

N

375

POLYMERASES

I

3’

0

0

0

ri

5

10

15

20

25

0

5

10

15

20

25

0

v

C

x -w .c 0 Q: W

D

I

.? 10000 8000 6000 L 0)

E

~Idk!!!

10000

4000

4000

0 2000

2000

x -

a 6

z

n

0 0

0 0

5

10

15

20

25

5

10

15

20

25

F raction Number bot

top

FIG. 4. Binding of KB cell pol-a catalytic core enzyme to nonsubstrate DNA molecules of defined structure. Purified pol a was subjected to ultacentrifugation alone (A), after mixing with supercoiled circular duplex PM2 DNA (B), after mixing with relaxed circular duplex PM2 DNA (C), and after mixing with single-stranded circular +XI74 DNA (D). The solid line above each panel indicates the position of pol a sedimented alone; the broken line above each panel indicates the position of DNA sedimented alone. (For further details, see 6, 8, and 9.)

B. Primer Recognition and Binding Primer binding is the second step in the ordered sequential terreactant mechanism of substrate recognition and binding by the catalytic core of pol a (see Fig. 1).For efficient binding and catalysis, the catalytic core requires an octanucleotide primer (9), of which the terminal three or four nucleotides must be properly base-paired to an appropriate template (7, 9). Moreover, the chemical structure of the 3’-terminal sugar group determines whether the enzyme will bind at all (Table I). Pol-a catalytic core will bind with more

376

PAUL A. FISHER

EFFECT OF

TABLE I CHEMICAL STRUCTC‘HE A T THE 3‘-PRIMER

’ ~ U U I N U S ON

BINDINGAND INCORPORATION BY POL a

Chemical structure at the 3‘-primer terminus

Binds

Incorporates

Yes Yes Yes Yes

Yes Yes Yes

NO

N0

~

2’-H, 3’-OH Z O H . 3’-OH 2’-PO,, 3‘-OH 2‘-H, 3’-H 2’-H, 3’-P03

NO

or less equal affinity to base-paired 3’ termini containing 2’-H, 3’-OH (a typical deoxyribonucleotide primer); 2’-OH, 3’-0€1(a ribonucleotide primer); 2‘-P04, 3‘-OH; or 2’-H, 3’-H (a dideoxynucleotide primer). Catalysis, i.e., dNMP incorporation, occurs with all but the last of these primers, to which pol a will bind. In contrast, pol-a catalytic core will neither bind to nor catalyze incorporation of dNMP on a 2’-H, 3’-PO,-containing primer (10).

C. The Role of Mg2+ in Template and Primer Binding

It has long been assumed that divalent cations such as Mg2+ are required to chelate dNTPs in DNA-polymerase incorporation reactions. On this basis alone, it might be predicted that a plot of enzyme activity versus Mg2+ concentration would exhibit simple saturation kinetics; polymerase activity would increase as the concentration of Mg2+ approached that of the total dNTP present, after which enzyme activity would be unaffected by further concentration. In actuality, plots of enzyme activity versus increases in &I@+ Mg2+ concentration, an example of which is shown for pol a (Fig. 5), are much different in appearance. Enzyme activity continues to increase at Mg2+ concentrations far in excess of the total dNTP concentration, implying another role or roles for Mg2+ in the pol-a reaction mechanism. Moreover, increasing Mgz+ coiicentration beyond an empirical optimum results in dramatic inhibition of pol a. The complex role of Mgz+ in the pol-a incorporation reaction was dissected enzymologically (9).To analyze the effect of Mgz+ on template binding, the K, of pol a for heteropolymeric single-stranded DNA was measured at several different Mg2+ concentrations. As Mgz+ concentration was increased, the K , of pol a for single-stranded DNA decreased, suggesting that

MECHANISM OF REPLICATIVE

DNA POLYMERASES

377

15000

h

TI

3 30 .-

b12500

u n U L P)v

:=loo00

k n

EE

0

7500

2 Q

5000 V

v

2500

0

1

2

3

4

5

6

7

8

9

1011

[MgCI,] (mM) FIG. 5. Activity of pol a versus Mg*+ concentration with an activated DNA substrate. DNA polymerase activity and MgC& concentration are as indicated.

pol a binds template more tightly at higher concentrations of Mgz+. This conclusion was confirmed by direct sedimentation binding analyses. Similar studies performed with homopolymeric single-stranded DNA indicated that increasing concentrations of Mg2+ lead to a dramatically increased affinity for poly(dT) and poly(dC) (polypyrimidines) but have little or no effect on the interaction of pol-a catalytic core with poly(dA) (a polypurine). Because the interaction of pol a with poly(dA) templates was apparently independent of Mgz+ concentration, a “hook homopolymer, (dA)m-(dT)z, was used to study the effects of Mgz+ concentration on the interaction of pol-a catalytic core with primer (9). Results of extensive kinetic analyses indicate that free Mg2+ competes with primer for pol-a binding. This accounts for the dramatic inhibition of pol-a activity at Mgz+ concentrations above the empirical optimum. Competition by Mg2+ is highly cooperative; linear Hill plots were obtained with Hill coefficients of 3.8-3.9, indicating a minimum of four interacting Mg2+ binding sites on each molecule of pol-a catalytic core. The conclusions drawn from kinetic analyses were further substantiated by results of direct sedimentation binding experiments. These results, in conjunction with the observation that an octanucleotide is mini-

378

PAUL A. FISHER

mally necessary to be recognized as primer, led to the suggestion that pol-a catalytic core binds primer through a Mg2+ chelate, with each of four Mg2+ ions acting to coordinate two phosphodiester phosphate groups (9).

D. dNTP Recognition and Binding The binding of dNTP is the third step in the ordered sequential terreactant mechanism of pol-a catalytic core (see Fig. 1).Although primer binding is the immediate prerequisite to dNTP recognition, which of the four dNTPs is recognized and bound is dictated by the template nucleotide immediately adjacent to the primer terminus. Indeed, definitive elucidation of the ordered terreactant mechanism of pol-a catalytic core resulted from the fact that after binding to a 2',3'-dideoxynucleotide-terminated primer, pol a is able to bind dNTP in a template-specific manner, but is unable to catalyze nucleotide incorporation at such a primer because a 3'-OH group is absent (8).In this situation, both as a consequence of the highly ordered mechanism of substrate recognition and binding and because the forward step to catalysis is blocked by the lack of a 3'-OH group, pol-a catalytic core can be trapped in a stable complex with template, base-paired dideoxynucleotideterminated primer, and template-specific dNTP. This phenomenon is represented diagrammatically in Fig. 6 and was demonstrated experimentally, both in the context of steady-state kinetic analyses and semiquantitative sedimentation binding experiments (8). The assumption that MgZ+-chelated dNTPs are the actual substrates for

I

C

FIG. 6. The ordered sequential terreactant mechanism of substrate recognition and binding by KB cell pol-a catalytic core enzyme; a diagrammatic representation including the pathway followed with a dideoxynucleotide-terminated primer. The mechanism of pol a is represented as described in the legend to Fig. 1. I represents a correctly base-paired 2',3'dideoxynucleotide terminated primer.

MECHANISM OF REPLICATIVE

DNA

POLYMERASES

379

DNA polymerases has specific implications in the context of the pol-a catalytic core reaction mechanism. Whereas DNA has a relatively low affinity for Mgz+ and is mostly bound to Na+ in uiuo, dNTPs have a much higher affinity for divalent cations and compete effectively for Mg2+. It therefore seems likely that in the cell nucleus, Mg2+ ultimately destined to chelate primer is brought to the pol-a active site by dNTP. After incorporation and translocation, Mg2+ originally bound at the dNTP site remains associated with pol a in the primer-binding site.

E. The Ordered Sequential Terreactant Mechanism of Substrate Recognition and Binding

The ordered sequential terreactant mechanism of substrate recognition and binding by human pol-a catalytic core, shown diagrammatically in Fig. 1 and referred to throughout this section, is presented in Fig. 7. Included in this representation are the participation of two pol-a single-stranded DNA (template) binding sites in orienting pol a at the replication fork as well as the role of Mg2+ in primer binding. The only functional substrate binding sites on free pol a recognize singlestranded DNA templates (Fig. 7, A and B). Each molecule of pol-a core protomer apparently possesses two such sites, which interact allosterically. Once bound to template, pol a acquires a functional primer-binding site (Fig. 7, B and C). Presumably, the pol-a core protomer is able to search the single-stranded template until a suitable primer is found. To be recognized as such, the three or four 3’-terminal nucleotides of a primer must be basepaired to template and the primer must be at least 8 nt long. Binding is through a Mg2+-chelate of the primer phosphodiester backbone. There is considerable flexibility in the chemical structure permissible at the 3’ terminus; primers containing 2’-H, 3’-OH; 2’-OH, 3’-OH; T-PO,, 3’-OH; and 2’-H, 3’-H are all recognized and bound with approximately equal affinity. In contrast, 3’-PO,-containing primers cannot be bound. Primer binding induces formation on pol a of a functional dNTP-binding site (Fig. 7D). Although dependent for its activity on a prerequisite step of primer binding, this site derives its specificity from the template nucleotide immediately adjacent to the primer terminus. Thus, only the appropriate nucleotide for incorporation, as directed by the DNA template, is bound by the polymerase (Fig. 7E). dNTP is bound by pol a as a MgZ+-chelate. Once the ternary complex (i.e., pol aetemplate-primer correct dNTP) is formed, catalysis ensues, provided that the primer contains a 3’-OH group, necessary for nucleophilic attack on the a+ phosphodiester bond of the incoming dNTP. We have suggested that the Mg2+ ion brought to the ternary pol asubstrate complex by the dNTP remains bound to the polymerase-active site

380

PAUL A. FISHER

FIG. 7. A representation of the ordered sequential terreactant mechanism of substrate retognition and binding by KB cell pol-a catalytic core enzyme. (A) Free pol a contains only template-binding sites (+); there are two such sites. (B) Pol a bound to primed single-stranded D N A at one of its two template-binding sites. These two sites can interact allosterically. as indicated by the double-headed arrow. A primer binding site (4)is generated adjacent to the bound template. ( C ) Pol a positioned within a replication fork by virtue of binding to singlestranded DNA at both template-binding sites. The enzyme is poised to replicate the lagging strand. (D) Binding of primer induces formation of a template-directed dNTP-binding site (0. (E) dNTP-binding site binds dNTP in a template-directed manner; catalysis ensues.

and goes on to chelate the newly formed primer after the dNMP is incorporated and PP, is released.

II. Holoenzyme of DNA Polymerase a A. Comparison of Holoenzyme with Catalytic Core Protomer from Human KB Cells Purification of apparently undegraded pol-a holoenzyme from human KB cells allowed enzymologic comparison between holoenzyme and catalytic core protomer (5). Several aspects of the fundamental mechanism of substrate recognition and binding were tested (5).In all respects, human pol-a

MECHANISM OF REPLICATIVE

DNA

C

D

5’

381

POLYMERASES

E

3’

FIG.7 . (Continued)

holoenzyme behaved identically to human pol-a catalytic core protomer. Like the catalytic core protomer, human pol-a holoenzyme is inhibited by single-stranded but not by double-stranded DNA. An example of this inhibition is shown in Fig. 8. Inhibition by single-stranded DNA showed greater than first-order dependence on inhibitor concentration; linear Hill plots with slopes of 1.5-1.6 were obtained (Fig. 9). Human pol-a holoenzyme bound primer as the second substrate and, like the catalytic core protomer, recognized properly base-paired 2’,3’-dideoxy-terminatedprimers. As a result, it was possible to demonstrate induced dNTP inhibition (Fig. lo), thus confirming the ordered sequential terreactant mechanism of substrate recognition and binding by human pol-u holoenzyme. This mechanism was identical to that previously established for the isolated catalytic core (see Figs. 1, 6, and 7). The role of Mg2+ in template-primer recognition by human pol-a holoenzyme was elucidated by steady-state kinetic analyses. With the appropriate substrate, (dA)m-(dT)z, Mg2+ was shown to be a highly cooperative competitive inhibitor of primer binding. Linear Hill plots with slopes of 3.9

382

PAUL A. FISHER

*t FIG. 8. Inhibition of human pol-aholoenzyme by single-stranded DNA. Concentration of competitive inhibitor (in nucleotide) and DNA polymerase activity are as shown. Competitor DNAs were supercded circular duplex pBR322 DNA ( +), DNase-I-nicked relaxed circular duplex pBR322 DNA (a),blunt-ended duplex pBR322 DNA fragments generated with HwIII rrrtriction endonuclease (A),and single-stranded circular +X174 DNA (W).

were obtained (Fig. 11). As with the human pol-a catalytic core protomer, this has been interpreted to indicate that human pol-a holoenzyme binds primer through a M@+-chelate of the primer phosphodiester backbone; we have suggested that four Mg2+ ions and eight phosphodiester phosphates are involved.

B. Comparison of Human Holoenzyme with Holoenzyme Purified from Drosophila melanogaster Embryos

To demonstrate that the enzymologic mechanism elucidated for human pol-a catalytic core and confirmed for human pol-a holoenzyme was applicable to pol a obtained from a different organism, pol-CYholoenzyme was purified from Drosophila mehogaster embryos. Drosophilu was chosen as a higher eukaryote of considerable evolutionary distance from humans; moreover, a conventional biochemical protocol for purification of Drosophilu pol-a holoenzyme was available (13). Like human pol-a catalytic core and holoenzyme, Drosophilu pol-a holoenzyme follows an ordered sequential terreactant mechanism for substrate

MECHANISM OF REPLICATIVE

DNA POLYMERASES

383

‘ i

>

50

100

150

200

250

[4x174 DNA] (pM)

, B

0.4

L

FIG.9. Inhibition of human pol-a holoenzyme by single-stranded DNA exhibits positive cooperativity; Dixon and Hill plot analysis. (A) Dixon plot (V-l versus I ) analysis of inhibition by single-stranded circular +X174 DNA. Three different concentrations (in nucleotide) of activated DNA substrate were used: 60 pM (O), 120 p M (A),and 240 pM (m). (B) Hill plot analysis of the data shown in A. Symbols are the same as in A. V,, velocity of incorporation in the absence of inhibitor DNA; Vi, velocity of incorporation in the presence of inhibitor DNA.

recognition and binding; template is bound first, followed by an appropriately base-paired primer, and then, template-directed dNTP (14). The demonstration of induced dNTP inhibition in the presence of a base-paired 2’,3’-dideoxy-terminated primer was crucial to the elucidation of this mechanism. A detailed study has recently been completed of the effects of primer mismatch on binding and dNMP incorporation on synthetic oligonucleotide template-primers by Drosophila pol-a holoenzyme (15). Results of these studies were consistent with and refine previous studies of human pol a. It

-

P 0 c X

E U

50

100

400

200 [dGTP]-’

v

(mM)

c

>

I 50

100

200

(00

[dNTP]-’ (mM, each)

FIG.10. Induced substrate inhibition of human pol-a holoenzyme in the presence of a correctly base-paired 2‘,3’-dideoxy-terminatedprimer. Data are shown as Lineweaver-Burk double-reciprocal plots (V-1 versus S-1). All nucleic acid concentrations are expressed in terms of nucleotide. (A) Nucleic acid substrate, (dC)m-(dC),, was at a final concentration of 20 pM. dCTP concentrations and DNA polymerase activity, as measured by CPM [32P]dCMP incorporated, were as indicated; nucleic acid substrate alone (0);nucleic acid substrate plus 2 pM (dC)m-(dG)z-(ddA, ddT, or ddC), (A);nucleic acid substrate plus 2 (LM (dC)-(dG)m(ddG), (m). (B) Nucleic acid substrate was activated DNA at a final concentration of SO p M . dNTP concentrations and DNA polymerase activity, as measured by CPM [3zP]dTMPincorporated, were as indicated; activated DNA alone (0);activated DNA plus 20 pM dideoxy-primed single-stranded DNA template molecules (mean length of template plus primer was approximately 75 nucleotides) (A).

MECHANISM OF REPLICATIVE

DNA

385

POLYMERASES

.

2.0

*

1.6

*

1.2

.

0.8

.

0.4

*

/ 0 ’

/ /’ 1.2

1.5

1.6

FIG. 11. Inhibition of human pol-a holoenzyme-primer binding by Mgz+ exhibits positive cooperativity;Hill plot analysis. Nucleic acid substrate, (dA)m-(dT)a was at a final concentration of 80 pM (nucleotide).The slope was computed from the extended linear portion of the plot as indicated by the solid line. See legend to Fig. 9B.

was demonstrated that Drosophila pol-a holoenzyme requires primerterminal complementarity of at least 4 bp for efficient binding and incorporation. When a mismatched base pair was present at the - 4 position relative to the 3’-primer terminus, only slight binding occurred. This was consistent with the ability of Drosophila pol-a holoenzyme to incorporate a single nucleotide on a template-primer containing a mismatch at this position, but at a rate of only 7% relative to incorporation on a perfectly matched template-primer. Despite the many similarities, several aspects of enzymologic mechanism elucidated for human pol a remain to be tested with the Drosophila pol-a holoenzyme. Two questions stand out. Is inhibition of Drosophila pol-a holoenzyme by single-stranded DNA cooperative? What is the role of Mg2+ in template binding and primer binding? In these contexts, it may also be useful to perform detailed enzymologic analyses of a lower eukaryotic pol-a homologue, for exapmle, Saccharomyces cerevisiae pol I.

386

PAUL A . FISHER

Ill. Interaction of DNA Polymerase a with Template-Primers Containing Chemically Damaged Nucleotides

A. I nteract ion with TempI ate- Primers Conta in ing Abasic Sites

Takeshita et al. (16) synthesized chemically oligodeoxyribonucleotides containing modified tetrahydrofuran moieties inserted into the phosphodiester backbone in place of normal deoxyribonucleotides. They suggested that such sites were structurally analogous to abasic (base-removed) sites naturally arising in DNA. Abasic sites in DNA have been proposed as common intermediates through which pass many pathways of chemical mutagenesis (17, 18). To study the interaction of Drosophilu pol-a holoenzyme with abasicsite-containing template-primers, a series of oligonucleotides, 30-mer templates and 12-mer primers, containing abasic residues at various defined positions along their lengths, was synthesized (14). A control 30-mer and a control 12-mer, both lacking abasic residues, were synthesized as well. After annealing a complementary 12-mer primer to one end of the 30-mer teniplate, abasic sites were located at various defined positions in both template and primer regions. A single 30-12-mer contained at most one such site. The structure of the 30-12-mer template-primer is shown in Fig. 12; the possible locations of abasic residues are indicated by asterisks. Two aspects of Drosophila pol-a holoenzyme interaction with abasic-sitecontaining template-primers were studied. First, the ability of the enzyme to incorporate a single template-directed nucleotide on each available 3012-mer was determined. To make such determinations, a PAGE-dependent assay was developed. After incubation of enzyme with various templateprimers and [a-32P]dGTP, reaction products were analyzed by PAGE in the presence of 7 M urea. After electrophoresis and autoradiography, regions of the gel containing radiolabeled 13-mer reaction product were excised and

el0.

5’

+ 20* * . +

30

CTGCAGAGATCTGTCGACAAGCTTGAATTC 3’ TTCGAACTTAAG

+ + + *

3’

5’

FIG. 12. Structure of the 30-12-mer template-primer used to study the interaction of Drosophila pol-a holoenzyme with oligonucleotides containing model abasic sites. The possible positions of abasic sites are indicated by asterisks. Each template-primer contained, at most, one such site.

MECHANISM OF REPLICATIVE

DNA

POLYMERASES

387

incorporation was quantified by liquid scintillation counting. To facilitate quantification, odd-numbered gel lanes were loaded first, followed by evennumbered gel lanes 1 hour after the start of electrophoresis. This allowed excision after electrophoresis and autoradiography, without concern for overlap of radioactivity between lanes. An example of autoradiographic data from such an experiment is shown in Fig. 13. The results of incorporation studies (14) indicated that, relative to incorporation opposite a normal template nucleotide, Drosophila pol-a holoenzyme is essentially unable to catalyze nucleotide incorporation opposite an abasic template residue. This observation was consistent with reports of others (19; see also 16),suggesting that incorporation opposite the abasic site is about 1/4000th as efficient as incorporation opposite a normal template nucleotide. Abasic residues on either strand of the 30-12-mer in the primer region of the template-primer construct as far as 4 bp removed from the 3’-primer terminus prevented detectable incorporation opposite a normal template nucleotide at that primer terminus. In contrast, abasic residues in the primer region further than 4 nt removed from the primer terminus had relatively

FIG. 13. PAGE-dependent assay of single-nucleotide incorporation on 30-12-mer template primer. Denaturing PACE analysis was performed according to standard protocols (see 14 for original references). Odd-numbered lanes were loaded first and even-numbered lanes were loaded 1hour later. The migration positions of the 13-mer reaction product are as indicated to the right of the figure (el3 and 013).DNA concentrations are expressed in terms of molecules of 30-12-mer initially present; lane a, no DNA substrate; lane b, 0.25 p M DNA substrate; lane c, 0.50 pM DNA substrate; lane d, 1.0 pM DNA substrate; and lane e, 2.0 pM DNA substrate.

:388

PAUL A . FISHER

little effect on nucleotide incorporation by Drosophila pol-a holoenzyme opposite a normal template nucleotide. With one exception, abasic residues in the template other than at the site opposite the primer terminus also had relatively little effect on nucleotide incorporation by Drosophila pol-a holoenzyme opposite a normal template nucleotide. The exception was that when an abasic residue was placed in the template region close to, but not at, the 3’-primer terminus, incorporation opposite a normal template nucleotide at that primer terminus was apparently stimulated three- to fourfold. Induced dNTP inhibition experiments were performed in conjunction with nucleotide incorporation studies (14). The advantage of induced dNTP inhibition experiments is that they provide a direct measure of the pol-a template-primer binding interaction, independent of catalysis by the enzyme. Results of these experiments indicate that substrates that did not support catalysis by pol (Y in direct nucleotide incorporation experiments could not bind polymerase, thus indicating that lack of incorporation was due to lack of binding. Additionally, the substrate on which incorporation was apparently stimulated three- to fourfold, i.e., that containing an abasic template residue near to but not opposite the 3’-primer terminus, was bound similarly to the control template-primer. This suggests that enhanced incorporation on the former substrate resulted from enhancement of the rate of catalysis (kcat) and not enhanced binding of the substrate by pol a.

B.

interaction with Template-Primers Containing the Exocyclic Adduct, 1 ,N2-propanodeoxyguanosine

Studies similar to those performed with abasic-site-containing substrates were performed with template-primers containing the exocyclic adduct, 1,N2-propanodeoxyguanosine (PdG) (15).Virtually identical results were obtained. Synthetic oligonucleotides containing PdG residues at various defined sites were prepared according to Kouchakdjian et al. (20).Both direct incorporation and induced dNTP inhibition assays determined that Drosophila pol-a holoenzyme will not bind and hence cannot catalyze nucleotide incorporation when a PdG residue is present in the primer region at the -4 position or closer, relative to the 3’-primer terminus. PdG residues further than 4 nt from the 3’-primer terminus had relatively little effect on either binding or incorporation. When a PdG residue was located in the template region, near to but not at the 3’-primer terminus, single-dNMP incorporation opposite a normal template nucleotide at that primer terminus was stimulated three- to fourfold. Results obtained with template-primers containing PdG residues in the primer region are similar to those seen with both abasic-site-containing

MECHANISM OF REPLICATIVE

DNA POLYMERASES

389

template-primers and mismatch-containing template-primers. Together, they suggest that when pol a encounters either a noninformational abasic site or an exocyclic PdG adduct in the template, they are treated as residues for which no complementary nucleotide can be found. As such, incorporation stops until repair of the lesion occurs. That a relatively bulky exocyclic adduct like PdG has a similar effect on primer recognition by pol a as the noninformational abasic site suggests that, rather than recognizing base damage per se, pol a has a stringent requirement for a correctly base-paired primer. Any perturbation of that structure, whether by base mismatch or a modified nucleotide or lesion for which no normal complement exists, results in abrogation of primer binding and cessation of catalysis. Results obtained with template-primers containing PdG residues in the primer region, in conjunction with those obtained with abasic-sitecontaining primers and mismatch-containing primers, also have specific implications for fidelity of nucleotide incorporation by pol a (14, 15). When either an abasic site or a PdG residue is encountered in the template, pol a pauses, as these lesions are apparently mechanistically equivalent to a template nucleotide for which no normal complement exists. Indeed, the efficiency with which pol a incorporates a nucleotide opposite an abasic site is similar to the efficiency of base misincorporation (19).In the unlikely event that pol a does “misincorporate,” the product of misincorporation is now recognized by polymerase as a mismatched primer and further catalysis does not occur. The fact that each of the first four primer nucleotides must be base-paired for subsequent incorporation to proceed at normal rates means that immortalization of a misincorporated nucleotide actually requires that five unlikely events occur. Even if the probability of each of these events is as high as 10-2, the probability of all five occurring would be only 10-10.

C. Insights into the Mechanism of Polymerase Incorporation from Studies of Templates Containing Chemically Damaged Bases

The presence of either an abasic site or a PdG residue in the template, near to but not opposite the 3’-primer terminus, leads to a three- to fourfold stimulation of single nucleotide incorporation opposite a normal template nucleotide. We have suggested a possible mechanism for this effect (14, 15). Human pol-a catalytic core interacts with between 5 and 10 template nucleotides (11).A plausible explanation for the stimulation of incorporation by damaged template nucleotides located near to but not opposite primer termini is that, to incorporate, the polymerase must translocate. To translocate, polymerase must release each template nucleotide with which it interacts initially and reform a new set of enzyme-template bonds. Weakening (or

390

PAUL A . FISHER

eliminating) one of these bonds by placing a chemically modified residue in the template might therefore facilitate translocation and thereby enhance the rate of nucleotide incorporation at a nearby primer site. This hypothesis is currently being tested.

IV. DNA Polymerase 6 It is now certain that pol a and pol 6 are two distinct proteins. Initially, this conclusion was based on two-dimensional peptide map analysis (21), immunochemical comparison (21, 22), and a variety of enzymologic studies. More recently, distinct putative pol-6 sequences have been deduced from cDNA clones isolated from both human and bovine sources (23, 24). Most notable among the enzymologic differences between pol a and pol 6 are the specific association of a DNA primase activity with the pol-a holoenzyme, the specific association of a putative proofreading 3' + 5' exonuclease with p o l 3 catalytic core, and the response of pol 6 to the auxiliary factor, proliferating cell nuclear antigen (PCNA). Purification of pol-6 catalytic core to apparent homogeneity from calf thymus (25; see also 26) made possible detailed enzymologic characterization (26).In performing these experiments, we were guided by previous analyses of pol a. We reasoned that this would facilitate direct comparison between the two major replicative DNA polymerases in higher eukaryotes. We also felt that such characterization was a necessary prerequisite to understanding the mechanism whereby poi 6 was stimulated by its specific auxiliary factor, PCNA. PCNA was also purified from calf thymus for this purpose (25)and compared with a PCNAhomologue purified from Drosophila embryos (27) as well as with cloneencoded PCNA molecules expressed in Escherichia coli.

A. The Ordered Sequential Terreactant Mechanism of Substrate Recognition and Binding

Like both human pol a and Drosophila pol a,calf thymus pol-6 catalytic core follows an ordered sequential terreactant mechanism of substrate recognition and binding (see Fig. 1); also, like pol a,pol 6 binds template first, followed by primer and then template-directed dNTP (26).Template binding was demonstrable, both by enzyme inhibition studies and by direct semiquantitative sedimentation binding analyses. Of all the DNA molecules tested (Table 11), including single-stranded circular DNA, supercoiled double-stranded circular DNA, relaxed double-stranded circular DNA, and

MECHANISM OF REPLICATIVE

DNA

391

POLYMERASES

TABLE I1

EFFECTOF DNA STRUCTURE ON COMPETITIVE INHIBITION OF POL 6 DNA structure“

Inhibition of pol 6

ss circular ds circular (supercoiled) ds circular (relaxed) Blunt-ended ds frazments (3’-OH, 5’-POA)

Yes No No No

ass,

Single-stranded;ds, double-stranded.

blunt-ended linear duplex fragments, only single-stranded circular DNA inhibited pol 6 when the activity of this enzyme was assayed on an activated DNA substrate. Consistent with this, free pol 6 was only able to bind singlestranded DNA in the context of direct, semiquantitative sedimentation binding experiments. Pol 6 was unable to bind either supercoiled circular duplex DNA or relaxed circular duplex DNA. Primer binding was demonstrated specifically in the context of correct dNTP binding, and induced dNTP inhibition occurred in the presence of a base-paired 2’,3’-dideoxy-terminatedprimer (26). This allowed us to establish the ordered sequential terreactant mechanism of substrate recognition and binding, with primer binding as the second step in the mechanism followed by template-directed dNTP binding. Several additional aspects of primer binding that have been studied with pol a remain to be investigated with pol 6. These include the ability of pol 6 to bind and/or utilize primer termini with chemical structures other than 2’-H, 3’-OH (a conventional deoxynucleotide primer) and 2’-H, 3‘-H (a dideoxynucleotide primer); the role of Mg2+ in primer binding; and the ability of pol 6 to bind and/or utilize primers containing mismatched or unmatched bases at various defined positions. In conjunction with this last aspect of pol-6 mechanism, it may be particularly interesting to investigate the capacity of the pol-6-associated 3’+5’ exonuclease to excise mismatched primer-terminal nucleotides.

B. Mechanism of Stimulation by Proliferating Cell Nuclear Antigen Having established that the pol-6 catalytic core follows an ordered sequential terreactant mechanism similar to that elucidated for pol a (26),we next sought to determine the enzymologic mechanism whereby pol 6 is stimulated by its auxiliary factor, PCNA. Steady-state kinetic analyses were performed with two different substrates, (dA)m-(dT)z and 30-21-mer, a

392

PAUL A. FISHER

10

2o

30

5’ CTGCAGAGATCTGTCGACAAGCTTGAATTC 3‘ 3’ AGACAGCTGTTCGAACTTAAG 5’ 20

10

FIG. 1-1. Structure of (d.4)m-(dT), and 30-21-mer template-primers used to elucidate

the Ineclianism of pol-6 stimulation by PCNA.

heteropolymeric synthetic oligonucleotide template-primer. The structures of both substrates are shown in Fig. 14. When either clone-encoded human PCNA expressed in and purified from E . coli or authentic PCNA purified from calf thymus was added to incubations with calf thymus pol 6 and various DNA substrates, several effects were noted. On (dA)m-(dT)E (Fig. 14), a substrate on which processive DNA synthesis was possible, PCNA, as expected (see, e.g., 25), stimulated greatly the processivity of calf thymus pol 8. Results of steady-state kinetic analyses suggest that this is due both to an increased af6nity of pol 6 for template-primer reflected by a dramatic decrease in apparent &,,and to a small but reproducible increase in the rate of individual nucleotide incorporation (kcat) as reflected by an increased Vmu. To simplify the steady-state kinetic analysis, similar experiments were performed using a synthetic 30-21-mer template-primer (Fig. 14) in place of (dA)T-,-(dT)-,. By including in the incubation only dITP, the dNTP complementary to the template nucleotide on the 30-mer opposite the 3’-OH group of the 21-mer primer, it was possible to study the effects of PCNA on single-nucleotide incorporation by pol 6, without the kinetic cornplexity of processive DNA synthesis. In experiments with 30-21-mer, it was found (26) that PCNA increases V,,,,, substantially, thus confirming the impression that PCNA enhances the rate of single-nucleotide incorporation (kcS,Jby pol 6. In fact, the apparent K,,,of pol 6 for 30-21-mer in these experiments actually increased in response to addition of PCNA. We suggested that this increase in apparent K,, resulted from destabilization of the enzyme-template-primer complex brought about by increased catalysis (kcat)and not decreased affinity of pol 6 for the 30-21-mer in the presence of PCNA (26).

MECHANISM OF REPLICATIVE

DNA

POLYMERASES

393

C. A Nondenaturing PAGE-band Mobility Shift Assay to Study the Interaction of Pol 6, PCNA, and Synthetic Oligonucleotide Template-Primers

Further insights into the mechanism of pol-6 stimulation by PCNA were obtained from results of a novel PAGE-band mobility shift assay (28). An example of data from such an assay is shown in Fig. 15. This technique allowed us to study directly the effect of PCNA addition on the ability of pol 6 to bind the 30-21-mer without having to resort to sedimentation binding analysis. Results obtained from these assays indicated that either cloneencoded human PCNA or authentic calf thymus PCNA (i.e., homologous PCNA) can promote stable complex formation between calf thymus pol 6 and 5’-32P-labeled 30-21-mer. In contrast, neither clone-encoded nor authentic Drosophila PCNA (i.e., heterologous PCNA) functioned similarly.

FIG.15. Formation of a PAGE-detectable pol 6.PCNA.template-primer complex. Formulation of incubations and nondenaturing PAGE were as previously described (28). Each incubation contained 0.1 pM (molecules) of 30-21-mer (see Fig. 14) labeled at both 5’ ends with 32P. Lane a, 30-21-mer alone; lane b, 3&21-mer plus calf thymus PCNA; lane c, 30-21-mer plus calf thymus pol 6; and lane d, 30-21-mer plus calf thymus pol 6 plus calf thymus PCNA. Arrow to the left of the figure indicates the migration position of free 30-21-mer; arrow to the right of the figure indicates the migration of the pol 6-PCNA.(30-21-mer) complex.

394

PAUL A. FISHER

The differing abilities of homologous versus heterologous PCNA to promote PAGE-stable complex formation between calf thymus pol 6 and 30-21mer correlates well with the differing capacities of homologous versus heterologous PCNA to stimulate the activity of calf thymus pol 6 on (dA)m(dT)E(28)and are consistent with the limited ability of Drosophila PCNA to substitute for human PCNA in the reconstituted SV40 DNA replication system (27). A model for the ordered sequential interaction of pol 6, PCNA, and template-primers (Fig. 16) has been proposed (28). We have demonstrated a stable calf thymus pol 6.PCNA.oligonucleotide complex after electrophoresis on nondenaturing agarose gels (M. McConnell and P. A. Fisher, unpublished). A complex of almost identical mobility was detected in extracts of Drosophih eggs and early embryos but not in extracts prepared from older embryos (S. Bogachev and P. A. Fisher, unpublished).

V. Conclusions and Prospects for Future Research Pol a and pol 6 follow similar ordered sequential terreactant mechanisms of substrate recognition and binding. For both polymerases, the first substrate bound is template. This observation has two clear implications for in t;ioo replication. First, to initiate DNA synthesis, both enzymes would require single-stranded DNA template (i.e., first substrate). Second, neither pol a nor pol 6 should be able to fill a gap efficiently; once template size was PCNA Template Primer

pol 6.T-P

\

PCNA pol6

pol6.T

pol6.T-

pd 6.T-P-dNTP

+

pol 6.T-P \/ PCNA

L

pol 6oT-PedNTP \/

PCNA

pol 6oT-P.dHIP

FIG. 16. The ordered sequential mechanism of substrate recognition and binding by calf thymus pol 6 in cvmbination with PCNA-a working hypothesis. Incorporation can occur starting with either the pol &template-primer complex or the pol 6.PCNA.template-primer complex. Although there is no evidence for interaction of pol 6 with PCNA independently of template-primer, neither can such an interaction be ruled out. The model proposes that pol 6 cannot interact with PCNA before binding to template-primer. However, this remains hypothctical.

MECHANISM OF REPLICATIVE

DNA

POLYMERASES

395

reduced below the necessary minimum, both enzymes would presumably lack the first substrate and would dissociate from the DNA. The first prediction regarding initiation has been largely substantiated by results obtained with the reconstituted SV40 DNA replication system (see, e.g., 29-31). Current models propose that DNA synthesis on both leading and lagging strands of the DNA is initiated first by unwinding of the DNA duplex in the region of the replication origin. Unwinding generates singlestranded DNA template (i.e., the first substrate for pol a)and is followed by primer synthesis catalyzed by the pol-a holoenzyme-associated DNA primase. At the same time, pol 6, which also recognizes single-stranded template DNA as its first substrate, can bind to DNA while awaiting primer. The second prediction, regarding in vim gap-filling by pol a and pol 6, remains untested. In this context, it is tempting to speculate that pol E is the “gap-filling”polymerase. One would intuitively expect the requirement for gap-filling to be much more apparent with respect to lagging-strand replication. There might nevertheless be a certain minimal requirement for gap filling on the leading strand as well. Detailed enzymologic analysis of pol E could shed immediate light on these hypotheses. Primer represents the second substrate for both pol a and pol 6. From a purely mechanistic perspective, therefore, both leading and lagging strands could be elongated by either pol (Y or pol 6. However, here the intrinsic mechanism of the polymerase reaction becomes subject to specific modification by polymerase-associated factors. Hence, the inherently discontinuous nature of lagging-strand synthesis with the frequent need for repriming would make pol-a holoenzyme, with its tightly associated DNA primase, the logical choice for lagging-strand replication. Conversely, priming on the leading strand need only occur once. As soon as primer and template are available, pol 6 in conjunction with associated PCNA and perhaps other replication factors (e.g., RF-C) would be logical candidates for leadingstrand replication. Again, results in the reconstituted SV40 DNA replication system support such notions (29, 30). The requirement of pol a, an enzyme apparently lacking an associated proofreading 3’ + 5’ exonuclease, for primer terminal complementarity, has explicit implications for the fidelity of DNA synthesis by this enzyme. These have been discussed extensively (14, 15; see also Section 111,B). So too have implications of the observation that human pol a apparently contains two interacting single-stranded DNA (template) binding sites (5, 6, 11; see also Sections 1,A and 11,A). In the present context, it is important to emphasize that these two template-binding sites have only been observed during enzyme inhibition studies. Simultaneous polymerase activity at both sites therefore seems highly unlikely. Rather, the second template-binding site on

396

PAUL A. FISHER

pol ci may serve to align the enzyme at the replication fork and ensure efficient lagging-strand DNA synthesis. In contrast with pol a, pol F has an associated 3' + 5' exonuclease activity, presumably involved in proofreading. Currently, there is little understanding of how pol-6 polymerase activity and pol-b exonuclease activity act coordinately, if indeed they do. It is likely that detailed enzymologic analyses of interactions among pol 6, PCNA, and synthetic oligonucleotides of varying primary and secondary structures will shed considerable light on these and related questions. Such analyses are under way. There is now little doubt that a Drosophilu pol 6 exists. This conclusion is based on unequivocal identification of Drosophilu PCNA (27,32),the reported detection in embryos of a DNA polymerase activity, physically distinct from pol ci and apparently responsive to PCNA (33),and the identification by nondenaturing gel-electrophoresis-band mobility shift assay (28) in Drosophiln oocyte and early embryo extracts, of a protein-nucleic acid species of mobility nearly identical to that of the calf thymus pol 6-PCNA-templateprimer complex (see Section IV,C). The complete purification of pol 6 from Drosophilu, a higher eukaryote amenable to systematic genetic manipulation, would permit in civo analysis of pol-6 function. Application of nondenaturing gel-electrophoresis-band mobility shift assays may greatly facilitate this purification.

ACKNOWLEDGMENTS It is a pleasure to acknowledge many colleagues and collaborators for contributing to the research described herein. These include S. Bogwhey K. Downey. D. Korn, M. McConnell, L. Ng, C. Tan, '1 \Vang, and S . Weiss. I also express my gratitude to A. Daraio for computer design of the figures and for help in preparation of the manuscript. Stndies from m y laboratory presented in this essay were supported by Research Grants Gh435943 and ESM068 from the National Institutes of Health. I was partially supported during the writing of this essay by Research Scholar Grant SG 189 from the American Cancer Society and by a Guest Research Fellowship from the Royal Society. This essay is dedicated to niy wife, Peggy, on the occasion of o u r tenth wedding anniversary

KEFERENCES I . A. Morrison, H. Araki, A . B. Clark. R. K. Hamatake and A. Sugino, Cell 62, 1143 (1990). 2. P. A. Fisher and D. Korn, JBC 252, 6528 (1977). 3 . I>. Filpula. P. A. Fisher and D. Korn, JBC 257, 2029 (1982). 1. S. Tanaka, S.-Z. Hit, T. S.-F. Wang and D. Korn, JRC 257, 8386 (1982). 5 . S. M: \Vong, I,. R. Pabarsky, P. A. Fisher, T. S. Wang and D. Korn. JBC 261, 7958 (1986). 6. P. A. Fisher and 0 . Ktirn, JBC 254, 11033 (1979).

MECHANISM OF REPLICATIVE 7. 8. 9. 10. 11. 12. 13. 14.

DNA POLYMERASES

P. A. Fisher and D. Korn, JBC 254, 11040 (1979). P. A. Fisher and D. Korn, Bchem 20, 4560 (1981).

397

P. A. Fisher and D. Korn, Bchem 20, 4570 (1981). P. A. Fisher, T. S.-F. Wang and D. Kom, JBC 254, 6128 (1979). P. A. Fisher, J. T. Chen and D. Kom, JBC 256, 133 (1981). D. Korn, P. A. Fisher and T. S.-F. Wang, This Series 26, 63 (1981). L. S. Kaguni, J. Rossignol, R. C. Conaway and I. R. Lehman, PNAS 80, 2221 (1983). L. Ng, S. J. Weiss and P. A. Fisher, JBC 264, 13018 (1989). 15. S. J. Weiss and P. A. Fisher, JBC 267, 18520 (1992). 16. M. Thkeshita, C. Chang, F. Johnson, S. Will and A. P. Grollman, JBC 262, 10171 (1987). 17. L. A. Loeb, Cell 40, 483 (1985). 18. L. A. Loeb and B. D. Preston, ARGen 20, 51 (1987). 19. S. K. Randall, R. Eritja, B. E. Kaplan, J. Petrushka and M. F. Goodman, JBC 262, 6864 (1987). 20. M. Kouchakdjian, E. Marinelli, X. Gao, F. Johnson, A. Grollman and D. Patel, Bchem 28, 5647 (1989). 21. S. W. Wong, J. Syvaoja, C.-K. Tan, K. Downey, A. G. So, S. Linn and T. S.-F. Wang, JBC 264, 5924 (1989). 22. M. Y. W. T. Lee, Y. Jiang, S. J. Zhang and N. L. Toomey, JBC 266, 2423 (1991). 23. D. W. Chung, J. Zhang, C.-K. Tan, E. W. Davie, A. G. So and K. M. Downey, PNAS 88, 11197 (1991). 24. J. Zhang, D. W. Chung, C.-K. Tan, K. M. Downey, E. W. DavieandA. G. So, Bchem30, 11742 (1991). 25. C.-K. Tan, C . Castillo, A. G. So and K. M. Downey, JBC 261, 12310 (1986). 26. L. Ng, C.-K. Tan, K. M. Downey and P. A. Fisher, JBC 266, 11699 (1991). 27. L. Ng, G. Prelich, C. W. Anderson, B. Stillman and P. A. Fisher, JBC 265, 11948 (1990). 28. L. Ng, M. McConnell, C.-K. Tan, K. M. Downey and P. A. Fisher, JBC 268,13571 (1993). 29. M. D. Challberg and T. H. Kelly, ARB 58, 671 (1989). 30. B. Stillman, Annu. Rev Cell Biol. 5, 197 (1989). 31. T. S.-F. Wang, ARB 60, 513 (1991). 32. M. Yamaguchi, N. Yasuyoshi, T. Moriuchi, F. Hirose, C.-C. Hui, Y. Suzuki and A. Matsukage, MCBiol 10, 872 (1990). 33. V. M. Peck, E. W. Gerner and A. E. Cress, NARes 20, 5779 (1992).