Enzymology of DNA Transfer by Conjugative Mechanisms

Enzymology of DNA Tra nsfer by Con iugat ive Mechanisms’

WERNER PANSEGRAU ERICHL A N K A ~

AND

Mar-Planck-Znstitut fur Molekulare Genetik 0-14195 Berlin, Germany

I. Model of the Transfer Process . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

11. Organization of IncP Transfer Regions . ............ 111. Mating Aggregate Formation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

A. Definition of a Core System for Conjugative Transfer B. A Single Membrane Protein Complex Functions as P and Sustains Pilus Assembly and Conjugative DNA Transport . . . . C. TraC-like Proteins . . . .................................. D. The IncP Entry Exclus unction Is Specified by trbK . . . . . . . . E. Biochemical Analysis of Mpf Functions ........................ IV. DNA Processing Reactions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. Kelaxosome Assembly at the IncP Transfer Origin . . . . . . . . . . . . . . . B. DNA Kelaxases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C. Accessory Proteins . . . ........................... D. Biochemical Methods fo elaxosomes . . . . . . . . . . . . . . . . E. DNA Primases . . . . . . . . . . . . . . . . . . . . . . . . . ... V. Phylogenetic Relationships to Other Systems . . . . . . . . . . . . . . . . . . . . . . VI. Conclusions and Perspectives . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . .........................................

197 200 207 207 210 211 212 214 215 215 218 226 229 232 234 245 247

1. Model of the Transfer Process Bacterial conjugation is one of the major routes of genetic exchange in prokaryotes. Although the process has been studied for 50 years, the enzymology of many of its steps is still an enigma. In 1946, Lederberg and Tatum ( I ) discovered that Escherichia coli K12 I Abbreviations: C terminus, carboxy terminus; Dtr, DNA processing; Hfr, high frequency of recombination; Inc, incompatibility group; IPTG, isopropy-P-D-thiogalactopyranoside;IS element, insertion element; Mpf, mating aggregate formation; N-terminus, amino terminus; PTH amino acid, phenylthiohydantion amino acid; RBS, ribosomal binding site; R-strand, retained strand; SDS, sodium dodecyl sulfate; T-complex, nucleoprotein complex of T-DNA; T-DNA, tumorigenic DNA; Tra, transfer region; T-strand, transferred strand. Corresponding author.

Progress ~n Nucleic Acid Rercarch and M o l r ~ u l a rBioloRy. \‘ol 54

197

Copyright 0 19% by Academic Press, Inc. All rights of reproduction in any form reserved

198

WERNER PANSEGRAU AND ERICH LANKA

can act as a donor for chromosomal genes. A cryptic conjugative plasmid (the F-factor) was later recognized to be responsible for the donor activity of E . coli K12 (2, 3). The F-factor contains several copies of insertional elements (IS) that occur also in the chromosome of E . coli and other Gram-negative bacteria (4). These IS elements are “hot spots” for chromosomal integration of F via homologous recombination. In the integrated state, designated as Hfr (high frequency of recombination), transfer of chromosomal genes occurs with high probability. The gene transfer commences within the integrated plasmid and is unidirectional. This property can be used to map chromosomal genes by determining the period of time required for a certain marker to arrive in the recipient. By the same technique, it was also shown that the E . coli chromosome is a circular entity (5). Bacterial conjugation is still used as a tool for introducing genetic information into organisms for which transformation procedures do not exist. By using shuttle-vectors with alternative origins of vegetative replication, genetic information can be transferred and stably established across species boundaries between organisms as phylogenetically remote as E . coli and Sacchuromyces cereuisiae (6). Recently, tumorigenic DNA (T-DNA) transfer from Agrohacterium tumefaciens to plant cells has been recognized as a special form of bacterial conjugation, adapted to the requirements of transkingdom gene transfer (7, 8). The T-DNA transfer system is extensively used for the genetic manipulation of plants. The major drawback of this method, however, is the low susceptibility of monocotyledenous plants to Agrohacterium-mediated gene transfer (9). Shortly after antibiotics were introduced for treatment of infectious diseases and as a supplement in animal food, bacterial strains with multiple antibiotic resistance appeared (10).These strains contained extrachromosoma1 elements, conjugative plasmids, and resistance (R-) factors that carried the genetic information for the antibiotic-resistance phenotype (11). The resistance genes, in most cases, were parts of transposable elements, suggesting that the plasmids had acquired these genes only recently and in response to the environmental challenge imposed on their hosts by the antibiotics. The phenomenon of antibiotic resistance spread might serve as example for the potential of prokaryotes to adapt rapidly to environmental changes. Other examples of genes that are located on plasmids and that might help a host to exist under special conditions are virulence genes, genes for the utilization of certain carbohydrates, and genes for the biodegradation of aromatic hydrocarbons (12). Recombination and transposition events may result also in incorporation of plasmid-encoded genes into the bacterial genome. Thus, plasmids and their exchange by conjugation play a prominent role in the evolution of bacterial species (12-14).

BACTERIAL CONJUGATION

199

A. Model Systems for Studying Bacterial Conjugation

Two conjugative plasmid systems have been studied in detail: The F-plasmid incompatibility group (Inc) FI (IncFI) and the antibiotic resistance transfer factor RP4 (IncPa). RP4 is considered to be identical to the plasmids R18, R68, RK2, and RP1 that, due to the geographic location of their place of isolation, are designated as Birmingham plasmids (15).Other systems under investigation are the non-self-transmissible IncQ plasmids (R1162, RSF1010) (16, 17). However, these plasmids can be mobilized in the presence of certain conjugative plasmids providing functions required for DNA transport across bacterial cell membranes that are not encoded by IncQ plasmids. IncP plasmids are of particular interest, because they are broad hostrange plasmids, capable of transfer between and stable inheritance in a wide variety of Gram-negative bacterial species. The broad host-range character includes the replication, maintenance, and transfer properties of the respective plasmid. In contrast, the host range of the vegetative replication machinery of IncF plasmids in general is confined to the Enterobacteriaceae. However, the host range of the transfer apparatus in both systems is considerably greater, illustrated impressively by the fact that both IncP and IncF plasmids can direct the transfer of DNA to yeast (6). Nevertheless, there could be some kind of specific interaction with potential recipient cells: the efficiency of DNA transfer varies considerably depending on the type of organism that functions as mating partner (6) and depending on the type of plasmid that directs the interkingdom DNA transfer (B. M. Wilkins, personal communication). Apart from the possibility that host-specific DNA restriction systems are involved, this could be due either to varying efficiency of interaction of the mating aggregate formation (Mpf) system with structures on the receptor’s cell surface, or due to the incapability of the donor to penetrate the cell wall of the recipient for DNA passage. The latter possibility seems especially reasonable when phylogenetically remote organisms such as yeast are involved. The enzymology of transfer DNA replication has been studied in all three systems. Reconstitution studies using purified plasmid-encoded transfer gene products allowed mimicking the initiation reaction in uitro (18-20).

6. Steps in Bacterial Conjugation Bacterial conjugation is a replicative process, during which a DNA molecule is transferred unidirectionally from a donor to a recipient cell. The transfer reaction requires physical contact between donor and recipient cells, possibly initiated by cellular appendices of the donor, called conjuga-

200

WERNER PANSEGRAU AND ERICH LANKA

tive or sex pili. The current model of bacterial conjugation (Fig. 1) for historical reasons is based primarily on the observations with the F-system (21-23). According to that model, pilus retraction leads to intimate cell-cell contact, and a mating bridge between the cells is formed that allows DNA passage. Establishment of stable cell-cell contact is postulated to create a trigger signal that is transmitted to a specialized protein-DNA complex, the “relaxosome” (19, 20). Relaxosomes are the initiation complexes of conjugative transfer DNA replication that form at an origin of transfer (oriT). One relaxosomal component, the “relaxase,” is a DNA strand transferase that, on receiving the mating signal, cleaves the DNA at the nick site of oriT and attaches covalently to the 5’ terminus. Rolling-circle-like replication is thought to create the DNA single strand destined for transfer. DNA transfer proceeds with 5’ to 3‘ polarity. During transfer, the 5’-attached relaxase is thought to remain associated within the DNA transport channel, scanning the incoming DNA for the reconstituted nick site (24). When the reconstituted nick site passes the relaxase, a second strand transfer reaction takes place, recircularizing the transferred DNA single strand (19). Discontinuous complementary strand synthesis is initiated either by host-encoded priming mechanisms or by plasmid-encoded DNA primases that may enter the recipient cell noncovalently attached to the imported DNA single strand. Complementary strand synthesis in the donor and recipient cells, supercoiling of the covalently closed plasmids, and active dissociation of the mating partners complete the conjugative process.

II. Organization of lncP Transfer Regions A. Clustering of Transfer Functions Transfer functions of IncP plasmids map in two regions, transfer regions 1 and 2 (Tral and Tra2). In most natural isolates of IncPa or p plasmids, these regions are separated by insertion elements andlor antibiotic resistance genes (25-27). It is likely that the IncP backbone sequences at the junction of Tral and Tra2 provide a general hotspot for illegitimate recombination. The reason for this could consist either in the structure of the region within the context of the whole plasmid, or the functions located there are not very important for plasmid propagation or transfer. Thus, disruption of genes by insertion elements in this region would not result in an evolutionary disadvantage for the plasmid. Functions within the IncP Tra regions appear to be highly clustered according to their role (Fig. 2): the core of Tra2 encodes exclusively gene products involved in mating aggregate formation and entry exclusion; Tral

201

BACTERIAL CONJUGATION

Pilus attachment, Pilus retraction

+

Plasmid cleavage at the nick site

ssDNA transfer d

recircularization

+

complementary strand synthesis

DNA supercoiling

d

FIG. 1. Mechanistic dissection of bacterial conjugation. See Section I,B for details

(15 loci, 3 operons) specifies the gene products required for DNA processing, i. e., relaxosome proteins, a DNA topoisomerase, and a DNA primase (26,28). Only one gene within Tral (truF) seems to be devoted to mating aggregate Another Tral gene (truG)encodes a product that probably formation (29,30). provides a link between the IncP Mpf and Dtr systems (29, 31).

Tra2 core

1

FiwA H

I

TL271

trbA

trbC trbB trbD

trbE

TR37 1

I

25.0

Tral core

I

Relaxase

operon

TRL396

I:

traC

traD tfaE

traF

I

30.0

I

40.0

45.0

I

I

'traK

0, sites

v

t

> <%

TRL53 I

traG traHtraltraXoriT traL traJ traK traM

v

t

I

operon

'haJ

'tiaG

traA traB

Leader

operon

A

t I

4

trbF trbH trbl trbJ trbL trbN trbP fiwAupf32.8 trbG trbK trbM trb0 upf31.7

tt 20.0

TRL335

Primase

t

KorB

I

50.0

[kbl

FIG. 2. Genetic maps of RP4 transfer regions. Regulatory circuits are indicated by vertical arrows. Transcripts are represented by horizontal arrows. Genes are drawn as boxes and arrowheads mark their 5' ends. P, Promoters; T, p-independent transcriptional terminators. The scale refers to the standard RP4 coordinates (25). Genes belonging to Dtr or Mpf are shown in dark or light gray, respectively. Regulatory genes are hatched. See Section II,A,B for details.

BACTERIAL CONJUGATION

203

Tra2 consist of a single operon containing 19 genes (trbA-P, upf31.7, $wA, upJ32.8)(Fig. 2). Transcription of this operon initiates at two possible promoter sites, PtrLAand PtrbB,resulting in polycistronic messengers with maximal sizes of 15.5 and 14.6 kb, respectively (32-34). Transcription may terminate at two terminator/attenuator sequences located in trbP (T,,, ,) and in the intergenic region between Tra2 and the Par/Mrs region (THL33s) (25). The organization of Tral is more complex: this Tra region contains the origin of transfer (oriT), the site where the relaxosome assembles and transfer DNA replication initiates (35).The transfer origin is an intergenic region containing a divergent back-to-back promoter arrangement (26, 36). The promoters within oriT, PtraK and P,,.,, drive transcription of two adjacent operons, the leader operon and the relaxase operon, each containing three genes, truK-M and truH-J, respectively (26).Transcription that initiates at P,,, might continue into the primase operon containing the genes truAtraG, thus resulting in a polycistronic messenger with a maximal size of 11.7 kb. In the 3'-terminal region of the traE gene, an additional promoter, Ptrac, was localized. This promoter might serve to enhance transcription of the primase operon and to provide a regulation mode of gene expression that is independent from that of P,, (see Section 11,3,2). Termination of transcription takes place at bidirectional terminators at the boundaries of Tral (25). Both terminator sequences are located in short intergenic regions downstream of the genes traA (T,,,, 6) and truM (TRU3 The Tral region contains two examples of overlapping genes: traC, the structural gene for the DNA priinase encodes two different gene products, TraCl and TraC2, that result from an in-phase overlapping gene arrangement (28,37).The smaller one, TraC2, is produced from an internal in-frame initiation codon within truC. The second example is the traH gene that overlaps on its whole length part of the 3'-terminal region of trul in an out-ofphase arrangement (Fig. 2) (26, 38).

B. Regulation of Transfer Gene Expression Although the conjugative transfer machinery of IncP plasmids appears to be expressed constitutively, some gene regulation mechanisms have to exist, facilitating balanced expression of the large number of transfer loci (33)and to coordinate conjugative transfer functions with vegetative replication and maintenance of the plasmid. IncP plasmids encode a whole collection of regulatory networks that can be classified in three major groups: (1) global networks, consisting of an effector protein and its binding sites, which are spread over the whole plasmid genome affecting different operons; (2) local networks, consisting of an effector that has only one or a few binding sites that are usually in the vicinity of the effector gene (in most cases these are

204

WERNER PANSEGRAU AND ERICH LANKA

autoregulatory circuits); and (3) gene regulation on the level of translation. Transfer genes can be subject to all these classes of control (25).

1. GLOBALREGULATION Three different global regulators are involved in IncP transfer gene regulation, KorA, KorB, and TrbA. Whereas TrbA seems to control only the expression of Tra functions, KorA and KorB are encoded by the IncP central control operon that coordinates transcription of various operons scattered over the genome and is involved in different functions, such as vegetative plasmid replication, plasmid transfer, and maintenance (39-43). KorA is a typical dimeric repressor protein with a clear helix-turn-helix motif in its amino-acid sequence. The protein recognizes the sequence TITAGCTAAA, which exists seven times in the IncPci genome (25). Interestingly, the C-terminal halves of KorA and TrbA show significant sequence similarity (33).Possibly, these genes evolved after a gene duplication event. Although the regulation of Tra functions by KorA is indirect, it seems to be of central importance for the expression of Tra2 genes. The promoters P,l-fAand PtrbAform a face-to-face arrangement in the intergenic region between the IncP ssb gene and trbA (PtrfA)and in the 5’-terminal region of the ssb structural gene (PtrbA).Binding of KorA to its recognition site at PtrfAstimulates P,, (43). Most probably, both promoters compete for RNA polymerase. When separated from each other PtrfA is 50-fold more active than PtrbB. In the native arrangement, the presence of PtqA results in a further reduction of PtrbAactivity by a factor of 20. Repression of PtqA by KorA could enhance the availability of RNA polymerase for Pt,,. However, this explanation might not be sufficient, because the effect is unique to KorA; other repressors that reduce transcription from PtqA (KorB, KorF, KorG, TrbA) have no effect on P,,, activity (43).It has been suggested that KorA acts on PtrfAand PtrbAas a switch: low KorA levels allow expression of tgA, promoting vegetative plasmid replication and reducing expression of Tra2 genes; high levels of KorA repress trfA expression and stimulate transcription of the Tra2 region, promoting the conjugative spread of the plasmid (43). The second global regulator that is thought to control tra gene expression is KorB (Fig. 2). KorB is an acidic protein that in solution exists as a dimer or tetramer (39-41). KorB binds to 12 sites on the IncPol genome, named 0,, which have the consensus sequence TITAGCSGCTAAA. Although some of these sites are clearly related to regulation of gene expression, others are not associated with promoter sequences and occur even within the reading frames of structural genes. The latter type of 0, sites might play a role in the plasmid’s structural organization, i.e., folding or pairing of the plasmid genome (39). However, with lacZ as a reporter gene, a moderate repression of

BACTERIAL CONJUGATION

205

gene expression (twofold) has been found when KorB binds to an 0, site within lac2 separated by 197 bp from a constitutive phage P1 bun promoter

(44). 0, occurs six times within the IncPa Tra regions. 0, sites are associated with the promoters PtgA and PtrbBand are located within the reading frames of trbJ, trb0, truF, and truX (Fig. 2). All 0, sites within the IncPa Tra regions are conserved at equivalent positions within the Tra regions of the IncPP plasmid R751, confirming their importance for the respective plasmids (26; C . M. Thomas, personal communication). Repression of the promoters P,gA and PtrbBby KorB has been demonstrated experimentally (34, 45). Interestingly, the 0, site that seems to be involved in PtrbBrepression is separated from PtrbBby almost 200 bp. It has been speculated that this longrange effect on PtrbB might result from loop formation with an additional degenerated 0, site within the Pt,.bs sequence (34). Another interesting situation exists in the relaxase operon of Tral: truX is involved in regulation of trul expression on the translational level (see Section II,B,3). The 0, site within the truX reading frame could provide an alternative pathway for finetuning of TraI expression on the transcriptional level (25). The trbA gene is the first gene of the Tra2 region (32,33,46).The protein functions as a repressor for the promoters PtrbB,Ptrac, P, and PtraK.Thus, TrbA might provide a means of coordinating the expression of genes in Tral and Tra2. Although the sequence of the TrbA target site has not yet been defined experimentally, a careful inspection of the nucleotide sequences of promoters known to be regulated by TrbA revealed a common feature: the consensus sequence CNGTATATC overlaps the promoters PtrbB(- 10 region), PtraG(- 10 and -35 region), p,, (-35 region), and PtraK(-35 region). Moreover, this sequence occurs only six times on RP4; the only case where it is not associated with a TrbA-regulated promoter is within the tnpA sequence of Tnl (our unpublished observation).

2. LOCALREGULATION Besides the global regulation mechanisms that seem to ensure balanced expression of tru genes, local regulation circuits exist on IncP plasmids. These local circuits provide a means for autoregulation of relaxosomal components, ensuring that enough relaxosome proteins are produced without overburdening the host. Two promoters in the Tral region are locally regulated: the oriT promoters P,,.=, and PtraK.The TraK protein, a relaxosome component (47, 48), confers the strongest effects on both oriT promoters: P,, and PtraKare repressed by a factor of 30 in the presence of TraK (42). The protein winds a 180-bp region of oriT around a core of 15-20 TraK subunits (see Sections IV,A and IV,C,2). Because this region includes both

206

WERNER PANSEGRAU AND ERICH LANKA

P , , and PtraK,repression is most probably due to exclusion of RNA polymerase from the oriT.TraK nucleoprotein complex. As a consequence, repression of the oriT promoters by TraK results not only in an autoregulatory circuit but also in down-regulation of the relaxase operon (40, 42). The second protein that has a local regulatory effect on tru gene expression is TraJ. TraJ forms another type of nucleoprotein complex with the transfer origin, binding to a 10-bp imperfect palindrome located within the right part of an 38-bp invert repeat sequence (49). Formation of this nucleoprotein complex is the initial step in relaxosome formation (see Section IV,A). The relaxosome assembles in the intergenic space between the truJ 5’ end and the 1position of PtrOJ. Thus, it is conceivable that the presence of the relaxosome or even TraJ alone at oriT results in premature termination of transcription from Pfraj. The result is an autoregulatory circuit that attenuates formation of the relaxosome components TraH, I, and J when a relaxosome is present at oriT. Repression of P , , by TraJ alone is not as strong as by TraK; a fivefold reduction of transcription activity was measured (42).

+

3.

REGULATION AT THE

LEVELOF TRANSLATION

Another means to achieve balanced expression of components of the conjugative transfer apparatus exists on the level of translation. Many genes in the Tra regions are coupled translationally (25). This way of regulation is used extensively by IncP plasmids probably because clustering of genes according to their function favors the development of this type of regulation. Five examples of translational coupling in the Tra regions have been demonstrated experimentally: the genes trbBltrbC, trbZltrbJ, truGltruF, truXltraZ, and traLltruM (25, 30, 50, 51). A special situation exists in the case of traXltral. traX codes for a peptide of only 13 amino-acid residues. Termination- and initiation-codons of truX and traZ overlap and the ribosome binding site (RBS) of truZ is located within traX. The mRNA in the traX region has the potential to form a stable secondary structure that masks the RBS of traZ as part of a stem in a hairpin structure (51).Thus, it is conceivable that only when traX is translated is the hairpin structure opened and the trul RBS becomes accessible for ribosomes. Additionally, the initiation codon of truX overlaps with the termination codon of TraJ. Therefore, it is possible that truJ and truX are also coupled translationally. The role of the truX leader gene might consist in functioning as a moderator for adjusting the relative amounts of TraJ and TraI. The presence of an operator site for the KorB protein in the traX reading frame might provide an additional tool for the transfer machinery to respond to different conditions. It is remarkable that TraI has a very low copy-number (less than 5 per cell) (52).

BACTERIAL CONJUGATION

207

111. Mating Aggregate Formation The initial step in bacterial conjugation consists in establishing cell-cell contact stable enough to allow passage of DNA molecules through the cellular membrane barriers (Fig. 1).This process has been named “mating aggregate formation” (Mpf). Transport of the DNA single strand through the membranes of the donor and recipient cell requires a hydrophilic channel or pore spanning the inner and outer membranes of the mating partners. Finally, the transport process must be energized, e. g., by hydrolysis of nucleoside triphosphates. Most of the components encoded by the IncP transfer regions are devoted to providing these functions.

A. Definition of a Core System for Coniugat ive Tra nsf er

To classify IncP tru genes as belonging to Mpf or Dtr, and to define a core system consisting only of essential components, a deletion analysis of the Tra regions has been done. Initially, Tral and Tra2 were separated by molecular cloning in two compatible vector plasmids (29, 32). Defined deletions were created using suitable restriction endonucleases, and the resulting phenotypes were analyzed. Following narrowing down of Tral and Tra2 to the core regions containing a minimal number of functions required for efficient mobilization of the oriT-containing Tral plasmid, Tral-core and Tra2-core were inserted as gene cassettes into a ColD replicon-based vector plasmid (31).In the resulting plasmid construct, the Tra2-core region is under control of the tac promoter. The vector part of the plasmid encodes the lac1 repressor gene, thus allowing control of Tra2 gene expression by addition of IPTG to the culture medium. The Tral genes are under control of their native promoters (32). The core system (either the reconstituted one-plasmid system or the twoplasmid system) was the basis for a linker insertion analysis of single tru or trb genes. Multiple reading frame insertion (Murfi) linkers containing three termination codons, one for each reading frame, were inserted using suitable restriction sites within the genes. Where these were lacking, restriction endonuclease sites were created by site-directed mutagenesis. Nonpolarity of the insertions was checked by complementation of the inactivated genes in trans (50). Several phenotypes are available to monitor the effects of the deletions and linker insertion mutations.

1. Conjugative DNA transfer. This process requires the complete set of tru genes and the IncP transfer origin.

208

WERNER PANSEGRAU AND ERICH LANKA

2. Mobilization of the IncQ plasmid RSF1010. The plasmid relies on the IncP Mpf machinery for its mobilization. It encodes its own relaxosoma1 components and therefore is independent of the IncP Dtr system. 3. Propagation of the donor-specific bacteriophages PRD1, Pf3, and PRR1. These bacteriophages use a structure as a receptor that forms at the surface of IncP donor cells. 4. Production of filamentous cell appendices (“pili”) that might be required to overcome the like surface potentials of donor and recipient cells in ionic environments to adhere the mating partners. The filaments therefore are considered as a part of the Mpf system (29,32,50). The Tra core system has been defined for intraspecific E . coli matings. It consists of 20 components: the Tra2 loci trbB-trbL, the Tral genes traFtruM, and oriT (Fig. 3). Two genes, traL and truM, are not strictly essential, however; the transfer frequency drops by 2-3 orders of magnitude when these genes are absent; therefore, they are considered as belonging to the Tra core (29). Another nonessential Tra core gene is trbK. The trbK gene encodes the entry exclusion function of IncP plasmids. Although it is not required for self-transfer of IncP plasmids, trbK is indispensable for assembly of IncP-type pili and thus classified as an Mpf gene (50). The genes truA-truE of the Tral region are not required for intraspecific E . coli matings (29). However, two of these are known to code for enzymes: truC specifies a DNA primase (see Section IV,E) and truE an analog of E . coli topoisomerase I11 (R. J. DiGate, personal communication). The aminoacid sequences of TraE and TopB (topoisomerase 111) are quite similar: 40% of the amino acids at equivalent positions are identical and 57% are functionally equivalent. Obviously, TraE is replaceable by a chromosomally encoded protein: the high degree of similarity between TraE and TopB suggests that it is indeed E . coli topoisomerase I11 that can substitute functionally for TraE. The role of a topoisomerase I11 analog in the conjugation process can only be speculated. Topoisomerase 111, in contrast to topoisomerase I, has the ability to decatenate replication intermediates and to substitute for DNA gyrase in nascent chain elongation during &type replication (53). It is well possible that these activities play an important role in converting the relaxosome to the conjugative rolling-circle-type replication intermediate or to sustain the elongation step of transfer DNA replication. Mobilization of RSFlOlO depends on the IncP Mpf system (54).Thus, RSFlOlO mobilization provides a tool for identifying and characterizing the IncP conjugative DNA transport machinery. Mobilization of RSF1010, as expected, requires less components as conjugative self-transfer: the Tra2 genes trbB-trbL and the Tral genes traF and truG (29). One Tra2 gene, trbF, is not essential; however, its inactivation results in a severe reduction

Tra2 core

I

trbB

trbD trbC

trbE

I

trbF trbG trbH trbl

trbL

trbJ

trbK

Relaxase

traH tral

traG

traF

/d

Pili synthesis (Dps)

Tral core

I

rn

Leader

traJ traK

traX

traL

I

traM

Mobilization of lncQ plasmids (Mob)

Self-transfer (Tra)

4

Classification

I

MDf

Similarity to Ti plasmid region

I

VirB I

, 20.0

1

1

22.0

I

24.0

,

+ - - - -I

c

w

I

I

26.0

28.0

46.0

I

Dtr I

VirD

,

, 48.0

I

I

50.0

1

H

VirC I

52.0

I

[kbl

FIG. 3. Classification of IncPa transfer functions. Genes are drawn as boxes and arrowheads mark their 5’ ends. Genes belonging to Dtr or Mpf are shown in dark or light gray, respectively. Nonessential genes are marked by hatching. Hatched bars mark sets of genes that are required for the functions listed on the left-hand side. Horizontal lines indicate the extension of regions that are applied for classification of genes. Mpf, Mating aggregate formation; Dtr, DNA processing functions. The scale refers to the standard RP4 coordinates (25).

210

WERNER PANSEGRAU AND ERICH LANKA

of the mobilization frequency (3 orders of magnitude) (50). It is known from biochemical experiments applying purified components that most of the Tral core gene products that are not required for RSFlOlO transfer are involved in RP4 relaxosome formation (traH-traK; see Section IV). The remaining nonessential functions truL and traM could play accessory roles in the RP4 relaxosome assembly process. Because traL and traM have no effect on RSFlOlO mobilization, analogous functions should be encoded by the IncQ mobilization genes. Thus, the contiguous Tral gene cluster traH-M is considered as belonging to the Dtr system of IiicP plasmids.

B. A Single Membrane Protein Complex Functions as Phage Receptor and Sustains Pilus Assembly and Conjugative DNA Transport

1. DONOR-SPECIFIC PHAGEPROPAGATION Propagation of the donor specific phage PRDl requires the genes traF and trbB-trbL (29, 50). Thus, the whole set of Mpf functions is required to display the phage receptor on the bacterial cell surface, indicating that each of the corresponding 12 gene products is involved either as structural components or as accessory factors that process and position structural components of a larger membrane structure. One gene displays a more differentiated phenotype: mutants in trbK still allow attachment of PRD1; however, the phage cannot propagate, suggesting that injection of the phage DNA into the cell is blocked at some stage. 2. PILUSASSEMBLY The same set of genes required for phage reproduction, traF and trbBtrhL, is also required for pilus assembly (50). This indicates that the same structure that functions as receptor for phage PRDl is also responsible for processing, transport, and assembly of the pilin subunits into extracellular filaments (Fig. 4). Notably, the filamentous structures observed under Mpf overexpression conditions are morphologically identical to those described by Bradley (55). 3. CONJUGATIVE D N A TRANSPORT

Finally, also the DNA must use the same transmembrane structure for its passage through the membranes of the donor: all the genes required for phage propagation or pilus assembly are also required for DNA transfer (plasmid mobilization and self-transfer). The only exception is TrbK, the entry exclusion factor, which is dispensable for DNA transfer but is required for production of extended pilus structures. This finding, on the other hand, leads to the conclusion that, in the IncP system, an extended pilus is in fact

BACTERIAL CONJUGATION

21 1

FIG. 4. Electron microscopy of IncP pili. Cells containing the reconstituted IncP transfer system were mounted as described (50). Bar = 500 nm.

not required for DNA transfer. Of course, this leaves the possibility open that, in the trbK mutant, remnants of the extracellular filaments still exist, but these might escape detection by electron microscopy (SO). Furthermore, the pilus-like structures might be required only under natural conditions, for instance in a liquid environment. Under laboratory mating conditions, donor and recipient cells are densely packed on a semisolid agar surface or on a membrane filter. Although, such conditions conceivably could occur also in nature (e.g., in biofilms), the pilus-like filaments could be required to adhere the cells under less favorable conditions.

C. TraG-like Proteins

Remarkably, TraG is the only component required for RSFlOlO mobilization, but neither for pilus assembly nor for phage P R D l propagation (29, 30, 50).Therefore, TraG is likely to be involved in the DNA transport process or in linking the relaxosome to the transmembrane structure encoded by Mpf. Because the TraG primary structure contains nucleotide binding motifs of type A and B (56), the protein is also a reasonably good candidate for provid-

212

WERNER PANSEGRAU AND ERICH LANKA

ing motive force for transport of the DNA single strand across the bacterial membranes (26,57). TraG could act as a specialized DNA helicase separating the T- and the R-strand during rolling-circle-type transfer DNA replication. The importance of amino-acid residues in the nucleotide binding motifs for the DNA transfer process has been demonstrated by site-directed mutagenesis: mutants in each of the motifs A or B were shown to be inactive in plasmid self-transfer and RSFlOlO mobilization (31). Analogs to TraG exist in all conjugative DNA transfer systems studied so far, even in conjugative plasmids of Gram-positive bacteria (i.e., TrsK of pGO1) (31).An interesting example is the colicinogenic plasmid CloDF13. Although, the plasmid is not self-transmissible, it is mobilized efficiently by IncF and IncW plasmids (58; F. de la Cruz, personal communication). The mobilization by F (IncF1) or R388 (IncW) is independent of the RP4 TraGlike proteins TraD (IncF) and TrwB (IncW), encoded by the respective plasmids. Indeed, CloDF13 specifies its own RP4 TraG analog: sequence alignment identified the CloDF13 MobB protein to be TraG-like (31). Also TraD (IncF) has been proposed to be involved in the DNA transport step of conjugation (59).Analogous to RP4 TraG, TraD is essential for self-transfer of F, whereas the requirement of the helicase domain of the F plasmid-encoded Tral protein for self-transfer of F remains to be demonstrated (58). The IncW t m B gene cannot be complemented by its IncPa analog truG in the R388 self-transfer process (60). However, the IncQ plasmid RSFlOlO is efficiently mobilized by a transfer machinery consisting of the IncW Mpf system and IncPa TraG, indicating that IncQ but not IncW relaxosomes do specifically interact with IncPa TraG. On the other hand, the Mpf machinery of IncW plasmids obviously interacts both with IncPol TraG and, of course, with IncW TrwB (60).Thus, two types of specificity exist in TraG-like proteins: a more stringent interaction with the relaxosome and a less stringent one with the Mpf system. The Ti-plasmid-encoded TraG-like protein, VirD4, was localized at the cytoplasmatic surface of the inner membrane (61),corroborating the hypothesis that TraG-like proteins provide a connection between the relaxosome and the DNA transport structure in the bacterial membrane. VirD4 is also required for the VirB-mediated interbacterial mobilization of the IncQ plasmid RSFlOlO (62), demonstrating that the T-DNA transfer machinery can also be used to transmit DNA among bacteria.

D. The lncP Entry Exclusion Function Is Specified by trbK Cells that harbor an IncP plasmid are poor recipients in matings with other IncP-type donor cells (21, 63).This phenomenon is designated as entry

BACTERIAL CONJUGATION

213

exclusion (Eex). Typically, the transfer frequency with an IncP plasmidcarrying recipient is lower by a factor of 50-100 compared to a plasmid-free cell. The entry exclusion function of IncPa plasmids is determined by the trbK gene. In contrast to statements in earlier reports (64,65), trbK is the only function that is necessary and sufficient to express the IncPa entry exclusion phenotype. The apparent involvement of the preceding gene, trbJ, in entry exclusion is probably due to translational coupling between the two genes. Expression of trbJ and trbK from separate plasmids in trans revealed that trbK alone is sufficient to produce the Eex phenotype, and that trbJ gives no entry exclusion phenotype by itself nor does it stimulate the function of the trbK gene product. Thus, the Eex function of IncP plasmids, is specified by a single gene (50). The entry exclusion systems of IncN and IncW plasmids apparently belong to the same class: a single gene is sufficient to produce the Eex phenotype. Moreover, significant sequence similarity has been demonstrated between TrbK (IncPct) and Eex (IncN) (66). However, these systems are different from those of IncFl and Incl plasmids, which encode two-component systems. The F-encoded gene products operate through quite unique mechanisms and therefore their contributions are synergistic. Cells carrying the F plasmid typically have a 100- to 300-fold reduction for their ability to act as recipients in F+ x F+ inatings relative to an F- cell. Two plasmidborne genes, truS and traT, are responsible for the Eex phenotype. The product of traS (16.9 kDa) is an inner membrane protein that is thought to act by inhibiting the triggering of conjugative DNA replication. The truT gene product (23.8 kDa), a lipoprotein, located at an exposed site in the outer membrane, blocks conjugation at an earlier stage, before the cells have formed stable mating aggregates. Two models of TraT action are presently discussed: TraT could block a specific site on the major outer membrane protein OmpA that otherwise would be recognized by the pilus tip of a potential donor to initiate the mating process. Alternatively, TraT could interact with the pilus tip, thereby preventing the normal mating contact

(67).

Interestingly, the trbK gene product predicted from the nucleotide sequence of the gene, like TraT of F (68),has a lipoprotein signature at its N terminus, suggesting that TrbK, like TraT of F, is exposed at the cell surface (46). Studies with site-directed mutations in trbK show that trbK mutants, although able to adsorb PRD1, cannot propagate the phage. This result leads to the somehow paradoxical situation that trbK (1) independent of other transfer genes, specifies the entry exclusion function; (2) must interact with the IncP-pilus assembly machinery of Mpf because it is required for production of the filamentous appendices; (3)is not required for RP4 self-transfer despite the fact that cells devoid of TrbK do not produce visible pili (an

214

WERNER PANSEGRAU AND ERICH LANKA

extended pilus apparently is not required for conjugative DNA transfer to take place); (4)is required for uptake of phage PRDl DNA but not for adsorption of the phage. All Eex systems discussed here have in common that they are not required for plasmid self-transfer. TraS- and TraT- mutants of IncFl plasmids are transfer proficient (21) and so are Eex- and TrbK- mutants of IncN (66) and IncP plasmids (50),respectively. Therefore, Eex determinants in a strict sense are not transfer genes. The fact that Eex systems function independently from the DNA transfer machinery conforms with this classification. Therefore, Eex hnctions should be regarded as accessory functions that prevent unproductive mating. In some cases, however (e.g., IncP), coevolution of the Eex and Tra systems apparently results in a close association of Tra and Eex gene products. This could explain the effects of the trbK mutations on pilus formation and phage propagation.

E. Biochemical Analysis of Mpf Functions Biochemical analysis of Mpf gene products requires their purification. Usually, protein purification procedures are facilitated by overexpression of the corresponding genes using suitable expression vectors. In fact, overproduction of Tra2 gene products has been achieved in most cases (50).The main problems in working with Mpf components, however, are caused by the fact that all except one (TrbB) are typical membrane proteins, being highly insoluble under native conditions. Therefore, two main approaches are currently applied to overcome these difficulties. 1. Creation of fusion proteins. It has been shown in several cases that

N-terminal fusions of originally insoluble proteins with thioredoxin (Trx) are more soluble. Moreover, Trx-derivatives containing histidine tags allow rather easy purification procedures applying NiZ+-chelate &nity columns. Even if the fusion proteins obtained by this approach are biologically inactive (this can be tested by complementation experiments), at least they can be applied for raising antisera against Mpf components. 2. Purification of the protein under denaturing conditions, followed by renaturation and/or incorporation into reconstituted membrane vesicles. Without applying renaturation procedures, proteins obtained in this way have been applied for raising antisera (50). At least two Mpf gene products, TrbB and TrbE, are candidates for having enzymatic activities (70, 71). Both polypeptides contain consensus sequences for nucleotide-binding motifs (Table I) (72-75) and therefore are supposed to be involved either in active positioning of other Mpf compo-

BACTERIAL CONJUGATION

215

nents to assemble the DNA transport complex or in energizing the DNA transport process itself by NTP hydrolysis. Consistent with their membraneprotein character, several Mpf components have N-terminal protein export signals, i.e., cleavage sites for signal peptidase I (TraF, TrbC, TrbC, TrbJ, and TrbL). Moreover, two gene products (TrbH and TrbK) have lipoprotein signatures, i.e., cleavage sites for signal peptidase 11. TrbD and TrbJ contain bacterial leucine-zipper motifs (46, 50). TrbB is the only Mpf component that can be overproduced and purified under native conditions. In solution, the protein exists as a hexamer; this has been verified by electron microscopy ( G . Ziegelin, R. Lurz and E. Lanka, unpublished results). In uitro, the protein exhibits weak ATPase, protein kinase, and autophosphorylating activities. None of these activities is stimulated by the presence of DNA (double- or single-stranded) (E. Scherzinger and E. Lanka, unpublished results). Virtually identical enzymatic activities have been described for VirBll (71).TrbB shows sequence similarity to gene products from several specialized protein export systems, including noncon. jugative pilus assembly systems, the competence system of Bacillus subtilis for uptake of DNA from the environment, protein secretion systems, and toxin export systems (see Section V). These data suggest that TrbB most likely belongs to a class of NTP-binding proteins required for the assembly of trans-periplasmatic pilus-like structures. These structures are supposed to exist in all the systems mentioned above. Localization studies with the TrbB analog of the Ti system (VirB11) suggest an association of the protein with the cytoplasmatic membrane of A . turnefaciens (76, 77). Fractionation studies with E . coli cells harboring the complete IncP Mpf system support these observations, demonstrating an association of TrbB with the inner membrane (A. M. Grahn and D. H. Bamford, personal communication).

IV. DNA Processing Reactions A. Relaxosome Assembly at the lncP Transfer 0rigin The origin of transfer (oriT)is the site where transfer DNA replication is initiated by a site- and strand-specific cleavage event (1 9). Obviously, factors required to exert this reaction must not interfere with such plasmid maintenance functions as vegetative replication, partitioning, or the topological state of the DNA. Therefore, sophisticated regulation mechanisms are needed to ensure (I) site-specificity of cleavage and ( 2 )precise timing of the initiation reaction to coordinate it with mating aggregate formation. These requirements are fulfilled by the relaxosome, a specialized high-precision

TABLE I PHYSICAL PROPERTIES OF

INCPa-ENCODED TRANSFER-RELATED

Designation

Number of residues

Molecular mass (Da)

FiwA

23I

25,590.03

28

KorB

358

39,010.79

53

TraA

96

10,611.88

8.6

1

8.43

146

16.5 118

- 29

7

10.55 5.72

80

-19 - 18 7

5.59 3.53 8.22

TraB TraC 1

1061

15,844.07 116,721.49

TraC2 TraD TraE

746 87 737

81,647.41 9218.66 82,022.40

M, (X

Net lo3) charge

20

-

TraF TraG

177 635

18,901.66 69,857.45

72

TraH Trd

119 732

12,869.13 81,562.43

TraJ

123

TraK

134

14 -21

IsoeIectric point

Multimeric structure in solution

11.44

-

4.59

6 8

10.14 9.45

22 82

-11 32

4.21 10.78

13,463.50

11

1

8.40

14,716.66

17

8

10.65

Dirnerltetrarner -

Features of amino-acid sequence

Helix-turn-helix motif Lipoprotein signature

-

-

Monomer

Monomer

GENE PRODUCTS

-

-

Similar to E . coli topoisomerase I11

-

Monomer Dimer Tetrarner

RCR-initiator signature Bacterial zipper (?)

-

Ref.

Proposed function Inhibition of IncW plasmid fertility Regulation of gene expression

-

DNA prirnase, singlestranded DNAbinding protein DNA primase

-

DNA topoisomerase

Mating pair formation DNA transport during conjugation Relaxosome stabilization DNA relaxase

72 39-41. 45 28 28 28, 73 28, 73

R. J. DiCate, pers. comrn. 30 26, 31

26, 36, 74 26, 74

oriT-recognizing protein

49

oriT-binding protein

26

TraL

24 1

26,566.32

26

-6

5.40

TraM TraX

145 13

15,562.88 1241.47

14

-3 1

5.78 8.43

TrbA

103

11,307.92

12

TrbB

319

35,027.15

36

TrbC

145

15,011.57

14.8

TrbD Trb E

103 852

12,085.11 94,361.45

90

-9

TrbF TrbG

252 297

27,404.16 32,582.76

31 34

-1

10.23 6.94

TrbH

160

16,941.21

20.2

4

10.00

TrbI TrbJ TrbK

463 258 69

48,852.66 28,077.46 7333.45

61.5 26

2

5

-

3

9.43 9.77 8.79

TrbL TrbM TrbN TrbO Trb P

528 199 234 87 244

52,182.68 22,155.54 25,228.41 9440.20 26.848.88

58 21.8

-4 3 8 6 9

4.91 8.21 10.32 11.22 10.70

-

-

1

-4

9.14

Dimer

6.69

Hexamer

2

10.83

12

11.77 6.53

5

26, 36

ATPIGTP binding site motif A (P-loop)

Helix-turn-helix motif ATPIGTP binding site motif A (P-loop) Export signal sequence Bacterial zipper ATPlCTF' binding site motif A (P-looP)

-

Export signal sequence

26 25, 51 Translational regulation of Tra gene expression 33 Regulation of Tra gene expression ATPase, autophosphory- 34, 46, 75 lase

Pilin (P)

34, 46

Mating pair formation

34, 46 46

Mating pair formation Mating pair formation

46 46

Export signal sequence, lipoprotein signature

-

Export signal sequence Export signal sequence, lipoprotein signature Export signal sequence Export signal sequence

-

Mating pair formation Mating pair formation Entry exclusion

46 46, 64 46, 64

-

Mating pair formation

46 46 46 46 46

-

-

Surface protein anchoring hexapeptide

46

218

WERNER PANSEGRAU AND ERICH LANKA

nucleoprotein complex that forms at oriT and that exists stably throughout the cell cycle. IncP relaxosornes consist of at least four plasmid-encoded gene products-TraH, TraI, TraJ, and TraK-and the supercoiled oriT DNA (Fig. 5 ) (52, 78). The IncP origin of transfer is located within an intergenic region of the Tral region (Fig. 6). Main features of the IncP ariTs are (1) a pair of divergent promoters in a back-to-back arrangement directing transcription of the relaxase and leader operons (see Section 1,A); (2) a set of inverted sequence repetitions functioning as recognition sites for relaxosome components or forming defined hairpin structures in the single-stranded transfer intermediate; the hairpin structures possibly represent signals for specific termination of transfer DNA replication that occurs after a plasmid unit length has been transmitted to a recipient cell (79); (3) an intrinsically bent D N A region specifically recognized by the TraK protein (srk)(47). The cleavage site (nic) is located eight nucleotides downstream from the right end of an imperfect 19-bp invert repeat sequence (52, 80). Only the right part of this inverted repeat is required for relaxosome assembly: it contains the recognition site for the TraJ protein (srj), one of the specificity determinants that forms the initial complex with the transfer origin. Nucleotides between nic and the inverted repeat form the recognition site for the TraI protein (sri),the IncP-encoded DNA relaxase that catalyzes the specific cleaving-joining reaction at nic (30, 81).

B. DNA Relaxases 1.

INITIATION AND %€WINATION IN

REACTIONS

CONJUGATIVE DNA TRANSFER

Initiation of replication by a rolling-circle-type mechanism requires cleavage of one plasmid strand within the origin of replication. In conjugative DNA processing, this reaction is catalyzed by a DNA relaxase (26). The IncP-encoded relaxase (TraI) virtually has the ability to catalyze two different DNA cleaving-joining reactions: (1)cleaving-joining of a DNA single strand in a double-stranded, superhelical substrate containing at least srj and sri and (2)cleaving-joining of single-stranded DNA containing at least sri (Table 11).Whereas the former reaction requires the presence of the oriT-binding protein TraJ as accessory factor, the latter requires no additional proteins (49, 52, 81). The only cofactor required for all types of relaxase-mediated cleaving-joining reactions is Mg2+ ions (Table 11). Initiation of DNA processing in other conjugative systems follows a similar scheme: The systems that are closely related to the IncP system (R64, pTF-FCZ, the T-DNA transfer systems of agrobacterial pTi and pRi plasmids) all use a two-component system for dsDNA cleavage-joining (20, 82).

219

BACTERIAL CONJUGATION

FIG.5 . Model of the IncP relaxosome. See Section V,A for explanation

D traJ

Relaxase operon

nic

C-C

v

100 bp

D

traK

Directionof DNA transfer

Leader operon

+

\ -

srj sri

TraJ binding

-.. +.-.AAGGGACAGTGAAGAAGGAACACCCGCTCG GG -.-.A

-..p -a.

TTCCCTGTCACTTCATCCTTGTGGGCGAGC

cc

recognition Tral

n : i c

+

I p q ~

1 1 C-CCGGCTGA GATAGGACGGGCCGACT

specific termination relaxosorne formatiortiinitiation

FIG. 6. Modular structure of the IncP transfer origin. Transcription of relaxase and leader operons initiating at divergent promoter sites within oriT is indicated by horizontal arrows. An inverted repeat sequence adjacent to the nick site (nic) is marked by bold horizontal arrows. Binding sites for transfer gene products (sri, srj, srk) are drawn as shaded bars. The 5’-terminal regions of the transfer genes tru] and truK are represented by open bars. Arrowheads show the 5’ ends. Part of the nucleotide sequence of oriT is depicted below: inverted repeat sequences are indicated by horizontal arrows, dots mark deviations from the symmetry. Shaded regions within sd indicate nucleotides that, in the presence of TraJ, are protected against attack by hydroxyl radicals (49). Nucleotides recognized by TraI are drawn in white with a dark background. The position of the cleavage site is marked by a wedge.

220

WERNER PANSEGRAU AND ERICH LANKA

TABLE I1 PHOPERTIES OF RELAXASE-MEDIATEDDNA CLEAVING-JOINING REACTIONS Relaxase substrate Substrate DNA

dsDNA: negative superhelical sri, srj (srk).

ssDNA: singlestranded sri

5 mM 50 mM 8.5

5 mM 50 m M 8.5

+ +

+

Optimum conditions

Mg2+ NaCl PH Cofactor requirements TraI Tra] TraK Fraction of cleaved DNA in equilibrium Release of cleaved reactiou products

(+)a

0.9 (0.3 when TraK omitted) Addition of protein denaturant (SDS, proteinase K) required

0.3 Spontaneous

TraK is not essential in titro, srk is not essential in cioo or in citro. TraK and srk together increase the yield of cleaved &DNA in citru. (1

For the Ti system, cleaving-joining of double-stranded T-border sequences by the combination VirDUVirD2 has recently been demonstrated in vitro (83).Moreover, cleaving-joining of single-stranded DNA by VirD2 alone has also been shown (84). The relaxase of F (TraI) cleaves and joins double- and single-stranded DNA in uitro (85-87). In cleavage of dsDNA, the oriT binding-protein Tray and the host-encoded histone-like protein I H F are involved as cofactors (88).Another well-studied example is the MobA protein of the mobilizable plasmid RSFlOlO (89, 90). However, in this case MobA alone is sufficient to exert both dsDNA and ssDNA cleavage, indicating that MobA contains the DNA double-strand and single-strand recognition domains both in a single polypeptide chain. What is the biological relevance of these two reactions? Obviously, dsDNA cleavage is required in the initiation reaction. In contrast, further processing of the single-stranded transfer intermediate to terminate conjugative DNA replication involves cleaving and joining of a DNA single strand. Termination of rolling-circle-like transfer DNA replication is thought to include a so-called second cleavage reaction that occurred after a unit length of the DNA molecule to be transferred had entered the recipient cell. In this model, the joining reaction would then be used to recircularize the exported DNA single strand (19). A more detailed model on the termination reaction begins to emerge

BACTERIAL CONJUGATION

221

from experiments using relaxase-oligonucleotide adducts immobilized via the oligonucleotide moiety to magnetic beads. Under the experimental conditions applied, only TraI monomers covalently attached to the 5’ terminus of the oligonucleotides were retained by the beads. These TraI monomers could not catalyze a second cleavage reaction with a second oligonucleotide containing sri and several nucleotides downstream of nic. In contrast to that result, another oligonucleotide containing sri but ending at the 3’-terminal nucleotide of nic was efficiently joined to the oligonucleotide moiety in the covalent relaxase adduct, demonstrating the biochemical activity of the immobilized TraI protein (our unpublished results). The inability of a TraI monomer to catalyze second cleavage can be interpreted in two ways.

1. Second cleavage is not necessary because there is no elongation at the nic 3’ hydroxyl terminus and hence only a unit length of the plasmid is transmitted. Leading strand synthesis in the donor could initiate by a special priming event and the 3‘ hydroxyl at nic is protected in some way. In fact, this model has already been proposed for initiation of donor complementary strand synthesis during conjugative transfer of the F plasmid (91). In this model, termination would occur by a simple joining reaction catalyzed by the relaxase that transfers the covalently attached 5‘ end of the T-strand to the 3’ terminus. (Fig. 7, I). 2. Elongation at the 3’ end takes place. Therefore, after a unit length of the plasmid has been transferred to the recipient, second cleavage must occur. Obviously, the relaxase subunit covalently linked to the T-strands 5’ terminus cannot catalyze this reaction, because its unique active-site tyrosine is already occupied by the attached DNA. For the bacteriophage +X174 gene A protein, a tandem arrangement of two active site tyrosine residues alternates in cleaving and joining the (+)-strand during rollingcircle-type replication of the phage genome (Fig. 7, 11) (92, 93). Such a mechanism seems unlikely for IncP-type relaxases: linkage between TraI and DNA was only detectable at tyrosine-22 and a tandem arrangement of tyrosine residues resembling that in +X174 gpA is not present in the TraI sequence. Finally, attempts to demonstrate second cleavage by a TraI monomer in vitro failed. Plasmids of Gram-positive bacteria that undergo rolling-circle-type replication terminate after a single round of replication by a second cleavage mechanism that involves a dimer of the initiator protein (94). Whereas the first subunit of the dimer catalyzes initiation by site-specific cleavage of the origin, the second subunit cleaves the origin after the first round of replication, following restoration of the cleavage site. The 3’ hydroxyl that is created by the second cleavage event makes a nucleophilic attack on the phos-

222

WERNER PANSEGRAU AND ERICH LANKA

I

Ill

Tra I

FIG. 7. Alternative models for termination of transfer DNA replication. Protein subunits are represented by ellipsoids. Single-stranded DNA is drawn as a black line. The active site tyrosines are symbolized by “Y.” The encircled P depicts the phosphodiester moiety at the nick site. Bent arrows indicate nucleophilic attacks. Panel I: Closing of the T-strand without second cleavage; Panel 11: second cleavage and recircularization reaction catalyzed by a tandem arrangement of active-site tyrosines; Panel 111: second cleavage and recircularization reaction catalyzed by a TraI dimer.

phodiester between the DNA 5’ terminus and the first subunit of the initiator protein, resulting in recircularization of the DNA. Rapid dissociation of the initiator complex from the DNA leads to formation of an inactive initiator heterodimer in which one of the protein subunits remains linked to

BACTERIAL CONJUGATION

223

a short oligonucleotide. This mechanism prevents uncontrolled reinitiation of plasmid replication and the plasmid copy-number is directly linked to the copy-number of the initiator protein. The latter type of mechanism seems to be the most likely one to occur during conjugative transfer DNA replication (Fig. 7, 111). It is even conceivable that formation of an inactive relaxase heterodimer could trigger active dissociation of the mating partners. There is evidence that second cleavage occurs also with plasmid substrates that contain tandem arrangements of oriT (79, 95). In these constructs, initiation and termination take place at different transfer origins on the same plasmid. Thus, mating results in transfer of only the intervening sequence and the rest of the plasmid is deleted (20). An intact invert repeat sequence in the oriT of RSF1010-like plasmids seems to be a requirement for specific termination to occur (79). Site-specific cleavage-joining of DNA single strands by the IncP relaxase requires a core sequence of only six to seven nucleotides (Fig. 6) (81). This sequence occurs several times on IncP plasmids. Moreover, certain nucleotides within the core sequence can be exchanged without losing cleavage-joining activity with TraI. Therefore, the invert repeat sequence near nic could provide a clue for specific termination also in IncP plasmids. The hairpin structures that could form in the singlestranded transfer intermediate could contribute to the specificity of the reaction, providing, in addition to sri, a second signal for termination. 2. DOMAINSTRUCTURE OF DNA RELAXASES Relaxases of IncP-type plasmids are multidomain proteins (Fig. 8) (96). The N-terminal fifth of the TraI amino-acid sequence (732 amino acids, 81.6 kDa) contains the DNA cleaving-joining activity. The remaining part of the protein is thought to be involved in making protein-protein contacts to the accessory proteins TraH and TraJ and in receiving the postulated mating signal proposed to trigger initiation of conjugative DNA processing. In contrast to the N-terminal fifth of TraI, the amino-acid sequence of this region is not conserved among relaxases from other DNA export systems. This may reflect the different specificities in the interactions with other relaxosome components. Also these show no or only barely detectable similarity, if functional analogous proteins from different systems are compared (96, 97). In the N-terminal part of the TraI, three conserved motifs (1-111) were identified by sequence comparison (Fig. 8). These motifs are conserved in relaxases from different conjugative or mobilizable plasmids of Gram-negative bacteria (R751, R64, pTF-FCS), in the VirD2 relaxases of agrobacterial pTi and pRi plasmids, and in mobilizable plasmids from Gram-positive bacteria (96). Remnants of motifs I and 111 were also detectable in F-like (F, R100, R388, R46) and in RSF1010-like relaxases, and in other rolling-circletype replication initiator proteins (97, 98).

224 i

WERNER PANSEGRAU AND ERICH LANKA

relaxase activity

I I

I

1

TraH interaction

L -

17

24

68

732

- - _ - _ _. _. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 76

103

124

I

FIG.8. Domain structure of the RP4 TraI relaxase. The upper bar represents the entire polypeptide. Domains with known activities are marked by shading. The lower bar depicts the relaxase domain of TraI. Three motifs (I, 11, and 111) that are conserved among relaxases from other systems are drawn as black bars (96). The respective amino-acid sequences are shown below. The active-site tyrosine within motif I is marked by an asterisk. Invariant positions and positions where conservative replacements occur are drawn with a black or gray background, respectively.

A site-directed mutagenesis study with the RP4 TraI protein allowed assignment of specific functions to protein domains corresponding to the three motifs. Side-chains of conserved amino-acid residues were exchanged in such a way that their functionality was altered but the protein's secondary structure should remain unaffected (96). Exchange of the conserved tyrosine residue in motif I (position 22) against leucine resulted in the complete loss of cleavage-joining activity. This residue had been identified previously as the site of covalent attachment of TraI to the 5' terminus of the cleaved D N A (81). By N-terminal sequencing of TraI peptides that remained covalently attached to specifically cleaved oligonucleotides, the hydroxyl group of TraI Tyr-22 was shown to be linked via a phosphodiester moiety to the 5' hydroxyl of the terminal cytidyl residue at the oriT nic site. Therefore, it was concluded that motif I represents a fundamental part of the relaxase active site containing the tyrosine residue that, during cleavage, exerts a nucleophilic attack on the D N A backbone. A mutation in motif I1 (Ser-74 + Ala) resulted in instability of the relaxosomes and in the production of a variety of partially relaxed topoisomers (96). This finding suggested that motif I1 is involved in stable binding of the substrate and possibly also in recognition of sri. However, it also indicated that in the relaxosome, even without a trigger signal, continuous cleaving and joining of the D N A takes place, resulting in an equilibrium of open and closed plasmid species (96) (Fig. 9). With the wild-type TraI, the superhelical state of the cleaved D N A species is maintained, because the protein binds sri at the nic 3' terminus very tightly. With the mutant protein TraI

BACTERIAL CONJUGATION

225

FIG. 9. An equilibrium reaction between open and closed DNA in relaxosomes. Right: Superhelical DNA is represented by a ribbon, the relaxase and accessory proteins by an ellipsoid. Left: DNA single strands are drawn as ribbons. Particular amino-acid residues that participate in the equilibrium reaction are indicated. The phosphodiester group at the nick site is represented as an enrircled “P.” See Section V,B,2 for explanations.

S74A, this interaction is disturbed, resulting in occasional release of sri and hence in spontaneous relaxation of the plasmid DNA. When superhelical stress has decreased sufficiently for TraI S74A to bind again to sri, the mutant enzyme seals the cleaved DNA strand. This model recently has been confirmed by the finding that the mutant TraI S74A immobilized to magnetic beads binds oligonucleotides containing sri much less efficiently than does the wild-type protein (our unpublished results). Additional evidence for the existence of a cleaving-joining equilibrium in relaxosomes comes from studies with the RSFlOlO relaxase (MobA). Incubation of RSFlOlO relaxosomes under high-salt conditions allows quantitative recovery of form-I plasmid DNA from the reaction. Protein denaturants, such as sodium dodecyl sulfate or proteinase K, freeze the equilibrium, resulting in capturing form-I1 plasmid intermediates. In contrast, treatment with salt dissociates from the DNA only the proteins that are noncovalently associated. Plasmid D N A in the open state is covalently associated with the relaxase, which under high-salt conditions might still be able to seal the single-strand incision. Therefore, only when the plasmid enters the covalently closed state (form I) can the relaxase dissociate; consequently the equilibrium is driven completely to a covalently closed plasmid form (89). Motif I11 of TraI contains two histidine residues separated by one residue and followed by a stretch of hydrophobic amino acids. This subdomain is the only feature conserved in all rolling-circle-type replication initiator proteins,

226

WERNER PANSEGRAU AND ERICH LANKA

including the relaxases from F- and RSF1010-like plasmids (97, 98). Accordingly, it was expected that exchange of each of these histidine residues in RP4 TraI against serine would result in a severe loss of relaxase activity irrespective if double- or single-stranded DNA is used as a substrate (96). Because relaxosome assembly is not affected by these mutations, it was concluded that His-116 and His-118 are involved in catalyzing the cleavingjoining reaction. Histidine residues can be involved in activating aromatic and aliphatic hydroxyl groups to become strong nucleophiles (99). Two hydroxyl groups are involved in the cleaving-joining reaction at nic: (1) the aromatic hydroxyl group of Tyr-22 attacking the phosphodiester backbone of the DNA by a trans-esterification reaction that opens the DNA and links the protein to the 5‘ terminus, and (2) the 3’ hydroxyl that, in the reverse reaction, attacks the phosphodiester between TraI Tyr-22 and the DNA to join the ends of the DNA. It seems reasonable to speculate that each of the histidine residues is involved in the activation of one of these two hydroxyl groups, resulting in a reversible charge relay mechanism (Fig. 10).

C. Accessory Proteins 1. TRAJ

The IncP TraJ protein is the only relaxosome component that, in addition to the relaxase, TraI, is essential for the specific cleaving-joining reaction to take place on superhelical substrate DNA (74). TraJ is a specific DNA-binding protein that recognizes a 10-bp sequence (srj) within the transfer origin (Fig. 6) (49). The protein binds without cofactors such as nucleotides or divalent cations to double-stranded relaxed or negative superhelical DNA. In solution, TraJ exists as a dimer, and estimates on the stoichiometry of the

FIG. 10. Proposed reaction mechanism of the cleaving-joining reaction catalyzed by DNA relaxases. As an example, amino-acid residues are numbered according to the RP4 TrdI sequence (26).“B” represents a so-far unidentified basic function. See Section IV,B,2 for explanations.

BACTERIAL CONJUGATION

227

interaction with DNA imply that a dimer also attaches to srj. In accordance with that, srj has imperfect twofold rotational symmetry (Fig. 6). Binding of TraJ to srj is the first step in an assembly cascade leading to relaxosome formation (49, 74). The ability of TraI to cleave single-stranded oligonucleotides specifically, and the requirement for negative superhelical DNA when TraI acts on a double-stranded substrate, strongly suggest that the TraI recognition site sri must be exposed as a single strand to be recognized and cleaved by the relaxase. Binding of TraJ to srj is thought to distort the DNA structure locally allowing access of TraI to sri. Moreover, the close spacing of sri and srj and the fact that both sites face the DNA from the same side suggest that TraJ also makes direct protein-protein contacts with TraI (Fig. 5).

2. TRAK TraK is a specific oriT-binding protein that, although not essential for DNA cleavage or relaxosome assembly in uitro, is an essential transfer factor for conjugation to take place in uivo (36, 74, 100). In uitro, the protein binds to an intrinsically bent region of the IncP transfer origin, wrapping a region of about 180 bp around a core of TraK (Fig. 5). Moreover, binding of TraK to its recognition site (srk) dramatically enhances observable bending in this region, indicating that a highly ordered nucleoprotein structure is formed. Estimates on the stoichiometry of this reaction suggest that 15 to 20 TraK monomers are involved in forming this complex. In solution, the protein exists as a tetramer (47). TraK is encoded by one of the two specificity determinants (truJ and traK) that cannot be complemented by the corresponding genes of the IncPP plasmid R751, indicating that the TraK-oriT interaction is highly specific (36, 101). Nevertheless, it was not possible to define the exact limits of the DNA sequence that forms srk. The reason for this might consist in a requirement not only for a specific DNA sequence forming a nucleation site where complex formation initiates, but also for the ability of the adjacent DNA to follow a path given by the core of TraK around which the DNA is to be wrapped. The sequence-directed bend that overlaps with srk might reflect the increased flexibility of that DNA region being required for forming the TraK-oriT complex. In uitro, the presence of TraK increases the yield of cleaved plasmid DNA that can be isolated from reconstituted relaxosomes, indicating that the cleaving-joining equilibrium in the presence of TraK is shifted to the cleaved plasmid form (48, 96). An explanation for this observation could be a local change of the DNA topology that is imposed by TraK on the transfer origin. Hydroxyl radical footprints show that the helical repeat of the DNA

228

WERNER PANSEGRAU AND ERICH LANKA

within the TraK complex drops from 10.6 bplturn, which is the value for normal B-form DNA, to 10.2 bp/turn. Considering that about 180 bp are wrapped in the TraK complex, a drop by 0.4 bp/turn would be topologically equivalent to about 7 bp of totally unwound DNA. Thus, it is conceivable that TraK acts as a DNA chaperone (102) and that binding of TraK to srk helps to expose sri as a single strand, allowing efficient access of TraI to its recognition site (Fig. 5). The hypothesis that a local change in DNA topology is the explanation for the observed stimulation of plasmid cleavage activity is also confirmed by the observation that the in vitro-topoisomerase activity of the relaxase mutant TraI S74A can be completely suppressed by addition of TraK (96). In the presence of TraK, topological stress on the relwosome should be at least partially compensated, because local strand separation at sri is not only due to negative superhelicity of the substrate but could also result from the structure of the adjacent TraK complex. Thus, in the presence of TraK, binding of TraI S74A to sri obviously can be tight enough to prevent spontaneous plasmid relaxation. Besides the DNA chaperone activity, TraK must have another, perhaps even more important, function. This is implicated by the finding that a functional traK gene product is essential for conjugative transfer to take place, even under conditions where, in the absence of TraK, relaxosome formation and specific cleavage at oriT can be demonstrated (100). TraK remains an essential transfer factor even for plasmids that are completely deleted for srk. In the presence of a functional traK gene, this deletion results in a drop of the transfer frequency by two to three orders of magnitude, but transfer is easily detectable. In the absence of traK, however, no plasmid transfer can be observed (36).Another hint on an additional function of TraK is the finding that TraK is the only Tra gene product that, if overproduced, has a deleterious effect on the host cell (47).

3. TRAH The TraH protein is encoded by an unusual out-of-frame overlapping gene arrangement within the tral gene (Fig. 2). TraH is not an essential transfer factor: a site-specific mutation that destroys the initiation codon of traH but does not alter the amino-acid sequence of TraI has no effect on intraspecific E . coli matings (38).TraH is an acidic protein that does not bind by itself to DNA (Table I). In solution the protein forms higher multimers, and electron microscopy of TraH preparations suggests that these multimers consist of stacked disks with sevenfold rotational symmetry. Another unusual feature of the protein is its deep brown color; the chromophore is still unknown ( G . Ziegelin, W. Pansegrau and E. Lanka, unpublished results). TraH shows several interesting activities in uitro. In the absence of DNA,

BACTERIAL CONJUGATION

229

the protein forms specific and very stable complexes with the relaxosome components TraJ and TraI (51).Both complexes, and the multimeric form of TraH itself, are stable at room temperature in the presence of SDS. Only boiling with SDS leads to their disruption into single subunits. Only C-terminal deletion derivatives of TraI that exceed 71 kDa can form the specific TraH complex (our unpublished results). Therefore, the TraH-binding domain within TraI should be located in the C-terminal part of the protein (Fig. 8). Electrophoretic detection of relaxosome formation by specific retention of supercoiled oriT plasmids on agarose gels is possible only in the presence of TraH (74). Specific complex formation of TraH with the relaxosome components TraI and TraJ could be an explanation for this stabilizing effect of TraH on relaxosomes in uitro. According to this model, TraH would act as a clamp between TraI and TraJ preventing spontaneous dissociation of the relaxosome components.

D. Biochemical Methods for Studying Relaxosomes In recent years, a number of assay systems have been developed to study the biochemistry of relaxosomes and DNA relaxases and the events that take place at oriTs when conjugative DNA processing proceeds. Two main approaches have been followed: (1)isolation of relaxosomes from bacterial cells that overproduce relaxosomal components and (2) overproduction and purification of relaxosome components and reconstitution of protein-DNA complexes in uitro (36, 74, 82, 86, 89, 103-107). The first approach has been used extensively to study the structure of oriT DNA after cleavage had taken place. The cleavage site (nic)was mapped first by analyzing specifically relaxed plasmid DNA on alkaline agarose gels to separate the plasmid single strands (36, 80). The exact position was determined by identlfying the 5'- and 3'-terminal nucleotides at nic by MaxamGilbert sequencing (52, 74, 80). The substrate for the sequencing reactions was obtained by incubating relaxosomes in a cleared lysate with SDS and proteinase K. This treatment results in capturing relaxed plasmid intermediates that can be isolated by preparative gel electrophoresis. Cutting the DNA by appropriate restriction endonncleases and end-labeling of the fragments (3' or 5', depending on which terminus is to be sequenced) yielded the substrate for the chemical degradation reactions. To identify the 5' terminal nucleotide, a second, less laborious method was also applied. Primer extension on specifically relaxed plasmid DNA was done in the presence of dideoxynucleotides using a primer that annealed downstream of nic (52). Analysis of the extension products on a sequencing

230

WERNER PANSEGRAU AND ERICH LANKA

gel resulted in a sequence ladder that terminated at the 5' end of the cleavage site, allowing determination of the position of nic unambiguously. However, the use of polymerases other than the large fragment of DNA polymerase I might lead to incorrect results: for T7 Sequenase (TM) Version 2.0 DNA polymerase a terminal transferase (extendase) activity has been reported that could account for some discrepancies in nick sites that were mapped in other systems (108).The extendase activity of T7 Sequenase may lead to a template-independent addition of one or a few nucleotides to the 3' termini of the extension products synthesized with the T-strand as template. Thus, the virtual position of the nick site will be shifted from its actual position by one or a few nucleotides upstream when T7 Sequenase is used. Attempts to label the 5' ends of specifically nicked DNA fragments demonstrated that the 5' terminus is blocked by a covalent modification (80). TraI-specific antiserum identified this modification to be TraI, showing that this protein embodies the catalytic activity of the relaxosome. Alkali-resistance of the covalent linkage between TraI and the DNA suggested that an 04-tyrosyl phosphodiester is formed with the DNA 5' terminus (52, 109). The second main approach used relaxosomes reconstituted in vitro from purified components. Assembly of relaxosomes can be followed by agarose gel electrophoresis under native conditions. Relaxosomes that form on superhelical oriT plasmid DNA diminish the electrophoretic mobility of this plasmid species. Site specificity of the assembly reaction is examined by electron microscopy. The large nucleoprotein complexes that form at oriT can be visualized after fixation by glutaraldehyde followed by linearization of the DNA by an appropriate restriction endonuclease (74). Intermediates specifically cleaved at nic can be captured if IncP relaxosomes reconstituted in vitro are treated with ionic detergents, such as SDS, or proteases, such as proteinase K. The structure of these intermediates is indistinguishable from the structure of those isolated from cells (74). An additional assay method for IncP-like DNA relaxes makes use of the ability of these enzymes to cleave specifically single-stranded oligonucleotides containing sri (81, 87, 90). This reaction requires only Mgz+ ions and no additional proteins as cofactors (Table 11).As in the double-stranded DNA cleavage reaction, a covalent protein-oligonucleotide adduct is formed (Fig. 11).This reaction has been used to determine the amino acid that forms the covalent linkage between the relaxase and the DNA. Following digestion of covalent adducts with specific proteases, peptide-oligonucleotide adducts were separated on polyacrylamide gels. Distinct mobilities of these adducts allowed mapping of the attachments sites for the DNA relaxases TraI and VirD2 (81, 84). A more direct approach involved N-terminal peptide sequencing of peptide-oligonucleotide adducts. At the position of the amino

23 1

BACTERIAL CONJUGATION

nic

30-mer

cleaving nick region

21-mer

tl

relaxase, Mg2'

+ nick region

m

joining

13-mer nic

nick region!

22-mer FIG. 11. Detection of specific cleaving-joining catalyzed by DNA relaxases. Singlestranded nick region oligodeoxyribonucleotidesare represented by shaded bars. See Section V, D for explanations.

acid that forms the linkage with the DNA, a gap in the sequence was found because a non-volatile PTH-amino-acid derivative, formed during Edman degradation, escaped detection (81, 90). However, amino acids that precede or follow this position were detected without disturbance by the DNA moiety, allowing unambiguous determination of the attached amino acid. The oligonucleotide cleavage-joining assay can also be used for the exact determination of the position of the cleavage site. To determine their size, 5'-end-labeled cleavage products can be coelectrophoresed with the partially digested substrate. The resulting ladder serves as a reference to determine the size of the cleavage product. To get a final proof of the position of nic, a synthesized cleavage product containing the sequence upstream of nic can be applied to demonstrate specific joining. Only an oligonucleotide with a 3' end that corresponds to that of the cleaved T-strand will be accepted in the joining reaction (Fig. 11)(81, 84).

232

WERNER PANSEGRAU AND ERICH LANKA

E. DNA Primases DNA primases are enzymes that catalyze de nmo synthesis of short oligonucleotides on a single-stranded circular DNA template (110). The oligonucleotides can be elongated by the host replication machinery, allowing complementary strand synthesis to take place on DNA single strands in the absence of other chromosomally encoded priming systems. This ability of DNA primases led also to their discovery: most plasmid-encoded DNA primases suppress a temperature-sensitive E. coli dnaG mutation, indicating that these enzymes can hnctionally replace the dnaG gene product, the primase of the chromosomally encoded replisome (19, 20). Moreover, the ability for primer synthesis persists in the presence of rifampicin, demonstrating its independence from RNA polymerase. Conjugative plasmids of several incompatibility groups of Gram-negative bacteria specify a DNA primase (78).The best-characterized representatives are enzymes encoded by the IncIl and IncPa plasmids ColIb-P9 and RP4, respectively (111-113). DNA primases of IncP plasmids are encoded by inphase overlapping gene arrangements within the Tral region (Fig. 2). IncPa plasmids encode two forms of DNA primases, 82 (TraC2) and 117 kDa (TraCl) in size; the smaller form is made from an internal initiation codon within the truC gene (28,37).IncPP plasmids (the prototype is R751) encode even four distinct forms, the largest one (173 kDa) (TraCl) is produced by readthrough of the truD termination codon. The three smaller forms (159, 134, and 81 kDa) (TraC2, C3, and C4, respectively) are specified by traC, which has two internal initiation codons. Each of the different forms of IncPencoded primases shows primase activity in vitro, indicating that the primase domain must be completely contained within the smallest forms (28). The organization of primase genes in ColIb-P9 is quite similar to that in RP4: the primase is encoded by the sog gene, which is located within the Tra region of ColIb-PS. Also the sog gene encodes two polypeptides (210 and 160 kDa) by an in-phase-overlapping gene arrangement (112, 114). However, there is one difference in the situation in IncP plasmids: only the large Sog form shows primase activity; therefore, the primase domain must be located in the N-terminal part of the 210-kDa Sog protein. Amino-acid sequence comparison revealed three conserved regions (1-111) in TraC2 (RP4), in TraC4 (R751), and in the N-terminal part of the 210-kDa Sog protein. One is conserved sequence motif within region 111, -Glu-Gly-Tyr-Ala-Thr-Ala-, among all known prokaryotic DNA primase sequences (115). Interestingly, the motif was also found in the cr protein of the E . coli satellite phage P4. This protein is multifunctional, having DNA primase, DNA helicase, and origin recognition activities on a single polypeptide chain, making replication of the P4 genome independent of host initiation factors (114, 116, 117).

BACTERIAL CONJUGATION

233

Amino-acid residues within the conserved motif were the targets for sitedirected mutagenesis studies of the KP4 TraC2 and the P4 a protein (114). These studies demonstrated that the -Glu-Gly-Tyr-Ala-Thr-Alamotif apparently is essential for the primase function. The activity pattern obtained with the mutant proteins of RP4 TraC2 and P4 a fit into a general scheme: Glu + Gln and Thr + Ser exchanges abolish or strongly decrease the specific activity, whereas a Tyr 4 Phe change increases the activity or leaves it unaltered. In vitro, the Glu 4 Gln exchange results in complete loss of oligonucleotide synthesis. These results suggest that these residues could form a part of a critical domain involved in the primase function. The common feature of plasmid-encoded primases, to be encoded by inphase-overlapping genes, suggests that these proteins are multidomain enzymes and that the different forms are fulfilling specific functions in the bacterial life cycle, i.e., conjugative transfer or plasmid maintenance. In fact, it has been shown that, during conjugation, plasmid-encoded primases can be transferred from the donor to a recipient cell (118, 119). The transport mechanism is not understood. The N-terminal amino-acid sequences of the protein lack the typical signal sequences, indicating that the proteins are transferred by some process other than the classical protein export pathway. However, conjugative DNA primase transfer requires specific sequences too: only the RP4 TraCl protein is detectably transferred, indicating that the N-terminal part of TraCl absent from TraC2 is required for transfer to take place. Conversely, both forms of Sog are transferred to recipient cells in ColIb-P9 conjugation. In the case of Sog, the transfer domain must be located toward the C terminus of the protein and is therefore common to both the Sog210 and Sogl60 polypeptide. What is the biological significance of plasmid-encoded DNA primases and their conjugative transfer? Under laboratory conditions, neither TraC nor Sog is an essential transfer factor. However, in a suboptimal environment, for example starvation, a specialized transfer DNA primase in the recipient cell could facilitate initiation of complementary strand synthesis. Another possibility is that primases are required only in matings between certain bacterial species but not in intraspecific E . coli matings. Indeed, this has been demonstrated for RP4 TraC, which strongly stimulates DNA transfer to Salmonella spp. and Providencia spp. (113).It has been speculated that primases are transferred to the recipient cell along with the T-strand as a protein-DNA complex (111). Because DNA primases are very abundant gene products in RP4- or ColIb-PS-containing cells, it is conceivable that TraCl or the Sog proteins coat the DNA single strand during transfer. However, in both systems, the DNA primases do not have to be present during transfer. This would mean that the same transport channel had to be used with nearly the same efficiency both for the naked DNA single strand

234

WERNER PANSEGRAU AND ERICH LANKA

and for the primase-DNA complex. Because this seems very unlikely, either another host- or plasmid-encoded protein may substitute for the primase during transfer or the primase in fact uses another independent pathway to reach the recipient. RP4-mediated DNA transfer to yeast does not require the truC gene products (S. Bates, A. Cashmore and B. M. Wilkins, personal communication). The biochemistry of plasmid-encoded DNA primases has been studied extensively in uitro. TraCl and TraC2 are anisometric molecules that exist in solution as monomers. Both TraCl and TraC2 bind to DNA single strands with equal affinity. A typical assay for primase activity consists of an E . coli extract that sustains DNA replication but is devoid of a functional host primosome, and a single-stranded circular template DNA, for example, of phage +X174, G4, or fd (111).Additional compounds are rifampicin to inhibit RNA polymerase activity and the complete set of ribo- and deoxyribonucleoside triphosphates. Suitable strains to prepare the DNA replicating extract are BT308 (dnuG) or, when +X174 DNA is used as a template, BT1304 (dnaB, dnuC). Primase activity is monitored by incorporation of labeled deoxyribonucleotides into acid-insoluble material during the elongation reaction. Analysis of the primers synthesized by the RP4 TraC primase revealed that these consist of 2- to 12-mer oligoribonucleotides. The 5’-terminal nucleotide is always C or pC. The second nucleotide is A or G, with A being the preferred compound. No preference was detectable for the following nucleotides. Experiments with synthetic oligodeoxyribonucleotides as templates confirmed that the dinucleotide sequence d(TG) is the preferred recognition site and sufficient for TraC to initiate primer synthesis. d(CG) is also accepted, however with lower af€inity. The presence of a C or pC residue at the 5‘ terminus instead of pppC provides strong evidence that TraC has two different nucleotide-binding sites, one for the initiating 5’-terminal nucleotide and a second one for the nucleoside triphosphates to be incorporated into the primer chain (73).

V. Phylogenetic Relationships to Other Systems Relationships among conjugative systems or to other systems can be discovered by two basic approaches: by the analysis of mechanistic analogies and by search for sequence similarities between genes or gene products. Both approaches have been successfully applied for the IncP system. In several cases, mechanistic analogies served also as a guide for a careful examination of functionally analogous gene products for sequence similarities to demonstrate an evolutionary relationship.

BACTERIAL CONJUGATION

235

A. Conjugative Plasmids of Gram-positive and Gram-negative Bacteria All conjugative systems analyzed so far share mechanistic analogies: adhesion of donor and recipient cells is mediated by extracellular filamentous structures (pili) (12O), or, in Gram-positive bacteria, by a fibrillar “adhesion substance” (121); the DNA is transferred as a single strand thought to be generated by rolling-circle-type replication; the leading 5’ end is covalently associated with relaxase protein initiating transfer DNA replication by a siteand strand-specific cleavage event. A comparison of the sequences adjacent to the cleavage sites within the transfer origins of conjugative and mobilizable plasmids from Gram-negative and Gram-positive bacteria revealed the existence of at least four groups of sequence-related transfer origins (Fig. 12) (122-138). Based on the prototype plasmids that gave origin to these families, we propose to designate them IncP-, IncF-, IncQ-, and ColEl-like transfer origins (20). The prototype plasmids are those of its group that were characterized and sequenced first. IncP-like transfer origins seem to be most widely distributed: the core of the relaxase recognition site (sri, Figs. 6 and 13) has been found to be conserved not only among a wide variety of transfer origins from other conjugative and mobilizable plasmids but also among conjugative transposons, the T-border sequences of the Agrobacterium tumefaciens Ti plasmid, vegetative replication origins of plasmids from Gram-positive bacteria, and replication origins from single-stranded bacteriophages (48, 139, 140). In any case, the position of the cleavage site is conserved and the invariant nucleotide positions are found exclusively upstream of the cleavage site (Fig. 13) (141-147). The transfer origins from the other families (Fig. 12) do not fit into this scheme: conserved positions were detected upstream and downstream of nic, indicating that the mode of substrate recognition by the respective DNA relaxases probably differs significantly from that of the IncP-like relaxases. The sequences around the nic sites are highly conserved within each of these groups, but the conserved positions are not shared among the families. Nevertheless, all transfer origins studied so far are functionally equivalent: Transfer is initiated by a specific single-strand incision and the cleaving enzyme attaches covalently to the 5’ terminus of the interrupted DNA strand. In general, the pattern of relationships among the relaxases from different conjugative or mobilizable plasmids follows that of the transfer origins: relaxases that act on IncP-like transfer origins share three conserved motifs at their N termini [Figs. 8 and 14 (148, 149); see Section IV,B,2] (48, 96).

236

WERNER PANSEGRAU AND ERICH LANKA

C C A C C C C R

C C T C A A C

G G T C C A T

G C G G C A G

C C C T A C T

Y A T C C T G Y

F T T P307 T T RlOO T T pED208 T T R46 G C R388 G G T G C G

G T

T A A

T R

R C

G C G C C C - T

ColEl G G A G T G T A T A C T G G I C T T A A C ColA G G A G T G T A T A C T G G C T T A C T FIG.12. Families of oriT nick regions. Nucleotide positions that are conserved within a family of oriT sequences are drawn with a black background. A shaded background marks purine or pyrimidine cf pyrimidine positions where conservative replacements (purine nucleotide) may occur. In cases where the cleavage site has been determined, it is indicated by a wedge. Consensus sequences are depicted below of each block of related sequences. ReferencesiCenBank accession numbers: RP4/RK2 (26)/L27758; R751 (26)/X54458; pTF-FC2 (122)/M57717; R64 (123)/D90273; pTiC58 LB (124)/J01818; pTiC58 RB (124)/J01819; NTP16 (125)/L05392; F (126)/XOO545; P307 (127)/X06534; RlOO (128)/M17148; R46 (129)/M30197; R388(130)/X51505;RSFlOlO (131)/M28829; Rl162 (132)/M13380; pTFl(133)/X52699; pTiC58 oriT (134);pSClOl(135)/XO1654; pIP501 (136)/L39769;p C 0 1 (C. L. Archer, personal communication); ColEl (137)/J01566;ColA (138)/M37402. @

Most notably, motif I11 partially appears also in relaxases of plasmids from the other families: the two histidine residues that are thought to be involved in activation of the reactive nucleophiles in the cleaving-joining reaction are conserved throughout (97, 98, 150). Motif I1 was not found in the non-IncPlike relaxases, which is the expected result because this motif is proposed to be required for specific substrate recognition and stable binding (Fig. 9).

237

BACTERIAL CONJUGATION

Motif I is the least conserved one, also among IncP-like relaxases: except for the reactive tyrosine, all other positions are variable (96). A comparison of the Dtr and Mpf systems from the different plasmids revealed that apparently several combinations of Mpf and Dtr components of diverse origin exist. This finding suggests that the various conjugative transfer systems have formed by combination of exchangeable modules that, in the course of evolution, have adapted to optimal function in the respective context (25). Two examples of module shuffling can be given: The transfer apparatus of IncW plasmids seems to consist of an IncP-like Mpf system (Pil, Fig. 15) and a Dtr system that is composed of an IncF-like transfer origin with the corresponding DNA relaxase/helicase showing similarity to the IncF TraI protein (TrwC), an IncP TraJ-like oriT-binding protein (TrwA), and a protein (TrwB) that belongs into the family of IncP TraG-like proteins (108). The second example is the conjugative system of the Ti plasmid for interbacterial plasmid transfer: the Tra3 region shows extended similarity to the Tra2 core

RP4 R751 PTF-FCP R64

ACTTCAC ACTTCAC ACAACGG CAATTGC

CCGGCT CCGCCT ATTGCT CCCGTT

pTiC58 T-DNA (RB) pTiC58 T-DNA (LB)

CGCCAAT CCACAAT

CAAACA CCACCA

Tn4399

GCCGACA

TATCCT

pC194 PUB110

TTCTTTC TTCTTTC

TAATAA TACATA

TGCTCCC GTGCTGC TGCTCGG TAACTGGA

TATTAA TAATAG TATTAA TGTTAC

phage QX174

phage 3 - 1 , a-3

phage G4, G14, U3 phasyl Consensus

YAWCYTd

FIG. 13. Alignment of rolling-circle-type replication origins. Nucleotide positions that are throughout conserved are drawn with a black background. A shaded background marks positions where conservative replacements (purine c) purine or pyrimidine ct pyrimidine nucleotide) may occur. The consensus sequence is depicted below. ReferencedGenBank accession numbers: Tn4399 (107)/L20975; pC194 (141)/J01754; pUBllO (I42)/M19465; phage 4x174 (143)/ J02482;phage St-I (144)/J02501;phage a-3 (144)/M10631; phage G4 (145)/V00657;phage 614 (146)/M10632; phage U3 (146)/M10630; phasyl (147)/X56069. Others: see legend to Fig. 12.

238

WERNER PANSEGRAU AND ERICH LANKA vrrD3

pTiA6 VirD/C

RP4 Tral (IncPa) oriT

PTF-FC2 Mob mobA

R64 Nik (Incll)

dobB mobC mobD mob€ Or17

-+-+ nrk8

nikA

1kb

FIG. 14. Conserved gene organization among relaxase regions of different DNA transfer systems. Conserved motifs in DNA (nick region sequences) or amino-acid sequences are connected by broken lines. (For details on conserved relaxase motifs see Fig. 8.)Genes proposed to encode functionally related gene products are shown with the same type of hatching or gray tone. ReferencedGenBank accession numbers: IncPa (26)/L27758; pTiA6 VirDlC (148, 149)/M17989, M14480; pTF-FC2 (122)/M57717;R64 (123)/D90273.

region of IncP plasmids (Fig. 15) (151-154). The Dtr system, located in Tra2 of the Ti plasmid, is IncQ-like with a relaxase (TraA) similar to the RSFlOlO MobA protein and a transfer origin that fits into the family of IncQ-like oriTs (Fig. 12). However, the C-terminal part of TraA contains motifs that were also found in the helicases TraI (IncF) and RecD ( E . coli) and in the E . coZi primase DnaG (S. K. Farrand, personal communication). Recently, the sequences of several new systems, including conjugative transposons and integrated elements from Bacteroidm and of conjugative plasmids from Gram-positive bacteria, have become available. Interestingly, most of these systems seem to fit into the IncP family: the transfer origin of Tn4399 contains a sequence that matches the consensus for IncP-like oriTs and an invert repeat sequence upstream of the putative nick region (Fig. 13) (107, 155). The “mobilization region” of Tn4399 encodes two proteins, MocB and MocA, that show similarity to the TraJ and TraI proteins of IncP plasmids, respectively. Particularly, the three IncP relaxase motifs occur also in the MocA sequence. The mobilization protein (Mob) of NBUl displays similarity to TraJ as well as to TraI of IncP plasmids (156).The TraI-like domains are located at the N terminus and comprise the TraI motifs I, 11, and 111.

239

BACTERIAL CONJUGATION

RP4 Tra2 (IncPa)

pTiC58 Tra3 pTiA6 VirB pKM101 Tra (IncN) pVr745 Tra R388 Pil, (IncW)

B. pertussis Ptl

ptm

c

D

E

F

G

H

__ 1 kb

FIG. 15. Conserved gene organization among specialized bacterial export systems. Genes encoding similar products are connected by broken lines or are shown with the same type of hatching. Tags marked with E represent protein export signals. Tags marked with L indicate lipoprotein signatures at the N terminus of the respective protein. Conserved nucleotidebinding motifs of type A are marked by tags labeled with A. ReferencedGenBank accession numbers: IncPa Tra2 (25)/L27758; pTiC58 Tra3 (151; S. K. Farrand, personal communication); pTiA6 VirB (152)/J03216; pKMlOl Tra (153)/U09868; pVT745 Tra (D. Galli and D. Leblanc, personal communication); R388 Pil, (F. de la Cruz, personal communication); B . pertussis Ptl (154)/L10720.

However, the arrangements of motif I1 and I11 differ: in the Mob protein these domains form a single block of approximately 20 amino-acid residues. The C-terminal part of Mob contains a region similar to TraJ (IncP), suggesting that this protein embodies relaxase and origin-recognizing functions in a single polypeptide chain (156). The MobA protein of RSFlOlO is another example for combining double-strand recognition and cleaving-joining activity in one polypeptide chain (89). The transfer region of the conjugative plasmid pSK4 from Staphylococcus aureus encodes 13transfer gene products. Two of these display similarity to IncP transfer proteins: TraK of pSK4 shares similarity with the IncP TraGlike proteins (31)and TraI (pSK4) with the topoisomerase TraE of the IncP plasmids (157).The relaxase has not yet been identified; however, the transfer origin of the closely related plasmid pGOl fits into the IncQ family (Fig. 12), suggesting that also the relaxase probably will be similar to the IncQ MobA protein (158).

240

WERNER PANSEGRAU AND ERICH LANKA

The product of the gene 19 of the IncFl plasmid R 1 is not essential for conjugative DNA transfer; however, mutants in gene 19 are attenuated in DNA transfer and bacteriophage R17 propagation (159). The amino-acid sequence of P19 contains three motifs that are conserved among soluble lytic transglycosylases (e.g., Slt70 of E . coli). The three motifs were also found in the sequences of IpgF (encoded by a virulence plasmid of ShigeZZafEexneri), PilT of R64 (IncI), TrbN of RP4 (IncP), VirBl of pTi, and TraL of pKMlOl (IncN). Mutations in the corresponding genes in most cases result in an attenuation of DNA transfer but not in a Tra- phenotype, suggesting that the proteins might play analogous roles in the DNA transfer process. The three motifs are suggested to be indicative of muramidase activity (159). Thus, it is conceivable that this class of proteins either facilitates the passage of the DNA single strand through the peptidoglycan layer or the insertion of components of the membrane-spanning DNA transport complex into the bacterial cell wall. The attenuated phenotype of mutants in the genes could result from the fact that muramidases provided by the host cell, albeit with lower efficiency, could functionally replace the corresponding gene products. Interestingly, the highest overall similarity exists between the IncP conjugative machinery and the T-DNA transfer system of the Ti plasmids (Figs. 3 and 12-15). Similarities were found between transfer origins and T-borders, between the Tral core region (IncP Dtr) and the VirD region (pTi Dtr) and between the Tra2 core region (IncP Mpf) and the VirB region (pTi Mpf) (26, 46, 57, 75, 139).

B. The T-DNA Transfer System of Agrobacteriurn tumefaciens

Although A. tumefaciens-mediated tumor induction in plants at first sight appears to be rather different from bacterial conjugation, a closer look at the mechanism of tumor induction reveals striking similarities: T-DNAs encoding enzymes for the synthesis of plant hormones and opines are transferred as single-stranded DNA-protein complexes to the plant nucleus (160).In the plant, the DNA arrives coated over its whole length by a specialized singlestranded DNA-binding protein, VirE2 (161, 162), and the 5' end is covalently associated with the VirD2 relaxase (109, 163, 164). This protein-DNA complex has been designated the T-complex. In its structure, it might resemble a filamentous bacteriophage (Fig. 16). The targets for VirD2 relaxase are the border sequences that form a tandem arrangement of 25-bp direct repeats, flanking the T-DNA regions of Ti plasmids on their left and right side. By comparing the T-border sequences with IncP-like transfer origins, it became for the first time apparent that T-borders not only are functionally related to conjugative transfer ori-

24 1

BACTERIAL CONJUGATION

T-DNA transfer mediated by pTi right T-DNA border

conjugative DNA transfer mediated by RP4

5'

3’

oriTnick region

3,

Tral TraJ TraH

Complex formation

VirD2 VirD1 VirD3

3’

VirD2

3

VirE2

VirD4

Linkage of the DNA to the export apparatus NTP hydrolysis (?)

Tral

TraC

TraG

VirB gene products

Tra2 gene products

Plant cell

Bacterial cell Recipient

FIG. 16. Functional analogies hetween IncP-type bacterial conjugation and T-DNA transfer to plants. Components proposed to fulfill analogous functions are arranged at opposing positions. See Section V,B for explanations.

gins but also are evolutionary: a core region of 6-7 nucleotides is identical in both systems (48). Moreover, the positions of the cleavage sites relative to this core are conserved (Figs. 12 and 13). However, a substantial difference

242

WERNER PANSEGRAU AND ERICH LANKA

of T-border sequences from other conjugative transfer origins is the absence of invert repeat structures upstream of the cleavage site. In interbacterial conjugation, these invert repeat structures are thought to be required as a signal for termination of transfer DNA replication and for precise recircularization of the transferred DNA single strand (see Section IV,B,l). Because these reactions are not required for T-DNA transfer-termination takes place by cleavage at the left T-border sequence and the DNA in the T-complex is integrated into the plant genome as a linear molecule (165)-it is reasonable that invert repeat sequences are not present in T-border sequences. The sequence identity in transfer origins and border sequences is paralleled by sequence similarities of conjugative relaxases and pTi-encoded VirD2 proteins (139). The three relaxase motifs identified as conserved among several conjugative DNA relaxases are also present in VirD2 (Figs. 8 and 14). The importance of motif I for the function of VirD2 has been demonstrated by site-directed mutagenesis: exchange of Tyr-28 for phenylalanine abolishes in vivo cleavage activity of VirD2 (166). Furthermore, Tyr-28 is functionally analogous to Tyr-22 of TraI: peptide mapping of covalent VirD2-DNA adducts identified this residue to form the covalent linkage to the 5' end of the covalently attached DNA in the T-complex (84). Purified VirD2 has been applied in vitro for cleaving-joining reactions on single-stranded oligonucleotides containing the nick region of T-border sequences (84, 167) and, together with purified VirD1, for the cleavage of superhelical T-border DNA (83).In the latter reaction VirDl acts as a functional analog of the IncP TraJ protein, although binding of VirDl to DNA has not been demonstrated. The characteristics of the in uitro reactions of VirD2 and VirD2/VirD1 are nearly identical to those of TraI and TraIfTraJ of the IncP system. The only detectable difference is a more relaxed substrate specificity of VirD2 in the single-stranded DNA cleaving-joining reaction. VirD2 cleaves and joins not only oligonucleotides containing the nick region of Ti border sequences, but also those containing the nick region of IncP plasmids (sri, Figs. 6 and 13).In contrast, IncP-encoded TraI protein cleaves and joins only oligonucleotides with the cognate sri sequence (84). VirD2 has been proposed to be also involved in integrating the T-DNA into the plant genome (84). Therefore, the lower stringency on substrate requirement might reflect the ability of VirD2 to use free 3' hydroxyl ends that may occur transiently in the plant genome to initiate the integration reaction to join these ends with the 5' terminus of the T-DNA. Sequencing the ends of integrated T-DNAs has revealed that in many cases integration is precise with respect to the T-DNA 5' terminus. This finding indeed suggests a functional involvement of VirD2 in integrating the T-DNA into the plant genome (168).

BACTERIAL CONJUGATION

243

The gene organization of conjugative relaxase operons shows a striking similarity to the VirD region of Ti plasmids (Fig. 14). The similarity continues on the right-hand site of the intergenic region that separates VirD and VirC: the gene products of virC1 and uirC2 are sequence-related to the proteins TraL and TraM of the IncP leader operon (25).The function of the products of the VirC region is proposed to consist in interacting with “overdrive” sequences that may be present in the vicinity of right T-border sequences to stimulate border-specific cleavage (169).Although such a function has not been demonstrated for TraL and TraM, both gene products, like VirC 1 and VirC2, are nonessential accessory proteins that might stimulate DNA processing reactions at the transfer origin. Most strikingly, a nucleotide-binding motif of type A (56) at the very N terminus of the amino-acid sequences of VirCl and TraL is conserved (Fig. 14). Sequence alignments of corresponding genes reveal that the IncP-encoded TraG proteins have sequence-related analogs in the pTi-encoded VirD4 proteins (26). Again, nucleotide-binding motifs (types A and B) are well conserved among IncP and pTi-encoded proteins. In both cases, however, like in the other TraG-like proteins, the type A motif does not correspond very well to the consensus (57). The similarity between functions involved in T-DNA transfer and bacterial conjugation continues in the pTi VirB region (7). VirB-encoded gene products are thought to be involved in transporting the T-complex across the bacterial membranes and the plant cell wall into the plant cytoplasm (76, 170). Several products of VirB show sequence similarity to products of the IncP Tra2 core region and related conjugative systems (Fig. 15)and the gene organization of both regions matches over a considerable range (46).Particularly, the genes virB2-5 are in the same order as are the IncP Tra2 genes trbC-F (Fig. 15).Because the trbC and uirB2 gene products show similarity to the IncF pilin TraA, it has been speculated that also in T-DNA transfer a pilus-like structure might be involved (38, 44). Interestingly, the uirB11 gene and its analogous counterpart trbB are located at opposite ends of their respective operons, providing evidence that these transport regions could have evolved from exchangeable modules that may arrange in several ways to yield a functional system.

C. The Toxin Secretion System of Bordetella pertussis Bordetellu pertussis is a human pathogen, the infective agent of whooping cough. A major virulence factor of B. pertussis is the pertussis toxin, consisting of five different subunits that are exported individually to the periplasmatic space by the signal peptide-dependent pathway (1 71). After

244

WERNER PANSEGRAU AND ERICH LANKA

assembly, the toxin is secreted from the periplasm into the extracellular environment. The latter step requires the gene products of the chromosomal Ptl operon that is located downstream from the pertussis toxin operon. Ptl consists of at least seven genes (ptlB-H) arranged in a single polycistronic operon. Comparison of the amino-acid sequences of the gene products of ptlB, C , D, E , F , G, and H revealed a striking similarity with gene products virB2, 3 , 4 , 5, 6 , 8 , 9, 10, and 1 1 , respectively (Fig. 15) (153, 154). Consequently, ptl gene products are also sequence related to polypeptides encoded by IncP Tra2 core, IncN Tra, and IncW Pil, and to the pTi-encoded Tra region for interbacterial conjugative transfer (Fig. 15). Special features in the amino-acid sequences, such as protein export signals (cleavage sites for signal peptidase I, PtlF), nucleotide binding motifs (PtlC, PtlH), and leucin zipper motifs (PtlB), are throughout conserved (25, 29). This and the fact that the genes in both Ptl and VirB are colinear demonstrate that the DNA transfer systems and the Ptl toxin secretion system have a common evolutionary origin. Moreover, it shows that the basic principles underlying conjugative DNA transfer can also be applied to protein secretion, and vice versa. Therefore, it is also impossible to decide what a common ancestry system might have been: a delivery system for protein or for DNA.

D. Other Systems One component of the IncP Mpf system, the trbB gene product, is related not only to proteins involved in conjugative DNA transport but also to proteins from a wide variety of specialized protein export systems and from one DNA import system (7, 75). TrbB, which is sequence related to PtlH (Ptl, B . pertussis) (153),TrbB (pTiC58 Tra3) (151; S. K. Farrand, personal communication), TrwD (R388) (172),TraG (pKM101) (153),and VirBll (152,173-175), displays also significant similarity to the gene products XcpR (Pseudomonas aeruginosa) (176), ComGl (Bacillus subtilis competence system for transformation by exogenous DNA) (177), PulE (Klebsiella pneumoniae pullulanase export system) (178), XpsE (Xanthomonas campestris) (1 79), OutE (Erwinia chrysanthemi) (180), ExeA (Aeromonas hydrophilia) ( I S ] ) , and PilB and PilT (Pseudomonas aeruginosa pilus assembly systems) (182). All these proteins have in common three highly conserved regions, one of which is a nucleotide-binding motif of type A (56).The fact that TrbBlike proteins appear in all these types of transport systems makes it unlikely that TrbB is involved directly in the DNA transport reaction during conjugative transfer. A common feature of the systems from which these proteins originate is, however, that these consist of membrane-located multiprotein complexes, often associated with pilus-like structures. Thus, it is most likely

BACTERIAL CONJUGATION

245

that the TrbB-like proteins are involved in the assembly of these membrane complexes, possibly functioning as chaperones preparing components of the complex for assembly.

VI. Conclusions and Perspectives The mechanistic analysis of the process of bacterial conjugation revealed that the great majority of eubacterial DNA transfer systems studied so far rely on the same basic principle: during initiation of transfer DNA replication, the D N A molecule to be transferred is cleaved in a reversible site- and strand-specific reaction. The cleaving agent, the relaxase, forms a covalent intermediate with the DNA, attaching to the 5’ terminus and a DNA single strand is generated by rolling-circle-like replication, initiating at the strand interruption introduced by the relaxase. The DNA single strand is transferred in a 5’ + 3’ polar transmission process across the membranes of donor and recipient. Parallel to these functional analogies, sequence comparisons unveiled a phylogenetic relationship between most conjugative systems and also to some other macromolecular transport systems. Most notably, the agrobacterial T-DNA transfer to plants is now recognized to be a special conjugative process adapted to the requirements imposed by the plant acting as a recipient (7). Biochemical studies on relaxases reveal numerous details of the mechanism of the nicking-closing reaction that takes place at the transfer origin. However, a still-open question concerns the conversion of the relaxosome into a structure that can be used by a rolling-circle replication machinery to generate the single strand destined for transfer. This conversion takes place only on mating aggregate formation, thus, some sort of trigger signal must be sent to the relaxosome to initiate transfer DNA replication. The origin and nature of this signal remains to be determined. Generation of a DNA single strand, in general, requires the action of a DNA helicase, a type of enzyme that has not been discovered among the Tra proteins of IncP plasmids. In those systems known to encode DNA helicases (e.g., IncF and IncW) (183, 184), functional relevance for DNA transfer is still to be demonstrated. Currently, two possibilities are favored: either a host-encoded helicase is engaged in transfer DNA replication, or a specialized enzyme that differs substantially from known DNA helicases in its primary structure and enzymology provides the strand-separating activity. The main enigma of bacterial conjugation, however, remains the transport of the D N A across the cell membranes of the donor and recipient cells. Our knowledge about the structure of the transport channel (Fig. 17) and the

246

WERNER PANSEGRAU AND ERICH LAN'KA

FIG.17. Model of the IncP-type transfer machinery

function of its components is still marginal. Biochemical studies of Mpf components are beginning now: most components of the IncP Mpf system have been overproduced and several are purified. This will provide a basis for studying the structure of the single compounds and to unravel interactions between them and with relaxosomes.

ACKNOWLEDGMENTS We thank our colleagues Gordon J. Archer, A. Marika Grahn, and Dennis H. Bamford, Fernando de la Cruz, Dominique Galli, and Donald Le Blanc, Stephen K. Farrand, Giinther Koraimann, Russell J. DiGate, Ron A. Skurray, Christopher M. Thomas, and Brian M. Wilkins for providing manuscripts and data prior to publication. Work in our laboratory was supported by a grant from the Deutsche Forschungsgemeinschaft (SFB 344/B2) to E. L.

247

BACTERIAL CONJUCATION

REFERENCES J. Lederherg and E. L. Tatum, Nature 158, 558 (1946). L. L. Cavalli, E. M. Lederberg and J. Lederberg, J. G e n . Microbiol. 8, 89 (1953). W. Hayes, J . Gen. Microhiol. 8, 72 (1953). R. C. Deonier, in “Escherichia coli and Salmonella typhimurium. Cellular and Molecular Biology” (F. C . Neidhardt, ed.), p. 982. American Society for Microbiology, Washington, DC, 1987. 5. F. Jacob and E. L. Wollman, Symp. SOC.Exp. B i d . 12, 75 (1958). 6. J. A. Heinemann and G . F. J. Sprague, Nature 340, 205 (1989). 7 . M. Lessl and E. Lanka, Cell 77, 321 (1994). 8 . S. E. Stache1 and P. C. Zambryski, Cell 47, 155 (1986). 9. P. Zambryski, ARGen 22, 1 (1988). 10. T. Watanabe, Microbid. Reu. 27, 87 (1963). 1 1 . T. Watanabe and T. Fukasawa, BBRC 3, 660 (1960). 12. C. F. Amlbile-Cuevas and M. E. Chicurel, Cell 70, 189 (1992). 13. P. Mazodier and J. Davies, ARGen 25, 147 (1991). 14. P. Courvalin, Antimicrob. Agents C h m t h e r . 38, 1447 (1994). 15. E. J. L. Lowbury, A. Kidson, H. A. Lilly, G. A. Ayliffe and R. J. Jones, Lancet 2, 448 (1969). 16. P. Barth and N. J. Grinter, J. Bact. 120, 618 (1974). 17. P. Guerry, J. van Embden and S. Falkow, J. Bact. 117, 619 (1974). 18. D. G. Guiney and E. Lanka, in “Promiscuous Plasmids in Gram-negative Bacteria” (C. M. Thomas, ed.), p. 27. Academic Press, London, 1989. 19. B. M. Wilkins and E. Lanka, in “Bacterial Conjugation” (D. B. Clewell, ed.), p. 105. Plenum, New York, 1993. 20. E. Lanka and B. M. Wilkins, ARB 64, 141 (1995). 21. N. Firth, K. Ippen-Ihler and R. A. Skurray, in “Escherichia coli and Salmonella typhimurium. Cellular and Molecular Biology” (F. C. Neidhardt, ed.). American Society for Microbiology, Washington, DC, 1986 (in press). 22. L. S. Frost, K. Ippen-Ihler and R. A. Skurray, Microbiol. Reu. 58, 162 (1994). 23. D. B. Clewell, “Bacterial Conjugation.” Plenum, New York, 1993. 24. N. Willetts and B. M. Wilkins, Microbiol. Reu. 48, 24 (1984). 25. W. Pansegrau, E. Lanka, P. T. Barth, D. H. Figurski, D. G. Guiney, D. Haas, D. R. Helinski, H. Schwab, V. A. Stanisich and C. M. Thomas, J M B 239, 623 (1994). 26. G . Ziegelin, W. Pansegrau, B. Strack, D. Balzer, M. Kroger, V. Kruft and E. Lanka, DNA Seq. J. 1, 303 (1991). 27. W. Pansegrau and E. Lanka, NARes 15, 2385 (1987). 28. L. Miele, B. Strack, V. Kruft and E. Lanka, DNA Seq. J. 2, 145 (1991). 29. M. Lessl, D. Balzer, K. Weyrauch and E. Lanka, J. B u t . 175, 6415 (1993). 30. V. L. Waters, B. Strack, W. Pansegrau, E. Lanka and D. 6. Guiney, J. Bact. 174, 6666 (1992). 31. D. Balzer, W. Pansegrau and E. Lanka, J. Bact. 176, 4285 (1994). 32. M. L e d , D. Balzer, R. Lurz, V. L. Waters, D. G . Guiney and E. Lanka, J. B u t . 174, 2493 (1992). 33. G. Jagura-Burdzy, F. Khanim, C. A. Smith and C. M. Thomas, NARes 20, 3939 (1992). 34. V. J. Thomson, 0. S. Jovanovic, R. F. Pohlman, C. H. Chang and D. H. Figurski, J. Bact. 175, 2423 (1993). 35. D. G. Guiney and E. Yakobson, PNAS 80, 3595 (1983). 1. 2. 3. 4.

248

WERNER PANSEGRAU AND ERICH LANKA

36. J. P. Fiirste, W. Pansegrau, G. Ziegelin, M. Kroger and E. Lanka, PNAS 86, 1771 (1989). 37. E. Lanka, R. Lurz, M. Kroger and J. P. Fiirste, MGG 194, 65 (1984). 38. S. P. Cole, E. Lanka and D. G. Guiney, J. Bact. 175, 4911 (1993). 39. J. A. Kornacki, P. J. Balderes and D. H. Figurski, J M B 198, 211 (1987). 40. D. Balzer, G. Ziegelin, W. Pansegrau, V. Kruft and E. Lanka, NARes 20, 1851 (1992). 41. D. R. Williams, M. Motallebi-Veshareh and C. M. Thomas, NARes 21, 1141 (1993). 42. M. Zatyka, G. Jagura-Burdzy and C. M. Thomas, Microbiology 140, 2981 (1994). 43. 6. Jagura-Burdzy and C. M. Thomas, PNAS 91, 10571 (1994). 44. D. Balzer, Ph. D. Dissertation, Freie Universitat Berlin (1993). 45. B. D. Theophilus and C. M. Thomas, NARes 15, 7443 (1987). 46. M. Lessl, D. Balzer, W. Pansegrau and E. Lanka, JBC 267, 20471 (1992). 47. G. Ziegelin, W. Pansegrau, R. Lurz and E. Lanka, JBC 267, 17279 (1992). 48. V. L. Waters, K. H. Hirata, W. Pansegrau, E. Lanka and D. G. Guiney, PNAS 88, 1456 (1991).

49. G. Ziegelin, J. P. Fiirste and E. Lanka, JBC 264, 11989 (1989). 50. J. Haase, R. Lurz, A. M. Grahn, D. H. Bamford and E. Lanka,J. Bact. 177, 4779 (1995). 51. W. Pansegrau, Ph. D. Dissertation, Freie Universitat Berlin (1991). 52. W. Pansegrau, G. Ziegelin and E. Lanka, JBC 265, 10637 (1990). 53. H. Hiasa and K. J. Marians, JBC 269, 32655 (1994). 54. N. S. Willetts and C. Crowther, Genet. Res. 37, 311 (1981). 55. D. E. Bradley and T. Chaudhuri, in “Plasmids and Transposons. Environmental Effects and Maintenance Mechanisms” (C. Stuttard and K. Rozee, eds.), p. 335. Academic Press, New York, 1980. 56. E. Walker, M. Saraste, M . J. Runswick and N. J. Gay, EMBO J. 1, 945 (1982). 57. M. Lessl, W. Pansegrau and E. Lanka, NARes 20, 6099 (1992). 58. N. Willetts, MGG 180, 213 (1980). 59. M. M . Panicker and E. G . Minkley, Jr., JBC 267, 12761 (1992). 60. E. Cabezh, E. Lanka and F. de la Cruz, J. B a t . 176, 4455 (1994). 61. S . Okamoto, A. Toyoda Yamamoto, K. Ito, I. Takebe and Y. Machida, MGG 228,24 (1991). 62. A. Beijersbergen, A. Den Dulk-Ras, R. A. Schilperoort and P. J. J. Hooykaas, Science 256, 1324 (1992).

63. P. T. Barth, M. J. Grinter and D. E. Bradley, J . Bact. 133, 43 (1978). 64. M. Lessl, V. Krishnapillai and W. Schilf, MGG 227, 120 (1991). 65. D. Lyras, A. W. Chan, J. McFarlane and V. A. Stanisich, Plasmid 32, 254 (1994). 66. R. F. Pohlman, H. D. Genetti and S. C. Winans, Plasmid 31, 158 (1994). 67. S. Sukupolvi and C. D. O’Connor, Microbiol. Reu. 54, 331 (1990). 68. N. B. Perumal and J. E. G. Minkley, JBC 259, 5357 (1984). 69. Deleted in proof. 70. K. Shirasu, Z. Koukolfkovi-Nicola, B. Hohn and C. I. Kado, Mol. Microbiol. 11, 581 (1994).

71. P. J. Christie, J. E. Ward, Jr., M. P. Gordon and E. W. Nester, PNAS 86, 9677 (1989). 72. S. T. Fong and V. A. Stanisich, J . Gen. Microbiol. 135, 499 (1989). 73. E. Lanka and J. P. Fiirste, in “Proteins Involved in DNA Replication” (U. Hiibscher and S. Spadari, eds.), p. 265. Plenum, New York and London, 1984. 74. W. Pansegrau, D. Balzer, V. Kruft, R. Lurz and E. Lanka, PNAS 87, 6555 (1990). 75. M. Motallebi-Veshareh, D. Balzer, E. Lanka, G. Jagura-Burdzy and C. M. Thomas, Mol.

Microbiol. 6, 907 (1992).

76. Y. R. Thorstenson, G. A. Kuldau and P. C. Zambryski, J. B a t . 175, 5233 (1993). 77. P. J. Christie, J. E. Ward, Jr., M. P. Gordon and E. W. Nester, PNAS 86, 9677 (1989). 78. J. P. Fiirste, G. Ziegelin, W. Pansegrau and E. Lanka, in “Mechanisms of DNA Replica-

BACTERIAL CONJUGATION

249

tion and Recombination” (T. Kelly and R. McMacken, eds.), p. 553. Alan R. Liss, New York, 1987. 79. M. Bhattacharjee, X. M. Rao and R. J. Meyer, J. Bact. 174, 6659 (1992). 80. W. Pansegrau, G. Ziegelin and E. Lanka, BBA 951, 365 (1988). 81. W. Pansegrau, W. Schroder and E. Lanka, PNAS 90, 2925 (1993). 82. S. W. Matson, W. C. Nelson and B. S. Morton, J . B u t . 175, 2599 (1993). 83. P. Scheiffele, W. Pansegrau and E. Lanka, JBC 270, 1269 (1995). 84. W. Pansegrau, F. Schoumacher, B. Hohn and E. Lanka, PNAS 90, 11538 (1993). 85. S. W. Matson and B. S. Morton, JBC 266, 16232 (1991). 86. U . Reygers, R. Wessel, H. Muller and H. Hoffmann-Berling, EMBO J . 10, 2689 (1991). 87. J. A. Sherman and S. W. Matson, J B C 269, 26220 (1994). 88. S. Inamoto, H. Fukuda, T. Abo and E. Ohtsubo, J . Biochem. 116, 838 (1994). 89. E. Scherzinger, R. Lurz, S. Otto and B. Dobrinski, NARCS20, 41 (1992). 90. E. Scherzinger, V. Kruft and S. Otto, EJB 217, 929 (1993). 91. A. Kingsman and N. Willetts, JMB 122, 287 (1978). 92. A. D. M. van Mansfeld, H. A. A. M. vanTeeffelen, P. D. BaasandH. S. Jansz, NARCS14, 4229 (1986). 93. R. Hanai and J. C. Wang, JBC 268, 23830 (1993). 94. A. Rasooly, P. Z. Wang and R. P. Novick, E M B O J . 13, 5245 (1994). 95. Q . Gao, Y. Luo and R. C. Deonier, Mol. Microbiol. 11, 449 (1994). 96. W. Pansegrau, W. Schroder and E. Lanka, JBC 269, 2782 (1994). 97. T. V. Ilyina and E. V. Koonin, NARes 20, 3279 (1992). 98. E. V. Koonin and T. V. Ilyina, BioSystem 30, 241 (1993). 99. J. Lee, M.-C. Serre, S.-H. Yang, I. Whang, H. Araki, Y. Oshima and M. Jayaram, J M B 228, 1091 (1992). 100. D. G. Guiney, C. Deiss, V. Simnad, L. Yee, W. PansegrauandE. Lanka,J. Bact. 171, 100 (1989). 101. E. Yakobson and D. G. Guiney, MGG 192, 436 (1983). 102. S. S. Ner, A. A. Travers and M. E. Churchill, Trends Biochem. Sci. 19, 185 (1994). 103. D. B. Clewell and D. R. Helinski, PNAS 62, 1159 (1969). 104. S. Inamoto, Y. Yoshioka and E. Ohtsubo, JBC 266, 10086 (1991). 105. N. Furuya and T. Komano, J . Bact. 173, 6612 (1991). 106. P. Mazodier, R. Petter and C. Thompson, J . Bact. 171, 3583 (1989). 107. C. G. Murphy and M. H. Malamy, J. Bact. 177, 3158 (1995). 108. M. Llosa, 6 . Grandoso and F. d e la Cruz, J M B 246, 54 (1995). 109. F. Diirrenberger, A. Crameri, 8. Hohn and Z. Koukolikova-Nicola, PNAS 86, 9154 (1989). 110. A. Kornberg and T. A. Baker, in “DNA Replication,” p. 275. Freeman, New York, 1992. 111. E. Lanka, E. Scherzinger, E. Gunther and H. Schuster, PNAS 76, 3632 (1979). 112. B. M. Wilkins, C . J. Boulnois and E. Lanka, Nature 290, 217 (1981). 113. E. Lanka and P. T. Barth, J. Bact. 148, 769 (1981). 114. B. Strack, M. Lessl, R. Calendar and E. Lanka, JBC 267, 13062 (1992). 115. W. Pansegrau and E. Lanka, NARes 20, 4931 (1992). 116. G. Ziegelin, E. Scherzinger, R. Lurz and E. Lanka, E M B O J .12, 3703 (1993). 117. 6. Ziegelin, N. A. Linderoth, R. Calendar and E. Lanka, J . Bact. 177, 4333 (1995). 118. A. Merryweather, C. E. Rees, N. M. Smith and 8 . M. Wilkins, EMBOJ. 5, 3007 (1986). 119. C. E. Rees and B. M. Wilkins, Mol. Microbiol. 4, 1199 (1990). 120. L. S. Frost, in “Bacterial Conjugation” (D. B. Clewell, ed.), p. 189. Plenum, New York, 1993. 121. D. B. Clewell, Cell 73, 9 (1993).

250

WERNER PANSEGRAU AND ERICH LANKA

122. J. Rohrer and D. E. Rawlings, J. B a t . 174, 6230 (1992). 123. T. Komano, A. Toyoshima, K. Morita and T. Nishioka, J. Bact. 170, 4385 (1988). 124. P. Zambryski, A. Depicker, K. Kruger and H. M. Goodman, J. Mol. Appl. Genet. 1,361 (1982). 125. P. M. Cannon and P. Strike, P l m i d 27, 220 (1992). 126. R. Thompsom, L. Taylor, K. Kelly, R. Everett and N. Willetts, EMBOJ. 3, 1175 (1984). 127. A. Goldner, H. Graus and G. Hogenauer, Plasmid 18, 76 (1987). 128. S. A. McIntire and W. B. Dempsey, J. Bact. 169, 3829 (1987). 129. G. M. Coupland, A. M. C. Brown and N. S. Willetts, MGG 208, 219 (1987). 130. M. Llosa, S. Bolland and F. de la Cruz, MGG 226, 473 (1991). 131. P. Scholz, V. Haring, B. Wittmann-Liebold, K. Ashman, M. Bagdasarian and E. Scherzinger, Gene 75, 271 (1989). 132. M. A. Brasch and R. J. Meyer, J . B a t . 167, 703 (1986). 133. M. Drolet, P. Zanga and P. C. Lau, Mol. Microbiol. 4, 1381 (1990). 134. D. M. Cook and S. K. Farrand, J, B a t . 174, 6238 (1992). 135. A. Bernardi and F. Bernardi, NARes 12, 9415 (1984). 136. A. Wang and F. L. Macrina, J. Bact. 177, 4199 (1995). 137. D. Bastia, J M B 124, 601 (1978). 138. J. Morlon, M. Chartier, M. Bidaud and C. Lazdunski, MGG 211, 231 (1988). 139. W. Pansegrau and E. Lanka, NARes 19, 3455 (1991). 140. V. L. Waters and D. G. Guiney, Mol. Microbiol. 9, 1123 (1993). 141. S. Hironouchi and B. Weisblum, J. B a t . 150, 815 (1982). 142. T. McKenzie, T. Hoshino, T. Tanaka and N. Sueoka, Plasmid 15, 93 (1986). 143. F. Sanger, G. M. Air, B. 6. Barrell, N . L. Brown, A. R. Coulson, J. C. Fiddes, C. A. Hutchison, P. M. Slocombe and M. Smith, Nature 265, 687 (1977). 144. J, Sinis, D. Capon and D. Dressler, J S C 254, 12615 (1979). 145. G. N. Godson, B. G. Barrell, R. Staden and J. C. Fiddes, Nature 276, 236 (1978). 146. F. Heidekamp, P. D. Baas and H. S. Jansz, J. Virol. 42, 91 (1982). 147. A. Gielow, L. Diederich and W. Messer, J. B a t . 173, 73 (1991). 148. M. F. Yanofsky, S. 6. Porter, C. Young, L. M. Albright, M. P. Gordon and E. W. Nester, Cell 47, 471 (1986). 149. M. F. Yanofsky and E. W. Nester, J. B a t . 168, 244 (1986). 150. E. V. Koonin and T. V. Ilyina, J. Gen. Virol. 73, 2763 (1992). 151. I. Hwang, P. L. Li, L. Zhang, K. R. Piper, D. M. Cook, M. E. Tate and S. K. Farrand, PNAS 91, 4639 (1994). 152. J. E. Ward, D. E. Akiyoshi, D. Regier, A. Datta, M. P. Gordon and E. W. Nester,JBC 263, 5804 (1988). 153. R. F. Pohlman, H. D. Genetti and S. C. Winans, Mol. Microbiol. 14, 655 (1994). 154. A. A. Weiss, F. D. Johnson and D. L. Burns, PNAS 90, 2870 (1993). 155. C. G. Murphy and M. H. Malamy, J. Bact. 175, 5814 (1993). 156. L.-Y. Li, N. B. Shoemaker, (2.-R. Wang, S. P. Cole, M. K. Hashimoto, J. Wang and A. A. Salyers, J. Bact. 177, 3940 (1995). 157. N. Firth, K. P. Ridgway, M. E. Byrne, P. D. Fink, L. Johnson, I. T. Paulsen and R. A. Skurray, Gene 136, 13 (1993). 158. T. M. Morton, D. M. Eaton, J. L. Johnston and G. L. Archer, J. Bact. 175, 4436 (1993). 159. M. Bayer, R. Eferl, G. Zellnig, A. Teferle, A. Dijkstra, G. Koraimann and G. Hogenauer, J. Bact. 177, 4279 (1995). 160. P. C. Zambryski, Annu. Reu. Plant Physiol. Plant Mol. B i d . 43, 465 (1992). 161. V Citovsky, M. L. Wong and P. Zambryski, PNAS 86, 1193 (1989). 162. V. Citovsky, D. Warnick and P. Zambryski, PNAS 91, 3210 (1994).

BACTERIAL CONJUGATION

163. 164. 165. 166. 167. 168. 169. 170. 171. 172. 173. 174. 175. 176. 177. 178. 179. 180. 181. 182. 183. 184.

251

C. Young and E. W. Nester, ]. B a t . 170, 3367 (1988). E. A. Howard, B. A. Winsor, G. De Vos and P. Zambryski, PNAS 86, 4017 (1989). B. Tinland, B. Hohn and H. Puchta, PNAS 91, 8000 (1994). A. M. Vogel and A. Das, ]. Bact. 174, 303 (1992). F. Jasper, C. Koncz, J. Schell and H.-H. Steinbiss, PNAS 91, 694 (1994). B. Tinland, F. Schoumacher, V. Gloeckler, A. M. Bravo-Angel and B. Hohn, EMBO]. 14, 3585 (1995). N . Toro, A. Datta, 0. A. Carmi, C . Young, R. K. Prusti and E. W. Nester, j . Bact. 171, 6845 (1989). K. Shirasu and C. I. Kado, FEMS Microbiol. Lett. 111, 287 (1993). A. Covacci and R. Rappuoli, Mol. Microbiol. 8, 429 (1993). S. Bolland, M. Llosa, P. Avila and F. de la Cruz, ]. B u t . 172, 5795 (1990). D. V. Thompson, L. S. Melchers, K. B. Idler, R. A. Schilperoort and P. J. Hooykaas, NARes 16, 4621 (1988). G. A. Kuldau, G . De Vos, J. Owen, G. McCafkey and P. Zambryski, MGG 221, 256 (1990). K. Shirasu, P. Morel and C. I. Kado, MoZ. Microbiol. 4, 1153 (1990). M. Bally, A. Filloux, M. Akriin, C . Ball, A. Lazdunskiand J. Tommassen, Mol. Microbiol. 6, 1121 (1992). M. Albano, R. Breitling and D. A. Dubnau, ]. B a t . 172, 5386 (1989). 0. Possot, C. dEnfert, I. Reyss and A. P. Pugsley, Mol. Microbiol. 6, 95 (1992). F. Dums, J. M. Dow and M . J. Daniels, MGG 229, 357 (1991). M. Lindherg and A. Collmer, J . B u t . 174, 7385 (1992). B. Jiang and S. P. Howard, Mol. Microbiol. 6, 1351 (1992). D. Nunn, S. Bergman and S. Lory,]. Bmt. 172, 2911 (1990). M. Abdel-Monem, G . Taucher-Scholz and M. Q. Klinkert, PNAS 80, 4659 (1983). G. Grandoso, M. Llosa, J. C. Zabala and F. de la Cruz, E]B 226, 403 (1994).