- Email: [email protected]
EPHX1 Y113H polymorphism is associated with increased risk of chronic obstructive pulmonary disease in Kazakhstan population
Mutation Research 816 (2017) 1–6
Contents lists available at ScienceDirect
Mutation Research/Genetic Toxicology and Environmental Mutagenesis journal homepage: www.elsevier.com/locate/gentox Community address: www.elsevier.com/locate/mutres
EPHX1 Y113H polymorphism is associated with increased risk of chronic obstructive pulmonary disease in Kazakhstan population Almira Akparova a,∗ , Balkiya Abdrakhmanova a , Nilanjana Banerjee b,∗ , Rakhmetkazhy Bersimbaev a a b
Department of General Biology and Genomics, L.N. Gumilyov Eurasian National University, 2, Satpayev str., Astana, 010008, Kazakhstan Cell Biology and Physiology Division, CSIR-Indian Institute of Chemical Biology, 4, Raja S. C. Mullick Road, Kolkata,700032, India
a r t i c l e
i n f o
Article history: Received 24 August 2016 Received in revised form 30 January 2017 Accepted 21 February 2017 Available online 22 February 2017 Keywords: COPD EPHX1 Kazakhstan Polymorphism
a b s t r a c t Chronic obstructive pulmonary disease (COPD) is a type of obstructive lung disease characterized by long term poor airflow which worsens over time. It is considered to be one of the top five chronic diseases of the world in terms of morbidity and mortality. Genetic variability has been found to contribute to the development of COPD. Although association between gene polymorphisms in EPHX1 and TNF-a genes and chronic obstructive pulmonary disease (COPD) have been found but till date no genetic association studies have been done in the COPD affected Kazakhstan population. The aim of the present work was to investigate the association between the Y113H polymorphism (rs1051740) in EPHX1 gene and −308G/A polymorphism (rs1800629) in TNF-a gene and COPD in Kazakhstan population. A case-control study was conducted in Astana and Akmola regions of Kazakhstan, involving 55 cases with COPD and 52 healthy individuals who served as the controls. The polymorphisms were determined using conventional PCR and Sanger sequencing method. Results show that for the EPHX1 gene Y113H polymorphism, the presence of an “C” allele (TC/CC genotype) was significantly overrepresented in the COPD patients compared to the controls. For the TNF-a gene −308G/A polymorphism, no significant difference was found between the two groups. Thus we found that, Y113H polymorphism in EPHX1 gene contributed to increased susceptibility to COPD in the Kazakhstan population. © 2017 Elsevier B.V. All rights reserved.
1. Introduction Chronic obstructive pulmonary disease (COPD) is characterized by the development of airflow limitation that is progressive and not fully reversible [1]. It is considered as the fourth leading cause of death in the world [2]. Cigarette smoking has been proposed as the most important environmental risk factor associated with the development of COPD [3,4]. Not only that, susceptibility to COPD, also depends on various factors such as inflammatory cytokines, proteases, antiproteases, oxidoreductases, and detoxifying enzymes. Increasing oxidative stress is also a key factor in the pathogenesis of COPD. In general, our body has a perfect enzymatic and nonenzymatic antioxidation system to cope with oxidative stress and protect the body from attack by oxidants thus fighting against the oxidative damage caused by oxidative stress, and eventually maintaining the dynamic balance of oxidation/antioxidation
∗ Corresponding authors. E-mail addresses: [email protected] (A. Akparova), [email protected] (N. Banerjee). http://dx.doi.org/10.1016/j.mrgentox.2017.02.004 1383-5718/© 2017 Elsevier B.V. All rights reserved.
in the body. The main known oxidation inhibition enzymes in the body including glutathione-S-transferase, microsomal epoxide hydrolase (EPHX1), and heme oxygenase, hydrolyze and inactivate oxygen metabolites. When the production of oxidation inhibitors is decreased or their activity is diminished as a result of genetic variation, the dynamic balance of oxidation/antioxidation is lost, leading to oxidative damage [5]. Thus genetic variation play important role in developing COPD as well. Microsomal epoxide hydrolase (EPHX1) plays an important role in the metabolism of highly reactive epoxide intermediates formed in cigarette smoke. A meta-analysis of 16 studies showed that the EPHX1 113 mutant homozygote was significantly associated with an increased risk of COPD [6]. The meta-analysis of 19 studies on COPD patients and healthy controls showed limited variation among Y113H heterozygotes and homozygotes or A139G to define the risk of the disease [7]. However, an association study on Danish individuals did not find the association among patients with COPD diagnosed by spirometry, the EPHX1 genotypes or phenotypes, or in smokers or non-smokers, respectively [7]. Another gene polymorphism that has been associated with COPD in various other studies is −308G/A change in the TNF-a gene [8]. Elsewhere, in a
2
A. Akparova et al. / Mutation Research 816 (2017) 1–6
meta analysis it was reported that in 24 studies done between 1966 and 2009 a significant association was found between increased risk of development of COPD and −308G/A polymorphism in TNF-a [9], therefore this can also be considered as an important contender imparting genetic susceptibility towards COPD development. Although, there has been several studies dealing with the association of gene polymorphisms in EPHX1 and TNF-a genes but till date no genetic association studies have been done in the COPD affected Kazakhstan population. So, in the present study we aim to find the association between the Y113H and −308G/A polymorphisms in the EPHX1 and TNF-a genes, with COPD in the same population.
Council (mMRC) scale for an assessment of breathlessness. None of the patients had a previous history of other cancers, chemotherapy, or radiotherapy. The cases and controls were matched with respect to their age and gender status. Basic characteristics of the participants: age, sex, smoking status, nationality, and forced expiratory volume in 1 s (FEV1)/forced volume capacity, the degree of airflow limitation are listed in Table 1. 2.2. Collection of blood samples and DNA isolation Blood samples were collected from all study participants by vein puncture method, and DNA extraction from blood was carried out using standard phenol chloroform method [10].
2. Materials and methods 2.1. Study sites and study participants 55 patients with chronic obstructive pulmonary disease (cases) and 52 normal healthy individuals (controls) from Kazakhstan were recruited for the study. The study participants were mainly from Astana region and a few were from Akmola region of Kazakhstan. All patients and controls were living in Kazakhstan between 2011 and 2015. COPD patients were hospitalized in Hospital №2 of Astana. Blood samples, from COPD patients (cases) and the control group were collected within 2 years (from October 2013 to December 2015). Written informed consent was obtained from each of the study participant. The control group consisted of the staff of the hospital and Eurasian National University. They were matched with respect to age and gender status with the cases. Majority of the controls were non-smokers unlike that of the cases. These individuals did not have any history of allergy, pulmonary, endocrinological, metabolic, or nutritional disorders. The COPD group consisted of 93% Kazakhs and 7% Russians. The control group consisted of 96% Kazakhs and 4% Russians. COPD was diagnosed according to the criteria established by Global Initiative for Chronic Obstructive Lung Disease (GOLD), was used validated questionnaire the COPD Assessment Test (CAT) for assessment of symptoms and the modified British Medical Research
2.3. EPHX1 Y113H and TNF-a −308G/A polymorphism genotyping SNPs at positions Y113H in EPHX1 (rs1051740) and −308 in TNFa (rs1800629) were determined by conventional PCR-sequencing method. PCR was performed in a 25 ul reaction volume using standard buffer, MgCl2 (1.5 mM), deoxyribonucleotides (200uM), and Taq polymerase supplied by Takara (Otsu, Shiga, Japan) with the following primers—for TNF-a, PCR was carried out with the following primers: TNF-a (forward), 5#-GCCCCTCCCAGTTCTAGTTC-3# and TNF-a (reverse), 5#-AAAGTTGGGGACACACAAGC-3# (Integrated DNA technologies, IDT, Coralville, Iowa, United States) to generate a 248 bp product. Cycling was performed in Eppendorf Mastercycler (Hamburg, Germany) as follows: a pre-PCR step of 5 min denaturation at 94 ◦ C, followed by 30 cycles of 30 s denaturation at 94 ◦ C, 30 s annealing at 58 ◦ C, 30 s extension at 72 ◦ C, and finally 5 min incubation at 72 ◦ C. For EPHX1 gene, PCR was carried out with the following primers: EPHX1 (forward), 5#-GATCGATAAGTTCCGTTTCACC -3# and EPHX1 (reverse), 5#- ATCTTAGTCTTGAAGTGAGGAT -3# (IDT, Coralville, Iowa, United States) to generate a 165 bp product. Cycling was performed as follows: a pre-PCR step of 7 min denaturation at 94 ◦ C,
Table 1 Demographic and clinical characteristics of the study participants. Parameters
Control group
COPD group
Number of study participants (N) Age in years Mean ± SD
52 53.27 ± 6.17
55 53.81 ± 9.00
Male (N)
27 (51.92)
29 (52.73)
Female (N) Smoking status
25 (48.08) 6 (11.5)
26 (47.27) 37 (67.27)
Nonsmokers (N, %) Pack-year
46 (88.5) 1,3 ± 0,5
18 (32.73) 20,6± 7,9
FEV1 (%)
94,6 (±8,2)
61,02 (±18,1)
FEV1 /FVC
0,8 (±0,03)
0,67 (±0,13)
*
p value when compared to the control group.
*
p values
p > 0.05 t = 0.049 1.00 > p > 0.5 Students T-test p > 0.05 2 = 0.01 p = 0,93 Male OR = 0.97 (0.45–2.07) Female OR = 1.03 (0.48–2.21) Chi-square test p < 0.001 2 = 34.54 p = 4.OE-9 Smoking status Chi-square test p < 0.05 t = 2.4 0.01 < p < 0.05 Students T-test p > 0.05 t = 1.69 0.1 > p > 0.05 Students T-test p > 0.05 t = 0.96 0.4 > p > 0.3 Students T-test
A. Akparova et al. / Mutation Research 816 (2017) 1–6
3
Table 2 Spiro metric parameters of COPD patients.
Number of COPD patients (%) FEV1, % FEV1/FVC
GOLD1
GOLD2
GOLD3
GOLD4
8 (14,5) 93,3 ± 6,2 0,69 ± 0,001
24 (43,6) 67,1 ± 9,7 0,64 ± 0,02
17 (30,9) 48,4 ± 1,3 0,68 ± 0,01
6 (10,9) 29,4 ± 0,1 0,67 ± 0,03
followed by 30 cycles of 30 s denaturation at 94 ◦ C, 30 s annealing at 56 ◦ C, 30 s extension at 72 ◦ C, and finally 5 min incubation at 72 ◦ C. All PCR products were analyzed by polyacrylamide gel (6%) electrophoresis, stained with ethidium bromide, and photographed under UV. Bidirectional sequencing following Sanger method was carried out by Eurofins Genomics India Pvt. Ltd., Bangalore, India. Samples with ambiguous chromatograms were subjected to a second, independent round of amplification, followed by DNA sequencing, and obtained chromatograms were analyzed with Chromas 2.32 (Technelysium Pty Ltd, Tewantin, Australia). 2.4. Statistical analysis Students’ unpaired T-test was performed to calculate statistically significant difference of age between the two study groups. Chi-square test was used to compare the distribution of gender and tobacco usage status between the two study groups. Odds ratio (OR), 95% confidence intervals, and two-tailed p values were calculated for assessing the risk of the variant genotype towards the development of skin lesions and health effects. Microsoft Excel and GraphPad InStat3 Software (Graphpad Software Inc., San Diego, CA) were used for the purpose. 3. Results 3.1. Demographic characteristics of the study participants A total of 107 study participants from Astana and Akmola regions of Kazakhstan were recruited for this study. The study participants consisted of 55 individuals with COPD and 52 healthy individuals who served as the control. The demographic characteristic of the study participants are summarized in Table 1. Results show that there are no significant differences in the age or gender distribution patterns between the COPD patients and the control groups. However the smoking status varied significantly between the cases and the controls. According to chest X-ray and computed tomography, emphysema was diagnosed in 21.8% of COPD patients, chronic bronchitis −78%, pneumonia −10.9%. The study group included 9.1% of patients with asthma-COPD overlap syndrome (ACOS). It is defined as an FEV1/FVC ratio 0.7 plus a history of self-reported wheeze, and having a self-reported physician diag-
nosis of both asthma and COPD. The spirometric results are shown in Table 2. 3.2. Association of polymorphisms in EPHX1 and TNF-alpha genes with COPD The genotype frequencies in the control and case groups are shown in Table 3. Our results show that for EPHX1 gene Y113H SNP, the presence of an “C” allele (TC/CC genotype) was significantly overrepresented [Odds ratio: 3.186 (1.428–7.110)] in the COPD patients (cases) compared to the controls. The distribution of the alleles follows the Hardy-Weinberg-Equilibrium for EPHX1 Y113H. For the TNF-a gene (-308G/A) SNP, the presence of the A allele was not significantly overrepresented in the cases compared to the control. Figs. 1 and 2 show the representative chromatograms of the different study groups for EPHX1 Y113H SNP and TNF-a (308G/A) SNP respectively. The distribution of the alleles follows the Hardy-Weinberg-Equilibrium for TNF-a (-308G/A) also as shown below: The distribution of the alleles follows the Hardy-WeinbergEquilibrium for EPHX1 Y113H following the formula p2 + 2pq + q2 = 1: 0.44 × 0.44 + 2 × 0.44 × 0.56 + 0.56 × 0.56 = 1 and 0.71 × 0.71 + 2 × 0.71 × 0.29 + 0.29 × 0.29 = 1, for the cases and control groups respectively. The distribution of the alleles follows the Hardy-WeinbergEquilibrium also for TNF-a (−308G/A) following the formula p2 + 2pq + q2 = 1: 0.67 × 0.67 + 2 × 0.67 × 0.33 + 0.33 × 0.33 = 1 and 0.69 × 0.69 + 2 × 0.69 × 0.31 + 0.31 × 0.31 = 1, for the cases and control groups respectively. 4. Discussion Chronic obstructive pulmonary disease (COPD), comprised of pulmonary emphysema, chronic bronchitis, and structural and inflammatory changes of small airways, is a leading cause of morbidity and mortality in the world. Several gene polymorphisms have been previously associated with chronic obstructive pulmonary disease. Among them, SNPs of EPHX1 and TNF-alpha genes are important contenders which have been found to be strongly associated with COPD in different study populations. So in the present study we aim to identify whether any association exist between Y113H polymorphism in EPHX1 and −308G/A polymor-
Table 3 Association of EPHX1 Y113H and TNF-a (−308G > A) polymorphisms with COPD. Genotype
Control N (%)
COPD N (%)
OR (95% CI)
p values
EPHX1 (Y113H) TT TC CC TC/CC
37 (71.15%) 12 3 15 (28.85%)
24 (43.64%) 23 8 31 (56.36%)
1.00 (Reference) 2.95 (1.24–7.031) 4.11 (0.99–17.063) 3.186 (1.428–7.110)
0.0192* 0.0523 0.0060*
TNF-a (−308G/A) GG GA AA GA/AA
36 (69.23%) 14 2 16 (30.77%)
37 (67.27%) 13 5 18 (32.73)
1.00 (Reference) 0.90 (0.37–2.19) 2.43 (0.44–13.36) 1.095 (0.48–2.47)
0.9035 0.436 0.8388
Note: OR: Odds Ratio; CI: Control Interval. * p < 0.05.
4
A. Akparova et al. / Mutation Research 816 (2017) 1–6
Fig. 1. Representative chromatogtams showing three different genotypes of the study participants for the EPHX1 Y113H SNP.
phism in TNF-a genes with COPD in an affected population of Kazakhstan. The pathobiology of COPD encompasses multiple injurious processes including inflammation, cellular apoptosis, altered cellular and molecular alveolar maintenance program, abnormal cell repair, extracellular matrix destruction and oxidant and antioxidant imbalance. These processes are triggered by active and/or passive cigarette smoke and modified by cellular senescence and infection. A series of receptor-mediated signal transduction pathways are activated by reactive oxygen species and tobacco components, resulting in impairment of a variety of cell signaling and cytokine networks, subsequently leading to chronic airway responses with mucus production, airway remodeling, and alveolar destruction [11] .Cigarette smoking likely accounts for 80–90% of COPD cases in the United States [12]. Again studies have shown that passive smoking also contributes to COPD pathogenesis in significant number of individuals [11]. In our study population, majority of the COPD patients are current smokers while few are ex-smokers who have history of smoking for many years. For that reason the risk of development of COPD might have increased in them sig-
nificantly. Many toxins in cigarette smoke are metabolised in the liver. Among several detoxification enzyme microsomal epoxide hydrolase (EPHX1) have been studied intensely. EPHX1 SNPs have been found to be associated with its activity. The Y113H SNP have been found be associated with 40% decrease of the activity of EPHX1 and is often represented as the “slow” allele [13]. The slow activity phenotype was associated with increased risk of COPD in Asian population [8]. A strong correlation between the EPHX1 113 mutant homozygote and smoking related COPD was observed in the Taiwan population, and this genetic polymorphism was also associated with decreased bronchodilator response in COPD patients [14]. The investigation of association of EPHX1 polymorphisms to COPD in a Hungarian population showed, that the Y113H was not significantly associated with COPD even after adjusting the model for gender, age and pack-years in logistic regression [15]. An association study on Danish individuals did not find the association among patients with COPD diagnosed by spirometry, the EPHX1 genotypes or phenotypes, or in smokers or non-smokers, respectively [16]. In our study we have found that for Y113H polymorphism of the EPHX1 gene, the “C allele” was significantly overrepresented in the COPD
A. Akparova et al. / Mutation Research 816 (2017) 1–6
5
Fig. 2. Representative chromatogtams showing three different genotypes of the study participants for the TNF-a (−308G/A) SNP.
patients compared to the controls which are in agreement with the results of several previous studies as described above. The genomic polymorphism resulting in the nucleotide adenine (A) substitution for guanine (G) at position −308 in TNF-a gene was discovered in 1992. Since then, a large number of studies have been done, where an inconsistent association between COPD susceptibility and gene polymorphisms were observed. Earlier it was demonstrated association between polymorphism of GlutathioneS-transferase (GST) three genes GSTT1, GSTM1, GSTP1 and COPD development in Kazakh population [17]. In some studies a strong association was found between this polymorphism and COPD while in the others no such association was found between them [8]. It was found that −308 G/A polymorphism was found to be a risk factor for developing COPD in Asian populations but not among the Caucasions [18]. In another study Sakao et al. reported a strong association exsisted between this polymorphism and the COPD patients in a Japanese population [19]. In a Turkish population no significant difference in the frequency of G/G and G/A gene polymorphisms was found in the COPD group compared with control subjects (p > 0.05) [20]. However we also found no association with
−308G/A TNF-a polymorphism and COPD in our study population. This might be due to the fact that our study population was mostly of Caucasion origin and previous studies have reported that TNFa −308G/A polymorphism did not provide a risk in the Caucasion population as mentioned above. In meta-analysis study carried out by Li et al. [21], the analyses stratified by the cigarette smoking status of the controls showed that the increased risk of COPD was detected between the extremely slow enzyme activity and the subgroup with the non-smokers used as controls. Furthermore, the increased COPD risk of the slow enzyme activity was observed not only in the subgroup with the non-smokers as controls but also in the subgroup with the smokers and ex-smokers as controls, indicating that in addition to the polymorphisms in the genes associated with COPD, cigarette smoke is also an important contributor to the same.
5. Conclusion Thus in conclusion, we might say that the Y113H polymorphism in the EPHX1 gene is associated with COPD in the Kazakhstan pop-
6
A. Akparova et al. / Mutation Research 816 (2017) 1–6
ulation. Along with that, cigarette smoking increases the risk of development of COPD in them. More detailed study is required to understand the gene-environment interaction in imparting susceptibility to COPD in them. Acknowledgements This work has been supported by the program “Grant funding for research” № 0112RК02125 from the Ministry of Education and Science of the Republic of Kazakhstan to AA and RB and by Department of Science and Technology (DST), Govt of India, for providing DST-WOS-A Grant no: SR/WOSA/LS05/2014 to NB. The authors are extremely greatful to Dr A.K. Giri, Emeritus Scientist, Molecular Genetics Division, CSIR-Indian Institute of Chemical Biology, Kolkata, India, for providing laboratory space and facilities for doing the work in India. Thanks are also due to Dr. Suman Dutta, Molecular Genetics Division, CSIR-Indian Institute of Chemical Biology for his help and suggestions to carry out this work. We are grateful to Dr. Meyrzhan T. Abishev, the Head of Pulmonology Department of Hospital №2, Astana, Kazakhstan, for help in sample collection. References [1] K.F. Rabe, S. Hurd, A. Anzueto, P.J. Barnes, S.A. Buist, P. Calverley, et al., Global Initiative for Chronic Obstructive Lung Disease, global strategy for the diagnosis, management, and prevention of chronic obstructive pulmonary disease: GOLD executive summary, Am. J. Respir. Crit. Care Med. 176 (2007) 532–555, http://dx.doi.org/10.1164/rccm.200703-456SO. [2] R.A. Pauwels, K.F. Rabe, Burden and clinical features of chronic obstructive pulmonary disease (COPD), Lancet 364 (2004) 613–620, http://dx.doi.org/10. 1016/S0140-6736(04)16855-4. [3] A. Løkke, P. Lange, H. Scharling, P. Fabricius, J. Vestbo, Developing COPD: a 25 year follow up study of the general population, Thorax 61 (2006) 935–939, http://dx.doi.org/10.1136/thx.2006.062802. [4] B. Burrows, R.J. Knudson, M.G. Cline, M.D. Lebowitz, Quantitative relationships between cigarette smoking and ventilatory function, Am. Rev. Respir. Dis. 115 (1977) 195–205, http://dx.doi.org/10.1164/arrd.1977.115.2.195. [5] J. Zhang, J. Zhang, L. Liu, Z. Zhao, L.Z. Fang, L. Liu, et al., Effect of N-acetylcysteine in COPD patients with different microsomal epoxide hydrolase genotypes, Int. J. Chron. Obstr. Pulm. Dis. 10 (2015) 917–923, http://dx.doi.org/10.2147/COPD.S79710. [6] G. Hu, Z. Shi, J. Hu, G. Zou, G. Peng, P. Ran, Association between polymorphisms of microsomal epoxide hydrolase and COPD: results from meta-analyses, Respirology 13 (2008) 837–850, http://dx.doi.org/10.1111/j. 1440-1843.2008.01356.x. [7] J. Lee, B.G. Nordestgaard, M. Dahl, EPHX1 polymorphisms COPD and asthma in 47,000 individuals and in meta-analysis, Eur. Respir. J. 37 (June (1)) (2011) 18–25, http://dx.doi.org/10.1183/09031936.00012110, Epub 2010.
[8] X. Wu, B. Yuan, E. López, C. Bai, X. Wang, Gene polymorphisms and chronic obstructive pulmonary disease, J. Cell. Mol. Med. 18 (2014) 15–26, http://dx. doi.org/10.1111/jcmm.12159. [9] P. Zhan, J. Wang, S.Z. Wei, Q. Qian, L.X. Qiu, L.K. Yu, et al., TNF-308 gene polymorphism is associated with COPD risk among Asians: meta-analysis of data for 6,118 subjects, Mol. Biol. Rep. 38 (2011) 219–227, http://dx.doi.org/ 10.1007/s11033-010-0098-y. [10] J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. [11] T. Yoshida, R.M. Tuder, Pathobiology of cigarette smoke-Induced chronic obstructive pulmonary disease, Physiol. Rev. 87 (2007) 1047–1082, http://dx. doi.org/10.1152/physrev.00048.2006. [12] J.M. Sethi, C.L. Rochester, Smoking and chronic obstructive pulmonary disease, Clin. Chest Med. 21 (2000) 67–86. [13] J.J. Heidelbaugh, Chronic Obstructive Pulmonary Disease: A Multidisciplinary Approach, 2015 https://books.google.co.in/books?isbn=0323428223. [14] Ch.-Z. Chen, R.-H. Wang, et al., Polymorphism of microsomal epoxide hydrolase is associated with chronic obstructive pulmonary disease and bronchodilator response, J. Formos. Med. Assoc. 110 (2011) 685–689, http:// dx.doi.org/10.1016/j.jfma.2011.09.003. [15] A. Penyige1, S. Poliska, E. Csanky, et al., Analyses of association between PPAR gamma and EPHX1 polymorphisms and susceptibility to COPD in a Hungarian cohort, a case-control study, BMC Med. Genet. 11 (2010) 152, http://dx.doi. org/10.1186/1471-2350-11-152. [16] J. Lee, B.G. Nordestgaard, M. Dahl, EPHX1 polymorphisms, COPD and asthma in 47,000 individuals and in meta-analysis, Eur. Respir. J. 37 (2011) 18–25, http://dx.doi.org/10.1183/09031936.00012110. [17] A.Yu. Akparova, Association between cytokines and xenobiotics detoxification genes polymorphism and susceptibility to asthma and COPD in Kazakh population, in: 3rd Asian Conference on Environmental Mutagens & 15th Conference of Chinese Environmental Mutagen Society, Hangzhou (China), 2012. [18] C. Patuzzo, L.S. Gilè, M. Zorzetto, E. Trabetti, G. Malerba, P.F. Pignatti, et al., Tumor necrosis factor gene complex in COPD and disseminated bronchiectasis, Chest 117 (2000) 1353–1358. [19] S. Sakao, K. Tatsumi, H. Igari, Y. Shino, H. Shirasawa, T. Kiruyama, Association of tumor necrosis factor a gene promoter polymorphism with the presence of chronic obstructive pulmonary disease, Am. J. Respir. Crit. Care Med. 163 (2001) 420–422, http://dx.doi.org/10.1164/ajrccm.163.2.2006031. [20] N. Özdo˘gana, N. Tutara, R. Demira, Saatc¸ib C¸etin, A. Kanbaya, H. Büyüko˘glanaa, Is TNF-agene polymorphism related to pulmonary functions and prognosis as determined by FEV1, BMI, COPD exacerbation and hospitalization in patients with smoking-related COPD in a Turkish population? Revista Portuguesa de Pneumologia 20 (2014) 305–310, http:// dx.doi.org/10.1016/j.rppneu.2014.03.003. [21] H. Li, W.P. Fu, Z.H. Hong, Microsomal epoxide hydrolase gene polymorphism and risk of chronic obstructive pulmonary disease: a comprehensive meta-analysis, Oncol. Lett. 5 (2013) 1022–1030, http://dx.doi.org/10.3892/ol. 2012.1099.
Contents lists available at ScienceDirect
Mutation Research/Genetic Toxicology and Environmental Mutagenesis journal homepage: www.elsevier.com/locate/gentox Community address: www.elsevier.com/locate/mutres
EPHX1 Y113H polymorphism is associated with increased risk of chronic obstructive pulmonary disease in Kazakhstan population Almira Akparova a,∗ , Balkiya Abdrakhmanova a , Nilanjana Banerjee b,∗ , Rakhmetkazhy Bersimbaev a a b
Department of General Biology and Genomics, L.N. Gumilyov Eurasian National University, 2, Satpayev str., Astana, 010008, Kazakhstan Cell Biology and Physiology Division, CSIR-Indian Institute of Chemical Biology, 4, Raja S. C. Mullick Road, Kolkata,700032, India
a r t i c l e
i n f o
Article history: Received 24 August 2016 Received in revised form 30 January 2017 Accepted 21 February 2017 Available online 22 February 2017 Keywords: COPD EPHX1 Kazakhstan Polymorphism
a b s t r a c t Chronic obstructive pulmonary disease (COPD) is a type of obstructive lung disease characterized by long term poor airflow which worsens over time. It is considered to be one of the top five chronic diseases of the world in terms of morbidity and mortality. Genetic variability has been found to contribute to the development of COPD. Although association between gene polymorphisms in EPHX1 and TNF-a genes and chronic obstructive pulmonary disease (COPD) have been found but till date no genetic association studies have been done in the COPD affected Kazakhstan population. The aim of the present work was to investigate the association between the Y113H polymorphism (rs1051740) in EPHX1 gene and −308G/A polymorphism (rs1800629) in TNF-a gene and COPD in Kazakhstan population. A case-control study was conducted in Astana and Akmola regions of Kazakhstan, involving 55 cases with COPD and 52 healthy individuals who served as the controls. The polymorphisms were determined using conventional PCR and Sanger sequencing method. Results show that for the EPHX1 gene Y113H polymorphism, the presence of an “C” allele (TC/CC genotype) was significantly overrepresented in the COPD patients compared to the controls. For the TNF-a gene −308G/A polymorphism, no significant difference was found between the two groups. Thus we found that, Y113H polymorphism in EPHX1 gene contributed to increased susceptibility to COPD in the Kazakhstan population. © 2017 Elsevier B.V. All rights reserved.
1. Introduction Chronic obstructive pulmonary disease (COPD) is characterized by the development of airflow limitation that is progressive and not fully reversible [1]. It is considered as the fourth leading cause of death in the world [2]. Cigarette smoking has been proposed as the most important environmental risk factor associated with the development of COPD [3,4]. Not only that, susceptibility to COPD, also depends on various factors such as inflammatory cytokines, proteases, antiproteases, oxidoreductases, and detoxifying enzymes. Increasing oxidative stress is also a key factor in the pathogenesis of COPD. In general, our body has a perfect enzymatic and nonenzymatic antioxidation system to cope with oxidative stress and protect the body from attack by oxidants thus fighting against the oxidative damage caused by oxidative stress, and eventually maintaining the dynamic balance of oxidation/antioxidation
∗ Corresponding authors. E-mail addresses: [email protected] (A. Akparova), [email protected] (N. Banerjee). http://dx.doi.org/10.1016/j.mrgentox.2017.02.004 1383-5718/© 2017 Elsevier B.V. All rights reserved.
in the body. The main known oxidation inhibition enzymes in the body including glutathione-S-transferase, microsomal epoxide hydrolase (EPHX1), and heme oxygenase, hydrolyze and inactivate oxygen metabolites. When the production of oxidation inhibitors is decreased or their activity is diminished as a result of genetic variation, the dynamic balance of oxidation/antioxidation is lost, leading to oxidative damage [5]. Thus genetic variation play important role in developing COPD as well. Microsomal epoxide hydrolase (EPHX1) plays an important role in the metabolism of highly reactive epoxide intermediates formed in cigarette smoke. A meta-analysis of 16 studies showed that the EPHX1 113 mutant homozygote was significantly associated with an increased risk of COPD [6]. The meta-analysis of 19 studies on COPD patients and healthy controls showed limited variation among Y113H heterozygotes and homozygotes or A139G to define the risk of the disease [7]. However, an association study on Danish individuals did not find the association among patients with COPD diagnosed by spirometry, the EPHX1 genotypes or phenotypes, or in smokers or non-smokers, respectively [7]. Another gene polymorphism that has been associated with COPD in various other studies is −308G/A change in the TNF-a gene [8]. Elsewhere, in a
2
A. Akparova et al. / Mutation Research 816 (2017) 1–6
meta analysis it was reported that in 24 studies done between 1966 and 2009 a significant association was found between increased risk of development of COPD and −308G/A polymorphism in TNF-a [9], therefore this can also be considered as an important contender imparting genetic susceptibility towards COPD development. Although, there has been several studies dealing with the association of gene polymorphisms in EPHX1 and TNF-a genes but till date no genetic association studies have been done in the COPD affected Kazakhstan population. So, in the present study we aim to find the association between the Y113H and −308G/A polymorphisms in the EPHX1 and TNF-a genes, with COPD in the same population.
Council (mMRC) scale for an assessment of breathlessness. None of the patients had a previous history of other cancers, chemotherapy, or radiotherapy. The cases and controls were matched with respect to their age and gender status. Basic characteristics of the participants: age, sex, smoking status, nationality, and forced expiratory volume in 1 s (FEV1)/forced volume capacity, the degree of airflow limitation are listed in Table 1. 2.2. Collection of blood samples and DNA isolation Blood samples were collected from all study participants by vein puncture method, and DNA extraction from blood was carried out using standard phenol chloroform method [10].
2. Materials and methods 2.1. Study sites and study participants 55 patients with chronic obstructive pulmonary disease (cases) and 52 normal healthy individuals (controls) from Kazakhstan were recruited for the study. The study participants were mainly from Astana region and a few were from Akmola region of Kazakhstan. All patients and controls were living in Kazakhstan between 2011 and 2015. COPD patients were hospitalized in Hospital №2 of Astana. Blood samples, from COPD patients (cases) and the control group were collected within 2 years (from October 2013 to December 2015). Written informed consent was obtained from each of the study participant. The control group consisted of the staff of the hospital and Eurasian National University. They were matched with respect to age and gender status with the cases. Majority of the controls were non-smokers unlike that of the cases. These individuals did not have any history of allergy, pulmonary, endocrinological, metabolic, or nutritional disorders. The COPD group consisted of 93% Kazakhs and 7% Russians. The control group consisted of 96% Kazakhs and 4% Russians. COPD was diagnosed according to the criteria established by Global Initiative for Chronic Obstructive Lung Disease (GOLD), was used validated questionnaire the COPD Assessment Test (CAT) for assessment of symptoms and the modified British Medical Research
2.3. EPHX1 Y113H and TNF-a −308G/A polymorphism genotyping SNPs at positions Y113H in EPHX1 (rs1051740) and −308 in TNFa (rs1800629) were determined by conventional PCR-sequencing method. PCR was performed in a 25 ul reaction volume using standard buffer, MgCl2 (1.5 mM), deoxyribonucleotides (200uM), and Taq polymerase supplied by Takara (Otsu, Shiga, Japan) with the following primers—for TNF-a, PCR was carried out with the following primers: TNF-a (forward), 5#-GCCCCTCCCAGTTCTAGTTC-3# and TNF-a (reverse), 5#-AAAGTTGGGGACACACAAGC-3# (Integrated DNA technologies, IDT, Coralville, Iowa, United States) to generate a 248 bp product. Cycling was performed in Eppendorf Mastercycler (Hamburg, Germany) as follows: a pre-PCR step of 5 min denaturation at 94 ◦ C, followed by 30 cycles of 30 s denaturation at 94 ◦ C, 30 s annealing at 58 ◦ C, 30 s extension at 72 ◦ C, and finally 5 min incubation at 72 ◦ C. For EPHX1 gene, PCR was carried out with the following primers: EPHX1 (forward), 5#-GATCGATAAGTTCCGTTTCACC -3# and EPHX1 (reverse), 5#- ATCTTAGTCTTGAAGTGAGGAT -3# (IDT, Coralville, Iowa, United States) to generate a 165 bp product. Cycling was performed as follows: a pre-PCR step of 7 min denaturation at 94 ◦ C,
Table 1 Demographic and clinical characteristics of the study participants. Parameters
Control group
COPD group
Number of study participants (N) Age in years Mean ± SD
52 53.27 ± 6.17
55 53.81 ± 9.00
Male (N)
27 (51.92)
29 (52.73)
Female (N) Smoking status
25 (48.08) 6 (11.5)
26 (47.27) 37 (67.27)
Nonsmokers (N, %) Pack-year
46 (88.5) 1,3 ± 0,5
18 (32.73) 20,6± 7,9
FEV1 (%)
94,6 (±8,2)
61,02 (±18,1)
FEV1 /FVC
0,8 (±0,03)
0,67 (±0,13)
*
p value when compared to the control group.
*
p values
p > 0.05 t = 0.049 1.00 > p > 0.5 Students T-test p > 0.05 2 = 0.01 p = 0,93 Male OR = 0.97 (0.45–2.07) Female OR = 1.03 (0.48–2.21) Chi-square test p < 0.001 2 = 34.54 p = 4.OE-9 Smoking status Chi-square test p < 0.05 t = 2.4 0.01 < p < 0.05 Students T-test p > 0.05 t = 1.69 0.1 > p > 0.05 Students T-test p > 0.05 t = 0.96 0.4 > p > 0.3 Students T-test
A. Akparova et al. / Mutation Research 816 (2017) 1–6
3
Table 2 Spiro metric parameters of COPD patients.
Number of COPD patients (%) FEV1, % FEV1/FVC
GOLD1
GOLD2
GOLD3
GOLD4
8 (14,5) 93,3 ± 6,2 0,69 ± 0,001
24 (43,6) 67,1 ± 9,7 0,64 ± 0,02
17 (30,9) 48,4 ± 1,3 0,68 ± 0,01
6 (10,9) 29,4 ± 0,1 0,67 ± 0,03
followed by 30 cycles of 30 s denaturation at 94 ◦ C, 30 s annealing at 56 ◦ C, 30 s extension at 72 ◦ C, and finally 5 min incubation at 72 ◦ C. All PCR products were analyzed by polyacrylamide gel (6%) electrophoresis, stained with ethidium bromide, and photographed under UV. Bidirectional sequencing following Sanger method was carried out by Eurofins Genomics India Pvt. Ltd., Bangalore, India. Samples with ambiguous chromatograms were subjected to a second, independent round of amplification, followed by DNA sequencing, and obtained chromatograms were analyzed with Chromas 2.32 (Technelysium Pty Ltd, Tewantin, Australia). 2.4. Statistical analysis Students’ unpaired T-test was performed to calculate statistically significant difference of age between the two study groups. Chi-square test was used to compare the distribution of gender and tobacco usage status between the two study groups. Odds ratio (OR), 95% confidence intervals, and two-tailed p values were calculated for assessing the risk of the variant genotype towards the development of skin lesions and health effects. Microsoft Excel and GraphPad InStat3 Software (Graphpad Software Inc., San Diego, CA) were used for the purpose. 3. Results 3.1. Demographic characteristics of the study participants A total of 107 study participants from Astana and Akmola regions of Kazakhstan were recruited for this study. The study participants consisted of 55 individuals with COPD and 52 healthy individuals who served as the control. The demographic characteristic of the study participants are summarized in Table 1. Results show that there are no significant differences in the age or gender distribution patterns between the COPD patients and the control groups. However the smoking status varied significantly between the cases and the controls. According to chest X-ray and computed tomography, emphysema was diagnosed in 21.8% of COPD patients, chronic bronchitis −78%, pneumonia −10.9%. The study group included 9.1% of patients with asthma-COPD overlap syndrome (ACOS). It is defined as an FEV1/FVC ratio 0.7 plus a history of self-reported wheeze, and having a self-reported physician diag-
nosis of both asthma and COPD. The spirometric results are shown in Table 2. 3.2. Association of polymorphisms in EPHX1 and TNF-alpha genes with COPD The genotype frequencies in the control and case groups are shown in Table 3. Our results show that for EPHX1 gene Y113H SNP, the presence of an “C” allele (TC/CC genotype) was significantly overrepresented [Odds ratio: 3.186 (1.428–7.110)] in the COPD patients (cases) compared to the controls. The distribution of the alleles follows the Hardy-Weinberg-Equilibrium for EPHX1 Y113H. For the TNF-a gene (-308G/A) SNP, the presence of the A allele was not significantly overrepresented in the cases compared to the control. Figs. 1 and 2 show the representative chromatograms of the different study groups for EPHX1 Y113H SNP and TNF-a (308G/A) SNP respectively. The distribution of the alleles follows the Hardy-Weinberg-Equilibrium for TNF-a (-308G/A) also as shown below: The distribution of the alleles follows the Hardy-WeinbergEquilibrium for EPHX1 Y113H following the formula p2 + 2pq + q2 = 1: 0.44 × 0.44 + 2 × 0.44 × 0.56 + 0.56 × 0.56 = 1 and 0.71 × 0.71 + 2 × 0.71 × 0.29 + 0.29 × 0.29 = 1, for the cases and control groups respectively. The distribution of the alleles follows the Hardy-WeinbergEquilibrium also for TNF-a (−308G/A) following the formula p2 + 2pq + q2 = 1: 0.67 × 0.67 + 2 × 0.67 × 0.33 + 0.33 × 0.33 = 1 and 0.69 × 0.69 + 2 × 0.69 × 0.31 + 0.31 × 0.31 = 1, for the cases and control groups respectively. 4. Discussion Chronic obstructive pulmonary disease (COPD), comprised of pulmonary emphysema, chronic bronchitis, and structural and inflammatory changes of small airways, is a leading cause of morbidity and mortality in the world. Several gene polymorphisms have been previously associated with chronic obstructive pulmonary disease. Among them, SNPs of EPHX1 and TNF-alpha genes are important contenders which have been found to be strongly associated with COPD in different study populations. So in the present study we aim to identify whether any association exist between Y113H polymorphism in EPHX1 and −308G/A polymor-
Table 3 Association of EPHX1 Y113H and TNF-a (−308G > A) polymorphisms with COPD. Genotype
Control N (%)
COPD N (%)
OR (95% CI)
p values
EPHX1 (Y113H) TT TC CC TC/CC
37 (71.15%) 12 3 15 (28.85%)
24 (43.64%) 23 8 31 (56.36%)
1.00 (Reference) 2.95 (1.24–7.031) 4.11 (0.99–17.063) 3.186 (1.428–7.110)
0.0192* 0.0523 0.0060*
TNF-a (−308G/A) GG GA AA GA/AA
36 (69.23%) 14 2 16 (30.77%)
37 (67.27%) 13 5 18 (32.73)
1.00 (Reference) 0.90 (0.37–2.19) 2.43 (0.44–13.36) 1.095 (0.48–2.47)
0.9035 0.436 0.8388
Note: OR: Odds Ratio; CI: Control Interval. * p < 0.05.
4
A. Akparova et al. / Mutation Research 816 (2017) 1–6
Fig. 1. Representative chromatogtams showing three different genotypes of the study participants for the EPHX1 Y113H SNP.
phism in TNF-a genes with COPD in an affected population of Kazakhstan. The pathobiology of COPD encompasses multiple injurious processes including inflammation, cellular apoptosis, altered cellular and molecular alveolar maintenance program, abnormal cell repair, extracellular matrix destruction and oxidant and antioxidant imbalance. These processes are triggered by active and/or passive cigarette smoke and modified by cellular senescence and infection. A series of receptor-mediated signal transduction pathways are activated by reactive oxygen species and tobacco components, resulting in impairment of a variety of cell signaling and cytokine networks, subsequently leading to chronic airway responses with mucus production, airway remodeling, and alveolar destruction [11] .Cigarette smoking likely accounts for 80–90% of COPD cases in the United States [12]. Again studies have shown that passive smoking also contributes to COPD pathogenesis in significant number of individuals [11]. In our study population, majority of the COPD patients are current smokers while few are ex-smokers who have history of smoking for many years. For that reason the risk of development of COPD might have increased in them sig-
nificantly. Many toxins in cigarette smoke are metabolised in the liver. Among several detoxification enzyme microsomal epoxide hydrolase (EPHX1) have been studied intensely. EPHX1 SNPs have been found to be associated with its activity. The Y113H SNP have been found be associated with 40% decrease of the activity of EPHX1 and is often represented as the “slow” allele [13]. The slow activity phenotype was associated with increased risk of COPD in Asian population [8]. A strong correlation between the EPHX1 113 mutant homozygote and smoking related COPD was observed in the Taiwan population, and this genetic polymorphism was also associated with decreased bronchodilator response in COPD patients [14]. The investigation of association of EPHX1 polymorphisms to COPD in a Hungarian population showed, that the Y113H was not significantly associated with COPD even after adjusting the model for gender, age and pack-years in logistic regression [15]. An association study on Danish individuals did not find the association among patients with COPD diagnosed by spirometry, the EPHX1 genotypes or phenotypes, or in smokers or non-smokers, respectively [16]. In our study we have found that for Y113H polymorphism of the EPHX1 gene, the “C allele” was significantly overrepresented in the COPD
A. Akparova et al. / Mutation Research 816 (2017) 1–6
5
Fig. 2. Representative chromatogtams showing three different genotypes of the study participants for the TNF-a (−308G/A) SNP.
patients compared to the controls which are in agreement with the results of several previous studies as described above. The genomic polymorphism resulting in the nucleotide adenine (A) substitution for guanine (G) at position −308 in TNF-a gene was discovered in 1992. Since then, a large number of studies have been done, where an inconsistent association between COPD susceptibility and gene polymorphisms were observed. Earlier it was demonstrated association between polymorphism of GlutathioneS-transferase (GST) three genes GSTT1, GSTM1, GSTP1 and COPD development in Kazakh population [17]. In some studies a strong association was found between this polymorphism and COPD while in the others no such association was found between them [8]. It was found that −308 G/A polymorphism was found to be a risk factor for developing COPD in Asian populations but not among the Caucasions [18]. In another study Sakao et al. reported a strong association exsisted between this polymorphism and the COPD patients in a Japanese population [19]. In a Turkish population no significant difference in the frequency of G/G and G/A gene polymorphisms was found in the COPD group compared with control subjects (p > 0.05) [20]. However we also found no association with
−308G/A TNF-a polymorphism and COPD in our study population. This might be due to the fact that our study population was mostly of Caucasion origin and previous studies have reported that TNFa −308G/A polymorphism did not provide a risk in the Caucasion population as mentioned above. In meta-analysis study carried out by Li et al. [21], the analyses stratified by the cigarette smoking status of the controls showed that the increased risk of COPD was detected between the extremely slow enzyme activity and the subgroup with the non-smokers used as controls. Furthermore, the increased COPD risk of the slow enzyme activity was observed not only in the subgroup with the non-smokers as controls but also in the subgroup with the smokers and ex-smokers as controls, indicating that in addition to the polymorphisms in the genes associated with COPD, cigarette smoke is also an important contributor to the same.
5. Conclusion Thus in conclusion, we might say that the Y113H polymorphism in the EPHX1 gene is associated with COPD in the Kazakhstan pop-
6
A. Akparova et al. / Mutation Research 816 (2017) 1–6
ulation. Along with that, cigarette smoking increases the risk of development of COPD in them. More detailed study is required to understand the gene-environment interaction in imparting susceptibility to COPD in them. Acknowledgements This work has been supported by the program “Grant funding for research” № 0112RК02125 from the Ministry of Education and Science of the Republic of Kazakhstan to AA and RB and by Department of Science and Technology (DST), Govt of India, for providing DST-WOS-A Grant no: SR/WOSA/LS05/2014 to NB. The authors are extremely greatful to Dr A.K. Giri, Emeritus Scientist, Molecular Genetics Division, CSIR-Indian Institute of Chemical Biology, Kolkata, India, for providing laboratory space and facilities for doing the work in India. Thanks are also due to Dr. Suman Dutta, Molecular Genetics Division, CSIR-Indian Institute of Chemical Biology for his help and suggestions to carry out this work. We are grateful to Dr. Meyrzhan T. Abishev, the Head of Pulmonology Department of Hospital №2, Astana, Kazakhstan, for help in sample collection. References [1] K.F. Rabe, S. Hurd, A. Anzueto, P.J. Barnes, S.A. Buist, P. Calverley, et al., Global Initiative for Chronic Obstructive Lung Disease, global strategy for the diagnosis, management, and prevention of chronic obstructive pulmonary disease: GOLD executive summary, Am. J. Respir. Crit. Care Med. 176 (2007) 532–555, http://dx.doi.org/10.1164/rccm.200703-456SO. [2] R.A. Pauwels, K.F. Rabe, Burden and clinical features of chronic obstructive pulmonary disease (COPD), Lancet 364 (2004) 613–620, http://dx.doi.org/10. 1016/S0140-6736(04)16855-4. [3] A. Løkke, P. Lange, H. Scharling, P. Fabricius, J. Vestbo, Developing COPD: a 25 year follow up study of the general population, Thorax 61 (2006) 935–939, http://dx.doi.org/10.1136/thx.2006.062802. [4] B. Burrows, R.J. Knudson, M.G. Cline, M.D. Lebowitz, Quantitative relationships between cigarette smoking and ventilatory function, Am. Rev. Respir. Dis. 115 (1977) 195–205, http://dx.doi.org/10.1164/arrd.1977.115.2.195. [5] J. Zhang, J. Zhang, L. Liu, Z. Zhao, L.Z. Fang, L. Liu, et al., Effect of N-acetylcysteine in COPD patients with different microsomal epoxide hydrolase genotypes, Int. J. Chron. Obstr. Pulm. Dis. 10 (2015) 917–923, http://dx.doi.org/10.2147/COPD.S79710. [6] G. Hu, Z. Shi, J. Hu, G. Zou, G. Peng, P. Ran, Association between polymorphisms of microsomal epoxide hydrolase and COPD: results from meta-analyses, Respirology 13 (2008) 837–850, http://dx.doi.org/10.1111/j. 1440-1843.2008.01356.x. [7] J. Lee, B.G. Nordestgaard, M. Dahl, EPHX1 polymorphisms COPD and asthma in 47,000 individuals and in meta-analysis, Eur. Respir. J. 37 (June (1)) (2011) 18–25, http://dx.doi.org/10.1183/09031936.00012110, Epub 2010.
[8] X. Wu, B. Yuan, E. López, C. Bai, X. Wang, Gene polymorphisms and chronic obstructive pulmonary disease, J. Cell. Mol. Med. 18 (2014) 15–26, http://dx. doi.org/10.1111/jcmm.12159. [9] P. Zhan, J. Wang, S.Z. Wei, Q. Qian, L.X. Qiu, L.K. Yu, et al., TNF-308 gene polymorphism is associated with COPD risk among Asians: meta-analysis of data for 6,118 subjects, Mol. Biol. Rep. 38 (2011) 219–227, http://dx.doi.org/ 10.1007/s11033-010-0098-y. [10] J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. [11] T. Yoshida, R.M. Tuder, Pathobiology of cigarette smoke-Induced chronic obstructive pulmonary disease, Physiol. Rev. 87 (2007) 1047–1082, http://dx. doi.org/10.1152/physrev.00048.2006. [12] J.M. Sethi, C.L. Rochester, Smoking and chronic obstructive pulmonary disease, Clin. Chest Med. 21 (2000) 67–86. [13] J.J. Heidelbaugh, Chronic Obstructive Pulmonary Disease: A Multidisciplinary Approach, 2015 https://books.google.co.in/books?isbn=0323428223. [14] Ch.-Z. Chen, R.-H. Wang, et al., Polymorphism of microsomal epoxide hydrolase is associated with chronic obstructive pulmonary disease and bronchodilator response, J. Formos. Med. Assoc. 110 (2011) 685–689, http:// dx.doi.org/10.1016/j.jfma.2011.09.003. [15] A. Penyige1, S. Poliska, E. Csanky, et al., Analyses of association between PPAR gamma and EPHX1 polymorphisms and susceptibility to COPD in a Hungarian cohort, a case-control study, BMC Med. Genet. 11 (2010) 152, http://dx.doi. org/10.1186/1471-2350-11-152. [16] J. Lee, B.G. Nordestgaard, M. Dahl, EPHX1 polymorphisms, COPD and asthma in 47,000 individuals and in meta-analysis, Eur. Respir. J. 37 (2011) 18–25, http://dx.doi.org/10.1183/09031936.00012110. [17] A.Yu. Akparova, Association between cytokines and xenobiotics detoxification genes polymorphism and susceptibility to asthma and COPD in Kazakh population, in: 3rd Asian Conference on Environmental Mutagens & 15th Conference of Chinese Environmental Mutagen Society, Hangzhou (China), 2012. [18] C. Patuzzo, L.S. Gilè, M. Zorzetto, E. Trabetti, G. Malerba, P.F. Pignatti, et al., Tumor necrosis factor gene complex in COPD and disseminated bronchiectasis, Chest 117 (2000) 1353–1358. [19] S. Sakao, K. Tatsumi, H. Igari, Y. Shino, H. Shirasawa, T. Kiruyama, Association of tumor necrosis factor a gene promoter polymorphism with the presence of chronic obstructive pulmonary disease, Am. J. Respir. Crit. Care Med. 163 (2001) 420–422, http://dx.doi.org/10.1164/ajrccm.163.2.2006031. [20] N. Özdo˘gana, N. Tutara, R. Demira, Saatc¸ib C¸etin, A. Kanbaya, H. Büyüko˘glanaa, Is TNF-agene polymorphism related to pulmonary functions and prognosis as determined by FEV1, BMI, COPD exacerbation and hospitalization in patients with smoking-related COPD in a Turkish population? Revista Portuguesa de Pneumologia 20 (2014) 305–310, http:// dx.doi.org/10.1016/j.rppneu.2014.03.003. [21] H. Li, W.P. Fu, Z.H. Hong, Microsomal epoxide hydrolase gene polymorphism and risk of chronic obstructive pulmonary disease: a comprehensive meta-analysis, Oncol. Lett. 5 (2013) 1022–1030, http://dx.doi.org/10.3892/ol. 2012.1099.