- Email: [email protected]
Epidemiology and molecular characterization of Cryptococcus neoformans isolated from pigeon excreta in Mazandaran province, northern Iran
Journal de Mycologie Médicale (2012) 22, 160—166
Available online at
www.sciencedirect.com
ORIGINAL ARTICLE/ARTICLE ORIGINAL
Epidemiology and molecular characterization of Cryptococcus neoformans isolated from pigeon excreta in Mazandaran province, northern Iran ´Epide ´ miologie et caracte ´ risation mole ´ culaire de Cryptococcus neoformans ´ de fientes de pigeons vivant dans la province de Mazandaran, isole au nord de l’Iran S. Agha Kuchak Afshari, T. Shokohi *, R. Aghili, H. Badali Department of Medical Mycology and Parasitology, School of Medicine, Mazandaran University of Medical Sciences, Km 18 Khazarabad Road, P.O. Box 48175-1665, Sari, Iran Received 5 December 2011; received in revised form 13 February 2012; accepted 22 February 2012 Available online 17 April 2012
KEYWORDS Cryptococcus neoformans; Pigeon excreta; Epidemiology; Molecular characterization; Iran
Summary Objective. — The aims of this study were to verify the presence of Cryptococcus neoformans in pigeon excreta in Mazandaran province, Iran, to identify the varieties of the C. neoformans isolates using D1/D2 and IGS sequencing, and determining the presence of the two mating types: a and a. Materials and methods. — Four hundred pigeon droppings samples were collected from 15 different cities in Mazandaran province over a period of 1 year (February 2010—March 2011). Identification of C. neoformans was determined based on growing brown colonies on Niger seed agar (NSA) and biochemical characteristics. We used MATa and MATa specific primers for determining mating type and sequence analysis of the D1/D2 and intergenic spacer regions were done. Results. — Out of 400 samples, 20 samples (5%) were positive for C. neoformans and all of these isolates were a mating types. Sequence analysis of polymerase chain reaction (PCR) amplicons of D1/D2 regions revealed that all of the isolates were C. neoformans var. grubii except two isolates that were C. neoformans var. neoformans. Conclusion. — Our results reinforced that the pigeon excreta is a favorable environment rich in nitrogen and supports the growth of C. neoformans and the pigeon could play an important role in spread of this organism. # 2012 Elsevier Masson SAS. All rights reserved.
* Corresponding author. E-mail address: [email protected] (T. Shokohi). 1156-5233/$ — see front matter # 2012 Elsevier Masson SAS. All rights reserved. doi:10.1016/j.mycmed.2012.02.002
Epidemiology and molecular characterization of Cryptococcus neoformans
MOTS CLÉS Cryptococcus neoformans ; Fientes de pigeon ; Épidémiologie ; Caractérisation moléculaire ; Iran
161
Re ´sume ´ Objectif. — Les objectifs de cette étude étaient de vérifier la présence de Cryptococcus neoformans dans les fientes de pigeons d’origine de la province de Mazandaran (Iran), afin d’identifier les variétés de C. neoformans isolées à l’aide des séquences D1/D2 et IGS et de déterminer la présence des deux types : a et a. Mate´riels et me´thodes. — Les 400 échantillons d’excréments de pigeons ont été recueillis dans 15 villes différentes de la province de Mazandaran durant une période de plus d’un an (février 2010—mars 2011). L’identification de C. neoformans a été réalisée sur la base de la croissance de colonies brunes sur gélose à base de graines de Niger (NSA) et des caractéristiques biochimiques. Nous avons utilisé les amorces spécifiques MATa et MATa pour déterminer le type sexuel et analysé les séquences D1/D2 et inter-géniques. Re ´sultats. — Sur les 400 échantillons, 20 échantillons (5 %) étaient positifs pour C. neoformans et l’ensemble de tous ces isolats étaient de type a. Les séquences analysées par PCR des amplicons des régions D1/D2 ont révélé que tous les isolats étaient C. neoformans var. grubii sauf deux isolats qui étaient C. neoformans var. neoformans. Conclusion. — Nos résultats ont confirmé que les excréments de pigeon sont un environnement favorable riche en azote qui favorise la croissance de C. neoformans et que le pigeon joue un rôle important dans la propagation de cet organisme. # 2012 Elsevier Masson SAS. Tous droits réservés.
Introduction Cryptococcus neoformans and Cryptococcus gattii is the encapsulated basidiomycetous yeast that caused cryptococcosis in animals and human, especially in patients with AIDS. C. neoformans has three serotypes and two varieties: C. neoformans variety (var.) grubii (serotype A), C. neoformans var. neoformans (serotype D, and serotype AD), and C. gattii (serotypes B and C) [8]. Recently unique interspecies hybrids of AB and BD serotypes have been defined [3,4]. The varieties differ in their natural habitat, epidemiology, ecology, biochemical and molecular characteristics. C. neoformans cause disease predominately in immunocompromised patients and the reservoirs of them are mainly pigeon or other bird droppings. C. neoformans var. grubii is worldwide in distribution, whereas C. neoformans var. neoformans (serotype D) causes disease less frequently and is the more common in Europe [8]. Reports display that the serotype A has been predominant serotype of C. neoformans isolated from HIV-infected patients and environmental sources. C. neoformans has a bipolar mating system, with mating type determined (a and a) by a single locus with two alleles [22]. Surveys of guano and soil contaminated with guano in various regions of world have found to be positive for C. neoformans [7] and cryptococcosis may developed in people after exposure to birds or bird guano [23,35]. Cryptococcosis is to date relatively uncommon disease and a few cases have been reported over the last 47 years in Iran [1,2,13,16,28]. The incidence of cryptococcosis in Iran is most likely an underestimation of actual occurrence because there is no reference center focusing on registering of this disease and it was accidentally diagnosed. Changing cultural norms in Iran that increase HIV infection and associated immunosuppresion would therefore allow C. neoformans to becoming an emerging pathogen in this region. Environmental sampling has found C. gattii to be uncommon, despite the importation and cultivation of Eucalyptus trees known to harbor this organism in Iran [41]. A second
survey of decaying wood in the hollows of 200 living trees belonging to 21 different species failed to find any viable C. neoformans cells, despite to use of selective media and recommended sampling technique [32]. However, C. neoformans can be obtained quite readily from pigeon guano. The isolation of C. neoformans from guano and soil contaminated with guano varies between 0.8 and 34% in various regions of Iran [12,18,26,31,42]. Knowledge of the geographic distribution C. neoformans may provide a rational framework for the design of prevention and control strategies of it within Iran. Pigeon are popular as pet and are considered as a holy bird in general population; therefore they raise and care in close with human living area in north and other parts of Iran. The present study is the first molecular study of C. neoformans from Iran, and it extends the molecular epidemiologic survey of C. neoformans to the Middle East, where data are currently scarce. The aims of this study were: to verify the presence of C. neoformans in pigeon excreta in Mazandaran province, Iran; to identify the varieties of the C. neoformans isolates using D1/D2 and IGS sequencing; to survey for the presence of the two mating types: a and a.
Materials and methods A total of 400 samples of pigeon droppings were collected from 15 different cities in Mazandaran province over a period of 1 year (February 2010—March 2011). The numbers of samples collected from each 15 different cities are shown in Table 1. Samples were collected from houses, holy places and aviary shops in sterile packet depending on the number of domesticated pigeons in each cage. In average one dropping sample was collected from each cage with at least five pigeons, but in cages with a large number of pigeons, one sample per 10 birds was obtained. The cages with direct sunlight exposure were excluded. Cryptococcus isolation was
162
S. Agha Kuchak Afshari et al.
Table 1 Frequency of Cryptococcus neoformans isolated from droppings from the different sites. ´ des fientes dans les diffe ´ rentes villes. ´ quence de Cryptococcus neoformans isole Fre Geographic origin (city) Sari Ghaemshahr Neka Behshahr Babolsar Mahmudabad Savadkuh Joybar Chalus Nur Noshahr Babol Amol Tonkabon Ramsar Total (%)
Number of samples collected 27 27 27 27 26 26 26 26 27 27 27 27 27 26 27 400 (100)
Number of positive samples (%) 4 (14.8) 3 (11.1) 1 (3.7) 0 0 0 0 0 2 (7.4) 1 (3.7) 1 (3.7) 2 (7.4) 2 (7.4) 0 4 (14.8)
Months/Year
Relative humidity %
Temperature (mean) 8C
Annual rainfall (mean) mm
February & March/2010 March/2010 May/2010 May/2010 August/2010 August/2010 September/2010 September/2010 December/2010 December/2010 December/2010 January/2011 January/2011 February/2011 March/2011
71 76 75 74 77 77 64 76 79 79 79 76 78 79 79
18.9 13.2 18.4 18.1 18.9 18.9 16.6 13.2 17.6 17.6 17.6 13.2 18.2 17.9 17.9
547.2 575.4 438.6 371.2 619.2 619.2 377.3 575.4 1072 1072 1072 575.4 501.5 948.5 948.5
20 (5)
done according our previous research [17,32]. Briefly, approximately 2 g of each sample was added to 50 ml sterile physiological saline (0.9%) with chloramphenicol (100 mg/l), then vortexed for 5 min and filtered through sterile gauze, allowed to settle for 30 min. Hundred microliters of the supernatant of each sample were streaked on Niger seed agar of following composition: Niger seed (Guizotia abyssinica), 50 g; dextrose, 1 g; KH2PO4,1 g; creatinine, 1 g; agar 15 g, chloramphenicol, 1 g; and 1000 ml dH2O. All inoculated plates incubated at 30 8C up to 2 weeks. The brown colonies suggestive of C. neoformans were selected and then were subcultured on sabouraud dextrose agar plates for single colonies. These colonies were tested by India ink examination for the presence of capsules, as well as the isolates were confirmed as C. neoformans using urease activity on Christensen urea agar medium.
DNA isolation Genomic DNA was extracted by using a (glass bead — phenol chloroform) method [40]. Briefly C. neoformans strains were grown on sabouraud dextrose agar plates at 25 8C for 48 h and a loopful of fresh yeast was suspended in 300 ml of lyses buffer (10 mM Tris, 1 mM EDTA [pH 8], 1% SDS, 100 mM NaCl, 2% Triton X-100). Then, 300 ml of phenol- chloroform (1:1) and 300 mg glass beads (0.5 mm in diameter) were added, and samples were vortex vigorously for 5 min. After centrifugation for 10 min at 12,000 rpm, transfer the aqueous layer to new tube and extract it with equal volume of chlorophorm, then invert the tube a few times to mix the two phases and centrifuge at 12,000 rpm for 10 min. Collect the aqueous layer and precipitate with 2.5 volume of ice-cold 100% Ethanol, mix by inversion and then centrifuge tubes at 12,000 rpm for 10 min. Put the tube into 20 freezer for 2 h and then the DNA was pelleted by centrifugation at 12,000 rpm for 10 min. Remove the supernatant and rinse the pellet in 1 ml of ice-cold 70% Ethanol, mix by inversion
and then centrifuge tube at 12,000 rpm for 10 min. Remove ethanol and dry pellet by inverting tube upside down for 30 min at room temperature. The pellet was resuspended in 50 ml TE buffer (10 mM tris, 1 mM EDTA pH 8) and kept in 4 8C or stored at 20 8C for later PCR amplification. DNA was visualized by electrophoresis on 1% agarose gel in 1 TBE buffer stained with ethidium bromide to estimate its quantity and a spectrophotometer reading was performed at at various wavelengths for determining its purity. Nucleic acid purity was confirmed by an absorbance ratio (A260/ A280) which was between 1.8 and 2.0.
Amplification and sequencing of the D1-D2 and IGS regions The two primers NL1 and NL4 were used to amplify the D1/D2 regions of large subunit (26 S) rDNA (Table 2). PCR was using the following conditions: initial denaturation at 94 8C for 3 min, 35cycles of denaturation (94 8C for 1 min), annealing (52 8C for 2 min), and extension (72 8C for 2 min); and a final extension step at 72 8C for 5 min. For amplification of the IGS1 regions the two primers IGSF and IGSR were used (Table 2). The PCR reaction was performed for 35 cycles as follows: Initial denaturation for 3 min at 94 8C, denaturation step 30 sec at 94 8C, annealing 30 sec at 60 8C and extension for 1 min at 72 8C, followed by a final extension 72 8C at 10 min.
Sequencing The PCR products were sequenced with forward primer (NL1 and IGSF). After conversion the sequences to a FASTA format, they aligned and species were identified by searching databases using the online basic local alignment search tool (BLAST) system at the website of National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov). All sequences obtained in this study were submitted to the NCBI
Epidemiology and molecular characterization of Cryptococcus neoformans
163
Table 2 Primers used in PCR amplification reactions. ´ es dans les re ´ actions d’amplification par PCR. Amorces utilise Primers names
Sequence (50 to 30 )
PCR specificity
References
MFaU MFaL STE20aSFU STE20aSFL NL-1 NL-4 IGS1F IGS1R
TTCACTGCCATCTTCACCACC TCCGATTGCTGCGATTTGCC TCTAGGCGATGACACAAAGGG GCGCCTGCACCATAATTCACC GCATATCAATAAGCGGAGGAAAAG GGTCCGTGTTTCAAGACGG GCGCCTGCACCATAATTCACC ATCCTTTGCAGACGACTT GA GTGATCAGT GCATTGCATGA
Mating type a Mating type a Mating type a Mating type a D1-D2 region D1-D2 region IGS1 region IGS1 region
[30] [30] [30] [30] [10] [10] [9] [9]
GenBank and their received accession numbers were indicated in Table 3.
Determination of mating type by PCR
annealing (55 8C for 1 min) and extension (72 8C for 1 min), with a final extension step of 72 8C for 7 min.
Results
Two PCR primer pairs, for mating type a and a, were used. The MATa primers (MFaU — MFaL), and the MATa (STE20aSFU — STE20aSFL) specific primers (Table 2) were established to the STE20a genes as described previously [30] in a co amplification reaction to amplify a 109-bp fragment from a mating type strains and a 219-bp fragment from ‘‘a’’ mating type strains. The two type of strains JEC20 (serotype D-MATa); JEC21 (serotype D-MATa) were used as positive controls and also one negative control (dd water) was included in each set of PCR. PCR performed in a thermocycler (Thermal cycler techneT312) as follows: initial denaturation at 94 8C for 5 min, was followed by 35 cycles of denaturation (94 8C for 1 min),
Out of 400 pigeon excreta samples, a total of 20 (5%) C. neoformans were isolated in the different cities understudy (Table 1). The numbers of positive samples were high in Sari and Ramsar (both 14.8%) while in some cities, such as Behshahr, Babolsar, Mahmudabad, Savadkuh, Joybar, there were no positive culture. All the isolates were positive for MATa with 109-bp product (Fig. 1). All of the twenty C. neoformans isolates showed an approximately 650-bp and 900-bp PCR products with the NL1- NL4 and IGSF- IGSR primer pair, respectively. Twenty PCR-amplified products were sequenced in the D1/D2 and IGS regions with forward primers. The resulting
Table 3 Accession numbers of sequences of D1/D2 and IGS regions isolated Cryptococcus neoformans from pigeon excreta in different cities of Mazandaran province, Iran during February 2009 to March 2010. ´ quences des re ´ gions D1/D2 et IGS de C. neoformans isole ´ des fientes de pigeon dans diffe ´ rentes villes de ´ ro d’accession des se Nume ´ vrier 2009 `a mars 2010. la province de Mazandaran, Iran de fe No.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
Sample name
Tsh1 Tsh2 Tsh3 Tsh4 Tsh5 Tsh6 Tsh7 Tsh8 Tsh9 Tsh10 Tsh11 Tsh12 Tsh13 Tsh14 Tsh15 Tsh16 Tsh17 Tsh18 Tsh19 Tsh20
Species
C. C. C. C. C. C. C. C. C. C. C. C. C. C. C. C. C. C. C. C.
neoformans neoformans neoformans neoformans neoformans neoformans neoformans neoformans neoformans neoformans neoformans neoformans neoformans neoformans neoformans neoformans neoformans neoformans neoformans neoformans
Mating type
var. var. var. var. var. var. var. var. var. var. var. var. var. var. var. var. var. var. var. var.
grubii grubii grubii grubii grubii grubii neoformans grubii grubii grubii grubii grubii neoformans grubii grubii grubii grubii grubii grubii grubii
Alpha Alpha Alpha Alpha Alpha Alpha Alpha Alpha Alpha Alpha Alpha Alpha Alpha Alpha Alpha Alpha Alpha Alpha Alpha Alpha
Origin
Sari Sari Sari Sari Ghaemshahr Ghaemshahr Ghaemshahr Neka Amol Amol Babol Babol Ramsar Ramsar Ramsar Ramsar Nour Noshahr Chalus Chalus
GenBank accession no. D1/D2
IGS
JN589753 JN589754 JN589755 JN589756 JN589757 JN589758 JN589759 JN589760 JN589761 JN589762 JN589763 JN589764 JN589765 JN589766 JN589767 JN589768 JN589769 JN589770 JN589771 JN589772
JN589773 JN589774 JN589775 JN589776 JN589777 JN589778 JN589779 JN589780 JN589781 JN589782 JN589783 JN589784 JN589785 JN589786 JN589787 JN589788 JN589789 JN589790 JN589791 JN589792
164
Figure 1 Determination of mating type of Cryptococcus neoformans isolates from this study by PCR. Line 1 and 16; 100 bp molecular marker, lines 2 to 21; C. neoformans, line 23 positive control for MATa (109 bp) line 24 positive control for MATa (219 bp), line 25 negative control. Primer dimmers can be seen below all of the amplified fragments. ´ termination du type sexuel de C. neoformans isole ´ `a partir de De ´ cucette ´etude par PCR. Ligne 1 et 16 ; 100 bp marqueur mole ˆ le positif laire, lignes 2 `a 21 C. neoformans, ligne 23 : de contro ˆ le positif pour MATa pour MATa (109 bp), ligne 24 : de contro ˆ le ne ´ gatif. (219 bp), ligne 25 : de contro
sequences were compared with reference data obtained from GenBank database using BLAST and all DNA sequences were submitted to GenBank. Table 3 shows accession numbers of the isolates that were sequenced in the D1/D2 and IGS regions. Sequence analysis of PCR amplicons of D1/D2 regions revealed all of the isolates were C. neoformans var. grubii except 2 isolates (TSh 7 and TSh 13) that were C. neoformans var. neoformans. All the sequences showed nearly 99% query coverage and 99% maximum identity. Using IGS sequence analysis, all isolates were correctly identified to species level with nearly 94% query coverage and 99% maximum identity.
Discussion This study of Iranian Cryptococcus isolates was performed as an effort to determine the characteristics environmental Cryptococcus strain, including the varieties and mating types within the northern region of country. Our aim was to provide preliminary data, which could act as basis for investigating an acceptable number of environmental and clinical isolates in the future. As far as we know, the data reported gave for the first time a general overview about molecular characterization and mating type distribution of C. neoformans in Iran. The pigeon excreta the best recognised of putative environmental risk factor can be a source of C. neoformans and other Cryptococcus species and has a potential risk especially for immunocompromised patients [38]. In Iran, there have been a few studies on the occurrence and identification of C. neoformans from pigeon excreta [18,26,28,31] and other avian droppings [17] in public residence. The present study is performed 37 years after the first screening [12] and 14 years after the second sampling [18] in northern Iran. The isolation rates were 15.2% and 17.8%
S. Agha Kuchak Afshari et al. respectively in these investigations, although the number of samples in each cites and the cities, which were studied varied from the present study. Moreover, the prevalence of C. neoformans varies strikingly between different sites of Iran from 0.8% in west [26] to 34% in south [42]. The present investigation has shown the lower occurrence (5%) of C. neoformans in pigeon excreta in comparison with the two previous studies in this area, whereas it is fully compatible with our recent finding on swallow [17]. There are several hypotheses that account for these differences. They could result from the diversity of climate and habitat conditions (such as pH, relative’s humidity and sunlight exposure) of C. neoformans in pigeon dropping. The number of collected samples from each location, availability of holy places and aviary shops, diets with alkaline pH, the composition of the excreta, co-infection with free living amoebae and bacteria, sanitary condition are variables that possibly influenced the results of these investigations [6,34,36]. Moreover, the fast growing saprophytic fungi, which are growing on NSA might be act as a competing organism with C. neoformans and affect on isolation rates [14]. The high isolation rates from some areas can be resulted from the number of cage inhabitants, high density of cages, accumulation of excreta and seed and insufficient ventilation, which can serve as substrate for growth of the yeast [11,25]. The low rate of isolation of fungus from holy places, aviary shop and houses in present study is due to low quantity of bird guano available be as a result of frequent cleaning and disinfecting of the cages [11]. In this study, the frequency of isolated Cryptococcus in old building with accumulation of excreta was much more than newly constructed buildings. The Mazandaran province is located in northern Iran and in the southern coast of the Caspian Sea. It has a moderate, subtropical climate with an average temperature of 25 8C in summer and about 8 8C in winter and humid temperate climate with a plenty of annual rainfall. Although snow may fall heavily in the mountains in winter, it rarely falls around sea lines. Our study samples were collected over of a period of one year. Due to small number of samples and distributed nonuniformly throughout this year, our survey could not clear the seasonal variation properly. But it is shown that the isolation C. neoformans var. grubii was significantly lower in the rainy season. This finding is similar to the reported low isolation frequency of this organism the rainy season of north-western India [37]. In spite of another study that determined in environmental occurrence of yeasts did not find any seasonal variation [20]. There was no isolation in some cities which could be due to unfavorable environmental conditions or as a result of less pigeon excrement available in the cages and the presence of various fast-growing filamentous or yeasts fungi which grew on the plates and act as a competing organism with isolation of Cryptococcus species. Some studies had already indicated an inverse relation between sunlight exposure of excrement and C. neoformans occurrence [5,29]. Even though, our samples were gathered from areas with little or no sunlight exposure and this factor did not appear to be a determining factor. As far as we are aware, this is the first study on molecular characterization of C. neoformans isolated from pigeon excreta in Iran. In this study we employed sequence analysis of the large subunit rRNA gene (D1/D2) and the intergenic
Epidemiology and molecular characterization of Cryptococcus neoformans spacer regions for detected Cryptococcus species that revealed all of the isolates were C. neoformans var. grubii except two isolates that were C. neoformans var. neoformans. In various researches sequence analysis of the IGS or D1/D2 regions is used for the identification of the Cryptococcus species [9,10]. Analysis of the D1/D2 region, which is generally used for phylogenetic analysis, revealed that there is only one nucleotide diversity between the D1/D2 sequences of var. neoformans and C. gattii [10]. IGS sequence analysis recommended that Cryptococcus isolates should be considered two distinct species; C. neoformans and C. gatti and C neoformans var. grubii (serotype A) should not be considered as separate variety [9]. In this study, it was found that sequence of D1/D2 region provides an accurate identification than that of IGS region. The presence of the C. neoformans var. grubii is not surprising because it is most common C. neoformans in the world which can be isolated from avian, especially pigeon, habitant, soil contaminated avian excreta and decaying wood [15,19,24,37,39]. Despite the fact that all varieties of C. neoformans are capable of growth on pigeon guano, only var. grubii and var. neoformans exhibit prolific mating, completing its life cycle. Then, bird guano may represent the ecological niche for C. neoformans [34]. Moreover, most clinical and veterinary cases worldwide are also caused by C. neoformans var. grubii [6,39]. The results of the mating type analysis revealed all of our isolates were a mating type, which were in complete agreement with those reports in other countries that indicated MATa is more prevalent than MATa [21]. MATa strains of clinical and environmental cryptococcal isolates are much more virulent than MATa [21,27]. Mating type has a welldocumented but poorly understood relationship with C. neoformans infection [27]. The vast majority of infections are cause by isolates of mating type a, not mating type ‘‘a’’ [38]. Kwon-Chung et al. [21] created congenic mating type a and mating type ‘‘a’’ in a strain of C. neoformans serotype D and found that the mating type a strain substantially more virulent than the mating type ‘‘a’’ strain in a mouse model. But Nielson et al. [33] assessed virulence of C. neoformans serotype A in two frequently used animal models and they saw no difference in the levels of virulence of the mating type ‘‘a’’ and mating type a strain, thus the situation with serotype A seems quite different from that with serotype D. In conclusion, our results reinforce that the pigeon excreta is a favorable environment rich in nitrogen and support the growth of C. neoformans and the pigeon could play an important role in spread of this organism. We do not know if C. neoformans var. grubii is the most common variety in clinical sample in Mazandaran because the present study only analyzed environmental strains. Clinical strains should be isolated and undergo molecular typing. Such a study would offer insight into the importance of this strain in relation to infection. Therefore further environmental and clinical investigations are warranted to determine the extent of C. neoformans variety in climatically different regions of Iran.
Disclosure of interest The authors declare that they have no conflicts of interest concerning this article.
165
Acknowledgment We are grateful to the vice-chancellor of research of Mazandaran university of medical sciences for financial support. We would like also to thank Miss. Sabah Mayahi and Mr. Iman Haghani for technical assistance.
References [1] Alilou M, Emami M, Zanian MT, Ahmadi M. Le premier cas, la cryptococcose généralisée en Iran. Iran J Public Health 1978;7:180—5. [2] Bijani K, Abbasi A. Pulmonary infection due to Cryptococcus neoformans in a patient without immunodeficiency; a case report. J Babol Uni Med Sci 1999;1:21—7. [3] Bovers M, Hagen F, Kuramae EE, Diaz MR, Spanjaard L, Dromer F, et al. Unique hybrids between the fungal pathogens Cryptococcus neoformans and Cryptococcus gattii. FEMS Yeast Res 2006;6:599—607. [4] Bovers M, Hagen F, Kuramae EE, Hoogveld HL, Dromer F, StGermain G, et al. AIDS patient death caused by novel Cryptococcus neoformans C. gattii hybrid. Emerg Infect Dis 2008;14:1105—8. [5] Caicedo LD, Alvarez MI, Delgado M, Cárdenas A. Cryptococcus neoformans in bird excreta in the city zoo of Cali, Colombia. Mycopathol 1999;147:121—4. [6] Casadevall A, Perfect JR. Cryptococcus neoformans. Washington: ASM Press; 1998. p. 451. [7] Castanón-Olivares LR, López-Martínez R. Isolation of Cryptococcus neoformans from pigeon (Columba livia) droppings in Mexico City. Mycoses 1994;37:325—7. [8] Chaturvedi V, Chaturvedi S. Cryptococcus gattii: a resurgent fungal pathogen. Trends Microbiol 2011;19:564—71. [9] Diaz MR, Boekhout T, Theelen B, Fell JW. Molecular sequence analyses of the intergenic spacer (IGS) associated with rDNA of the two varieties of the pathogenic yeast, Cryptococcus neoformans. Syst Appl Microbiol 2000;23:535—45. [10] Fell JW, Boekhout T, Fonseca A, Scorzetti G, Statzell-Tallman A. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int J Syst Evol Microbiol 2000;50:1351—71. [11] Filiú WF, Wanke B, Agüena SM, Vilela VO, Macedo RC, Lazéra M. Avian habitats as sources of Cryptococcus neoformans in the city of Campo Grande, Mato Grosso do Sul. Brazil Rev Soc Bras Med Trop 2002;35:591—5. [12] Forouzesh K. Isolation of Cryptococcus neoformans from soil of coast of Caspian Sea. PhD thesis, Tehran University, 1979. [13] Ghasemian R, Najafi N, Shokohi T. Cryptococcal meningitis relapse in an immunocompetent patient. Iranian J Clin Infect Dis 2011;6:51—5. [14] Granados DP, Castan?da E. Isolation and characterization of Cryptococcus neoformans varieties recovered from natural sources in Bogotá, Colombia, and study of ecolological conditions in the area. Microbiol Ecol 2005;49:282—90. [15] Gugnani HC, Mitchell TG, Litvintseva AP, Lengeler KB, Heitman J, Kumar A, et al. Isolation of Cryptococcus gattii and Cryptococcus neoformans var. grubii from the flowers and bark of Eucalyptus trees in India. Med Mycol 2005;43:565—9. [16] Haghi-Ashtiani MT, Haghani H, Makki N. Cryptococcal meningitis. A case report. Iranian J Pediatr 1995;5:13—26. [17] Hedayati MT, Mayahi S, Fakhar M, Shokohi T, Majidi M. Cryptococcus neoformans isolation from swallow (Hirundo rustica) excreta in Iran. Rev Inst Med Trop Sao Paulo 2011;53(3):125—7. [18] Khosravi AR. Isolation of Cryptococcus neoformans from pigeon (Columba livia) droppings in northern Iran. Mycopathol 1997;139:93—5.
166 [19] Hiremath SS, Chowdhary A, Kowshik T, Randhawa HS, Sun S, Xu J. Long-distance dispersal and recombination in environmental populations of Cryptococcus neoformans var. grubii from India. Microbiol 2008;154:1513—24. [20] Krockenberger MB, Canfield PJ, Malik R. Cryptococcus neoformans in the koala (Phascolarctos cinereus): colonization by Cryptococcus neoformans var. gattii and investigation of environmental sources. Med Mycol 2002;40:263—72. [21] Kwon-Chung KJ, Edman JC, Wickes BL. Genetic association of mating types and virulence in Cryptococcus neoformans. Infect Immun 1992;60:602—5. [22] Kwon-Chung KJ. Morphogenesis of Filobasidiella, the sexual state of Cryptococcus neoformans B and C serotypes. Mycologia 1976;68:821—33. [23] Lagrou K, van Eldere J, Keuleers S, Hagen F, Merckx R, Verhaegen J, et al. Zoonotic transmission of Cryptococcus neoformans from a magpie to an immunocompetent patient. J Intern Med 2005;257:385—8. [24] Litvintseva AP, Thakur R, Vilgalys R, Mitchell TG. Multilocus sequence typing reveals three genetic subpopulations of Cryptococcus neoformans var. grubii (Serotype A), including a unique population in Botswana. Genetics 2006;172:2223—38. [25] Lugarini C, Goebel CS, Condas LA, Muro MD, de Farias MR, Ferreira FM, et al. Cryptococcus neoformans Isolated from Passerine and Psittacine bird excreta in the state of Paraná, Brazil. Mycopathol 2008;166:61—9. [26] Mikailie A. Cryptococcus neoformans in excreta of pigeons of Kermanshah (1999—2000). Behbood 2001;5:71—3. [27] Mitchell AP. Updated view of Cryptococcus neoformans mating type and virulence. Infect Immun 2003;71:4829—30. [28] Moghadami M, Kordbache P, Emami M. A case report of cryptoccocal meningitis. Iran J Public Health 1988;17:61—8. [29] Montenegro H, Paula CR. Environmental isolation of Cryptococcus neoformans var. gattii and C. neoformans var. neoformans in the city of Sao Paulo, Brazil. Med Mycol 2000;38:385—90. [30] Moore TD, Edman JC. The alpha-mating type locus of Cryptococcus neoformans contains a peptide pheromone gene. Mol Cell Biol 1993;13:1962—70. [31] Nasr Isfahani B, Shadzi Sh, Chadegani Pour M, Ilchi N. Isolation and detection of Cryptococcus neoformans from pigeon droppings: Isfahan and its suburbs. J Res Med Sci 2001;6:155—7.
S. Agha Kuchak Afshari et al. [32] Nazeri M. A survey of Cryptococcus neoformans in decaying wood of tree trunk hallow. MSc thesis, Sari Medical School, Mazandaran University of Medical Sciences, 2003. [33] Nielsen K, Cox GM, Wang P, Toffaletti DL, Perfect JR, Heitman J. Sexual cycle of Cryptococcus neoformans var. grubii and virulence of congenic a and alpha isolates. Infect Immun 2003;71:4831—41. [34] Nielsen K, De Obaldia AL, Heitman J. Cryptococcus neoformans mates on pigeon guano: implications for realized ecological niche and globalization. Eukaryot Cell 2007;6:949—59. [35] Nosanchuk JD, Shoham S, Fries BC, Shapiro DS, Levitz SM, Casadevall A. Evidence of zoonotic transmission of Cryptococcus neoformans from a pet cockatoo to an immunocompromised patient. Ann Intern Med 2000;132:205—8. [36] Passoni LF, Wanke B, Nishikawa MM, Lazéra MS. Cryptococcus neoformans isolated from human dwellings in Rio de Janeiro, Brazil: an analysis of the domestic environment of AIDS patients with and without cryptococcosis. Med Mycol 1998; 36:305—11. [37] Randhawa HS, Kowshik T, Chowdhary A, Prakash A, Khan ZU, Xu J. Seasonal variations in the prevalence of Cryptococcus neoformans var. grubii and Cryptococcus gattii in decayed wood inside trunk hollows of diverse tree species in northwestern India: a retrospective study. Med Mycol 2011;49: 320—3. [38] Richardson MD, Warnock DW. Fungal infection — diagnosis and management. Massachuset: Blackwell Publishing; 1997. p. 216. [39] Viviani MA, Cogliati M, Esposto MC, et al. Molecular analysis of 311 Cryptococcus neoformans isolates from a 30-month ECMM survey of cryptococcosis in Europe. FEMS Yeast Res 2006; 6:614—9. [40] Yamada Y, Makimura K, Mirhendi H, Ueda K, Nishiyama Y, Yamaguchi H, et al. Comparison of different methods for extraction of mitochondrial DNA from human pathogenic yeasts. Jpn J Infect Dis 2002;55:122—5. [41] Zaini F, Bineshian F. The first report of Cryptococcus gattii in Iran. The proceeding of Second Congress of Medical Parasitology. Tehran, Iran; 1997, p. 71. [42] Zarrin M, Jorfi M, Amirrajab N, Rostami M. Isolation of Cryptococcus neoformans from pigeon droppings in Ahwaz, Iran. Turk J Med Sci 2010;40:313—6.
Available online at
www.sciencedirect.com
ORIGINAL ARTICLE/ARTICLE ORIGINAL
Epidemiology and molecular characterization of Cryptococcus neoformans isolated from pigeon excreta in Mazandaran province, northern Iran ´Epide ´ miologie et caracte ´ risation mole ´ culaire de Cryptococcus neoformans ´ de fientes de pigeons vivant dans la province de Mazandaran, isole au nord de l’Iran S. Agha Kuchak Afshari, T. Shokohi *, R. Aghili, H. Badali Department of Medical Mycology and Parasitology, School of Medicine, Mazandaran University of Medical Sciences, Km 18 Khazarabad Road, P.O. Box 48175-1665, Sari, Iran Received 5 December 2011; received in revised form 13 February 2012; accepted 22 February 2012 Available online 17 April 2012
KEYWORDS Cryptococcus neoformans; Pigeon excreta; Epidemiology; Molecular characterization; Iran
Summary Objective. — The aims of this study were to verify the presence of Cryptococcus neoformans in pigeon excreta in Mazandaran province, Iran, to identify the varieties of the C. neoformans isolates using D1/D2 and IGS sequencing, and determining the presence of the two mating types: a and a. Materials and methods. — Four hundred pigeon droppings samples were collected from 15 different cities in Mazandaran province over a period of 1 year (February 2010—March 2011). Identification of C. neoformans was determined based on growing brown colonies on Niger seed agar (NSA) and biochemical characteristics. We used MATa and MATa specific primers for determining mating type and sequence analysis of the D1/D2 and intergenic spacer regions were done. Results. — Out of 400 samples, 20 samples (5%) were positive for C. neoformans and all of these isolates were a mating types. Sequence analysis of polymerase chain reaction (PCR) amplicons of D1/D2 regions revealed that all of the isolates were C. neoformans var. grubii except two isolates that were C. neoformans var. neoformans. Conclusion. — Our results reinforced that the pigeon excreta is a favorable environment rich in nitrogen and supports the growth of C. neoformans and the pigeon could play an important role in spread of this organism. # 2012 Elsevier Masson SAS. All rights reserved.
* Corresponding author. E-mail address: [email protected] (T. Shokohi). 1156-5233/$ — see front matter # 2012 Elsevier Masson SAS. All rights reserved. doi:10.1016/j.mycmed.2012.02.002
Epidemiology and molecular characterization of Cryptococcus neoformans
MOTS CLÉS Cryptococcus neoformans ; Fientes de pigeon ; Épidémiologie ; Caractérisation moléculaire ; Iran
161
Re ´sume ´ Objectif. — Les objectifs de cette étude étaient de vérifier la présence de Cryptococcus neoformans dans les fientes de pigeons d’origine de la province de Mazandaran (Iran), afin d’identifier les variétés de C. neoformans isolées à l’aide des séquences D1/D2 et IGS et de déterminer la présence des deux types : a et a. Mate´riels et me´thodes. — Les 400 échantillons d’excréments de pigeons ont été recueillis dans 15 villes différentes de la province de Mazandaran durant une période de plus d’un an (février 2010—mars 2011). L’identification de C. neoformans a été réalisée sur la base de la croissance de colonies brunes sur gélose à base de graines de Niger (NSA) et des caractéristiques biochimiques. Nous avons utilisé les amorces spécifiques MATa et MATa pour déterminer le type sexuel et analysé les séquences D1/D2 et inter-géniques. Re ´sultats. — Sur les 400 échantillons, 20 échantillons (5 %) étaient positifs pour C. neoformans et l’ensemble de tous ces isolats étaient de type a. Les séquences analysées par PCR des amplicons des régions D1/D2 ont révélé que tous les isolats étaient C. neoformans var. grubii sauf deux isolats qui étaient C. neoformans var. neoformans. Conclusion. — Nos résultats ont confirmé que les excréments de pigeon sont un environnement favorable riche en azote qui favorise la croissance de C. neoformans et que le pigeon joue un rôle important dans la propagation de cet organisme. # 2012 Elsevier Masson SAS. Tous droits réservés.
Introduction Cryptococcus neoformans and Cryptococcus gattii is the encapsulated basidiomycetous yeast that caused cryptococcosis in animals and human, especially in patients with AIDS. C. neoformans has three serotypes and two varieties: C. neoformans variety (var.) grubii (serotype A), C. neoformans var. neoformans (serotype D, and serotype AD), and C. gattii (serotypes B and C) [8]. Recently unique interspecies hybrids of AB and BD serotypes have been defined [3,4]. The varieties differ in their natural habitat, epidemiology, ecology, biochemical and molecular characteristics. C. neoformans cause disease predominately in immunocompromised patients and the reservoirs of them are mainly pigeon or other bird droppings. C. neoformans var. grubii is worldwide in distribution, whereas C. neoformans var. neoformans (serotype D) causes disease less frequently and is the more common in Europe [8]. Reports display that the serotype A has been predominant serotype of C. neoformans isolated from HIV-infected patients and environmental sources. C. neoformans has a bipolar mating system, with mating type determined (a and a) by a single locus with two alleles [22]. Surveys of guano and soil contaminated with guano in various regions of world have found to be positive for C. neoformans [7] and cryptococcosis may developed in people after exposure to birds or bird guano [23,35]. Cryptococcosis is to date relatively uncommon disease and a few cases have been reported over the last 47 years in Iran [1,2,13,16,28]. The incidence of cryptococcosis in Iran is most likely an underestimation of actual occurrence because there is no reference center focusing on registering of this disease and it was accidentally diagnosed. Changing cultural norms in Iran that increase HIV infection and associated immunosuppresion would therefore allow C. neoformans to becoming an emerging pathogen in this region. Environmental sampling has found C. gattii to be uncommon, despite the importation and cultivation of Eucalyptus trees known to harbor this organism in Iran [41]. A second
survey of decaying wood in the hollows of 200 living trees belonging to 21 different species failed to find any viable C. neoformans cells, despite to use of selective media and recommended sampling technique [32]. However, C. neoformans can be obtained quite readily from pigeon guano. The isolation of C. neoformans from guano and soil contaminated with guano varies between 0.8 and 34% in various regions of Iran [12,18,26,31,42]. Knowledge of the geographic distribution C. neoformans may provide a rational framework for the design of prevention and control strategies of it within Iran. Pigeon are popular as pet and are considered as a holy bird in general population; therefore they raise and care in close with human living area in north and other parts of Iran. The present study is the first molecular study of C. neoformans from Iran, and it extends the molecular epidemiologic survey of C. neoformans to the Middle East, where data are currently scarce. The aims of this study were: to verify the presence of C. neoformans in pigeon excreta in Mazandaran province, Iran; to identify the varieties of the C. neoformans isolates using D1/D2 and IGS sequencing; to survey for the presence of the two mating types: a and a.
Materials and methods A total of 400 samples of pigeon droppings were collected from 15 different cities in Mazandaran province over a period of 1 year (February 2010—March 2011). The numbers of samples collected from each 15 different cities are shown in Table 1. Samples were collected from houses, holy places and aviary shops in sterile packet depending on the number of domesticated pigeons in each cage. In average one dropping sample was collected from each cage with at least five pigeons, but in cages with a large number of pigeons, one sample per 10 birds was obtained. The cages with direct sunlight exposure were excluded. Cryptococcus isolation was
162
S. Agha Kuchak Afshari et al.
Table 1 Frequency of Cryptococcus neoformans isolated from droppings from the different sites. ´ des fientes dans les diffe ´ rentes villes. ´ quence de Cryptococcus neoformans isole Fre Geographic origin (city) Sari Ghaemshahr Neka Behshahr Babolsar Mahmudabad Savadkuh Joybar Chalus Nur Noshahr Babol Amol Tonkabon Ramsar Total (%)
Number of samples collected 27 27 27 27 26 26 26 26 27 27 27 27 27 26 27 400 (100)
Number of positive samples (%) 4 (14.8) 3 (11.1) 1 (3.7) 0 0 0 0 0 2 (7.4) 1 (3.7) 1 (3.7) 2 (7.4) 2 (7.4) 0 4 (14.8)
Months/Year
Relative humidity %
Temperature (mean) 8C
Annual rainfall (mean) mm
February & March/2010 March/2010 May/2010 May/2010 August/2010 August/2010 September/2010 September/2010 December/2010 December/2010 December/2010 January/2011 January/2011 February/2011 March/2011
71 76 75 74 77 77 64 76 79 79 79 76 78 79 79
18.9 13.2 18.4 18.1 18.9 18.9 16.6 13.2 17.6 17.6 17.6 13.2 18.2 17.9 17.9
547.2 575.4 438.6 371.2 619.2 619.2 377.3 575.4 1072 1072 1072 575.4 501.5 948.5 948.5
20 (5)
done according our previous research [17,32]. Briefly, approximately 2 g of each sample was added to 50 ml sterile physiological saline (0.9%) with chloramphenicol (100 mg/l), then vortexed for 5 min and filtered through sterile gauze, allowed to settle for 30 min. Hundred microliters of the supernatant of each sample were streaked on Niger seed agar of following composition: Niger seed (Guizotia abyssinica), 50 g; dextrose, 1 g; KH2PO4,1 g; creatinine, 1 g; agar 15 g, chloramphenicol, 1 g; and 1000 ml dH2O. All inoculated plates incubated at 30 8C up to 2 weeks. The brown colonies suggestive of C. neoformans were selected and then were subcultured on sabouraud dextrose agar plates for single colonies. These colonies were tested by India ink examination for the presence of capsules, as well as the isolates were confirmed as C. neoformans using urease activity on Christensen urea agar medium.
DNA isolation Genomic DNA was extracted by using a (glass bead — phenol chloroform) method [40]. Briefly C. neoformans strains were grown on sabouraud dextrose agar plates at 25 8C for 48 h and a loopful of fresh yeast was suspended in 300 ml of lyses buffer (10 mM Tris, 1 mM EDTA [pH 8], 1% SDS, 100 mM NaCl, 2% Triton X-100). Then, 300 ml of phenol- chloroform (1:1) and 300 mg glass beads (0.5 mm in diameter) were added, and samples were vortex vigorously for 5 min. After centrifugation for 10 min at 12,000 rpm, transfer the aqueous layer to new tube and extract it with equal volume of chlorophorm, then invert the tube a few times to mix the two phases and centrifuge at 12,000 rpm for 10 min. Collect the aqueous layer and precipitate with 2.5 volume of ice-cold 100% Ethanol, mix by inversion and then centrifuge tubes at 12,000 rpm for 10 min. Put the tube into 20 freezer for 2 h and then the DNA was pelleted by centrifugation at 12,000 rpm for 10 min. Remove the supernatant and rinse the pellet in 1 ml of ice-cold 70% Ethanol, mix by inversion
and then centrifuge tube at 12,000 rpm for 10 min. Remove ethanol and dry pellet by inverting tube upside down for 30 min at room temperature. The pellet was resuspended in 50 ml TE buffer (10 mM tris, 1 mM EDTA pH 8) and kept in 4 8C or stored at 20 8C for later PCR amplification. DNA was visualized by electrophoresis on 1% agarose gel in 1 TBE buffer stained with ethidium bromide to estimate its quantity and a spectrophotometer reading was performed at at various wavelengths for determining its purity. Nucleic acid purity was confirmed by an absorbance ratio (A260/ A280) which was between 1.8 and 2.0.
Amplification and sequencing of the D1-D2 and IGS regions The two primers NL1 and NL4 were used to amplify the D1/D2 regions of large subunit (26 S) rDNA (Table 2). PCR was using the following conditions: initial denaturation at 94 8C for 3 min, 35cycles of denaturation (94 8C for 1 min), annealing (52 8C for 2 min), and extension (72 8C for 2 min); and a final extension step at 72 8C for 5 min. For amplification of the IGS1 regions the two primers IGSF and IGSR were used (Table 2). The PCR reaction was performed for 35 cycles as follows: Initial denaturation for 3 min at 94 8C, denaturation step 30 sec at 94 8C, annealing 30 sec at 60 8C and extension for 1 min at 72 8C, followed by a final extension 72 8C at 10 min.
Sequencing The PCR products were sequenced with forward primer (NL1 and IGSF). After conversion the sequences to a FASTA format, they aligned and species were identified by searching databases using the online basic local alignment search tool (BLAST) system at the website of National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov). All sequences obtained in this study were submitted to the NCBI
Epidemiology and molecular characterization of Cryptococcus neoformans
163
Table 2 Primers used in PCR amplification reactions. ´ es dans les re ´ actions d’amplification par PCR. Amorces utilise Primers names
Sequence (50 to 30 )
PCR specificity
References
MFaU MFaL STE20aSFU STE20aSFL NL-1 NL-4 IGS1F IGS1R
TTCACTGCCATCTTCACCACC TCCGATTGCTGCGATTTGCC TCTAGGCGATGACACAAAGGG GCGCCTGCACCATAATTCACC GCATATCAATAAGCGGAGGAAAAG GGTCCGTGTTTCAAGACGG GCGCCTGCACCATAATTCACC ATCCTTTGCAGACGACTT GA GTGATCAGT GCATTGCATGA
Mating type a Mating type a Mating type a Mating type a D1-D2 region D1-D2 region IGS1 region IGS1 region
[30] [30] [30] [30] [10] [10] [9] [9]
GenBank and their received accession numbers were indicated in Table 3.
Determination of mating type by PCR
annealing (55 8C for 1 min) and extension (72 8C for 1 min), with a final extension step of 72 8C for 7 min.
Results
Two PCR primer pairs, for mating type a and a, were used. The MATa primers (MFaU — MFaL), and the MATa (STE20aSFU — STE20aSFL) specific primers (Table 2) were established to the STE20a genes as described previously [30] in a co amplification reaction to amplify a 109-bp fragment from a mating type strains and a 219-bp fragment from ‘‘a’’ mating type strains. The two type of strains JEC20 (serotype D-MATa); JEC21 (serotype D-MATa) were used as positive controls and also one negative control (dd water) was included in each set of PCR. PCR performed in a thermocycler (Thermal cycler techneT312) as follows: initial denaturation at 94 8C for 5 min, was followed by 35 cycles of denaturation (94 8C for 1 min),
Out of 400 pigeon excreta samples, a total of 20 (5%) C. neoformans were isolated in the different cities understudy (Table 1). The numbers of positive samples were high in Sari and Ramsar (both 14.8%) while in some cities, such as Behshahr, Babolsar, Mahmudabad, Savadkuh, Joybar, there were no positive culture. All the isolates were positive for MATa with 109-bp product (Fig. 1). All of the twenty C. neoformans isolates showed an approximately 650-bp and 900-bp PCR products with the NL1- NL4 and IGSF- IGSR primer pair, respectively. Twenty PCR-amplified products were sequenced in the D1/D2 and IGS regions with forward primers. The resulting
Table 3 Accession numbers of sequences of D1/D2 and IGS regions isolated Cryptococcus neoformans from pigeon excreta in different cities of Mazandaran province, Iran during February 2009 to March 2010. ´ quences des re ´ gions D1/D2 et IGS de C. neoformans isole ´ des fientes de pigeon dans diffe ´ rentes villes de ´ ro d’accession des se Nume ´ vrier 2009 `a mars 2010. la province de Mazandaran, Iran de fe No.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
Sample name
Tsh1 Tsh2 Tsh3 Tsh4 Tsh5 Tsh6 Tsh7 Tsh8 Tsh9 Tsh10 Tsh11 Tsh12 Tsh13 Tsh14 Tsh15 Tsh16 Tsh17 Tsh18 Tsh19 Tsh20
Species
C. C. C. C. C. C. C. C. C. C. C. C. C. C. C. C. C. C. C. C.
neoformans neoformans neoformans neoformans neoformans neoformans neoformans neoformans neoformans neoformans neoformans neoformans neoformans neoformans neoformans neoformans neoformans neoformans neoformans neoformans
Mating type
var. var. var. var. var. var. var. var. var. var. var. var. var. var. var. var. var. var. var. var.
grubii grubii grubii grubii grubii grubii neoformans grubii grubii grubii grubii grubii neoformans grubii grubii grubii grubii grubii grubii grubii
Alpha Alpha Alpha Alpha Alpha Alpha Alpha Alpha Alpha Alpha Alpha Alpha Alpha Alpha Alpha Alpha Alpha Alpha Alpha Alpha
Origin
Sari Sari Sari Sari Ghaemshahr Ghaemshahr Ghaemshahr Neka Amol Amol Babol Babol Ramsar Ramsar Ramsar Ramsar Nour Noshahr Chalus Chalus
GenBank accession no. D1/D2
IGS
JN589753 JN589754 JN589755 JN589756 JN589757 JN589758 JN589759 JN589760 JN589761 JN589762 JN589763 JN589764 JN589765 JN589766 JN589767 JN589768 JN589769 JN589770 JN589771 JN589772
JN589773 JN589774 JN589775 JN589776 JN589777 JN589778 JN589779 JN589780 JN589781 JN589782 JN589783 JN589784 JN589785 JN589786 JN589787 JN589788 JN589789 JN589790 JN589791 JN589792
164
Figure 1 Determination of mating type of Cryptococcus neoformans isolates from this study by PCR. Line 1 and 16; 100 bp molecular marker, lines 2 to 21; C. neoformans, line 23 positive control for MATa (109 bp) line 24 positive control for MATa (219 bp), line 25 negative control. Primer dimmers can be seen below all of the amplified fragments. ´ termination du type sexuel de C. neoformans isole ´ `a partir de De ´ cucette ´etude par PCR. Ligne 1 et 16 ; 100 bp marqueur mole ˆ le positif laire, lignes 2 `a 21 C. neoformans, ligne 23 : de contro ˆ le positif pour MATa pour MATa (109 bp), ligne 24 : de contro ˆ le ne ´ gatif. (219 bp), ligne 25 : de contro
sequences were compared with reference data obtained from GenBank database using BLAST and all DNA sequences were submitted to GenBank. Table 3 shows accession numbers of the isolates that were sequenced in the D1/D2 and IGS regions. Sequence analysis of PCR amplicons of D1/D2 regions revealed all of the isolates were C. neoformans var. grubii except 2 isolates (TSh 7 and TSh 13) that were C. neoformans var. neoformans. All the sequences showed nearly 99% query coverage and 99% maximum identity. Using IGS sequence analysis, all isolates were correctly identified to species level with nearly 94% query coverage and 99% maximum identity.
Discussion This study of Iranian Cryptococcus isolates was performed as an effort to determine the characteristics environmental Cryptococcus strain, including the varieties and mating types within the northern region of country. Our aim was to provide preliminary data, which could act as basis for investigating an acceptable number of environmental and clinical isolates in the future. As far as we know, the data reported gave for the first time a general overview about molecular characterization and mating type distribution of C. neoformans in Iran. The pigeon excreta the best recognised of putative environmental risk factor can be a source of C. neoformans and other Cryptococcus species and has a potential risk especially for immunocompromised patients [38]. In Iran, there have been a few studies on the occurrence and identification of C. neoformans from pigeon excreta [18,26,28,31] and other avian droppings [17] in public residence. The present study is performed 37 years after the first screening [12] and 14 years after the second sampling [18] in northern Iran. The isolation rates were 15.2% and 17.8%
S. Agha Kuchak Afshari et al. respectively in these investigations, although the number of samples in each cites and the cities, which were studied varied from the present study. Moreover, the prevalence of C. neoformans varies strikingly between different sites of Iran from 0.8% in west [26] to 34% in south [42]. The present investigation has shown the lower occurrence (5%) of C. neoformans in pigeon excreta in comparison with the two previous studies in this area, whereas it is fully compatible with our recent finding on swallow [17]. There are several hypotheses that account for these differences. They could result from the diversity of climate and habitat conditions (such as pH, relative’s humidity and sunlight exposure) of C. neoformans in pigeon dropping. The number of collected samples from each location, availability of holy places and aviary shops, diets with alkaline pH, the composition of the excreta, co-infection with free living amoebae and bacteria, sanitary condition are variables that possibly influenced the results of these investigations [6,34,36]. Moreover, the fast growing saprophytic fungi, which are growing on NSA might be act as a competing organism with C. neoformans and affect on isolation rates [14]. The high isolation rates from some areas can be resulted from the number of cage inhabitants, high density of cages, accumulation of excreta and seed and insufficient ventilation, which can serve as substrate for growth of the yeast [11,25]. The low rate of isolation of fungus from holy places, aviary shop and houses in present study is due to low quantity of bird guano available be as a result of frequent cleaning and disinfecting of the cages [11]. In this study, the frequency of isolated Cryptococcus in old building with accumulation of excreta was much more than newly constructed buildings. The Mazandaran province is located in northern Iran and in the southern coast of the Caspian Sea. It has a moderate, subtropical climate with an average temperature of 25 8C in summer and about 8 8C in winter and humid temperate climate with a plenty of annual rainfall. Although snow may fall heavily in the mountains in winter, it rarely falls around sea lines. Our study samples were collected over of a period of one year. Due to small number of samples and distributed nonuniformly throughout this year, our survey could not clear the seasonal variation properly. But it is shown that the isolation C. neoformans var. grubii was significantly lower in the rainy season. This finding is similar to the reported low isolation frequency of this organism the rainy season of north-western India [37]. In spite of another study that determined in environmental occurrence of yeasts did not find any seasonal variation [20]. There was no isolation in some cities which could be due to unfavorable environmental conditions or as a result of less pigeon excrement available in the cages and the presence of various fast-growing filamentous or yeasts fungi which grew on the plates and act as a competing organism with isolation of Cryptococcus species. Some studies had already indicated an inverse relation between sunlight exposure of excrement and C. neoformans occurrence [5,29]. Even though, our samples were gathered from areas with little or no sunlight exposure and this factor did not appear to be a determining factor. As far as we are aware, this is the first study on molecular characterization of C. neoformans isolated from pigeon excreta in Iran. In this study we employed sequence analysis of the large subunit rRNA gene (D1/D2) and the intergenic
Epidemiology and molecular characterization of Cryptococcus neoformans spacer regions for detected Cryptococcus species that revealed all of the isolates were C. neoformans var. grubii except two isolates that were C. neoformans var. neoformans. In various researches sequence analysis of the IGS or D1/D2 regions is used for the identification of the Cryptococcus species [9,10]. Analysis of the D1/D2 region, which is generally used for phylogenetic analysis, revealed that there is only one nucleotide diversity between the D1/D2 sequences of var. neoformans and C. gattii [10]. IGS sequence analysis recommended that Cryptococcus isolates should be considered two distinct species; C. neoformans and C. gatti and C neoformans var. grubii (serotype A) should not be considered as separate variety [9]. In this study, it was found that sequence of D1/D2 region provides an accurate identification than that of IGS region. The presence of the C. neoformans var. grubii is not surprising because it is most common C. neoformans in the world which can be isolated from avian, especially pigeon, habitant, soil contaminated avian excreta and decaying wood [15,19,24,37,39]. Despite the fact that all varieties of C. neoformans are capable of growth on pigeon guano, only var. grubii and var. neoformans exhibit prolific mating, completing its life cycle. Then, bird guano may represent the ecological niche for C. neoformans [34]. Moreover, most clinical and veterinary cases worldwide are also caused by C. neoformans var. grubii [6,39]. The results of the mating type analysis revealed all of our isolates were a mating type, which were in complete agreement with those reports in other countries that indicated MATa is more prevalent than MATa [21]. MATa strains of clinical and environmental cryptococcal isolates are much more virulent than MATa [21,27]. Mating type has a welldocumented but poorly understood relationship with C. neoformans infection [27]. The vast majority of infections are cause by isolates of mating type a, not mating type ‘‘a’’ [38]. Kwon-Chung et al. [21] created congenic mating type a and mating type ‘‘a’’ in a strain of C. neoformans serotype D and found that the mating type a strain substantially more virulent than the mating type ‘‘a’’ strain in a mouse model. But Nielson et al. [33] assessed virulence of C. neoformans serotype A in two frequently used animal models and they saw no difference in the levels of virulence of the mating type ‘‘a’’ and mating type a strain, thus the situation with serotype A seems quite different from that with serotype D. In conclusion, our results reinforce that the pigeon excreta is a favorable environment rich in nitrogen and support the growth of C. neoformans and the pigeon could play an important role in spread of this organism. We do not know if C. neoformans var. grubii is the most common variety in clinical sample in Mazandaran because the present study only analyzed environmental strains. Clinical strains should be isolated and undergo molecular typing. Such a study would offer insight into the importance of this strain in relation to infection. Therefore further environmental and clinical investigations are warranted to determine the extent of C. neoformans variety in climatically different regions of Iran.
Disclosure of interest The authors declare that they have no conflicts of interest concerning this article.
165
Acknowledgment We are grateful to the vice-chancellor of research of Mazandaran university of medical sciences for financial support. We would like also to thank Miss. Sabah Mayahi and Mr. Iman Haghani for technical assistance.
References [1] Alilou M, Emami M, Zanian MT, Ahmadi M. Le premier cas, la cryptococcose généralisée en Iran. Iran J Public Health 1978;7:180—5. [2] Bijani K, Abbasi A. Pulmonary infection due to Cryptococcus neoformans in a patient without immunodeficiency; a case report. J Babol Uni Med Sci 1999;1:21—7. [3] Bovers M, Hagen F, Kuramae EE, Diaz MR, Spanjaard L, Dromer F, et al. Unique hybrids between the fungal pathogens Cryptococcus neoformans and Cryptococcus gattii. FEMS Yeast Res 2006;6:599—607. [4] Bovers M, Hagen F, Kuramae EE, Hoogveld HL, Dromer F, StGermain G, et al. AIDS patient death caused by novel Cryptococcus neoformans C. gattii hybrid. Emerg Infect Dis 2008;14:1105—8. [5] Caicedo LD, Alvarez MI, Delgado M, Cárdenas A. Cryptococcus neoformans in bird excreta in the city zoo of Cali, Colombia. Mycopathol 1999;147:121—4. [6] Casadevall A, Perfect JR. Cryptococcus neoformans. Washington: ASM Press; 1998. p. 451. [7] Castanón-Olivares LR, López-Martínez R. Isolation of Cryptococcus neoformans from pigeon (Columba livia) droppings in Mexico City. Mycoses 1994;37:325—7. [8] Chaturvedi V, Chaturvedi S. Cryptococcus gattii: a resurgent fungal pathogen. Trends Microbiol 2011;19:564—71. [9] Diaz MR, Boekhout T, Theelen B, Fell JW. Molecular sequence analyses of the intergenic spacer (IGS) associated with rDNA of the two varieties of the pathogenic yeast, Cryptococcus neoformans. Syst Appl Microbiol 2000;23:535—45. [10] Fell JW, Boekhout T, Fonseca A, Scorzetti G, Statzell-Tallman A. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int J Syst Evol Microbiol 2000;50:1351—71. [11] Filiú WF, Wanke B, Agüena SM, Vilela VO, Macedo RC, Lazéra M. Avian habitats as sources of Cryptococcus neoformans in the city of Campo Grande, Mato Grosso do Sul. Brazil Rev Soc Bras Med Trop 2002;35:591—5. [12] Forouzesh K. Isolation of Cryptococcus neoformans from soil of coast of Caspian Sea. PhD thesis, Tehran University, 1979. [13] Ghasemian R, Najafi N, Shokohi T. Cryptococcal meningitis relapse in an immunocompetent patient. Iranian J Clin Infect Dis 2011;6:51—5. [14] Granados DP, Castan?da E. Isolation and characterization of Cryptococcus neoformans varieties recovered from natural sources in Bogotá, Colombia, and study of ecolological conditions in the area. Microbiol Ecol 2005;49:282—90. [15] Gugnani HC, Mitchell TG, Litvintseva AP, Lengeler KB, Heitman J, Kumar A, et al. Isolation of Cryptococcus gattii and Cryptococcus neoformans var. grubii from the flowers and bark of Eucalyptus trees in India. Med Mycol 2005;43:565—9. [16] Haghi-Ashtiani MT, Haghani H, Makki N. Cryptococcal meningitis. A case report. Iranian J Pediatr 1995;5:13—26. [17] Hedayati MT, Mayahi S, Fakhar M, Shokohi T, Majidi M. Cryptococcus neoformans isolation from swallow (Hirundo rustica) excreta in Iran. Rev Inst Med Trop Sao Paulo 2011;53(3):125—7. [18] Khosravi AR. Isolation of Cryptococcus neoformans from pigeon (Columba livia) droppings in northern Iran. Mycopathol 1997;139:93—5.
166 [19] Hiremath SS, Chowdhary A, Kowshik T, Randhawa HS, Sun S, Xu J. Long-distance dispersal and recombination in environmental populations of Cryptococcus neoformans var. grubii from India. Microbiol 2008;154:1513—24. [20] Krockenberger MB, Canfield PJ, Malik R. Cryptococcus neoformans in the koala (Phascolarctos cinereus): colonization by Cryptococcus neoformans var. gattii and investigation of environmental sources. Med Mycol 2002;40:263—72. [21] Kwon-Chung KJ, Edman JC, Wickes BL. Genetic association of mating types and virulence in Cryptococcus neoformans. Infect Immun 1992;60:602—5. [22] Kwon-Chung KJ. Morphogenesis of Filobasidiella, the sexual state of Cryptococcus neoformans B and C serotypes. Mycologia 1976;68:821—33. [23] Lagrou K, van Eldere J, Keuleers S, Hagen F, Merckx R, Verhaegen J, et al. Zoonotic transmission of Cryptococcus neoformans from a magpie to an immunocompetent patient. J Intern Med 2005;257:385—8. [24] Litvintseva AP, Thakur R, Vilgalys R, Mitchell TG. Multilocus sequence typing reveals three genetic subpopulations of Cryptococcus neoformans var. grubii (Serotype A), including a unique population in Botswana. Genetics 2006;172:2223—38. [25] Lugarini C, Goebel CS, Condas LA, Muro MD, de Farias MR, Ferreira FM, et al. Cryptococcus neoformans Isolated from Passerine and Psittacine bird excreta in the state of Paraná, Brazil. Mycopathol 2008;166:61—9. [26] Mikailie A. Cryptococcus neoformans in excreta of pigeons of Kermanshah (1999—2000). Behbood 2001;5:71—3. [27] Mitchell AP. Updated view of Cryptococcus neoformans mating type and virulence. Infect Immun 2003;71:4829—30. [28] Moghadami M, Kordbache P, Emami M. A case report of cryptoccocal meningitis. Iran J Public Health 1988;17:61—8. [29] Montenegro H, Paula CR. Environmental isolation of Cryptococcus neoformans var. gattii and C. neoformans var. neoformans in the city of Sao Paulo, Brazil. Med Mycol 2000;38:385—90. [30] Moore TD, Edman JC. The alpha-mating type locus of Cryptococcus neoformans contains a peptide pheromone gene. Mol Cell Biol 1993;13:1962—70. [31] Nasr Isfahani B, Shadzi Sh, Chadegani Pour M, Ilchi N. Isolation and detection of Cryptococcus neoformans from pigeon droppings: Isfahan and its suburbs. J Res Med Sci 2001;6:155—7.
S. Agha Kuchak Afshari et al. [32] Nazeri M. A survey of Cryptococcus neoformans in decaying wood of tree trunk hallow. MSc thesis, Sari Medical School, Mazandaran University of Medical Sciences, 2003. [33] Nielsen K, Cox GM, Wang P, Toffaletti DL, Perfect JR, Heitman J. Sexual cycle of Cryptococcus neoformans var. grubii and virulence of congenic a and alpha isolates. Infect Immun 2003;71:4831—41. [34] Nielsen K, De Obaldia AL, Heitman J. Cryptococcus neoformans mates on pigeon guano: implications for realized ecological niche and globalization. Eukaryot Cell 2007;6:949—59. [35] Nosanchuk JD, Shoham S, Fries BC, Shapiro DS, Levitz SM, Casadevall A. Evidence of zoonotic transmission of Cryptococcus neoformans from a pet cockatoo to an immunocompromised patient. Ann Intern Med 2000;132:205—8. [36] Passoni LF, Wanke B, Nishikawa MM, Lazéra MS. Cryptococcus neoformans isolated from human dwellings in Rio de Janeiro, Brazil: an analysis of the domestic environment of AIDS patients with and without cryptococcosis. Med Mycol 1998; 36:305—11. [37] Randhawa HS, Kowshik T, Chowdhary A, Prakash A, Khan ZU, Xu J. Seasonal variations in the prevalence of Cryptococcus neoformans var. grubii and Cryptococcus gattii in decayed wood inside trunk hollows of diverse tree species in northwestern India: a retrospective study. Med Mycol 2011;49: 320—3. [38] Richardson MD, Warnock DW. Fungal infection — diagnosis and management. Massachuset: Blackwell Publishing; 1997. p. 216. [39] Viviani MA, Cogliati M, Esposto MC, et al. Molecular analysis of 311 Cryptococcus neoformans isolates from a 30-month ECMM survey of cryptococcosis in Europe. FEMS Yeast Res 2006; 6:614—9. [40] Yamada Y, Makimura K, Mirhendi H, Ueda K, Nishiyama Y, Yamaguchi H, et al. Comparison of different methods for extraction of mitochondrial DNA from human pathogenic yeasts. Jpn J Infect Dis 2002;55:122—5. [41] Zaini F, Bineshian F. The first report of Cryptococcus gattii in Iran. The proceeding of Second Congress of Medical Parasitology. Tehran, Iran; 1997, p. 71. [42] Zarrin M, Jorfi M, Amirrajab N, Rostami M. Isolation of Cryptococcus neoformans from pigeon droppings in Ahwaz, Iran. Turk J Med Sci 2010;40:313—6.