Epididymal protease inhibitor (EPPIN) is a protein hub for seminal vesicle-secreted protein SVS2 binding in mouse spermatozoa

Molecular and Cellular Endocrinology 506 (2020) 110754

Contents lists available at ScienceDirect

Molecular and Cellular Endocrinology journal homepage: www.elsevier.com/locate/mce

Epididymal protease inhibitor (EPPIN) is a protein hub for seminal vesiclesecreted protein SVS2 binding in mouse spermatozoa

T

Noemia A.P. Mariania, Aline C. Camaraa, Alan Andrew S. Silvaa, Tamiris R.F. Raimundoa, Juliana J. Andradea, Alexandre D. Andradea, Bruno C. Rossinic,d, Celso L. Marinoc,d, Hélio Kushimaa, Lucilene D. Santosb,e, Erick J.R. Silvaa,∗ a

Department of Pharmacology, Institute of Biosciences, São Paulo State University (UNESP), Botucatu-SP, Brazil Center for the Study of Venoms of Venomous Animals (CEVAP), São Paulo State University (UNESP), Botucatu-SP, Brazil c Biotechnology Institute (IBTEC), São Paulo State University (UNESP), Botucatu-SP, Brazil d Department of Genetics, Institute of Biosciences, São Paulo State University (UNESP), Botucatu-SP, Brazil e Graduate Program in Tropical Diseases, Botucatu Medical School (FMB), São Paulo State University (UNESP), Botucatu-SP, Brazil b

A R T I C LE I N FO

A B S T R A C T

Keywords: EPPIN Spermatozoa Mouse SVS2 Male contraception

EPPIN is a sperm-surface drug target for male contraception. Here we investigated EPPIN-interacting proteins in mouse spermatozoa. We showed that EPPIN is an androgen-dependent gene, expressed in the testis and epididymis, but also present in the vas deferens, seminal vesicle and adrenal gland. Mature spermatozoa presented EPPIN staining on the head and flagellum. Immunoprecipitation of EPPIN from spermatozoa pre-incubated with seminal vesicle fluid (SVF) followed by LC-MS/MS or Western blot revealed the co-immunoprecipitation of SVS2, SVS3A, SVS5 and SVS6. In silico and Far-Western blot approaches demonstrated that EPPIN binds SVS2 in a protein network with other SVS proteins. Immunofluorescence using spermatozoa pre-incubated with SVF or recombinant SVS2 demonstrated the co-localization of EPPIN and SVS2 both on sperm head and flagellum. Our data show that EPPIN's roles in sperm function are conserved between mouse and human, demonstrating that the mouse is a suitable experimental model for translational studies on EPPIN.

1. Introduction EPPIN (Epididymal protease inhibitor) is a cysteine-rich protein containing an N-terminal WFDC-type (Whey protein type four disulfide type) and a C-terminal Kunitz-type protease inhibitor consensus sequences (Richardson et al., 2001). In humans and rodents, EPPIN is produced by Sertoli cells in the testis and epithelial cells in the epididymis as a secreted protein found on the sperm surface (Richardson et al., 2001; Sivashanmugam et al., 2003; Silva et al., 2012b). Human EPPIN forms a protein complex on the surface of epididymal spermatozoa by binding to clusterin (CLU) and lactotransferrin (LTF) (Wang et al., 2007). Upon ejaculation, spermatozoa are bathed in a semen coagulum and semenogelin-1 (SEMG1), the most abundant protein of the seminal plasma and an endogenous inhibitory factor of sperm motility (Robert and Gagnon, 1999; Mitra et al., 2010; Silva et al., 2013), is inserted into the EPPIN protein complex (Wang et al., 2005,

2007). EPPIN-SEMG1 interaction on the surface of ejaculate spermatozoa results in the inhibition of progressive motility in the semen coagulum (Mitra et al., 2010; Silva et al., 2013). After the degradation of SEMG1 by the enzyme prostate-specific antigen (PSA) and consequent liquefaction of semen coagulum, spermatozoa acquire progressive motility (Robert and Gagnon, 1999). Moreover, the EPPIN/LTF/CLU/SEMG1 complex provides protection to spermatozoa since EPPIN (Yenugu et al., 2004; McCrudden et al., 2008), LTF and SEMG1 are strong microbicides (Bourgeon et al., 2004) and CLU inhibits metalloproteinase activity (Matsuda et al., 2003). Thus, EPPIN is a central hub for proteinprotein interactions on spermatozoa, playing crucial roles in sperm function and protection. EPPIN has emerged as a sperm-surface target for the development of new male contraceptives. The immunization of male monkeys with recombinant human EPPIN resulted in high anti-EPPIN antibody titers

Abbreviations: EPPIN, Epididymal protease inhibitor; WFDC-type, Whey protein type four disulfide-type; CLU, Clusterin; LTF, Lactotransferrin; SEMG1, Semenogelin-1; PSA, Prostate-specific antigen; ACTG2, Actin; Rps18, Ribosomal protein S18; Ppia, Cyclophilin A; BSA, Bovine serum albumin; DAPI, 4,6-diamidino2-fenilindole; SVS, Seminal-vesicle secreted protein ∗ Corresponding author. E-mail address: [email protected] (E.J.R. Silva). https://doi.org/10.1016/j.mce.2020.110754 Received 21 October 2019; Received in revised form 16 January 2020; Accepted 4 February 2020 Available online 07 February 2020 0303-7207/ © 2020 Elsevier B.V. All rights reserved.

Molecular and Cellular Endocrinology 506 (2020) 110754

N.A.P. Mariani, et al.

amino acid residues D75-E88 (anti-SVS3 antibody) (Araki et al., 2016); goat antibody to human actin (ACTG2) C-terminal region (anti-ACTG2 antibody). Anti-EPPIN Q20E/S21C antibodies were kindly donated by Dr. Michael O'Rand, University of North Carolina at Chapel Hill (USA) and anti-EPPIN gQ20E antibody was produced by Rheabiotech (Brazil). Anti-SVS2 and anti-SVS3 antibodies were produced by GenScript Inc. Anti-ACTG2 antibody (Sc-1616) was purchased from Santa Cruz Biotechnology. Secondary antibodies were purchased from Abcam or Jackson ImmunoResearch Inc. Recombinant mouse EPPIN (mEPPIN, P22-T134 with a N-terminal 6xHis-tag) was cloned into pET-28a (+)-TEV vector (GenScript Inc.), expressed, and purified as previously described (Silva et al., 2012a). Purified recombinant 6xHis-tagged mouse SVS2 (mSVS2, Q32-G375) was purchased from GenScript Inc.

in systemic circulation and semen, leading to infertility with no obvious side effects (O'Rand et al., 2004). In addition, anti-EPPIN antibodies recognizing a sequence on EPPIN C-terminus compete with SEMG1 for EPPIN binding and inhibited the motility of human spermatozoa in vitro (O'Rand et al., 2009; O'Rand et al., 2011; O'Rand and Widgren, 2012). The dynamics of EPPIN-SEMG1 interaction resulted in the development of EPPIN-binding compounds that mimic the effects of SEMG1 and anti-EPPIN antibodies, thus resulting in the inhibition of sperm motility (O'Rand et al., 2011; O'Rand et al., 2016). In fact, recent studies showed that the small organic molecule EP055, which competes with both SEMG1 and anti-EPPIN S21C antibody for binding to EPPIN, inhibited sperm motility in monkeys following intravenous administration (O'Rand et al., 2018). Considering the development of novel EPPIN-binding contraceptive drugs, animal models are required to test their safety and efficacy in vivo in pre-clinical trials, as well as to provide a deeper understanding on EPPIN functions and mechanism of action. For that, the mouse emerges as an interesting experimental model, considering that EPPIN primary sequence is highly conserved between humans and mice, reaching ~80% identity in their C-terminal region. Importantly, human EPPIN amino acid residues found to be crucial for EPPIN-SEMG1 binding (C110, Y107, F117 and Q118) (Silva et al., 2012a; O'Rand et al., 2016) are conserved in mouse EPPIN. Based on that, we hypothesize that EPPIN roles on sperm function are conserved in humans and mice. Although selective EPPIN expression has been demonstrated in the mouse testis and epididymis (Sivashanmugam et al., 2003), the further development of this species as an experimental model to study EPPIN and its potential contraceptive applications still requires a deeper knowledge on its expression profile in reproductive and non-reproductive tissues, as well as the identification of its interacting partners on spermatozoa. Herein, we demonstrated that EPPIN is a central hub for the binding of the seminal vesicle-secreted protein SVS2, which is homologous to human SEMG1, on mouse mature spermatozoa. We also fully characterized EPPIN expression profile in mouse reproductive and non-reproductive tissues, showing that it is mostly restricted to the male reproductive tract. Our findings shed new light into EPPIN's functional conservation between humans and mice, supporting that mice are suitable experimental models for the pre-clinical development of new spermostatic drugs based on EPPIN binding.

2.2. Animals and orchidectomy Male C57BL/6 mice (10, 20, 40, 60 and 90 days old) were obtained either from Anilab Laboratory (Paulínia/SP) or from Instituto Nacional de Farmacologia, Universidade Federal de São Paulo – Escola Paulista de Medicina (UNIFESP-EPM). We maintained the animals under controlled light (12 h light:dark cycle) and temperature (22–24 °C), with food and water ad libitum. We conducted all procedures according to the National Council of Animal Experimentation (CONCEA, Brazil) guidelines for animal care and use of laboratory animal, approved by the Research Committee from UNESP (processes #1049 and #703), from UNIFESP-EPM (process #9776170216). A group of adult mice (90 days old) were submitted to orchidectomy as described by Mendes et al. (2004). Animals were euthanized 1, 3, and 10 days after surgery. Another group of mice were orchidectomized, treated daily with testosterone propionate (8 mg/kg body weight, s.c.) for 2 days and euthanized 3 days after surgery. Animals were euthanized by inhaled isoflurane overdose. Reproductive and non-reproductive organs of the animals were dissected, immediately frozen in liquid nitrogen and stored at −80 °C until further processing or immersed in fixative solution for histological processing. We also collected spermatozoa from different regions of the epididymis (initial segment, caput, corpus and cauda) for protein extraction and immunofluorescence assays. 2.3. Conventional polymerase chain reaction (PCR) and real-time PCR (qPCR)

2. Materials and methods We performed total RNA extraction and reverse transcriptase (RT) for cDNA synthesis as described in Supplementary Materials and Methods. We carried out conventional PCR assays using gene-specific primers for the amplification of Eppin and Rps18 (ribosomal protein S18, endogenous control) transcripts (Table 1), as described in Supplementary Materials and Methods. We performed qPCR experiments using Kappa Master Mix SYBR Universal (Kappa Biosystems) for the relative expression assays, which were performed to evaluate the relative levels of the Eppin transcript in the testis, epididymis and seminal vesicle of mice at different stages of sexual maturation (10, 20, 40, 60 and 90 days old) and in the epididymis of adult mice submitted to orchidectomy with or without testosterone replacement, as described in Supplementary Materials and

2.1. Reagents, kits and antibodies All reagents and chemicals were molecular-biology grade and were purchased either from Sigma-Aldrich or Thermo Fisher Scientific. The following primary affinity-purified polyclonal antibodies were used in this study: rabbit antibody to mouse EPPIN amino acid residues Q20E39 (anti-EPPIN Q20E antibody) (Wang et al., 2005); goat antibody to mouse EPPIN amino acid residues Q20-E39 (anti-EPPIN gQ20E antibody); rabbit antibody to human EPPIN amino acid residues S103–C123 (anti-EPPIN S21C antibody) (O'Rand et al., 2009); rabbit antibody to mouse SVS2 amino acid residues R353-C367 (anti-SVS2 antibody) (Kawano et al., 2014); rabbit antibody to mouse SVS3A Table 1 Oligonucleotides primers used in the RT-PCR and qPCR assays. Transcript

Acession Number

Sense

Sequences (5′-3′)

Efficiency (%)

Amplicon size (bp)

Eppin

NM_029325

204

NM_011296

104%

207

Ppia

NM_008907

TCTTGTGCTATTTGGCCTGCT TCCCAGCGTATCCTCTGTTC GTTCGCCAGAATGAAGCTTTC TACTGTCGTGGGTTCTGCAT GTCTCCTTCGAGCTGTTTGC GCGTGTAAAGTCACCACCCT

104%

Rps18

+ + + -

97%

150

2

Molecular and Cellular Endocrinology 506 (2020) 110754

N.A.P. Mariani, et al.

incubated with blocking solution supplemented with 0.02% saponin (m/v) for 60 min, anti-EPPIN Q20E antibody (5 μg/ml) overnight at 4 °C, and Alexa Fluor 594 conjugated anti-rabbit secondary antibody (10 μg/ml) for 60 min. 4,6-diamidino-2-fenilindole (DAPI) was used for nuclear identification. Negative control experiments were performed without primary antibody. Images were documented using appropriate excitation filters. For co-localization assays, we used spermatozoa from the cauda epididymis pre-incubated or not with PBS-soluble fraction of seminal vesicle fluid or recombinant mSVS2 (5 μm) for 30 min at 37 °C (5% CO2/95% air). Smears were sequentially incubated with antiEPPIN gQ20E antibody (20 μg/ml), anti-SVS2 antibody (0.5 μg/ml) overnight at 4 °C each, and secondary antibodies Alexa Fluor 488 conjugated anti-goat secondary antibody (10 μg/ml) and Alexa Fluor 594 conjugated anti-rabbit secondary antibody (10 μg/ml) for 60 min each. Negative control assays were performed in the absence of either or both primary antibodies. The final pictures were chosen to represent the pattern of EPPINpositive staining routinely observed in immunohistochemistry and immunofluorescence experiments and subjected to the same brightness/ contrast adjustments using ImageJ software (Schindelin et al., 2012).

Methods. The relative expression levels of Eppin transcript were normalized with values of the housekeeping gene Cyclophilin A (Ppia), used as endogenous control and calculated according to the methodology described by Pfaffl (2001). We performed the absolute quantification of Eppin transcript levels in the different regions of the epididymis (initial segment, caput, corpus and cauda) using PowerUp™ SYBR™ Green Master Mix Kit (Applied Biosystems) as described in Supplementary Materials and Methods. Upon amplification of cDNA samples their respective Ct values were compared to the linear regression curve of the titration curve (R2 = 0.9991, equation Y = −3.392*X + 39.05) to obtain the approximate copy number value of the Eppin transcript for each segment of the epididymis. 2.4. Western blot and Far-Western blot analysis Experiments were performed as described by Silva et al. (2012b). Total proteins from tissue and sperm samples were size-separated by SDS-PAGE as described in Supplementary Materials and Methods. Membranes were then incubated in blocking solution containing 5% milk (m/v) in TBS-T buffer (100 mM Tris-HCl pH 8.0, 150 mM NaCl and 0.05% Tween 20, v/v) for 1.5 h, then probed with one of the following antibodies: anti-EPPIN Q20E antibody (0.4 μg/ml and 1.5 μg/ml for tissue and sperm samples, respectively), anti-EPPIN S21C antibody (0.4 μg/ml and 1.5 μg/ml for tissue and sperm samples, respectively), anti-SVS2 antibody (0.2 μg/ml), anti-SVS3 antibody (0.5 μg/ml) or anti-ACTG2 (0.03 μg/ml) antibody, followed by appropriated secondary antibodies conjugated to horseradish peroxidase (0.01 μg/ml). Negative control experiments were performed in the presence of antiEPPIN antibodies pre-adsorbed with 10-fold molar excess of recombinant EPPIN, anti-SVS2 antibody pre-adsorbed with 30-fold molar excess of the blocking peptide, with normal rabbit IgG (Vector Laboratories) in substitution for primary antibodies, or absence of primary antibody. Recombinant mSVS2 (1 μg) was immobilized on a PVDF membrane, as described above. Membrane was incubated in blocking solution (TBS-T buffer supplemented with 1% BSA, m/v) for 1 h and probed with mEPPIN (3 μg/ml) diluted in blocking solution overnight at 4 °C. After a 5-min wash in TBS-T buffer, membrane was probed with antiEPPIN Q20E antibody as described above. Negative control experiments were performed in the absence of probe protein or with BSA in substitution for recombinant mSVS2.

2.6. Co-immunoprecipitation assay We performed co-immunoprecipitation assays using the MSCompatible Magnetic IP Protein A/G kit (Pierce) according to the manufacturer's recommendations. We collected ~14.0 × 106 spermatozoa from corpus/cauda epididymis in phosphate buffer (100 mM sodium phosphate, 150 mM NaCl, pH 7.2). We then incubated spermatozoa with PBS-soluble fraction of seminal vesicle fluid for 30 min at 37 °C (5% CO2/95% air). After washing the cells in phosphate buffer, we added the lysis buffer (500 μl/50 mg cell pellet) containing protease inhibitor cocktail (Sigma). Then, we processed the samples by: 1) vortexing for 30 s; 2) a sonication cycle at 30 Hz/1 min on ice; 3) homogenization in Polytron homogenizer, 17,000 rpm for 1 min on ice; 4) incubation at 4 °C for 1 h under stirring and; 5) three cycles of freezing in dry ice and thawing in ice. Samples were centrifuged (13,000 × g, 10 min), and then supernatants were collected. Next, we added 5 μg anti-EPPIN Q20E antibody to the lysate. After overnight incubation at 4 °C under shaking, we added the magnetic nanospheres coupled to protein A/G (25 μl) and incubated for 1 h at RT. Then, we washed the immunocomplex using wash buffers A and B using a DynaMag-2 Magnet magnetic carrier (Thermo Fisher Scientific). Finally, we eluted the co-immunoprecipitated proteins using the elution buffer. Eluates were dried in a vacuum concentrator and the dried samples were stored at −80 °C until further analysis.

2.5. Immunohistochemistry and immunofluorescence studies We performed immunohistochemistry studies using Paraplast-embedded testis, epididymis, seminal vesicle and adrenal gland sections (4 μm) previously fixed in 4% paraformaldehyde solution as described by Silva et al. (2012b). Antigen retrieval and blocking endogenous peroxidase were performed as described in Supplementary Materials and Methods. We sequentially incubated samples with blocking solution containing 3% BSA (m/v) in phosphate buffer (10 mM Na2HPO4, 1.4 mM NaH2PO4.H2O, 150 mM NaCl, pH 7.5) for 60 min, anti-EPPIN Q20E antibody (4.6 μg/ml, diluted in blocking solution containing 1% BSA, m/v) overnight at 4 °C, and anti-rabbit secondary antibody conjugated to biotin for 60 min. Vectastain Elite ABC HRP kit (Vector Laboratories) was used to localize biotinylated antibodies and peroxidase activity was revealed using diamino-benzidine peroxidase substrate kit (Vector Laboratories), according to manufacturer's recommendations. Negative control experiments were performed with anti-EPPIN antibody pre-adsorbed with a 10-fold molar excess of recombinant EPPIN. Tissue sections were counterstained with hematoxylin. We performed immunofluorescence assays using spermatozoa isolated from testis and epididymis (initial segment, caput, corpus and cauda) as described in Supplementary Materials and Methods. Briefly, paraformaldehyde-fixed air-dried sperm smears were sequentially

2.7. Peptide sequencing by LC-MS/MS After co-immunoprecipitation, we submitted samples to protein digestion in solution as described by Sylvestre et al. (2018). Briefly, samples were alkylated in the presence of 45 μM iodoacetamide and then submitted to protein hydrolysis by incubation with trypsin enzyme (1 ng/μl) overnight at 37 °C. We quenched the reaction by adding 1% trifluoroacetic acid (v/v). After centrifugation (15,000 × g, 2 min), the tryptic digests were subjected to PeptideCleanup C18 Spin desalination columns (Agilent Technologies). We performed mass spectrometry label-free analysis on Ultimate 3000 LC (Dionex) liquid nanocromatography equipment coupled to the Q-Exactive™ Hybrid Quadrupole-Orbitrap™ mass spectrometer (Thermo Fisher Scientific) using LC/MS reagents. Ionization was obtained using Nanospray ion source (PicoChip, Model 1PCH-550, 75 μm ReproSil Pur C18 3 μm; New Objective, USA) with pre-concentration on 2 cm Acclaim PepMap 100 trap (75 μm ID, C18 3 μm; Thermo Fisher Scientific). Each sample (2.5 μg) were separeted in a binary phase, were mobile phase A consisted of 0.1% formic acid in water and mobile phase B of 0.1% formic acid in acetonitrile at constant flow of 300 nl/ 3

Molecular and Cellular Endocrinology 506 (2020) 110754

N.A.P. Mariani, et al.

incubated with the primary antibody pre-adsorbed with recombinant EPPIN (Fig. 1D). In the testis, immunohistochemistry studies revealed the presence of EPPIN-positive immunostaining in the cytoplasm of primary spermatocytes, round spermatids, elongated spermatids and some but not all Sertoli cells (Supplementary Figs. S1A and B). In the epididymis, we observed EPPIN-positive immunostaining in principal and basal cells of the epithelium in all regions, as well as in apical cells in the initial segment (Supplementary Figs. S1C–E). We further observed EPPINpositive immunostaining along the epithelial cell basolateral compartment in the initial segment and caput regions (Supplementary Figs. S1C–E). Based on a qualitative analysis, EPPIN-positive immunostaining was more abundant in the epithelial compartment of the corpus epididymis in comparison to other epididymal regions (Supplementary Figs. S1C–E). In the seminal vesicle, we observed EPPIN-positive immunostaining in the cytoplasm of epithelial cells in primary and secondary mucosal curvature (Supplementary Figs. S1F and G). Interstitial cells and smooth muscle cells of the seminal vesicle, as well as the luminal compartment did not present evident signs of EPPIN-positive immunostaining (Supplementary Figs. S1F and G). In the adrenal gland, we detected abundant EPPIN-positive immunostaining in chromaffin cells of the adrenal medulla (Supplementary Fig. S2). In the adrenal cortex, immunostaining was detected in the cytoplasm of cells from glomerulosa (peripheral), fasciculata (central) and reticularis (internal) zones (Supplementary Figs. S1F and G). All immunostaining were abolished using the primary antibody pre-adsorbed with recombinant EPPIN (Supplementary Figs. S1 and S2).

min. The gradient consisted from 2% to 40% mobile phase B over 2 h, followed by 10-min column wash at 80% mobile phase B and column re-equilibration for 10 min at 2% mobile phase B. The operation mode was positive ionization using data dependent acquisition (DDA) method. MS spectra were obtained from m/z 200 to m/z 2000, resolution of 70,000 and 100 ms of injection time. Normalized collision energy of 30 was set, with resolution of 17,500, 50 ms of injection time, 1.2 m/z of isolation window and dynamic exclusion time of 10 s. Charge exclusion was set to 1 and greater than 5, with isotope exclusion. The spectrometric data were then acquired using the ThermoXcalibur software, version 4.0.27.19. Protein identification was performed using the software PatternLab for Proteomics, version 4.0.0.84 (Carvalho et al., 2015). The main parameters used were: NCBI database (Mus musculus taxonomy); trypsin enzyme semi-specific; permission of 2 missed cleavages; post-translational modification: carbamidomethylation of cysteine residues; variable post-translational modification: oxidation of methionine residues; precursor mass tolerance errors of 40 ppm. The FDR (False Discovery) rate was considered 1%. Protein-protein interaction network involving EPPIN and its binding partners was established using the on-line platform STRING (version 10.5, http://string-db.org), which is a database that comprises known and predicted protein-protein interactions (Szklarczyk et al., 2015). Active interaction sources included text mining, experiments, databases, co-expression, neighborhood and co-occurrence, species was limited to Mus musculus, interaction confidence score was set to ≥0.40 and PPI enrichment p-value of < 1.0e-16. 2.8. Statistical analysis We expressed the results as mean ± standard error of the mean (SEM). Statistical differences between two groups were analyzed using Student's t-test, while the differences between more than two groups, by analysis of one-way variance (ANOVA), followed by the Tukey's test. We considered significant the differences associated with the probability p < 0.05. The statistical treatment of the data was implemented by the program GraphPad Prism 5.01 (GraphPad Software).

3.2. EPPIN is upregulated by sexual maturation and downregulated by orchidectomy in reproductive tissues We observed an increase in the relative expression of Eppin transcript in the mouse testis, epididymis, and seminal vesicle during sexual maturation (Fig. 2). In the testis, qPCR assays demonstrated a 5-fold increase in the relative Eppin transcript expression in 20-day-old mice when compared to 10-day-old mice (Fig. 2A). In addition, we observed that the expression of this transcript was increased in 40-day-old mice compared to 10- and 20-day-old animals (Fig. 2A). Moreover, consistently with our qPCR data, we detected the same expression pattern when comparing the abundance of Eppin bands in cDNA samples from the testis from the same groups by conventional PCR assay (Fig. 2B). Similarly, we observed a 6-fold increase in the relative Eppin expression in the seminal vesicle of 40-, 60- and 90-day-old mice in comparison to 20-day old mice (Fig. 2E). The relative expression of Eppin transcript stabilized at 40 days of age in both testis and seminal vesicle, as no difference was observed among 40-, 60- and 90-day old mice (Fig. 2A, E). In the epididymis, qPCR revealed a 77-fold increase in the relative Eppin transcript levels in whole epididymis from 20-day-old mice when compared to 10-day-old mice (Fig. 2C). In older animals, the analysis of the relative expression of Eppin transcript levels according to each epididymal region revealed 1.4-fold increase in the initial segment of 90-day-old animals when compared 60-day-old mice (Fig. 2D). In contrast, relative Eppin mRNA levels remained unchanged when caput, corpus and cauda from 40-, 60- and 90-day-old animals were compared (Fig. 2D). Consistent with this data, immunohistochemistry performed using testis, epididymis and seminal vesicle from 40-, 60- and 90-dayold mice showed no evident differences in the abundance of EPPIN immunodistribution (Supplementary Fig. S3). Orchidectomy induced a time-dependent decrease in the relative Eppin transcript levels in all epididymal regions 1, 3 and 10 days postsurgery in comparison to control mice (Supplementary Fig. S4). The analysis of 3-day castrated mice revealed a decrease in the relative Eppin expression in the initial segment (6-fold), caput (5-fold), corpus (4-fold), and cauda (5-fold) (Fig. 2F; Supplementary Fig. S4).

3. Results 3.1. EPPIN is specifically expressed in androgen-producing and androgendependent tissues End-point RT-PCR analysis revealed the presence of Eppin transcript (204 bp) in the testis, epididymis (initial segment, caput, corpus and cauda), vas deferens and seminal vesicle, but not in the prostate (Fig. 1A). Absolute qPCR analysis showed that Eppin transcript was ~3and ~5-fold higher in the initial segment and corpus epididymis when compared to caput and cauda regions, respectively (Fig. 1B and C). Among all non-reproductive tissues analyzed, we detected Eppin mRNA in the adrenal glands only (Fig. 1A). We confirmed the identity of Eppin transcript in the initial segment, seminal vesicle and adrenal gland by DNA sequencing. The translation of Eppin mRNA into protein products in these tissues was confirmed by Western blot analysis and immunohistochemistry. In Western blot experiments, we detected two immunoreactive bands with apparent molecular masses of ~14 and ~19 kDa corresponding to the predicted full-length (precursor) and mature EPPIN forms, respectively, in the testis (Fig. 1D; see Supplementary Discussion). We also observed the ~14-kDa-band in all epididymal regions, vas deferens, seminal vesicle and adrenal gland (Fig. 1D). Additional bands of ~39 and ~65 kDa were detected in the vas deferens and adrenal gland, respectively (Fig. 1D). It is likely that these bands represent EPPIN dimers and oligomers, respectively (see Supplementary Discussion). The specificity of anti-EPPIN Q20E antibody was confirmed by its capacity to detect both recombinant human and mouse EPPIN and by the absence of immunoreactive bands in testis and corpus epididymis samples 4

Molecular and Cellular Endocrinology 506 (2020) 110754

N.A.P. Mariani, et al.

Fig. 1. Expression profile of EPPIN in adult mouse reproductive and non-reproductive organs. (A) Representative inverted images of agarose gels showing the expression of Eppin transcript by RT-PCR. Rps18 transcript was used as endogenous control. Testis (Te), epididymis (initial segment - IS, caput - Cp, corpus - Co, and cauda - Cd), vas deferens (VD), seminal vesicle (VS), prostate (Pr), brain (Br), cerebellum (Ce), salivary gland (SG), thymus (Th), heart (He), trachea (Tr), lung (Lu), spleen (Sp), Liver (Li), stomach (St), duodenum (Du), colon (Cl), adrenal gland (Ad), kidney (Ki), bladder (Bl), gastrocnemius (Ga), epididymis fat (Ef). MW indicates a 100 base pair (bp) standard ladder. Negative control (−) was performed in the absence of cDNA. (B) Absolute qPCR analysis showing the number of copies of Eppin transcript in 5 ng total RNA from the indicated epididymal regions. (C) Heat map depicting Eppin transcript expression in the different regions of the epididymis. Yellow, orange and red indicate low, intermediate and high levels of expression. Results expressed as mean ± SEM (n = 5/group). Different letters indicate statistical differences (p < 0.05; ANOVA followed by Tukey's test). (D) EPPIN detection by Western blot using anti-EPPIN Q20E antibody in total protein extracts from organs with positive detection of Eppin transcript shown in (A). Arrows indicate immunoreactive bands of ~14, ~19, ~39 and ~65 kDa in the tissues analyzed. Both human and mouse recombinant EPPIN were used as positive controls (+). Negative control (−) was performed with pre-adsorbed primary antibody with recombinant EPPIN. Actin (ACTG2) was used as endogenous control. MW indicates a standard protein ladder (kDa). Results in (A) and (D) are representative of experiments performed with three mice.

EPPIN (Fig. 3B); and 2) detection of EPPIN-positive immunoreactive band of ~14 kDa in immunoprecipitated samples by Western blot performed with anti-EPPIN S21C antibody (Fig. 3C, lane 1). Western blot assays performed with rabbit IgG in substitution for anti-EPPIN S21C antibody (Fig. 3C, lane 2), or in the absence of primary antibody (Fig. 3C, lane 3) showed no bands correspondent to EPPIN. Furthermore, we did not detect EPPIN when immunoprecipitation was performed with normal rabbit IgG replacing anti-EPPIN Q20E antibody and subjected to LC-MS/MS and Western blot analysis (Fig. 3C, lane 4). Immunofluorescence assays revealed a faint EPPIN-positive immunostaining in the midpiece of flagellum on spermatozoa isolated from the testis and initial segment (Fig. 3D). This staining became more abundant on spermatozoa isolated from the caput, corpus and cauda epididymis, in which we observed the presence of EPPIN in both the midpiece and principal piece of the flagellum (Fig. 3D). Spermatozoa collected from the corpus and cauda epididymis further showed EPPINpositive immunostaining on the head (acrosome and post-acrosome regions) and neck regions (Fig. 3D). Negative control assays

Testosterone replacement to 3-day castrated mice recovered Eppin mRNA expression in all epididymal regions (Fig. 2F).

3.3. EPPIN distribution in mouse spermatozoa is dynamically modulated during epididymal transit Our Western blot analysis showed the expression of EPPIN in spermatozoa collected from the initial segment/caput, corpus and cauda epididymis (Fig. 3A). We observed the presence of two immunoreactive bands with apparent molecular masses of ~14 kDa (of greater intensity) and ~19 kDa (of lower intensity) in spermatozoa from all regions analyzed (Fig. 3A). We detected no immunoreactive band when membranes were incubated with primary antibody pre-adsorbed with recombinant EPPIN (Fig. 3A). We further confirmed the ability of anti-EPPIN Q20E antibody to detect EPPIN in protein extracts from cauda epididymis spermatozoa by: 1) identification of three tryptic peptide sequences by LC-MS/MS (20GPSLADLLFPRR32, 35RFREECEEHQERD46, and 68KCLNPQQDICSLPK82) corresponding to mouse 5

Molecular and Cellular Endocrinology 506 (2020) 110754

N.A.P. Mariani, et al.

Fig. 2. Effect of sexual maturation and orchidectomy on Eppin transcript expression in mouse reproductive tissues. (A) Relative Eppin transcript expression in the testis from 10-, 20-, 40-, 60- and 90-day-old mice. Values were normalized using the Ppia transcript as the endogenous control and expressed relative to the amount of target mRNA determined in 10-day-old group. (B) Representative inverted image agarose gels showing the expression of Eppin transcript by RT-PCR in the testis of 10-, 20-, 40-, 60- and 90-day-old mice. Ppia transcript was used as endogenous control. (C, D) Relative Eppin transcript expression in the whole epididymis from 10-, 20-day-old mice and each epididymal segment (initial segment, caput, corpus and cauda) from 40-, 60- and 90-day-old mice. Values were normalized using the Ppia transcript as endogenous control and expressed relative to the amount of target mRNA determined in in 10-day-old group. (E) Relative Eppin transcript expression in the seminal vesicle from 20-, 40-, 60- and 90-day-old mice. Values were normalized using the Ppia transcript as the endogenous control and expressed relative to the amount of target mRNA determined in 20-day-old group. (F) Relative Eppin transcript expression in the epididymis (initial segment, caput, corpus and cauda) from control, 3-day orchidectomized (3-day CA) and 3-day orchimictomized mice treated daily with testosterone propionate (3-day CA + T, 8 mg/kg, s.c.). Values were normalized using the Ppia transcript as the endogenous control and expressed relative to the amount of target mRNA determined in control group. Values were expressed as mean ± SEM, n = 4–5 animals/group. Different letters indicate statistically significant differences between the groups (p < 0.05; ANOVA followed by Tukey's test in A, D and F; and Student's t-test in C).

detected an immunoreactive band with apparent molecular mass of ~45 kDa in samples co-immunoprecipitated with anti-EPPIN Q20E antibody (Fig. 4E, lane 1). Likewise, anti-SVS3 antibody detected an immunoreactive band with apparent molecular mass of ~31 kDa in samples co-immunoprecipitated with anti-EPPIN Q20E antibody (Fig. 4F, lane 1). In both cases, we did not observe these immunoreactive bands when we performed: 1) co-immunoprecipitation with anti-EPPIN Q20E antibody and western blots using anti-SVS2 or anti-SVS3 antibodies pre-incubated with their respective blocking peptides (Fig. 4E and F, lane 2); or 2) co-immunoprecipitation with normal rabbit IgG replacing the anti-EPPIN Q20E antibody and Western blots using anti-SVS2 or anti-SVS3 antibodies (Fig. 4E and F, lane 2). In addition, Western blots performed with anti-SVS2 and anti-SVS3 antibodies demonstrated their ability to recognize the ~45 and ~31 kDa band, respectively, in the PBS-soluble fraction of the seminal vesicle fluid (Fig. 4 E, F).

demonstrated the absence of immunostaining when spermatozoa were incubated in the absence of anti-EPPIN antibody (Supplementary Fig. S5). 3.4. Seminal-vesicle secreted proteins SVS2, SVS3, SVS5 and SVS6 are coimmunoprecipated with EPPIN from mouse spermatozoa In order to identify EPPIN-binding partners in mature spermatozoa, we performed co-immunoprecipitation with anti-EPPIN Q20E antibody followed by LC-MS/MS using spermatozoa collected from corpus/cauda epididymis pre-incubated with PBS-soluble fraction of seminal vesicle fluid. Immunoprecipitation of EPPIN resulted in the co-immunoprecipitation proteins whose tryptic peptides corresponded to SVS2 (Fig. 4A and B; ~68% coverage), SVS3A (Figure C, D ~33% coverage), SVS5 (Supplementary Figs. S6A and B; ~66% coverage), and SVS6 (Supplementary Figs. S6C and D; ~57% coverage). Of note, we detected EPPIN but not SVS proteins when samples from spermatozoa not incubated with the seminal vesicle fluid were submitted to co-immunoprecipitation followed by LC-MS/MS analysis. We further investigated the co-immunoprecipitation of SVS2 and SVS3a with EPPIN by Western blot. Using anti-SVS2 antibody, we

3.5. SVS2 is an EPPIN-binding protein To further investigate the potential interaction between EPPIN and SVS proteins, we employed in silico analysis to build a protein-protein 6

Molecular and Cellular Endocrinology 506 (2020) 110754

N.A.P. Mariani, et al.

Fig. 3. Identification, expression and cellular distribution of EPPIN in mouse spermatozoa. (A) EPPIN detection by Western blot using total protein extracts from spermatozoa collected from caput/initial segment, corpus and cauda epididymis. Arrows indicate immunoreactive bands of ~14 and ~19 kDa. The negative control was performed with pre-adsorbed primary antibody with recombinant EPPIN (right panel). Actin (ACTG2) was used as endogenous control. MW indicates a standard protein ladder (kDa). Results are representative of four independent experiments. (B) Mass spectrometric identification of EPPIN in immunoprecipitation assays using antiEPPIN Q20E antibody and mouse spermatozoa preincubated with seminal vesicle fluid. Tryptic peptide spectrum of the peptide KCLNPQQDICSLPK corresponding to residues 68–81 of mouse EPPIN. (C) Western blot analysis showing immunoprecipitation of EPPIN from mouse spermatozoa using anti-EPPIN Q20E antibody. Lane 1: sample immunoprecipated with anti-EPPIN Q20E antibody and probed with anti-EPPIN S21C antibody. Arrow indicate immunoreactive band of ~14 kDa; Lane 2: Negative control sample immunoprecipitated with rabbit IgG and probed with anti-EPPIN S21C antibody; Lane 3: Negative control sample immunoprecipitated with anti-EPPIN Q20E and probed with rabbit IgG in substitution for anti-EPPIN S21C antibody; Lane 4: Negative control sample immunoprecipitated with anti-EPPIN Q20E and probed with secondary antibody only. Results are representative of two independent experiments. (D) Indirect immunolocalization of EPPIN in spermatozoa collected from testis and different regions of the epididymis. EPPIN-positive-immunostaining was detected on the head (asterisk), midpiece (dotted arrow) and principal piece (solid arrow) of the sperm flagellum. Cell nuclei were stained with DAPI in blue. Testis: Te; initial segment: IS, caput: Cp, corpus: Co; and cauda: Ca; PhC: Phase contrast. Scale bar: 50 μm. Results are representative of three independent experiments.

4. Discussion

interaction network using EPPIN, SVS2, SVS3A, SVS5 and SVS6. The protein-protein interaction network built showed that EPPIN directly binds SVS2, while indirectly interacts with SVS3A, SVS5 and SVS6 via SVS2 (Fig. 5A). Consistently, the immunoprecipitation of SVS2 from mouse spermatozoa pre-incubated with seminal vesicle fluid using antiSVS2 antibody resulted in the co-immunoprecipitation of EPPIN (Fig. 5B). We identified EPPIN in samples immunoprecipitated with anti-SVS2 antibody as two bands of apparent molecular mass of ~26 kDa (higher intensity) and ~17 kDa (lower intensity) (Fig. 5B). Furthermore, our Far-Western blot experiments demonstrated the interaction between EPPIN and SVS2. Recombinant mEPPIN bound to immobilized recombinant mSVS2, as demonstrated by the presence of a ~45-kDa band when membrane was probed with anti-EPPIN antibody (Fig. 5C, lane 2). A similar band was detected when we probed the membrane with anti-SVS2 antibody (Fig. 5C, lane 1). We did not observe any immunoreactive band when the membrane was incubated in the absence of mEPPIN and probed with anti-EPPIN antibody or when BSA was used in substitution for immobilized mSVS2 (Fig. 5C, lanes 3 and 4). Immunofluorescence studies using spermatozoa pre-incubated with seminal vesicle fluid or recombinant mSVS2 showed that EPPIN and SVS2 co-localized both on sperm head and flagellum (Fig. 5D). Our negative control assays demonstrated the absence of immunostaining when cells were incubated in the absence of primary antibodies (Supplementary Fig. S7).

EPPIN is one of the most promising sperm-surface drug targets for male contraception (O'Rand et al., 2016; Drevet, 2018). Here we showed that EPPIN expression profile in male mice and at least part of its protein-protein interaction network in mature spermatozoa are similar to humans. We provided evidence that EPPIN present on mature spermatozoa acts as a hub for protein-protein interactions and binds to SVS2, which is orthologous to human SEMG1 (Yoshida et al., 2008). The identification of EPPIN-interacting proteins on mouse spermatozoa offers new insights on its evolution and physiological roles in male fertility and contributes to its development as a male contraceptive strategy focused on disrupting sperm function. By performing a comprehensive tissue array analysis, we confirmed that EPPIN is abundantly expressed in the mouse testis and epididymis, but also present in the vas deferens, seminal vesicle, and adrenal gland. Our data showing that EPPIN is abundantly expressed in the mouse seminiferous epithelium and epididymal epithelial cells is consistent with previous data in the literature (Sivashanmugam et al., 2003). The presence of EPPIN in both Sertoli cells and spermatogenic cells support the hypothesis of multiple sources of this protein within the seminiferous tubules in both human and rodents (Wang et al., 2007; Silva et al., 2012b). The roles of EPPIN in the testis warrants further investigation due to its high relevance for the understanding of the 7

Molecular and Cellular Endocrinology 506 (2020) 110754

N.A.P. Mariani, et al.

Fig. 4. Identification of SVS2 and SVS3a in co-immunoprecipitation assays using anti-EPPIN Q20E antibody and mouse spermatozoa. (A) Primary sequence of the mouse SVS2 showing the tryptic peptides identified by LC-MS/MS in red. (B) Representative tryptic peptide spectrum of the peptide KSGGSAFGQVK corresponding to residues 125–135 of mouse SVS2 (underlined in A). (C) Primary sequence of the mouse SVS3a showing the tryptic peptides identified by LC-MS/MS in red. (D) Representative tryptic peptide spectrum of the peptide KSYAAQLKS corresponding to residues 124–132 of mouse SVS3a (underlined in C). (E) Western blot analysis showing co-immunoprecipitation of SVS2 from mouse spermatozoa pre-incubated with the seminal vesicle fluid using anti-EPPIN Q20E antibody. Lane 1: Sample coimmunoprecipatated with anti-EPPIN Q20E antibody and probed with anti-SVS2 antibody; Lane 2: negative control sample immunoprecipitated with anti-EPPIN Q20E and probed with anti-SVS2 antibody incubated with 30-fold molar excess of blocking peptide; Lane 3: Negative control sample immunoprecipitated with rabbit IgG and probed with anti-SVS2 antibody. SVS2 detection by Western blot using seminal vesicle fluid (SVF) by anti-SVS2 is also shown. Arrow indicate immunoreactive band of ~45 kDa. (F) Western blot analysis showing co-immunoprecipitation of SVS3a from mouse spermatozoa pre-incubated with the seminal vesicle fluid using anti-EPPIN Q20E antibody. Lane 1: Sample co-immunoprecipitated with anti-EPPIN Q20E antibody and probed with anti-SVS3 antibody; Lane 2: negative control sample immunoprecipitated with anti-EPPIN Q20E and probed with anti-SVS3 antibody incubated with 30-fold molar excess of blocking peptide; Lane 3: Negative control sample immunoprecipitated with rabbit IgG and probed with anti-SVS3 antibody. SVS3 detection by Western blot using seminal vesicle fluid (SVF) by anti-SVS3 is also shown. Arrow indicates an immunoreactive band of ~31 kDa. Results are representative of three independent experiments.

(mRNA and protein) was found in the trachea/lung and brain, respectively, but not in the adrenal gland (Clauss et al., 2002; Silva et al., 2012b; Scott et al., 2017). Thus, it is likely that the expression of EPPIN in non-reproductive tissues follows a species-specific pattern. In a recent study, Scott et al. (2017) demonstrated that EPPIN reduced the inflammatory effects of lipopolysaccharide in both in vitro and in vivo models of lung inflammation, suggesting a potential immunomodulatory role for EPPIN outside the male reproductive tract. Further studies are necessary to determine whether EPPIN is a member of the innate immune arsenal in the adrenal glands. The analysis of relative Eppin transcript levels in the testis and epididymis from sexually immature and mature mice revealed a

pharmacological effects of EPPIN-binding drugs in this organ. Understanding EPPIN expression and physiological roles in nonreproductive tissues is important for its development as a contraceptive drug target, since they provide sources of off-target sites for EPPINbinding compounds, which could lead to potential side effects and safety concerns. In our study, the adrenal gland was the unique nonreproductive site of EPPIN expression in the male mouse, albeit to a lesser extent than in reproductive tissues. The local production of androgens may contribute to inducing EPPIN expression in the mouse adrenal gland, since EPPIN is known to be androgen-dependent (Sivashanmugam et al., 2003; Willems et al., 2009; Silva et al., 2012b). This does not appear to be the case for humans and rats, in which EPPIN 8

Molecular and Cellular Endocrinology 506 (2020) 110754

N.A.P. Mariani, et al.

Fig. 5. Interaction between EPPIN and SVS proteins. (A) Protein-protein interaction network showing the interaction between EPPIN and SVS proteins (SVS2, SVS3A, SVS5 and SVS6). Protein-protein interaction network was built based on text-mining (green lines), co-expression (black lines), and protein homology (blue line). (B) Western blot analysis showing co-immunoprecipitation of EPPIN from mouse spermatozoa pre-incubated with the seminal vesicle fluid using anti-SVS2 antibody. Lane 1: Sample co-immunoprecipitated with anti-SVS2 antibody and probed with anti-EPPIN Q20E antibody; Lane 2: negative control sample immunoprecipitated with anti-SVS2 and probed with anti-EPPIN Q20E antibody pre-adsorbed with recombinant EPPIN; Lane 3: Negative control sample immunoprecipitated with rabbit IgG and probed with anti-EPPIN Q20E antibody. Arrows indicates immunoreactive bands of ~17 and ~26 kDa corresponding to EPPIN. Results are representative of three independent experiments. (C) Far-Western blot analysis showing the capacity of recombinant mEPPIN to bind recombinant mSVS2. mSVS2 was immobilized in a PVDF membrane and probed with anti-SVS2 antibody (lane 1), or incubated with mEPPIN and then probed with anti-EPPIN Q20E antibody (lane 2). Arrow indicates an immunoreactive band of ~45 kDa corresponding to mSVS2. No clear band was observed when immobilized mSVS2 was incubated in the absence of mEPPIN and then probed with anti-EPPIN Q20E antibody (lane 3) or when BSA replaced mSVS2 in the membrane (lane 4). Results are representative of two independent experiments. (D) Co-localization of EPPIN (green) and SVS2 (red) on cauda epididymal spermatozoa pre-incubated with seminal vesicle fluid (SVF; left panel) or recombinant mSVS2 (5 μM; right panel). Merge of EPPIN- and SVS2-positive immunostaining is shown in each panel. Arrows indicate co-localization of EPPIN and SVS2 on sperm head and flagellum. PhC: Phase contrast. Scale bar: 50 μm. Results are representative from three (+SVF) or two (+recombinant mSVS2) independent experiments.

environment for sperm maturation during and quiescent storage in the cauda region (Sipila and Bjorkgren, 2016). Thus, the identity, proportion and functionality of these epididymal-secreted proteins may change according to the epididymal region and to the stage of sperm maturation. Our results support these observations by showing a segment-specific EPPIN expression pattern both at mRNA and protein levels in the mouse epididymis. The higher abundance of EPPIN expression in epithelial cells from the corpus epididymis suggests that its secretion occurs in a greater proportion in this epididymal region, which may dynamically affect its capacity to interact with maturing spermatozoa (Richardson et al., 2001; Sivashanmugam et al., 2003; Silva et al., 2012b). In agreement with this hypothesis, spermatozoa collected from corpus and cauda epididymis showed a more intense EPPIN-positive immunostaining than the gametes isolated from the proximal regions of this organ. EPPIN-positive staining in the acrosome and flagellum of mature spermatozoa supports the active role of this protein on sperm-related physiological events in mice, such as acrosome reaction and motility. The identification of EPPIN-interacting partners is a crucial step towards uncovering its physiological functions. In human spermatozoa, EPPIN is a central hub in a protein-protein interaction network known as EPPIN protein complex (EPC) (Wang et al., 2005, 2007). The EPC contains at least three proteins that were demonstrated to directly bind EPPIN: LTF, CLU and SEMG1 providing a multifunctional protein-

positive correlation with post-natal development reaching stability at early puberty. This event likely correlates with increases in plasma testosterone levels, given the androgen dependence of Eppin expression (Sivashanmugam et al., 2003; Willems et al., 2009; Silva et al., 2012b). It is known that plasma testosterone levels in male mice sharply increase between 15 and 40 days old, while gradually increase after that age, reaching a plateau at ~100 days old (Wang et al., 2015). This is consistent with the sharp upregulation on Eppin mRNA levels observed in the testis and epididymis from 10-, 20- and 40-day old mice, with no significant changes in older animals. To further support these observations, we evaluated Eppin mRNA expression in the epididymis from orchidectomized mice with or without testosterone replacement. Our results showed Eppin transcript levels were already downregulated 1 day post-orchidectomy in all epididymal regions, indicating that its expression is quickly affected by androgen withdraw. Testosterone replacement to orchidectomized mice effectively restored Eppin mRNA levels in the epididymis, demonstrating that androgens are sufficient to maintain Eppin expression levels in this tissue. After spermatogenesis, functionally immature spermatozoa are transported to the epididymis, where they undergo maturational changes promoting their ability to move forward, capacitate and fertilize the oocyte (Sipila and Bjorkgren, 2016; Gervasi and Visconti, 2017). The epididymis presents a large arsenal of proteins that are secreted into the lumen in a region-specific pattern, providing a suitable 9

Molecular and Cellular Endocrinology 506 (2020) 110754

N.A.P. Mariani, et al.

Marino: Investigation, Methodology. Lucilene D. Santos: Supervision, Methodology. Hélio Kushima: Supervision, Investigation, Methodology. Erick J. R. Silva: Formal analysis, Investigation, Visualization, Funding acquisition, Project administration, Supervision, Writing - original draft, Writing - review & editing.

protein network with roles in sperm protection and function (Wang et al., 2005; Wang et al., 2007; O'Rand et al., 2011). Specifically, EPPIN-SEMG1 interaction on the human sperm surface results in inhibition of progressive sperm motility via mechanisms that are still poorly understood (O'Rand et al., 2009; Mitra et al., 2010; Silva et al., 2013). In the present study, we showed that mouse EPPIN proteinprotein interaction profile is, at least in part, conserved with human, since it also interacts with proteins from the seminal vesicle fluid. Indeed, our data indicated that EPPIN is part of a protein-protein network with SVS2, SVS3A, SVS5 and SVS6 on mouse mature spermatozoa. In rodents, SVS proteins are secreted by the seminal vesicle epithelium as major components of seminal plasma (Kawano and Yoshida, 2007; Yoshida et al., 2008). These proteins belong to the REST (rapidly evolving seminal-vesicle-transcribed) family, which also comprises human SEMG1 and SEMG2 (Clauss et al., 2005). Our in silico and in vitro approaches indicated that EPPIN binds directly to SVS2, which is the mouse orthologue of human SEMG1, and a major component of mouse copulatory plug, a mass of coagulated seminal proteins that blocks the female reproductive tract (Kawano et al., 2014). Mouse SVS2 binds to ejaculate spermatozoa, inhibiting sperm capacitation while promoting their survival in the uterus (Kawano and Yoshida, 2007; Araki et al., 2016). Svs2−/− male mice were subfertile due to the lack of copulatory plug and premature sperm death before they arrive in the oviduct (Kawano et al., 2014). Our immunofluorescence studies confirmed the co-localization between EPPIN with native and recombinant mouse SVS2 in the head and flagellum of mature spermatozoa, suggesting that EPPIN is a sperm surface binding site for SVS2. Interestingly, SVS2 contains one cysteine residue in its primary structure, which is likely to be important for binding to EPPIN, as the cysteine in human SEMG1 was found to be necessary for this purpose (Wang et al., 2005; Silva et al., 2013). Thus, our findings lead us to propose that the EPPIN-SVS2 interaction on the surface of murine spermatozoa is involved in the control of their function via regulation of motility and capacitation, as well as in their protection in the female reproductive tract. It is also possible to hypothesize that other SVS proteins, such as SVS3 could be involved these events. Indeed, studies demonstrated that SVS3 facilitates SVS2-ellicited inhibition of capacitation of mouse spermatozoa (Araki et al., 2016). Altogether, our results encourage additional studies to investigate the impact of the interaction between and EPPIN and SVS2, as well as other SVS proteins, on sperm function and fertility. Recently, O'Rand et al. (2018) demonstrated that the small organic molecule EP055 binds EPPIN on the surface of human and macaque spermatozoa, leading to sperm motility inhibition and thus a potential male contraceptive effect. Our data support the hypothesis that EPPIN's roles on sperm function are conserved between mouse and human, validating the mouse as a suitable experimental model for translational studies on EPPIN functions, as well as for the pre-clinical evaluation of experimental EPPIN-binding contraceptive drugs.

Declaration of competing interest The authors declared no potential conflicts of interest. Acknowledgments The authors thank Dr. Luiz Gustavo Chuffa and Luiz Antonio Lupi for their help in immunohistochemistry, Dr. Maria Christina W. Avellar, Dr. Luiz Claudio Di Stasi, Dr. Rafael Henrique Nobrega, Fernanda Franchi and Geanne Freitas for their help in immunofluorescence, Dr. Agnaldo Chies for providing testosterone propionate and Institute of Biotechnology (IBTEC), UNESP, for collaboration in mass spectrometry assays. The authors are also grateful to Dr. Michael O'Rand and Katherine Hamil, MSc, for their comments, suggestions and critical analysis of the manuscript. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.mce.2020.110754. References Araki, N., Kawano, N., Kang, W., Miyado, K., et al., 2016. Seminal vesicle proteins SVS3 and SVS4 facilitate SVS2 effect on sperm capacitation. Reproduction 152 (4), 313–321. https://doi.org/10.1530/rep-15-0551. Bourgeon, F., Evrard, B., Brillard-Bourdet, M., Colleu, D., et al., 2004. Involvement of semenogelin-derived peptides in the antibacterial activity of human seminal Plasma1. Biol. Reprod. 70 (3), 768–774. https://doi.org/10.1095/biolreprod.103.022533. Carvalho, P.C., Lima, D.B., Leprevost, F.V., Santos, M.D.M., et al., 2015. Integrated analysis of shotgun proteomic data with PatternLab for proteomics 4.0. Nat. Protoc. 11, 102. https://doi.org/10.1038/nprot.2015.133. Clauss, A., Lilja, H., Lundwall, A., 2002. A locus on human chromosome 20 contains several genes expressing protease inhibitor domains with homology to whey acidic protein. Biochem. J. 368 (1), 233–242. https://doi.org/10.1042/bj20020869. Clauss, A., Lilja, H., Lundwall, A., 2005. The evolution of a genetic locus encoding small serine proteinase inhibitors. Biochem. Biophys. Res. Commun. 333 (2), 383–389. Drevet, J.R., 2018. Epididymal approaches to male contraception. Basic Clin Androl 28 (1), 12. https://doi.org/10.1186/s12610-018-0078-y. Gervasi, M.G., Visconti, P.E., 2017. Molecular changes and signaling events occurring in spermatozoa during epididymal maturation. Andrology 5 (2), 204–218. https://doi. org/10.1111/andr.12320. Kawano, N., Araki, N., Yoshida, K., Hibino, T., et al., 2014. Seminal vesicle protein SVS2 is required for sperm survival in the uterus. Proc. Natl. Acad. Sci. U. S. A. 111 (11), 4145–4150. https://doi.org/10.1073/pnas.1320715111. Kawano, N., Yoshida, M., 2007. Semen-coagulating protein, SVS2, in mouse seminal plasma controls sperm fertility. Biol. Reprod. 76 (3), 353–361. https://doi.org/10. 1095/biolreprod.106.056887. Matsuda, A., Itoh, Y., Koshikawa, N., Akizawa, T., et al., 2003. Clusterin, an abundant serum factor, is a possible negative regulator of MT6-MMP/MMP-25 produced by neutrophils. J. Biol. Chem. 278 (38), 36350–36357. https://doi.org/10.1074/jbc. M301509200. McCrudden, M.T., Dafforn, T.R., Houston, D.F., Turkington, P.T., et al., 2008. Functional domains of the human epididymal protease inhibitor, eppin. FEBS J. 275 (8), 1742–1750. https://doi.org/10.1111/j.1742-4658.2008.06333.x. Mendes, F.R., Hamamura, M., Queiroz, D.B., Porto, C.S., et al., 2004. Effects of androgen manipulation on alpha1-adrenoceptor subtypes in the rat seminal vesicle. Life Sci. 75 (12), 1449–1463. https://doi.org/10.1016/j.lfs.2004.03.011. Mitra, A., Richardson, R.T., O'Rand, M.G., 2010. Analysis of recombinant human semenogelin as an inhibitor of human sperm motility. Biol. Reprod. 82 (3), 489–496. https://doi.org/10.1095/biolreprod.109.081331. O'Rand, M.G., Silva, E.J.R., Hamil, K.G., 2016. Non-hormonal male contraception: a review and development of an Eppin based contraceptive. Pharmacol. Ther. 157, 105–111. https://doi.org/10.1016/j.pharmthera.2015.11.004. O'Rand, M.G., Widgren, E.E., 2012. Loss of calcium in human spermatozoa via EPPIN, the semenogelin receptor. Biol. Reprod. 86 (2), 55. https://doi.org/10.1095/biolreprod. 111.094227. 1-7. O'Rand, M.G., Widgren, E.E., Beyler, S., Richardson, R.T., 2009. Inhibition of human sperm motility by contraceptive anti-Eppin antibodies from infertile male monkeys: effect on cyclic adenosine monophosphate. Biol. Reprod. 80 (2), 279–285. https:// doi.org/10.1095/biolreprod.108.072942.

Funding This study was supported by Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP, process #2015/08227-0, #2016/230257, and #2017/11363-8) and by Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES, financial code 001). Author contributions Noemia Aparecida P. Mariani: Data curation, Formal analysis, Investigation, Methodology, Visualization, Writing - original draft. Aline C. Camara: Methodology, Formal analysis, Visualization. Alan Andrew S. Silva: Investigation, Methodology. Tamiris Rocha F. Raimundo: Investigation, Methodology. Juliana J. Andrade: Investigation, Methodology. Alexandre D. Andrade: Investigation, Methodology. Bruno C. Rossini: Investigation, Methodology. Celso L. 10

Molecular and Cellular Endocrinology 506 (2020) 110754

N.A.P. Mariani, et al.

832–842. https://doi.org/10.1002/mrd.22119. Sipila, P., Bjorkgren, I., 2016. Segment-specific regulation of epididymal gene expression. Reproduction 152 (3), R91–R99. https://doi.org/10.1530/REP-15-0533. Sivashanmugam, P., Hall, S.H., Hamil, K.G., French, F.S., et al., 2003. Characterization of mouse Eppin and a gene cluster of similar protease inhibitors on mouse chromosome 2. Gene 312, 125–134 S0378111903006085 [pii]. Sylvestre, T.F., Cavalcante, R.d.S., da Silva, J.d.F., Paniago, A.M.M., et al., 2018. Ceruloplasmin, transferrin and apolipoprotein A-II play important role in treatment's follow-up of paracoccidioidomycosis patients. PloS One 13 (10), e0206051. https:// doi.org/10.1371/journal.pone.0206051. Szklarczyk, D., Franceschini, A., Wyder, S., Forslund, K., et al., 2015. STRING v10: protein–protein interaction networks, integrated over the tree of life. Nucleic Acids Res. 43 (D1), D447–D452. https://doi.org/10.1093/nar/gku1003. Wang, J.-Y., Hsu, M.-C., Tseng, T.-H., Wu, L.-S., et al., 2015. Kisspeptin expression in mouse Leydig cells correlates with age. J. Chin. Med. Assoc. 78 (4), 249–257. https:// doi.org/10.1016/j.jcma.2015.01.004. Wang, Z., Widgren, E.E., Richardson, R.T., O'Rand, M.G., 2007. Characterization of an eppin protein complex from human semen and spermatozoa. Biol. Reprod. 77 (3), 476–484. https://doi.org/10.1095/biolreprod.107.060194. Wang, Z., Widgren, E.E., Sivashanmugam, P., O'Rand, M.G., et al., 2005. Association of eppin with semenogelin on human spermatozoa. Biol. Reprod. 72 (5), 1064–1070. https://doi.org/10.1095/biolreprod.104.036483. Willems, A., Gendt, K.D., Allemeersch, J., Smith, L.B., et al., 2009. Early effects of Sertoli cell-selective androgen receptor ablation on testicular gene expression. Int. J. Androl. 9999 (9999). Yenugu, S., Richardson, R.T., Sivashanmugam, P., Wang, Z., et al., 2004. Antimicrobial activity of human EPPIN, an androgen-regulated, sperm-bound protein with a whey acidic protein motif. Biol. Reprod. 71 (5), 1484–1490. https://doi.org/10.1095/ biolreprod.104.031567. Yoshida, M., Kawano, N., Yoshida, K., 2008. Control of sperm motility and fertility: diverse factors and common mechanisms. Cell. Mol. Life Sci. 65 (21), 3446–3457. https://doi.org/10.1007/s00018-008-8230-z.

O'Rand, M.G., Widgren, E.E., Hamil, K.G., Silva, E.J., et al., 2011. Epididymal protein targets: a brief history of the development of epididymal protease inhibitor as a contraceptive. J. Androl. 32 (6), 698–704. https://doi.org/10.2164/jandrol.110. 012781. O'Rand, M.G., Widgren, E.E., Sivashanmugam, P., Richardson, R.T., et al., 2004. Reversible immunocontraception in male monkeys immunized with Eppin. Science 306 (5699), 1189–1190. https://doi.org/10.1126/science.1099743. O'Rand, M.G., Hamil, K.G., Adevai, T., Zelinski, M., 2018. Inhibition of sperm motility in male macaques with EP055, a potential non-hormonal male contraceptive. PloS One 13 (4), e0195953. https://doi.org/10.1371/journal.pone.0195953. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RTPCR. Nucleic Acids Res. 29 (9), e45. Richardson, R.T., Sivashanmugam, P., Hall, S.H., Hamil, K.G., et al., 2001. Cloning and sequencing of human Eppin: a novel family of protease inhibitors expressed in the epididymis and testis. Gene 270 (1–2), 93–102 S0378111901004620 [pii]. Robert, M., Gagnon, C., 1999. Semenogelin I: a coagulum forming, multifunctional seminal vesicle protein. Cell. Mol. Life Sci. 55 (6), 944–960. Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., et al., 2012. Fiji: an open-source platform for biological-image analysis. Nat. Methods 9, 676. https://doi.org/10. 1038/nmeth.2019. Scott, A., Glasgow, A., Small, D., Carlile, S., et al., 2017. Characterisation of eppin function: expression and activity in the lung. Eur. Respir. J. 50 (1). https://doi.org/ 10.1183/13993003.01937-2016. Silva, E.J.R., Hamil, K.G., O'Rand, M.G., 2013. Interacting proteins on human spermatozoa: adaptive evolution of the binding of semenogelin I to EPPIN. PloS One 8 (12), e82014. https://doi.org/10.1371/journal.pone.0082014. Silva, E.J.R., Hamil, K.G., Richardson, R.T., O'Rand, M.G., 2012a. Characterization of EPPIN's Semenogelin I binding site: a contraceptive drug target. Biol. Reprod. 87 (3), 56. https://doi.org/10.1095/biolreprod.112.101832. 1-8. Silva, E.J.R., Patrão, M.T.C.C., Tsuruta, J.K., O'Rand, M.G., et al., 2012b. Epididymal protease inhibitor (EPPIN) is differentially expressed in the male rat reproductive tract and immunolocalized in maturing spermatozoa. Mol. Reprod. Dev. 79 (12),

11