Equine estrogen metabolite 4-hydroxyequilenin induces anchorage-independent growth of human mammary epithelial MCF-10A cells: differential gene expression

Mutation Research 550 (2004) 109–121

Equine estrogen metabolite 4-hydroxyequilenin induces anchorage-independent growth of human mammary epithelial MCF-10A cells: differential gene expression Muriel Cuendet1 , Xuemei Liu1 , Emily Pisha1 , Yan Li, Jiaqin Yao, Linning Yu, Judy L. Bolton∗ Department of Medicinal Chemistry and Pharmacognosy (M/C 781), College of Pharmacy, University of Illinois at Chicago, 833 S. Wood Street, Chicago, IL 60612, USA Received 24 October 2003; received in revised form 25 January 2004; accepted 4 February 2004

Abstract Long-term exposure to synthetic and endogenous estrogens has been associated with the development of cancer in several tissues. One potential mechanism of estrogen carcinogenesis involves catechol formation and these catechols are further oxidized to electrophilic/redox active o-quinones, which have the potential to both initiate and promote the carcinogenic process. Previously we showed that 4-hydroxyequilenin (4-OHEN) autoxidized to an o-quinone and caused a variety of damage to DNA. Since these deleterious effects could contribute to gene mutations, we investigated the Chinese hamster V79 cells to ascertain the relative ability of estradiol, 4-hydroxyestradiol, 17␤-hydroxyequilenin, 4,17␤-hydroxyequilenin, estrone, 4-hydroxyestrone, equilenin, and 4-hydroxyequilenin to induce the mutation of the hypoxanthine–guanine phosphoribosyltransferase (hprt) gene. All the 4-hydroxylated catechols induced significantly more colony formations in V79 cells as compared to the parent phenols at 100 nM, suggesting that the catechol estrogen metabolites are more mutagenic towards the hprt gene than estrogens. Since 4-OHEN induced the highest mutation frequency, we examined a biomarker for transformation potential of this compound in MCF-10A cells using an anchorage-independent growth assay. Although 4-OHEN induced anchorage-independent growth of these cells, the isolated clones were not able to grow as tumors in vivo when injected into nude mice. These cells were assayed for genetic changes using cDNA microarrays. Real time RT-PCR confirmation of some of the differentially expressed genes showed down-regulation of metallothionein 2A, p53, BRCA1, and c-myc. Moreover, we showed the involvement of other genes important in cell transformation and oxidative stress, strengthening the hypothesis that this mechanism plays a considerable role in 4-OHEN-induced anchorage-independent growth. © 2004 Elsevier B.V. All rights reserved. Keywords: Estrogen; Quinone; MCF-10A; Oxidative stress; Metallothionein

Abbreviations: 4,17␤-OHEN, 4,17␤-hydroxyequilenin; 4-OHE1 , 4-hydroxyestrone; 4-OHE2 , 4-hydroxyestradiol; 4-OHEN, 4-hydroxyequilenin; 17␤-EN, 17␤-hydroxyequilenin; E1 , estrone; E2 , estradiol; EN, equilenin; 6-TG, 6-thioguanine; B[a]P, benzo[a]pyrene; hprt, hypoxanthine–guanine phosphoribosyl transferase; ER, estrogen receptor; MT2A, metallothionein 2A; MNNG, N-methyl-N -nitro-Nnitrosoguanidine; ROS, reactive oxygen species ∗ Corresponding author. Tel.: +1-312-996-5280; fax: +1-312-996-7107. E-mail address: [email protected] (J.L. Bolton). 1 These authors contributed equally to this work. 0027-5107/$ – see front matter © 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.mrfmmm.2004.02.005

110

M. Cuendet et al. / Mutation Research 550 (2004) 109–121

1. Introduction Long time exposure to estrogens increases the risk of developing breast or endometrial cancer in humans [1–8]. Even though the mechanisms of estrogen carcinogenesis are controversial, it has been shown that hormonal potency cannot be directly correlated with the carcinogenic activity of estrogens [9]. Evidence suggests that the metabolism of estrogens to catechols and further oxidation to highly reactive o-quinones could play a major role in induction of DNA damage, leading to initiation of the carcinogenic process [10]. o-Quinones are Michael acceptors which cause damage in cells through alkylation of DNA, lipids, and proteins. In addition, they are potent redox cycling agents generating reactive oxygen species (ROS) leading to oxidation of cellular macromolecules. Oxidative stress and cellular damage from ROS have been implicated in both the initiation and promotion stages of carcinogenesis [11]. Previously, we showed that the major phase I metabolite of equine estrogens is 4-hydroxyequilenin (4-OHEN) which autoxidizes to a potent cytotoxic o-quinone and causes a variety of DNA lesions (Fig. 1) [12–15]. Our recent data suggested that 4-OHEN has the potential to be a much more effective tumor

promoter and complete carcinogen in vitro in comparison to similar experiments with the endogenous catechol estrogen, 4-hydroxyestrone (4-OHE1 ) [10]. In addition, 4-OHEN induced four different types of DNA lesions, including single strand breaks and oxidized bases, as shown in the mammary tissue isolated from female Sprague–Dawley rats treated with this compound [16]. Chinese hamster V79, an estrogen receptor (ER) ␣ positive cell line, provides valuable information regarding the potential mutagenic and carcinogenic activities of chemicals [17]. This is one of the most commonly employed selective systems, which measures mutations in the hypoxanthine–guanine phosphoribosyl transferase (hprt) gene encoding the salvage pathway enzyme hypoxanthine–guanine phosphoribosyl transferase [18]. In the present investigation, we examined the relative ability of estradiol (E2 ), 4-hydroxyestradiol (4-OHE2 ), 17␤-hydroxyequilenin (17␤-EN), 4,17␤hydroxyequilenin (4,17␤-OHEN), estrone (E1 ), 4-OHE1 , equilenin (EN), and 4-OHEN to induce the mutation frequency of the hprt gene in Chinese hamster V79 cells. This showed that all the 4-hydroxylated catechols induced significantly more colony formations in V79 cells compared to the parent phenols at

O

O

REDOX CYCLING HO

O OH

O

4-OHEN

4OHEN-o-QUINONE REACTIVE OXYGEN SPECIES

OXIDATIVE DNA DAMAGE

CARCINOGENESIS Fig. 1. Redox cycling by 4-OHEN generating reactive oxygen species and DNA damage, and initiating carcinogenesis.

M. Cuendet et al. / Mutation Research 550 (2004) 109–121

100 nM. We also studied the ability of 4-OHEN to act as a carcinogen with an anchorage-independent growth study using the human MCF-10A immortalized nontransformed mammary epithelial cell line. In order to understand the mechanisms involved in 4-OHEN-induced anchorage-independent growth, differentially expressed genes in the isolated clones compared to the parent cell line were analyzed by cDNA microarrays and real time RT-PCR. Our studies suggest that 4-OHEN induces the highest mutation frequency among the estrogens and catechol metabolites tested. Moreover, it is capable of inducing anchorageindependent growth of MCF-10A cell and differentially regulating genes involved in oxidative stress.

2. Materials and methods 2.1. Reagents Caution: The catechol estrogens were handled in accordance with NIH guidelines for the Laboratory Use of Chemical Carcinogens [19]. All chemicals were purchased from Fisher Scientific (Itasca, IL), or Sigma–Aldrich (St. Louis, MO) unless stated otherwise. 4-OHE1 (CAS no. 3131-23-5), 4-OHE2 (CAS no. 5976-61-4), E1 (CAS no. 53-16-7), E2 (CAS no. 50-28-2), and EN (CAS no. 517-09-9) were purchased from Sigma–Aldrich (St. Louis, MO). 4-OHEN was synthesized by treating equilin with Fremy’s salt as described previously [20] with minor modifications [13]. 4,17␤-OHEN was prepared by the reduction of 4-OHEN with lithium tri(tert-butoxy)aluminum hydride [21]. Culture media, antibiotic–antimitotic, and glutamine were purchased from Invitrogen (Carlsbad, CA). Fetal bovine serum (FBS) was obtained from Atlanta Biologicals (Atlanta, GA). 2.2. Cell culture conditions The male Chinese hamster lung cell line V79 was obtained from the American Type Culture Collection (ATCC, Rockville, MD). V79 cells were maintained in D-MEM/F-12 media containing 5% heat-inactivated FBS, supplemented with glutamine (2 mM), 1% 10,000 U penicillin G, 10 mg/ml streptomycin at 37 ◦ C in 5% CO2 . Human MCF-10A mammary epithelial cells were obtained from ATCC

111

and they were grown in D-MEM/F-12 media supplemented with 100 ng/ml cholera toxin, 10 ␮g/ml insulin, 0.5 ␮g/ml hydrocortisol, 20 ng/ml epidermal growth factor, 1% 10,000 U penicillin G, 10 mg/ml streptomycin, and 5% heat-inactivated FBS. Test compounds were freshly dissolved in DMSO and the final DMSO concentration was 0.05%. 2.3. Toxicity assays At least 24 h before treatment, a dispersed single cell suspension of V79 cells (200 cells) was plated in D-MEM/F-12 for attachment into 60-mm tissue culture dishes, three dishes per dose. After cell attachment, the media was removed and the cells were rinsed with PBS. Fresh media containing the test compounds was added. After 3 days, the cells were washed again with PBS and overlaid with fresh media. The plates were incubated at 37 ◦ C for a week and then stained with Giemsa. The clones were counted in order to determine the percentage survival relative to the control. 2.4. Mutation frequencies of V79 cells At least 24 h before treatment, a dispersed single-cell suspension of V79 cells (1 × 105 cells) was plated for attachment into 100-mm tissue culture dishes using two dishes per dose. After cell attachment, the media was removed, the cells were washed with PBS, and fresh media containing the test compounds was added. After 3 days, the cells were washed again with PBS and overlaid with fresh media. The plates were incubated at 37 ◦ C for a week and fresh media was added every 3 days. Following the 7-day expression period, V79 cells were reseeded at a cell density of 2×105 per 100-mm dish into D-MEM/F-12 media/5% FBS containing 6 ␮g/ml 6-thioguanine (6-TG), using 10 dishes per dose. They were incubated 10–14 days, allowing the 6-TG-resistant mutant clones to become macroscopic. During this period, the cells were supplied with fresh selective media every 3 days. The cells were then stained with Giemsa and the number of colonies per dish was counted. 2.5. Anchorage-independent growth assay The procedure described by Colburn et al. [22] was followed. MCF-10A cells were exposed to DMSO,

112

M. Cuendet et al. / Mutation Research 550 (2004) 109–121

benzo[a]pyrene (B[a]P, 1 ␮M), E2 (1 ␮M), or test compounds for 4 weeks twice a week. Cells were routinely passed before confluency was achieved. At the end of the treatment, cells (2 × 104 ) were suspended in 1 ml 0.35% agar D-MEM/F-12 over 3 ml 0.7% agar media. Plates were incubated at 37 ◦ C in 5% CO2 . After 3–5 weeks, anchorage-independent growth (spherical formation of >10 cells) was scored using a light microscope. The total number of foci per 5000 cells per well was estimated by counting the number of foci in 0.25 mm2 areas. The experiment was done in triplicate. Two clonal cell lines derived from each 4-OHEN-treatment group were further expanded and examined for genetic alterations. 2.6. Microarray analysis of transformed MCF-10A cells Total RNA was isolated from the transformed and nontransformed MCF-10A cells by using TRIzol® (Invitrogen) following the manufacturer’s protocol. RNA samples were run on an agarose denaturing gel to assess integrity and quantified by UV spectrophotometry. Reverse transcription was carried out by mixing 10 ␮g total RNA with oligo dT to have a volume of 14.5 ␮l which was incubated for 5 min at 65 ◦ C. Master mix was added containing 2 ␮l superscriptase, 6 ␮l superscript buffer, 3 ␮l DTT (0.1 M), 1.2 ␮l Cy3- or Cy5-dCTP (1 mM), 1.2 ␮l dCTP (1 mM, Amersham Pharmacia, Piscataway, NJ), 0.6 ␮l dNTP (25 mM, without dCTP) and 1.5 ␮l RNase OUT (Invitrogen). Samples were incubated for 2–3 h at 42 ◦ C. The reaction was stopped with 6 ␮l EDTA (10 mM) and 6 ␮l NaOH (0.5 mM), incubated at 65 ◦ C for 10 min, and neutralized by 25 ␮l Tris buffer (1 M, pH 7.5). Labeled probes were purified using ProbeQuantTM G50 columns (Amersham) and the cDNA precipitated with 7 ␮l NaOAc (3 M), 0.5 ␮l glycogen, and 175 ␮l EtOH for 1 h at −20 ◦ C. Fluorescent molecules were handled under dim light to minimize photobleaching. The protocol used for hybridization was based on the manufacturer’s protocol. Briefly, each slide (Microarray center, Toronto, Ontario) was prehybridized with Slide-HybTM glass array hybridization buffer #3 (Ambion, Austin, TX) for 1 h at 42 ◦ C. Cy3 and Cy5 labeled probes were resuspended together in 60 ␮l hybridization buffer and denatured at 75 ◦ C for 5 min. The microarray slide was then hybridized with the

probe in a sealed hybridization chamber (Ambion) at 42 ◦ C overnight. The slide was then removed from the chamber and placed into 1 × SSC to remove the cover-slip, washed three times in 1 × SSC, 0.1% SDS at 50 ◦ C for 10 min, dipped six times in 1 × SSC, and allowed to air dry. Each slide was scanned using a dual-laser confocal scanner ScanArray Lite (Packard BioChip Technologies, DSS Imagetech, New Delhi, India). Data from each fluorescence channel was collected and stored as a separate image. The images were then analyzed using the QuantArrayTM Analysis software (Perkin-Elmer, Boston, MA). The average signal ratio (Cy5-transformed/Cy3-normal) was calculated. A post-normalization cut-off of two-fold upor down-regulation was used to define differentially expressed genes. For the significally differently expressed genes, the average ratio (Cy5/Cy3) was calculated between the duplicates from the microarray slide and the clones derived from the same treatment with 4-OHEN. 2.7. RT-PCR analysis Total RNA was isolated as described above. The cDNA synthesis was performed in a total volume of 10 ␮l, containing 1 × TaqMan® RT buffer, 5.5 ␮M MgCl2 , 2 mM dNTPs mixture, 2.5 ␮M random hexamers, 4 U RNase inhibitor, 12.5 U MultiScribe® RT (Perkin-Elmer/Applied Biosystems, Foster City, CA), and 0.2 ␮g of RNA. The reaction was performed for 10 min at 25 ◦ C, followed by 48 ◦ C for 30 min and a 5 min incubation step at 95 ◦ C. Depending on the gene of interest, 1 or 2 ␮l was used for each PCR reaction. The PCR and subsequent analyses were performed in the GeneAmp 5700 Sequence Detection System (Applied Biosystems). Real time quantitation was performed using the TaqMan® technology of Applied Biosystems. Metallothionein 2A (MT2A) primers and probe sequences (5 to 3 ) were GCACTTCGTGCAAGAAAAGCT, GCAGCCTTGGGCACACTT, and CTCCTGCTGCCCTGTGGGCTG, BRCA1 primers and probe sequences (5 to 3 ) were CTGCTCAGGGCTATCCTCTCA, TGCTGGAGCTTTATCAGGTTATGT, and TGACATTTTAACCACTCAGCAGAGGGATACCA, c-myc primers and probe sequences (5 to 3 ) were CGTCTCCACACATCAGCACAA, TCTTGGCAGCAGGATAGTCCTT, and TACGCAGCGCCTCCCTCCACTC, p53 primers and probe were pur-

M. Cuendet et al. / Mutation Research 550 (2004) 109–121

113

chased as a Pre Developed Assay Reagent (Applied Biosystems). PCR reactions were performed in triplicate. The PCR reaction mixture contained different concentration of primers and probe depending on the gene of interest, and 1 × TaqMan® Universal Master Mix (Applied Biosystems). Concentrations used to study MT2A, BRCA1, and c-myc were 900, 900, and 300 nM, respectively, of the first primer, 900, 300, and 300 nM, respectively, of the second primer, and 200, 50, and 150 nM, respectively, of the TaqMan® probe. Volumes of the primer/probe mixture used with p53 were described by the manufacturer’s protocol. The reactions were first incubated at 50 ◦ C for 2 min, followed by 10 min at 95 ◦ C. The PCR itself consisted of 40 cycles with 15 s at 95 ◦ C and 1 min at 60 ◦ C each. The fluorescence signal was measured during the last 30 s of the annealing/extension phase. After the PCR, a fluorescence threshold value was set and threshold cycle (Ct) values were determined, i.e. the fractional cycle at which the fluorescence signal reached this threshold. These values were used for further calculations. β-Actin (TaqMan® PDAR control, Applied Biosystems) was used as an internal control to correct for any differences in the amount of total RNA used for a reaction and to compensate for different levels of inhibition during reverse transcription of RNA into cDNA. MT2A, p53, BRCA1, c-myc, and β-actin expression were related to a standard curve derived from a serial dilution of MCF-10A cDNA with dH2 O. Also, MT2A, p53, BRCA1, c-myc, and β-actin quantities were expressed in terms of nanograms of MCF-10A RNA yielding the same level of expression. Subsequently, normalization was achieved by dividing the expression level of MT2A, p53, BRCA1, or c-myc by the β-actin expression level. Finally, results were expressed as a percentage, where the level of MT2A, p53, BRCA1, or c-myc observed in the nontransformed MCF-10A sample was set as 100%.

The mice were palpated at least twice a week and sacrificed after 200 days.

2.8. Tumorigenic assay

Lower concentrations (10 and 100 nM) of test compounds showed a dose-dependent increase in colony formation (Table 2). In addition, at these concentrations, all the test compounds showed a statistically significant difference in the colony formation as compared to the solvent control (P < 0.0005). The catechol metabolites, 4-OHE1 and 4-OHEN, caused

Female athymic nude mice at 8 weeks of age were obtained from Frederick Cancer Research Facility (Frederick, MD). For each clone tested, 10 mice were injected subcutaneously into the dorsal flank with 10 million cells suspended in 100 ␮l of matrigel.

2.9. Statistical analysis Results are presented as the mean ± S.D. Statistical comparisons were performed by analysis of variance. A P value <0.05 was considered significant.

3. Results 3.1. Toxicity assays of estrogens and their catechol metabolites in V79 cells Before the mutation assays were performed, toxicity assays were determined to establish the appropriate concentration range which could leave enough surviving cells to reliably determine the mutation frequency. V79 cells were treated with test compounds at 10, 100, and 1000 nM for 3 days. Values are expressed as the mean ± S.D. of three determinations. Data showed that at lower concentrations (10 and 100 nM), all the test compounds had no toxicity and the survival percentages were higher than 90% compared to the DMSO control. As the concentration increased to 1000 nM, the catechol metabolites (4-OHE2 , 4,17␤-OHEN, 4-OHE1 , and 4-OHEN) showed cytotoxicity leading to a reduction in colonies observed as compared to the control (Table 1). In addition, 4,17␤-OHEN and 4-OHEN seemed to be slightly more toxic than endogenous catechol estrogens, 4-OHE2 and 4-OHE1 at 1000 nM. The survival percentages for 4-OHE2 , 4,17␤-OHEN, 4-OHE1 , and 4-OHEN were 72, 67, 78, and 69%, respectively. 3.2. Mutation frequency of V79 cells treated with the estrogens and their catechol metabolites

114

M. Cuendet et al. / Mutation Research 550 (2004) 109–121

Table 1 Percent survival of V79 cells treated with estrogens and their catechol metabolites compared to the controla Concentration (nM)

MNNG

E2

4-OHE2

17␤-EN

4,17␤-OHEN

E1

4-OHE1

EN

4-OHEN

10 100 1000

101 ± 4 100 ± 3 103 ± 5

106 ± 7 97 ± 10 96 ± 4

103 ± 13 92 ± 9 72 ± 6

109 ± 11 95 ± 10 101 ± 8

102 ± 10 93 ± 5 67 ± 9

123 ± 10 126 ± 7 118 ± 5

116 ± 6 110 ± 15 78 ± 6

113 ± 9 121 ± 7 115 ± 10

125 ± 5 109 ± 9 69 ± 9

a V79 cells (200 cells per well) were treated with test compounds, N-methyl-N-nitro-N-nitroso-guanidine (MNNG, positive control) or DMSO for 3 days. At the end of the treatment, cells were washed with PBS and overlaid with fresh media. The plates were incubated at 37 ◦ C for a week, and then the cells were stained with Giemsa. Values are expressed as the mean ± S.D. of three determinations. Experimental details are described in Section 2.

8

* *

*

4

2

0 DMSO 1 M B(a)P

3.3. Anchorage-independent growth assay In general, normal cells fail to grow when suspended in a viscous fluid or gel. In contrast, tumor cells do not usually require anchorage and can grow in suspension. This anchorage-independent growth is a fundamental hallmark of tumor cells [22]. In this study, we have used anchorage-independent growth of the immortalized but nontransformed human mammary epithelial cell line, MCF-10A, to model 4-OHEN

*

6 # foci per well

two-fold induction of colony formation at 10 and 100 nM compared to their parent compounds, E1 and EN, suggesting catechol formation could play a major role in induction of DNA damage leading to the carcinogenic process. 4-OHE2 and 4,17␤-OHEN showed no significant increase in colony formation compared to E2 and 17␤-EN at 10 nM, but a two-fold induction at 100 nM. At 10 nM, there was no significant difference between equine catechol estrogens and endogenous catechol estrogens. However, at 100 nM, 4,17␤-OHEN and 4-OHEN formed significantly more colonies than those of the endogenous catechol estrogens, 4-OHE2 and 4-OHE1 (P < 0.0005, Table 2).

1 M E2

10 nM 100 nM

1 M

4-OHEN

Fig. 2. Anchorage independence transformation of MCF-10A cells. MCF-10A cells were exposed to DMSO, B[a]P (1 ␮M), E2 (1 ␮M) or test compounds for 4 weeks twice a week. At the end of the treatment, cells (2 × 104 ) were suspended in agar media and incubated at 37 ◦ C in 5% CO2 . After 3–5 weeks, anchorage-independent growth was scored using a light microscope. The total number of foci per 5000 cells per well was estimated by counting the number of foci in 0.25 mm2 areas. Results are the mean of 18 samples ± S.D. ∗ Significantly different from control values, determined by ANOVA (P < 0.05).

Table 2 Colony formation of V79 cells treated with estrogens and their catechol metabolitesa Concentration (nM)

MNNG

E2

4-OHE2

17␤-EN

4,17␤-OHEN

E1

4-OHE1

EN

4-OHEN

10 100 1000

1±1 13 ± 3 125 ± 15

8±2 14 ± 3 19 ± 3

13 ± 4 29 ± 3 25 ± 4

9±2 12 ± 3 20 ± 6

10 ± 4 34 ± 3 15 ± 4

9±2 12 ± 4 15 ± 3

19 ± 3 24 ± 4 20 ± 2

8±2 19 ± 3 21 ± 5

19 ± 2 37 ± 5 26 ± 3

The number of colonies obtained with DMSO treatment was 2 ± 1. a V79 cells (1 × 105 cells) were treated with test compounds, MNNG or DMSO for 3 days. After the 7-day expression period, V79 cells were reseeded at a cell density of 1 × 105 cells per 100-mm dish in the media containing 6-TG (6 ␮g/ml). The plates were incubated at 37 ◦ C for 10–14 days, and then the cells were stained with Giemsa. Values are expressed as the mean ± S.D. of 10 determinations. Experimental details are described in Section 2.

M. Cuendet et al. / Mutation Research 550 (2004) 109–121

115

Table 3 List of differentially expressed genes in MCF-10A transformed clones Access no.

Gene description

Function

Average signal ratio (Cy5-transformed/Cy3-normal) 10-3 and 10-8

100-7

Oxidative stress H91613 R88553 BG565696 H61357 AA150817 W38462 BG547115

Metallothionein 2A Glutathione-S-transferase M2 Peroxiredoxin 1 Tumor protein p53 Thioredoxin Sulfotransferase Ferritin, heavy polypeptide 1

Xenobiotic transporter Stress response protein Xenobiotic transporter Tumor suppressor Metabolism enzyme Xenobiotic metabolism Trafficking protein

0.27 0.36 0.57 0.85 2.61 3.71 3.80

± ± ± ± ± ± ±

0.24 0.15 0.14 0.29 0.43 0.69 0.59

0.08 0.33 0.55 0.61 2.71 3.22 3.67

± ± ± ± ± ± ±

0.01 0.05 0.08 0.04 0.67 0.32 0.42

Cell proliferation AA151566 T97049 T75267 R20374 W94322 W02924 BI906378 N39825 AW406521 BI834224 BI493041

Profilin 1 CD31 antigen FK506 binding protein (FRAP1) Chromatin assembly factor 1, subunit B (p60) Melanoma inhibitory activity Cadherin 3, type 1, P-cadherin (placental) CD48 antigen CD83 antigen Immunoglobulin kappa constant S100 calcium binding protein A11 Tissue inhibitor of metalloproteinase 3

Motility protein Cell surface antigen Cell cycle Chromatin protein Growth factor Cell adhesion receptor Cell surface antigen Cell surface antigen Immunoglobulin Calcium binding protein Extracellular matrix protein

0.22 0.37 0.39 0.48 0.49 2.09 2.10 2.14 3.38 3.39 3.82

± ± ± ± ± ± ± ± ± ± ±

0.10 0.18 0.22 0.27 0.19 0.55 0.92 1.08 0.35 1.31 1.62

0.30 0.21 0.20 0.41 0.27 2.54 2.91 3.06 3.16 2.17 2.62

± ± ± ± ± ± ± ± ± ± ±

0.00 0.01 0.06 0.04 0.05 0.30 0.18 0.53 0.21 0.01 0.02

Cell survival R77378 T78107 N98784 R15256

Serine (or cysteine) proteinase inhibitor Glutamate receptor, metabotropic 5 Proteasome 26S subunit G protein-coupled receptor

Protease inhibitor G protein-coupled Proteosomal protein G protein-coupled

0.26 0.28 0.49 0.83

± ± ± ±

0.08 0.08 0.20 0.61

0.27 0.34 0.30 0.33

± ± ± ±

0.13 0.08 0.03 0.04

Transcriptional regulation AA033933 Sterol regulatory element binding transcription factor 2 R52866 v-myc H48337 Phospholipase C, gamma 2 H72224 Mitochondrial ribosomal protein S12 BG675524 Nucleolin H92226 TAF12 RNA polymerase II R88064 Transcription factor-like 1 BM010059 Ribosomal protein L37a BM009874 Ribosomal protein L21 BE669435 Forkhead box O1A BF308626 Ribosomal protein S27 BG029087 Poly(A) binding protein BM049661 Ribosomal protein L23a W24343 Ribosomal protein L32 H82390 Ribosomal protein S4 H50875 Forkhead box A3

Transcription factor

0.24 ± 0.17

Transcription factor Phospholipase kinase Ribosomal protein RNA binding activity Transcription factor Transcription factor Ribosomal protein Ribosomal protein CDK inhibitor Ribosomal protein Transcription protein Ribosomal protein Ribosomal protein Ribosomal protein Transcription factor

0.29 0.41 0.43 0.44 0.47 0.49 2.10 2.25 2.31 2.45 2.70 2.89 3.06 3.86 6.14

± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.07 0.22 0.11 0.44 0.01 0.31 0.41 1.12 0.32 0.50 0.64 0.35 0.62 0.19 3.67

0.25 0.20 0.38 0.22 0.47 0.23 2.46 3.24 2.25 2.85 3.27 3.22 2.56 3.80 9.36

± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.07 0.12 0.09 0.04 0.01 0.08 0.14 0.09 0.41 0.17 0.19 0.07 0.06 0.06 0.34

Metabolism R60388 R59901 H65659 H96028 T64853

Amino acid metabolism Lipid metabolism Metabolism of cofactors Xenobiotic metabolism Amino acid metabolism

0.17 0.30 0.34 0.43 0.44

± ± ± ± ±

0.05 0.13 0.14 0.37 0.12

0.13 0.20 0.28 0.11 0.46

± ± ± ± ±

0.01 0.02 0.01 0.00 0.02

Procollagen-lysine, 2-oxoglutarate-5-dioxygenase Mevalonate kinase Acyl-coenzyme A oxidase 1, palmitoyl Cytochrome P450, subfamily XXIV (CYP24) Arginase

0.28 ± 0.06

116

M. Cuendet et al. / Mutation Research 550 (2004) 109–121

Table 3 (Continued ) Access no.

Gene description

Function

Average signal ratio (Cy5-transformed/Cy3-normal) 10-3 and 10-8

W03390 AA033517 R82346 R48041 Transport R12987 H08286 R32695

± ± ± ±

Histamine-N-methyltransferase Electron-transfer-flavoprotein, beta polypeptide FXYD domain-containing ion transport regul. 3 Glucosidase, alpha

Methyl transferase Energy metabolism ATPase transporter Carbohydrate metabolism

0.47 0.47 2.27 3.03

Adaptor-related protein complex 1 Chloride channel 6 Neuronatin

Intracellular adaptor Membrane channel Membrane channel

0.32 ± 0.13 0.35 ± 0.15 0.45 ± 0.05

mediated genotype changes associated with breast cancer. The MCF-10A cells undergo transformation to an anchorage-independent phenotype which is easily read as colony formation on agar basement [23]. Treatment of MCF-10A cells with 4-OHEN showed a concentration-dependent increase of colony formation (Fig. 2). Two clonal cell lines derived from each 4-OHEN-treatment group were further expanded and they were designated 10-3 (e.g. 10 = nM of 4-OHEN treatment, 3 = third derived cell line from within this group), 10-8, 100-3, 100-7, 1000-2, and 1000-7.

0.11 0.20 1.03 0.53

100-7 0.21 0.31 3.19 3.18

± ± ± ±

0.12 0.07 0.13 0.19

0.21 ± 0.04 0.27 ± 0.06 0.45 ± 0.05

treatment with 1000 nM 4-OHEN showed some toxicity and, in the clones derived from cells treated at that dose, fewer genes than in the other clones were differentially expressed. Consequently, the results presented in Table 3 list the genes significantly down- or up-regulated in the clones derived from the two lower treatments. 3.5. RT-PCR analysis Based on the results obtained from the gene expression analysis and on their relevance for carcinogenesis, four genes, MT2A, p53, BRCA1, and c-myc were analyzed by real time RT-PCR in MCF-10A cells and the anchorage-independent growth cells. MT2A, p53, BRCA1, and c-myc mRNA was statistically significantly down-regulated in the six clones compared to the nontransformed MCF-10A cells (Table 4).

3.4. Effect of 4-OHEN-induced anchorageindependent growth of MCF-10A cell on gene expression profile Levels of differentially expressed genes were measured in these anchorage-independent growth cells as compared to the parent MCF-10A cell line. According to the two-fold base line of significant difference, there were 56 differentially expressed genes (3.3%), among which 35 showed lower expression in the isolated clones and 21 higher expression (Table 3). The

3.6. Tumorigenic assay The tumorigenic potential of the six anchorageindependent growth clones was tested in immuno-

Table 4 MT2A, p53, c-myc and BRCA1 mRNA levels in MCF-10A nontransformed and transformed cell linesa Cells

MT2A

MCF-10A 10-3 and 10-8 100-3 and 100-7 1000-2 and 1000-7

100 2 3 3

± ± ± ±

p53 14 0∗ 0∗ 0∗

100 36 52 36

BRCA1 ± ± ± ±

2 12∗ 16∗ 5∗

100 8 30 20

± ± ± ±

c-myc 14 4∗ 10∗ 4∗

100 9 18 14

± ± ± ±

14 2∗ 2∗ 2∗

Cells were analyzed for MT2A, p53, c-myc, BRCA1, and β-actin mRNA using real time RT-PCR. Results are shown as percentage of MT2A, p53, c-myc, or BRCA1 mRNA expression of control (MCF-10A cells) values. Results are the mean of triplicate samples ± S.D. MT2A, p53, c-myc, and BRCA1 mRNA values were normalized, relative to β-actin. ∗ Significantly different from control values, determined by ANOVA (P < 0.05). a

M. Cuendet et al. / Mutation Research 550 (2004) 109–121

compromised mice. Cells were suspended in matrigel and injected subcutaneously into the dorsal flank of mice. No tumors were detected in any of the animals during a 200 days observation period. Although there is an intrinsic lack of efficiency in the murine tumorigenicity assay, these data indicate that the anchorage-independent growth clones tested were not tumorigenic.

4. Discussion The relationship between DNA damage and carcinogenesis is poorly understood [24]. Several studies have determined that catechol estrogens can induce tumors in vivo, specifically renal tumors in male Syrian hamsters [25]. Similarly, a recent study has shown that 4-OHE2 induced uterine tumors in 66% of CD-1 mice following 1 year of treatment [26]. Beside the mitogenic and estrogenic properties these compounds possess, evidence is accruing for genotoxic characteristics such as alkylation of DNA bases, single strand breaks, and oxidation of DNA bases [6,27–29]. Previously, we showed that equine catechol estrogens can cause a variety of DNA lesions, including formation of bulky stable adducts, apurinic sites, and oxidation of the phosphate-sugar backbone and purine/pyrimidine bases in vitro and in vivo [6,16]. In the present study, the relative ability of E2 , 4-OHE2 , 17␤-EN, 4,17␤-OHEN, E1 , 4-OHE1 , EN, and 4-OHEN to induce specific mutation frequency in the hprt gene in Chinese hamster V79 cells was examined. V79 cells possess a number of desirable properties for mutagenesis assays and have been used extensively in studies of frequency of mutations in mammalian cells [30–34]. They are characterized by a rapid growth rate and short lag period and also have a high cloning efficiency of 75–95%. The differences in mutation frequency observed in V79 cells treated with the catechol estrogens can be explained as follows: 4,17␤-OHEN and 4-OHEN autoxidize to quinoids, consuming reducing equivalents and molecular oxygen, and cause a variety of damage to DNA. These metabolites induced the highest amount of colony formation. In the case of the endogenous catechol estrogens, 4-OHE2 and 4-OHE1 , oxidative enzymes are necessary to form the o-quinone prior to DNA damage and consequently led to less colony formation.

117

Finally, E2 , 17␤-EN, E1 , and EN were the weakest mutagenic compounds. These results are consistent with our previous data, showing that 4-OHEN had the potential to be a much more effective tumor promoter and complete carcinogen in vitro compared to similar experiments performed with 4-OHE1 [10]. Finally, the catechol metabolites showed a decreased trend in colony formation at 1000 nM compared to 100 nM. This can be explained by the toxicity that 4-OHE2 , 4,17␤-OHEN, 4-OHE1 , and 4-OHEN have on the cells at 1000 nM over the 3 days incubation period, leading to a reduction in the number of colonies. As 4-OHEN induced the highest mutation frequency in V79 cells and has been shown to induce C3H10T1/2 cell transformation at doses of 10–1000 nM [10], its ability to transform the human mammary epithelial cells MCF-10A was studied. In our model, foci were formed in 4-OHEN-exposed MCF-10A cultures but not in untreated cultures. Several of these foci were isolated and expanded, and six clones were further assayed for genetic changes. The gene expression profile of these clones was analyzed and compared to the parent cell line using cDNA microarrays. The hybridization results suggest these differentially expressed genes are involved in physical processes such as oxidative stress, cell proliferation and survival, transcriptional regulation, cell metabolism and transport (Table 3). Few differentially expressed genes, as well as some genes involved in carcinogenesis were analyzed by real time RT-PCR. There was some variance in the correlation of relative expression levels measured by microarays and RT-PCR, as previously observed by Hofmann et al. [35]. This might be due to the fact that oligo d(T)12–18 was used to prime reverse transcription prior to microarray hybridization, whereas random hexamers were used for the TaqMan® studies. Furthermore, cDNA microarrays should be considered a screening technology and cannot be expected to be quantitatively precise. The data obtained by RT-PCR are indisputably more accurate, but only microarrays permit the simultaneous measurement of thousands of genes. Some of the differentially regulated genes have been shown previously to be associated with oxidative stress. MT2A was greatly down-regulated in all the clones compared to nontransformed MCF-10A cells. MT is known to provide cell protection against ox-

118

M. Cuendet et al. / Mutation Research 550 (2004) 109–121

idative stress [36] and may provide protection against DNA damage [37]. MT2A expression changes have previously been reported in tumor-derived human cells. Tumor cell lines generally have a lower MT2A expression levels compared to normal cells [38]. Duncan and Reddel [39] demonstrated that MT2A and MT1E, but not MT1F, were down-regulated specifically in association with in vitro immortalization. These results correspond to what was found in this study. In our case, MT2A down-regulation could facilitate the occurrence of a mutation required for immortalization or transformation. Mutation of the tumor suppressor gene p53 is one of the most frequent genetic changes found in human cancers. p53 binds to specific DNA sequences and regulates the expression of target genes which encode for proteins that control cell cycle progression [40] or lead to apoptosis [41]. It was shown to be capable of suppressing the proliferation of transformed cells, thus p53 plays a vital role in suppressing the development of cancer [42]. Mutations in the BRCA1 gene are associated with predisposition to breast cancer; they account for approximately half of the inherited cases of the disease, or about 3% of disease incidence [43]. The loss of the wild-type BRCA1 allele during neoplastic transformation in these patients indicates that BRCA1 functions as a tumor suppressor. A study showed that BRCA1 was essential for transcription-coupled repair of oxidative DNA damage, but was not required for global removal of oxidized bases [44]. This could lead to inefficient transcription and the accumulation of mutations in critical genes, leading to uncontrolled growth during tumorigenesis. Mouse models carrying conditional disruption of BRCA1 in mammary epithelium in either p53 wild type or heterozygous backgrounds demonstrated that p53+/− mutation significantly accelerated tumorigenesis [45]. The roles of c-myc in proliferation, apoptosis, differentiation and growth of a cell are often conflicting. c-myc overexpression is often associated with cell transformation and apoptosis. In a c-myc transgenic mouse model, c-myc expression in the transgenic mammary tumors was attenuated in the highly proliferating, less apoptotic tumor foci [46]. Moreover, down-regulation of lysyl hydroxylase [47], 26S proteasome [48], sterol regulatory element binding transcription factor 2 [49] and histamine-N-methyltransferase [50] or up-regulation of ribosomal proteins [51], thioredoxin [52], ferritin

H, S100 calcium-binding protein [53] and tissue inhibitor of metalloproteinase 3 (TIMP-3) [54], which were differentially expressed in this study have been reported to be important in inducing cell transformation. Also, a decrease in glutathione-S-transferase [55] and chromatin assembly factor 1 [56] might play a role in 4-OHEN-induced DNA damage [57]. Previous studies investigating in vitro transformation of MCF-10A or a related cell line, MCF-10F, by B[a]P failed to show tumorigenicity of most of the clones in SCID mice [23,58]. Only one subclone, derived from an anchorage-independent growth clone at 446 days post-treatment, was isolated by its enhanced rate of growth and altered morphology and was found to be tumorigenic. These data showed that the phenotypes associated with neoplastic transformation appeared in a progressive fashion, and that the emergence of clones was associated with the expression of higher proliferative rate, anchorage independence, chemotactic and chemoinvasive abilities and, in certain cases, tumorigenicity. In our study, none of the 4-OHEN-induced anchorage-independent growth clones were tumorigenic. Previously, it was shown that the ER played a major role in inducing DNA damage, since cells which contained ER␣ were much more sensitive to catechol estrogen [57]. Given these results, the tumorigenic potential of 4-OHEN should be investigated in MCF-10A cells stably transfected with ER␣ using a clone that has been cultured in vitro long enough, post-treatment, to have had time to develop its full transformation. Oxidative DNA damage by reactive oxygen species likely represents an event of considerable importance in the early development of breast and endometrial cancers [59]. Previous work has shown that 4-OHEN demonstrated complete carcinogenic, initiation, and promotion activity in C3H10T1/2 cells at subtoxic concentration, 10-100-fold lower than that of 4-OHE1 , that also showed an increased level of ROS production and oxidized DNA bases [10]. Our results show that the mutation frequency of the hprt gene in Chinese hamster V79 cells was two times higher with the 4-hydroxylated catechols compared to the parent compounds at 100 nM. Moreover, 4-OHEN was capable of inducing anchorage-independent growth in an immortalized human mammary epithelial cell line. Clones selected for characterization were found to possess differentially expressed genes involved in

M. Cuendet et al. / Mutation Research 550 (2004) 109–121

oxidative stress, strengthening the hypothesis that this mechanism might be responsible for 4-OHEN-induced anchorage-independent growth.

Acknowledgements The authors are grateful to the Research Resources Center, UIC, for the provision of equipment and support for microarray analysis used in this investigation. Support for this work was provided by NIH grant CA73638. References [1] V.G. Vogel, A. Yeomeans, E. Higginbotham, Clinical management of women at increased risk for breast cancer, Breast Cancer Res. Treat. 28 (1993) 195–210. [2] R.F. Service, New role for estrogen in cancer? Science 279 (1998) 1631–1633. [3] G.A. Colditz, S.E. Hankinson, D.J. Hunter, W.C. Willett, J.E. Manson, M.J. Stampfer, C. Hennekens, B. Rosner, F.E. Speizer, The use of estrogens and progestins and the risk of breast cancer in postmenopausal women, New Engl. J. Med. 332 (1995) 1589–1593. [4] F. Grodstein, M.J. Stampfer, G.A. Colditz, W.C. Willett, J.E. Manson, M. Joffe, B. Rosner, C. Fuchs, S.E. Hankinson, D.J. Hunter, C.H. Hennekens, F.E. Speizer, Postmenopausal hormone therapy and mortality, New Engl. J. Med. 336 (1997) 1769–1775. [5] A. Lupulescu, Estrogen use and cancer incidence: a review, Cancer Invest. 13 (1995) 287–295. [6] J.L. Bolton, E. Pisha, F. Zhang, S. Qiu, Role of quinoids in estrogen carcinogenesis, Chem. Res. Toxicol. 11 (1998) 1113–1127. [7] B. Zumoff, Does postmenopausal estrogen administration increase the risk of breast cancer? Contributions of animal, biochemical, and clinical investigative studies to a resolution of the controversy, Proc. Soc. Exp. Biol. Med. 217 (1998) 30–37. [8] K.K. Steinberg, S.J. Smith, S.B. Thacker, D.F. Stroup, Breast cancer risk and duration of estrogen use—the role of study design in meta-analysis, Epidemiology 5 (1994) 415–421. [9] J.J. Li, S.A. Li, Estrogen-induced tumorigenesis in hamsters: roles for hormonal and carcinogenic activities, Arch. Toxicol. 55 (1984) 110–118. [10] E. Pisha, X. Liu, A.I. Constantinou, J.L. Bolton, Evidence that a metabolite of equine estrogens, 4-hydroxyequilenin, induces cellular transformation in vitro, Chem. Res. Toxicol. 14 (2001) 82–90. [11] J.E. Klaunig, Y. Xu, J.S. Isenberg, S. Bachowski, K.L. Kolaja, J. Jiang, D.E. Stevenson, E.F. Walborg, The role of oxidative stress in chemical carcinogenesis, Environ. Health Perspect. 106 (S1) (1998) 289–295.

119

[12] Y. Chen, L. Shen, F. Zhang, S.S. Lau, R.B. van Breemen, D. Nikolic, J.L. Bolton, The equine estrogen metabolite 4-hydroxyequilenin causes DNA single-strand breaks and oxidation of DNA bases in vitro, Chem. Res. Toxicol. 11 (1998) 1105–1111. [13] F. Zhang, Y. Chen, E. Pisha, L. Shen, Y. Xiong, R.B. van Breemen, J.L. Bolton, The major metabolite of equilin, 4hydroxyequilin autoxidizes to an o-quinone which isomerizes to the potent cytotoxin 4-hydroxyequilenin-o-quinone, Chem. Res. Toxicol. 12 (1999) 204–213. [14] L. Shen, E. Pisha, Z. Huang, J.M. Pezzuto, E. Krol, Z. Alam, R.B. van Breemen, J.L. Bolton, Bioreductive activation of catechol estrogen-ortho-quinones: aromatization of the B ring in 4-hydroxyequilenin markedly alters quinoid formation and reactivity, Carcinogenesis 18 (1997) 1093–1101. [15] J.L. Bolton, M.A. Trush, T.M. Penning, G. Dryhurst, T.J. Monks, Role of quinones in toxicology, Chem. Res. Toxicol. 13 (2000) 135–160. [16] F. Zhang, S.M. Swanson, R.B. van Breemen, X. Liu, Y. Yang, C. Gu, J.L. Bolton, Equine estrogen metabolite 4-hydroxyequilenin induces DNA damage in the rat mammary tissues: formation of single-strand breaks, apurinic sites, stable adducts, and oxidized bases, Chem. Res. Toxicol. 14 (2001) 1654–1659. [17] L.Y. Kong, P. Szaniszlo, T. Albrecht, J.G. Liehr, Frequency and molecular analysis of hprt mutations induced by estradiol in Chinese hamster V79 cells, Int. J. Oncol. 17 (2000) 1141– 1149. [18] C.S. Aaron, G. Bolcsfoldi, H.R. Glatt, M. Moore, Y. Nishi, L. Stankowski, J. Theiss, E. Thompson, Mammalian cell gene mutation assays working group report, Mutat. Res. 312 (1994) 235–239. [19] NIH Guidelines for the Laboratory Use of Chemical Carcinogens, US Government Printing Office, Washington, DC, 1981. [20] X. Han, J.G. Liehr, Microsome-mediated 8-hydroxylation of guanine bases of DNA by steroid estrogens: correlation of DNA damage by free radicals with metabolic activation to quinones, Carcinogenesis 16 (1995) 2571–2574. [21] D.C. Spink, F. Zhang, M.M. Hussain, B.H. Katz, X. Liu, D.R. Hilker, J.L. Bolton, Metabolism of equilenin in MCF-7 and MDA-MB-231 human breast cancer cells, Chem. Res. Toxicol. 14 (2001) 572–581. [22] N.H. Colburn, W.F. Bruegge, J.R. Bates, R.H. Gray, J.D. Rossen, W.H. Kelsey, T. Shimada, Correlation of anchorageindependent growth with tumorigenicity of chemically transformed mouse epidermal cells, Cancer Res. 38 (1978) 624–634. [23] J.A. Caruso, J.J. Reiners Jr., J. Emond, T. Shultz, M.A. Tainsky, M. Alaoui-Jamali, G. Batist, Genetic alteration of chromosome 8 is a common feature of human mammary epithelial cell lines transformed in vitro with benzo[a]pyrene, Mutat. Res. 473 (2001) 85–99. [24] F.C. Manning, S.R. Patierno, Apoptosis: inhibitor or instigator of carcinogenesis? Cancer Invest. 14 (1996) 455–465. [25] J.G. Liehr, Hormone-associated cancer: mechanistic similarities between breast cancer and estrogen-induced

120

[26]

[27] [28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36] [37]

[38]

[39]

[40]

M. Cuendet et al. / Mutation Research 550 (2004) 109–121 kidney carcinogenesis in hamsters, Environ. Health Perspect. 105 (S3) (1997) 565–569. R.R. Newbold, J.G. Liehr, Induction of uterine adenocarcinoma in CD-1 mice by catechol estrogens, Cancer Res. 60 (2000) 235–237. J.G. Liehr, Is estradiol a genotoxic mutagenic carcinogen? Endocr. Rev. 21 (2000) 40–54. X. Han, J.G. Liehr, DNA single-strand breaks in kidneys of Syrian hamsters treated with steroidal estrogens: hormoneinduced free radical damage preceding renal malignancy, Carcinogenesis 15 (1994) 997–1000. X. Han, J.G. Liehr, 8-Hydroxylation of guanine bases in kidney and liver DNA of hamsters treated with estradiol: role of free radicals in estrogen-induced carcinogenesis, Cancer Res. 54 (1994) 5515–5517. M.O. Bradley, B. Bhuyan, M.C. Francis, R. Langenbach, A. Peterson, E. Huberman, Mutagenesis by chemical agents in V79 Chinese hamster cells: a review and analysis of the literature. A report of the Gene-Tox Program, Mutat. Res. 87 (1981) 81–142. M.J. McGinniss, J.A. Nicklas, R.J. Albertini, Molecular analyses of in vivo hprt mutations in human T-lymphocytes. Part IV: studies in newborns, Environ. Mol. Mutagen. 14 (1989) 229–237. J.A. Nicklas, T.C. Hunter, J.P. O’Neill, R.J. Albertini, Molecular analyses of in vivo hprt mutations in human T-lymphocytes. Part III: longitudinal study of hprt gene structural alterations and T-cell clonal origins, Mutat. Res. 215 (1989) 147–160. M.J. McGinniss, M.T. Falta, L.M. Sullivan, R.J. Albertini, In vivo hprt mutant frequencies in T-cells of normal human newborns, Mutat. Res. 240 (1990) 117–126. B.A. Finette, L.M. Sullivan, J.P. O’Neill, J.A. Nicklas, P.M. Vacek, R.J. Albertini, Determination of hprt mutant frequencies in T-lymphocytes from a healthy pediatric population: statistical comparison between newborn, children and adult mutant frequencies, cloning efficiency and age, Mutat. Res. 308 (1994) 223–231. W.K. Hofmann, S. de Vos, K. Tsukasaki, W. Wachsman, G.S. Pinkus, J.W. Said, H.P. Koeffler, Altered apoptosis pathways in mantle cell lymphoma detected by oligonucleotide microarray, Blood 98 (2001) 787–794. M. Sato, I. Bremner, Oxygen free radicals and metallothionein, Free Radic. Biol. Med. 14 (1993) 325–337. E.I. Goncharova, T.G. Rossman, A role for metallothionein and zinc in spontaneous mutagenesis, Cancer Res. 54 (1994) 5318–5323. L. Zhang, W. Zhou, V.E. Velculescu, S.E. Kern, R.H. Hruban, S.R. Hamilton, B. Vogelstein, K.W. Kinzler, Gene expression profiles in normal and cancer cells, Science 276 (1997) 1268– 1272. E.L. Duncan, R.R. Reddel, Downregulation of metallothionein-IIA expression occurs at immortalization, Oncogene 18 (1999) 897–903. A.J. Levine, p53, the cellular gatekeeper for growth and division, Cell 88 (1997) 323–331.

[41] J. Lotem, L. Sachs, Hematopoietic cells from mice deficient in wild-type p53 are more resistant to induction of apoptosis by some agents, Blood 82 (1993) 1092–1096. [42] D.G. Kirsch, M.B. Kastan, Tumor-suppressor p53: implications for tumor development and prognosis, J. Clin. Oncol. 16 (1998) 3158–3168. [43] Y. Miki, J. Swensen, D. Shattuck-Eidens, P.A. Futreal, K. Harshman, S. Tavtigian, Q. Liu, C. Cochran, L.M. Bennett, W. Ding, R. Bell, J. Rosenthal, C. Hussey, T. Tran, M. McClure, C. Frye, T. Hattier, R. Phelps, A. Haugen-Strano, H. Katcher, K. Yakumo, Z. Gholami, D. Shaffer, S. Stone, S. Bayer, C. Wray, R. Bogden, P. Dayananth, J. Ward, P. Tonin, S. Narod, P. Bristow, F. Norris, L. Helvering, P. Morrison, P. Rosteck, M. Lai, J. Barrett, C. Lewis, S. Neuhausen, L. Cannon-Albright, D. Goldgar, R. Wiseman, A. Kamb, M. Skolnick, A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1, Science 266 (1994) 66–71. [44] L.C. Gowen, A.V. Avrutskaya, A.M. Latour, B.H. Koller, S.A. Leadon, BRCA1 required for transcription-coupled repair of oxidative DNA damage, Science 281 (1998) 1009–1012. [45] S.G. Brodie, X. Xu, W. Qiao, W.M. Li, L. Cao, C.X. Deng, Multiple genetic changes are associated with mammary tumorigenesis in Brca1 conditional knockout mice, Oncogene 20 (2001) 7514–7523. [46] D.J. Liao, G. Natarajan, S.L. Deming, M.H. Jamerson, M. Johnson, G. Chepko, R.B. Dickson, Cell cycle basis for the onset and progression of c-Myc-induced, TGFalpha-enhanced mouse mammary gland carcinogenesis, Oncogene 19 (2000) 1307–1317. [47] R. Myllyla, K. Alitalo, A. Vaheri, K.I. Kivirikko, Regulation of collagen post-translational modification in transformed human and chick-embryo cells, Biochem. J. 196 (1981) 683– 692. [48] A. Echarri, A.M. Pendergast, Activated c-Abl is degraded by the ubiquitin-dependent proteasome pathway, Curr. Biol. 11 (2001) 1759–1765. [49] D. Kaul, V.K. Khosla, Molecular basis of cholesterol feedback lesion in CNS tumours, Neurol. India 48 (2000) 174–177. [50] C. Maslinski, D. Kierska, Histamine in C3H/W mice carrying spontaneous tumors of the mammary gland, Agents Actions 33 (1991) 192–194. [51] Y. Zhu, H. Lin, Z. Li, M. Wang, J. Luo, Modulation of expression of ribosomal protein L7a (rpL7a) by ethanol in human breast cancer cells, Breast Cancer Res. Treat. 69 (2001) 29–38. [52] A. Vogt, K. Tamura, S. Watson, J.S. Lazo, Antitumor imidazolyl disulfide IV-2 causes irreversible G(2)/M cell cycle arrest without hyperphosphorylation of cyclin-dependent kinase Cdk1, J. Pharmacol. Exp. Ther. 294 (2000) 1070–1075. [53] J. Russo, Y.F. Hu, I.D. Silva, I.H. Russo, Cancer risk related to mammary gland structure and development, Microsc. Res. Tech. 52 (2001) 204–223. [54] J.A. Uria, A.A. Ferrando, G. Velasco, J.M. Freije, C. Lopez-Otin, Structure and expression in breast tumors of human TIMP-3 a new member of the metalloproteinase inhibitor family, Cancer Res. 54 (1994) 2091–2094.

M. Cuendet et al. / Mutation Research 550 (2004) 109–121 [55] S.A. Sheweita, A.K. Tilmisany, Cancer and phase II drug-metabolizing enzymes, Curr. Drug Metab. 4 (2003) 45– 58. [56] X. Ye, A.A. Franco, H. Santos, D.M. Nelson, P.D. Kaufman, P.D. Adams, Defective S phase chromatin assembly causes DNA damage, activation of the S phase checkpoint, and S phase arrest, Mol. Cell 11 (2003) 341– 351. [57] X. Liu, J. Yao, E. Pisha, Y. Yang, Y. Hua, R.B. van Breemen, J.L. Bolton, Oxidative DNA damage induced by equine

121

estrogen metabolites: role of estrogen receptor alpha, Chem. Res. Toxicol. 15 (2002) 512–519. [58] G. Calaf, J. Russo, Transformation of human breast epithelial cells by chemical carcinogens, Carcinogenesis 14 (1993) 483– 492. [59] D.C. Malins, E.H. Holmes, N.L. Polissar, S.J. Gunselman, The etiology of breast cancer. Characteristic alteration in hydroxyl radical-induced DNA base lesions during oncogenesis with potential for evaluating incidence risk, Cancer 71 (1993) 3036–3043.