- Email: [email protected]
ER stress contributes to alpha-naphthyl isothiocyanate-induced liver injury with cholestasis in mice
G Model PRP-51575; No. of Pages 8
ARTICLE IN PRESS Pathology – Research and Practice xxx (2016) xxx–xxx
Contents lists available at ScienceDirect
Pathology – Research and Practice journal homepage: www.elsevier.com/locate/prp
Original article
ER stress contributes to alpha-naphthyl isothiocyanate-induced liver injury with cholestasis in mice Xiaomin Yao a,∗ , Yue Li b , Xiaoyan Cheng b , Hongwei Li a a b
Faculty of Pharmacy, Zhejiang Pharmaceutical College, Ningbo, 315100, China Beijing Centre For Physical & Chemical Analysis, Beijing, 100050, China
a r t i c l e
i n f o
Article history: Received 18 February 2016 Received in revised form 28 April 2016 Accepted 2 May 2016 Keywords: Apoptosis Alpha-naphthyl isothiocyanate Cholestasis ER stress Liver injury
a b s t r a c t Endoplasmic reticulum (ER) stress is involved in the development of several liver diseases and tumors. This study investigated the underlying mechanisms of ␣-naphthyl isothiocyanate (ANIT)-induced liver injury with cholestasis in mice and found ER stress contributes to the injury. All animals were randomly divided into three groups. In the ANIT-intoxicated group, mice were intragastrically given 100 mg/kg ANIT (dissolved in corn oil), while the other groups received an equal volume of vehicle as control. After 24 and 48 h of ANIT administration, blood samples and liver tissues of all animals were collected for serum biochemistry and hepatic histopathological examinations to evaluate liver injuries with cholestasis. Hepatocellular apoptosis was assessed by the terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) assay. The expression of hepatic ER stress-related markers was determined by real-time PCR, immunohistochemical assay and Western blot. ANIT was found to significantly induce liver injury with cholestasis compared with control mice as evidenced by the increase of serum transaminases and total bilirubin (TBil), and histopathological changes in mice. ANIT remarkably induced hepatocellular apoptosis, upregulated the expression of caspase-9 and cytochrome c, and inhibited the gene and protein expression of proliferating cell nuclear antigen (PCNA). The gene expression of ER stress–related markers, including glucose-regulated protein 78 (GRP78), protein kinase R–like ER kinase (PERK), eukaryotic initiation factor 2␣ (eIF2␣), inositol requiring enzyme-1␣ (IRE-1␣) and activating transcription factor 6 (ATF6) was upregulated by ANIT in mice. ANIT also upregulated the protein expression of GRP78 and activated the phosphorylation of IRE1. These results suggested that ANIT induced liver injury with cholestasis partly due to its ability to activate the ER stress pathway. © 2016 Elsevier GmbH. All rights reserved.
1. Introduction Cholestasis is a common clinical syndrome and is reflected in low bile flow from the hepatocytes to the duodenum, which is induced mainly by infections, drugs, and autoimmune, metabolic or genetic disorders [1,2]. Without appropriate treatments, cholestasis ultimately leads to hypercholesterolemia and jaundice, and later
Abbreviations: ANIT, ␣-naphthyl isothiocyanate; AST, aspartate aminotransferase; TBil, total bilirubin; ALT, alanine aminotransferase; ER, endoplasmic reticulum; PKR, protein kinase dependent on RNA; PERK, PKR-like ER kinase; GRP78, glucose-regulated protein 78; eIF2␣, eukaryotic initiation factor 2␣; ATF6, activating transcription factor 6; CHOP, C/EBP homologous protein; IRE-1␣, inositol requiring enzyme-1␣; XIAP, X-linked inhibitor of apoptosis; Cyt-c, cytochrome c; PCNA, proliferation cell nuclear antigen; TUNEL, terminal deoxynucleotidyl transferase dUTP nick-end labeling; PVDF, polyvinylidene difluoride; TBS, tris-buffered saline; TBST, Triton X-100-TBS. ∗ Corresponding author. E-mail addresses: [email protected], [email protected] (X. Yao).
into aggravated outcomes including cholestatic hepatitis, hepatic fibrosis, cirrhosis or even liver failure [3,4]. Therefore, it is important to further study the pathogenesis of cholestasis, and look for new targets of cholestasis treatment, which will provide crucial clues for drug development. Previous studies showed that cholestasis appeared in various dysfunctions, but current studies mainly concentrate on dysregulation of bile acid transporters, oxidative stress, and inflammation in hepatocytes, which directly induces the apoptosis of hepatocytes [5,6]. Sustained or massive endoplasmic reticulum (ER) stress leads to apoptosis. Several apoptosis mediators are implicated in ER stress–associated cell death in liver disease [7–9]. However, whether hepatic ER stress is involved in hepatocellular apoptosis induced by cholestasis is still unknown. The mechanisms of ␣-naphthyl isothiocyanate (ANIT)-induced liver injury with cholestasis have been proposed but have not been entirely clarified yet. Therefore, in-depth investigations on related mechanisms of cholestasis are needed.
http://dx.doi.org/10.1016/j.prp.2016.05.001 0344-0338/© 2016 Elsevier GmbH. All rights reserved.
Please cite this article in press as: X. Yao, et al., ER stress contributes to alpha-naphthyl isothiocyanate-induced liver injury with cholestasis in mice, Pathol. – Res. Pract (2016), http://dx.doi.org/10.1016/j.prp.2016.05.001
G Model PRP-51575; No. of Pages 8
ARTICLE IN PRESS X. Yao et al. / Pathology – Research and Practice xxx (2016) xxx–xxx
2
In the present study, cholestasis in the liver of mice was modeled by the administrating ANIT, a well-characterized cholestatic agent [10]. The study concluded that the induction of ER stress is one of the underlying mechanisms of ANIT-induced liver injury with cholestasis. 2. Materials and methods
trol. After 24 and 48 h of ANIT administration, blood samples of all animals were collected by harvesting eyeball and liver tissues of all animals after 12-h food deprivation for further analysis. Liver tissues were rapidly dissected, and two pieces of tissues from the same lobe of liver from each animal were fixed properly in formaldehyde saline (10%) solution for one week in 4 ◦ C for histopathological examinations. The rest of the liver tissues were snap frozen in liquid nitrogen for biochemical assays, RNA, and protein isolation.
2.1. Reagents 2.3. Serum biochemistry ANIT was purchased from Tokyo Chemical Industry Co., Ltd. (Japan). Aspartate aminotransferase (AST), alanine aminotransferase (ALT), and total bilirubin (TBil) assay kits were obtained from Nanjing Jiancheng Bioengineering Institute (China). Terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) was purchased from Wuhan Boster Biological Engineering Co., Ltd. (China). The PrimeScriptTM RT Reagent kit was purchased from TAKARA Bio Inc. (Japan). UltraSYBR Mixture was purchased from Beijing ComWin Biotech Co.,Ltd. (China). Trizol was purchased from BioDev Tech Co., Ltd. (China). BCA protein assay kit was obtained from TianGen Biotech (BeiJing) Co., Ltd. (China). Radioimmunoprecipitation (RIPA) buffer (P0013) was purchased from Beyotime Institute of Biotechnology (China). All primers were synthesized by Beijing AuGCT Biological Technology Co., Ltd. (China). Glucoseregulated protein 78 (GRP78), protein kinase R–like ER kinase (PERK), phospho-PERK, eukaryotic initiation factor 2␣ (eIF2␣), phospho-eIF2␣, inositol requiring enzyme-1␣ (IRE1␣), phosphoIRE1␣, cytochrome c (cyt c), caspase-9, proliferating cell nuclear antigen (PCNA) and -actin antibodies were purchased from Abcam Co. (UK), Cell Signaling Technology (USA), R&D systems Inc. (USA) and Santa Cruz Biotechnology (USA). Other chemicals were purchased from the local market. 2.2. Animals Male ICR mice weighing 22–24 g were obtained from Beijing Vital River Experimental Animal Co., Ltd. (China). The animal study protocol was in compliance with the guidelines of China for animal care, which conform to the internationally accepted principles in the care and use of experimental animals. All animals were randomly divided into 3 groups with 10 mice in each group. In the ANIT-intoxicated group, mice were intragastrically given 100 mg/kg ANIT (dissolved in corn oil), while mice in the control group were given an equal volume of vehicle as con-
Blood samples for biochemical analysis were obtained after 24 and 48 h of ANIT administration. Serum ALT, AST and TBil levels were determined by biochemical analyzer (PUZS-300, Beijing Prolong New Technology Co., Ltd., China) using commercial assay kits according to the standard procedures. 2.4. Histopathology and TUNEL assay Formalin-fixed liver samples from all mice were embedded in paraffin, and 5 m-thick sections were cut and stained with hematoxylin and eosin (HE) for pathological morphological examination. For the terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) assay, paraffin sections of liver were examined by an in situ cell apoptosis detection kit. The sections were treated with proteinase K for 15 min, rinsed with Tris-buffered saline (TBS; pH7.4, 0.01 mol/L) for 3 × 2 min, and then incubated for 2 h at 37 ◦ C in terminal deoxynucleotidyl transferase and digoxigenin11-dUTP labeling buffer in a humid atmosphere. The sections were rinsed for 2 min with TBS (pH 7.4, 0.01 mol/L) three times and then blocked in a blocking buffer for 30 min at room temperature. The sections were covered with biotinylated anti-digoxin antibodies (1:100 dilution) for 30 min at 37 ◦ C and rinsed for 2 min with TBS (pH 7.4, 0.01 mol/L) three times. The sections were then stained with streptavidin–fluorescein isothiocyanate and rinsed for 5 min with TBS (pH 7.4, 0.01 mol/L) four times. At last, the sections were mounted in antifade solution and analyzed by confocal laser scanning microscopy. 2.5. RNA isolation and real-time polymerase chain reaction analysis Total RNA was extracted from the liver tissue using a TRIzol reagent according to the manufacturer’s protocol. Using the Prime-
Table 1 Polymerase chain reaction primer sets in real-time PCR. Gene
Primer sequences
Size (bp)
GenBankTM accession no.
GRP78
Forward GTTTGCTGAGGAAGACAAAAAGCTC Reverse CACTTCCATAGAGTTTGCTGATAATTG Forward CAGCGACAGAGCCAGAATAAC Reverse ACCGTCTCCAAGGTGAAAGG Forward CGCATCACCAAGTGGAAGTA Reverse CCTTCCAGCAAAGGAAGAGT Forward TGATGGCTGTCCAGTACACA Reverse GCAGATGATCCCTTCGAAAT Forward GTTCAGATGGAGCCCAAAGT Reverse CTGCATCATCATCTCCATCC Forward GACCTCAAGCCTTCCAACAT Reverse TTTCCATGAATCTGCTCTGG Forward ATCTCCACGGTCTGTTCGG Reverse GCCCTTTCTCCCTTCTTCTTA Forward CTAGTGAGCGAGCTGCAAGT Reverse CAGATCCTGCCTGCTGAATA Forward CGAAGCACCAAATCAAGAGA Reverse CGGCATATACGTGCAAATTC Forward CAGGCATTGCTGACAGGATG Reverse TGCTGATCCACATCTGCTGG
271
NM 001163434
147
NM 007837.4
170
NM 023913
151
NM 001081304
108
NM 026114.3
188
NM 010121
183
XM 975140.1
100
NM 015733.5
138
NM 011045.2
155
NM 007393
CHOP IRE1␣ ATF6 eIF2␣ PERK Cyt-c Caspase-9 PCNA -actin
Please cite this article in press as: X. Yao, et al., ER stress contributes to alpha-naphthyl isothiocyanate-induced liver injury with cholestasis in mice, Pathol. – Res. Pract (2016), http://dx.doi.org/10.1016/j.prp.2016.05.001
G Model PRP-51575; No. of Pages 8
ARTICLE IN PRESS X. Yao et al. / Pathology – Research and Practice xxx (2016) xxx–xxx
3
Fig. 1. ANIT induced the increase of serum biochemical indices in ANIT-intoxicated mice (n = 10). Blood samples were obtained at 24 and 48 h after ANIT administration. A, serum ALT; B, serum AST; C, serum TBil. **P < 0.01, *** P < 0.001 versus control group.
Script RT reagent kit, cDNA was reverse-transcribed from 1 g of total RNA. Quantitative real-time polymerase chain reaction (PCR) was carried out using the UltraSYBR Mixture real-time detection system. The primer sets for PCR are shown in Table 1. The 20 L reaction mixture included 0.5 L of forward primer (10 pmol/L), 0.5 L of reverse primer (10 pmol/L), 10 L of UltraSYBR Mixture, and 2 L of cDNA. Real-time PCR conditions were as follows: 95 ◦ C for 10 min, followed by 40 cycles at 95 ◦ C for 15 s and 60 ◦ C for 1 min. Fold induction values were calculated using the 2−Ct method according to the manufacturer’s instructions.
2.6. Western blot analysis The liver tissues were washed with phosphate-buffered saline and lysed on ice for 40 min in radioimmunoprecipitation buffer (10 mmol/L phosphate buffer, pH 7.4; 2 mmol/L ethylenediaminetetraacetic acid; 0.1% sodium dodecyl sulfate; 150 mmol/L NaCl; 1% sodium deoxycholate; and 1% Triton X-100) containing 1 mmol/L sodium orthovanadate and protease inhibitors. After centrifuging at 13,000 rpm for 15 min at 4 ◦ C, the supernatant was transferred to a new tube, and protein concentration was determined using the bicinchoninic assay.
Fig. 2. ANIT induced the change of histopathology in ANIT-intoxicated mice (n = 10). Liver specimens were collected at 24 and 48 h after ANIT administration and liver sections were stained with hematoxylin-eosin. A, control; B, ANIT-24 h; C, ANIT-48 h. Original magnification, ×200.
Please cite this article in press as: X. Yao, et al., ER stress contributes to alpha-naphthyl isothiocyanate-induced liver injury with cholestasis in mice, Pathol. – Res. Pract (2016), http://dx.doi.org/10.1016/j.prp.2016.05.001
G Model PRP-51575; No. of Pages 8 4
ARTICLE IN PRESS X. Yao et al. / Pathology – Research and Practice xxx (2016) xxx–xxx
Fig. 3. ANIT induced hepatocellular apoptosis in ANIT-intoxicated mice (TUNEL assay) (n = 10). Liver specimens were collected at 24 and 48 h after ANIT administration. A, control; B, ANIT-24 h; C, ANIT-48 h. Original magnification, ×100.
Fig. 4. ANIT induced hepatocellular apoptosis-related gene and protein expressions in ANIT-intoxicated mice (n = 10). Liver specimens were collected at 24 and 48 h after ANIT administration. A–B, mRNA expression; C–D, protein expression. Lanes 1, control group; lanes 2, ANIT-24 h group; lanes 3, ANIT-48 h group. *P < 0.05, **P < 0.01, *** P < 0.001 versus control group.
Western blot was carried out using a prepared protein of 40 g. Specific primary antibodies to GRP78, PERK, phosphoPERK, eIF2␣, phospho-eIF2␣, IRE1␣, phospho-IRE1␣, cyt c,
and caspase-9 and secondary antibodies, including horseradish peroxidase–conjugated anti-rabbit and anti-goat immunoglobulin G (IgG) antibody, were used to detect the expression of ER-related
Please cite this article in press as: X. Yao, et al., ER stress contributes to alpha-naphthyl isothiocyanate-induced liver injury with cholestasis in mice, Pathol. – Res. Pract (2016), http://dx.doi.org/10.1016/j.prp.2016.05.001
G Model PRP-51575; No. of Pages 8
ARTICLE IN PRESS X. Yao et al. / Pathology – Research and Practice xxx (2016) xxx–xxx
5
Fig. 5. ANIT inhibited PCNA expression in ANIT-intoxicated mice (n = 10). Liver specimens were collected for real-time PCR at 24 and 48 h after ANIT administration and liver sections were analyzed by immunohistochemistry assay. A, control; B, ANIT-24 h; C, ANIT-48 h. D, mRNA expression. **P < 0.01 versus control group.
Fig. 6. ANIT induced hepatic ER stress-related gene expressions in ANIT-intoxicated mice (n = 10). Liver specimens were collected at 24 and 48 h after ANIT administration, and gene expressions were analyzed by real-time PCR. * P < 0.05, **P < 0.01, *** P < 0.001 versus control group.
markers. -actin was used as an internal control. Finally, the immunoreactive bands were visualized by the ECL Western Blot Detection System (LAS 400 Mini, General Electric Company, USA)
analyzed by the Student–Newman–Keuls test for multiple comparisons. A P value < 0.05 was considered statistically significant. 3. Results
2.7. Immunohistochemistry 3.1. ANIT induced the increase of serum biochemical indices Formalin-fixed liver samples from all mice were embedded in paraffin, and 5 m-thick sections were cut. Paraffin sections of liver tissues were analyzed using the indirect immunoperoxidase technique. Briefly, the sections were treated with 0.3% H2 O2 in methanol for 10 min to block endogenous peroxide activity and then incubated with a 200-fold diluted solution of rabbit anti-rat PCNA overnight at 4 ◦ C. Then the sections were incubated with biotinylated goat anti-rabbit IgG as the secondary antibody at 37 ◦ C for 20 min followed by 3,3 -diaminobenzidine staining.
Liver injury with cholestasis was evidenced by the increases of serum ALT, AST, and TBil. As shown in Fig. 1, the serum ALT and AST levels in ANIT-intoxicated mice were 1.7- and 1.5-fold of those in control mice after 24 h of ANIT administration, respectively. At 48 h, the increasing trend of serum ALT and AST in ANIT-intoxicated mice was further augmented to 9- and 11-fold. In addition, the serum TBil level in ANIT-intoxicated mice remarkably increased to 20 and 225 times compared with that in control mice after 24 and 48 h of ANIT administration, respectively.
2.8. Statistical analysis 3.2. ANIT induced the changes of histopathology All results expressed as mean ± standard deviation (SD) were analyzed by one-way analysis of variance using the SPSS 13.0 statistical software package. The differences between means were
As shown in Fig. 2, compared with the control mice, liver pathological changes characterized by vacuole degeneration, congestion,
Please cite this article in press as: X. Yao, et al., ER stress contributes to alpha-naphthyl isothiocyanate-induced liver injury with cholestasis in mice, Pathol. – Res. Pract (2016), http://dx.doi.org/10.1016/j.prp.2016.05.001
G Model PRP-51575; No. of Pages 8
ARTICLE IN PRESS X. Yao et al. / Pathology – Research and Practice xxx (2016) xxx–xxx
6
severe hemorrhagic necrosis and degenerative changes with an infiltration of neutrophils and monocytes were observed in ANITintoxicated mice after 24 and 48 h of ANIT administration.
mRNA and protein expression of caspase-9 was also upregulated after 48 h of ANIT administration (Fig. 4).
3.3. ANIT induced hepatocellular apoptosis
3.4. ANIT inhibited the hepatocellular proliferation
A larger percentage of apoptotic cells were observed in ANITintoxicated mice compared with control mice using TUNEL staining at 24-h time point, while more apoptotic cells were detected at 48 h than at 24 h after ANIT administration (Fig. 3). Hepatic cyt c mRNA expression was upregulated at 24 and 48 h after ANIT administration, and the protein expression of cyt c in the liver tissue was only upregulated at 48 h in mice. Moreover, the
The expression of PCNA may indicate hepatocyte proliferation. Compared with control mice, the mRNA expression of PCNA was notably decreased after 48 h of ANIT administration in ANIT-intoxicated mice. To further examine the possibility that hepatocyte proliferation was inhibited following ANIT administration, we assessed hepatocyte PCNA expression in liver specimens. PCNA-positive nuclei were assessed by immunohistochemistry.
Fig. 7. ANIT induced hepatic ER stress-related protein expressions in ANIT-intoxicated mice (n = 10). Liver specimens were collected at 24 and 48 h after ANIT administration, and protein expressions were analyzed by western blot. *P < 0.05, **P < 0.01 versus control group.
Please cite this article in press as: X. Yao, et al., ER stress contributes to alpha-naphthyl isothiocyanate-induced liver injury with cholestasis in mice, Pathol. – Res. Pract (2016), http://dx.doi.org/10.1016/j.prp.2016.05.001
G Model PRP-51575; No. of Pages 8
ARTICLE IN PRESS X. Yao et al. / Pathology – Research and Practice xxx (2016) xxx–xxx
PCNA-positive nuclei were significantly decreased in ANIT-induced mice compared with the control mice (Fig. 5). 3.5. ANIT induced hepatic ER stress–related gene expressions Because severe ER stress initiates apoptosis, the expression of ER stress–related gene was tested in this study. As shown in Fig. 6, the expression of mRNA in the liver of PERK, ATF6, GRP78, and IRE1␣ was remarkably upregulated after 24 and 48 h of ANIT administration in mice. Additionally, the mRNA expression of eIF2␣ was notably upregulated only at 24-h time point. But the mRNA expression of C/EBP homologous protein (CHOP) was downregulated after 48 h of ANIT administration in mice. 3.6. ANIT induced hepatic ER stress–related protein expression To further investigate the changes of ER stress–related protein expression in the liver after ANIT administration, several key transcriptional markers of ER stress, including GRP78, PERK, pPERK, eIF2␣, p-eIF2␣, IRE1␣, and p-IRE1␣, were measured. As shown in Fig. 7, consistent with the gene expression, the protein expression of GRP78 was markedly upregulated after 48 h of ANIT administration in mice. Moreover, the phosphorylation of IRE1 was remarkably activated after 48 h of ANIT administration. The phosphorylation of eIF2␣ and PERK was not activated at 24 and 48 h time points. 4. Discussion The results of the present study showed that administering a single dose of ANIT (100 mg/kg) caused liver injury with cholestasis in mice, as evidenced by the increased levels of serum transaminase and TBil, and liver pathological changes characterized by vacuole degeneration, congestion, severe hemorrhagic necrosis, and infiltration of inflammatory cells. Additionally, a larger percentage of apoptotic cells in the liver were also induced by ANIT. Interruption of bile flow induced by ANIT leads to the accumulation of bile acids and other bile components in the liver and ultimately results in liver injury with cholestasis [11–13]. In the injured cholestatic liver, apoptosis has long been recognized as a direct consequence of bile acid–mediated injury [14]. Apoptosis shares general machinery with cell death, including death receptor–dependent (extrinsic) pathway and mitochondrial–dependent (intrinsic) pathway [15,16]. The initiation of apoptosis is mediated by the translocation of proapoptotic Bad to mitochondria followed by the downregulation of antiapoptotic, Bcl-2, which leads to an upregulation of cytosolic cyt c over mitochondrial cyt c. The enhanced discharge of cyt c promotes the cleavage of caspases and thereby induces apoptosis by intrinsic pathways [17]. In the present study, the expression of cyt c mRNA and protein was remarkably upregulated after ANIT administration in mice. Additionally, the expression of caspase-9 in both mRNA and protein levels was also upregulated in ANIT-intoxicated mice, while X-linked inhibitor of apoptosis protein (XIAP) did not change (data not shown). The mitochondrial- dependent pathway may be involved in hepatocellular apoptosis with cholestasis induced by ANIT. Severe ER stress also initiates apoptosis in developing many diseases such as liver diseases. In mammals, ER stress is sensed and the unfolded protein response is activated by three ER transmembrane proteins, PERK, ATF6, and IRE1 [18,19]. Under normal conditions, the three ER transmembrane proteins are maintained in an inactive state as they remain bound to the chaperone protein called binding immunoglobulin protein, also known as GRP78 [20]. PERK activation leads to the phosphorylation of the ␣-subunit of the translation initiation factor eIF2 and the subsequent attenuation of
7
translation initiation, and increases the expression of transcription factor 4 (ATF4), which can further activate proapoptotic transcription factors, such as CHOP [21,22]. To determine whether ER stress is involved in ANIT-induced liver injury with cholestasis, several markers of ER stress were measured in the present study. The result demonstrated that ANIT administration can induce the upregulation of gene expression of the ER stress markers (GRP78, PERK, ATF6, IRE1 and eIF2). Moreover, the protein expression of hepatic GRP78 was upregulated in ANIT-induced mice. The phosphoprotein expression of IRE1 was also upregulated in ANIT-induced mice. Therefore, ER stress response is involved in ANIT-induced liver injury with cholestasis, which may contribute to the apoptosis of liver cells. The serum TBil level was increased more after 48 h of ANIT administration than at the other time points, which was consistent with ER stress response and liver cell apoptosis. In addition, a large number of apoptotic cells are seen in the liver when it damages, which in turn induce hepatocyte proliferation. PCNA, indicating hepatocyte proliferation, was quantified by realtime PCR and immunohistochemical analysis [23,24]. Interestingly, the mRNA and protein expression of PCNA was markedly inhibited in ANIT-induced mice, especially in the late stage (48 h) of liver injury with cholestasis. The results suggested that ANIT-induced liver injury with cholestasis disturbs the hepatocyte proliferation and regeneration. In conclusion, ANIT can induce liver injury with cholestasis, which is closely associated with hepatic ER stress (GRP78, PERK, ATF6, IRE1 and eIF2) and apoptosis in mice, as well as the delayed hepatocyte proliferation, providing new scientific evidences for treating of liver injury with cholestasis. Acknowledgments This work was supported by the Project Supported by Zhejiang Provincial Public Technology Research Projects (No. 2015C33202), the Programs Supported by Ningbo Natural Science Foundation (No. 2012A610245), the Programs Supported by Ningbo Science and Technology Huimin projects (No. 2015C50020) and the Schoolenterprise Cooperation project during Engineer-country visit in 2015. We thank for all helps provided by Beijing Laboratory Animal Research Center for the experiment. References [1] G.M. Hirschfield, R.W. Chapman, T.H. Karlsen, F. Lammert, K.N. Lazaridis, A.L. Mason, The genetics of complex cholestatic disorders, Gastroenterology 144 (7) (2013) 1357–1374. [2] J.L. Boyer, New perspectives for the treatment of cholestasis: lessons from basic science applied clinically, J. Hepatol. 46 (3) (2007) 365–371. [3] C. Selmi, C.L. Bowlus, M.E. Gershwin, R.L. Coppel, Primary biliary cirrhosis, Lancet 377 (9777) (2011) 1600–1609. [4] K. Abshagen, M. König, A. Hoppe, I. Müller, M. Ebert, H. Weng, H.G. Holzhütter, U.M. Zanger, J. Bode, B. Vollmar, M. Thomas, S. Dooley, Pathobiochemical signatures of cholestatic liver disease in bile duct ligated mice, BMC Syst. Biol. 9 (1) (2015) 83–93. [5] X. Ma, Y.L. Zhao, Y. Zhu, Z. Chen, J.B. Wang, R.Y. Li, C. Chen, S.Z. Wei, J.Y. Li, B. Liu, R.L. Wang, Y.G. Li, L.F. Wang, X.H. Xiao, Paeonia lactiflora Pall. Protects against ANIT-induced cholestasis by activating Nrf2 via PI3 K/Akt signaling pathway, Drug Des Dev. Ther. 9 (2015) 5061–5074. [6] M. Sellinger, W. Xu, A. Pathil, W. Stremmel, W. Chamulitrat, Ursodeoxycholyl lysophosphatidylethanolamide inhibits cholestasis- and hypoxia-induced apoptosis by upregulating antiapoptosis proteins, Exp. Biol. Med. (Maywood) 240 (2) (2015) 252–260. [7] H. Malhi, R.J. Kaufman, Endoplasmic reticulum stress in liver disease, J. Hepatol. 54 (4) (2011) 795–809. [8] X. Xiong, X. Wang, Y. Lu, E. Wang, Z. Zhang, J. Yang, H. Zhang, X. Li, Hepatic steatosis exacerbated by endoplasmic reticulum stress-mediated downregulation of FXR in aging mice, J. Hepatol. 60 (4) (2014) 847–854. [9] J.P. Lu, X. Li, Y.L. Jin, M.X. Chen, Endoplasmic reticulum stress-mediated aldosterone-induced apoptosis in vascular endothelial cells, J. Huazhong Univ. Sci. Technol. Med. Sci. 34 (6) (2014) 821–824. [10] G.L. Plaa, B.G. Priestly, Intrahepatic cholestasis induced by drugs and chemicals, Pharmacol. Rev. 28 (3) (1976) 207–273.
Please cite this article in press as: X. Yao, et al., ER stress contributes to alpha-naphthyl isothiocyanate-induced liver injury with cholestasis in mice, Pathol. – Res. Pract (2016), http://dx.doi.org/10.1016/j.prp.2016.05.001
G Model PRP-51575; No. of Pages 8 8
ARTICLE IN PRESS X. Yao et al. / Pathology – Research and Practice xxx (2016) xxx–xxx
[11] G. Paumgartner, T. Pusl, Medical treatment of cholestatic liver disease, Clin. Liver Dis. 12 (1) (2008) 53–80. [12] S. Cipriani, B. Renga, C. D’Amore, M. Simonetti, A.A. De Tursi, A. Carino, M.C. Monti, V. Sepe, A. Zampella, S. Fiorucci, Impaired itching perception in murine models of cholestasis is supported by dysregulation of GPBAR1 signaling, PLoS One 15 (10(7)) (2015) e0129866. [13] T. Wang, Z.X. Zhou, L.X. Sun, X. Li, Z.M. Xu, M. Chen, G.L. Zhao, Z.Z. Jiang, L.Y. Zhang, Resveratrol effectively attenuates ␣-naphthyl-isothiocyanate-induced acute cholestasis and liver injury through choleretic and anti-inflammatory mechanisms, Acta Pharmacol. Sin. 35 (12) (2014) 1527–1536. [14] Y. Osawa, E. Seki, M. Adachi, A. Suetsugu, H. Ito, H. Moriwaki, M. Seishima, M. Nagaki, Role of acid sphingomyelinase of Kupffer cells in cholestatic liver injury in mice, Hepatology 51 (1) (2010) 237–245. [15] H. Hikita, T. Takehara, T. Kodama, S. Shimizu, M. Shigekawa, A. Hosui, T. Miyagi, T. Tatsumi, H. Ishida, W. Li, T. Kanto, N. Hiramatsu, S. Shimizu, Y. Tsujimoto, N. Hayashi, Delayed-onset caspase-dependent massive hepatocyte apoptosis upon fas activation in Bak/Bax-deficient mice, Hepatology 54 (1) (2011) 240–251. [16] K. Wang, Molecular mechanisms of liver injury: apoptosis or necrosis, Exp. Toxicol. Pathol. 66 (8) (2014) 351–356. [17] S. Dewanjee, T.K. Dua, R. Khanra, S. Das, S. Barma, S. Joardar, N. Bhattacharjee, M. Zia-Ul-Haq, H.Z. Jaafar, Water spinach, ipomoea aquatic (convolvulaceae), ameliorates lead toxicity by inhibiting oxidative stress and apoptosis, PLoS One 10 (10) (2015) e0139831.
[18] O.K. Kim, W. Jun, J. Lee, Mechanism of ER stress and inflammation for hepatic insulin resistance in obesity, Ann. Nutr. Metab. 67 (4) (2015) 218–227. [19] K. Zhang, R.J. Kaufman, From endoplasmic-reticulum stress to the inflammatory response, Nature 454 (7203) (2008) 455–462. [20] C.W. Woo, D. Cui, J. Arellano, B. Dorweiler, H. Harding, K.A. Fitzgerald, D. Ron, I. Tabas, Adaptive suppression of the ATF4-CHOP branch of the unfolded protein response by toll-like receptor signalling, Nat. Cell Biol. 11 (12) (2009) 1473–1480. [21] C.L. Gentile, M.J. Pagliassotti, The role of fatty acids in the development and progression of nonalcoholic fatty liver disease, J. Nutr. Biochem. 19 (9) (2008) 567–576. [22] C. Ji, N. Kaplowitz, Betaine decreases hyperhomocysteinemia, endoplasmic reticulum stress, and liver injury in alcohol-fed mice, Gastroenterology 124 (5) (2003) 1488–1499. [23] M. Hamano, H. Ezaki, S. Kiso, K. Furuta, M. Egawa, T. Kizu, N. Chatani, Y. Kamada, Y. Yoshida, T. Takehara, Lipid overloading during liver regeneration causes delayed. hepatocyte DNA replication by increasing ER stress in mice with simple hepatic steatosis, J. Gastroenterol. 49 (2) (2014) 305–316. [24] Q. Zhang, Y. Li, T. Liang, X. Lu, C. Zhang, X. Liu, X. Jiang, R.C. Martin, M. Cheng, L. Cai, ER stress and autophagy dysfunction contribute to fatty liver in diabetic mice, Int. J. Biol. Sci. 11 (5) (2015) 559–568.
Please cite this article in press as: X. Yao, et al., ER stress contributes to alpha-naphthyl isothiocyanate-induced liver injury with cholestasis in mice, Pathol. – Res. Pract (2016), http://dx.doi.org/10.1016/j.prp.2016.05.001
ARTICLE IN PRESS Pathology – Research and Practice xxx (2016) xxx–xxx
Contents lists available at ScienceDirect
Pathology – Research and Practice journal homepage: www.elsevier.com/locate/prp
Original article
ER stress contributes to alpha-naphthyl isothiocyanate-induced liver injury with cholestasis in mice Xiaomin Yao a,∗ , Yue Li b , Xiaoyan Cheng b , Hongwei Li a a b
Faculty of Pharmacy, Zhejiang Pharmaceutical College, Ningbo, 315100, China Beijing Centre For Physical & Chemical Analysis, Beijing, 100050, China
a r t i c l e
i n f o
Article history: Received 18 February 2016 Received in revised form 28 April 2016 Accepted 2 May 2016 Keywords: Apoptosis Alpha-naphthyl isothiocyanate Cholestasis ER stress Liver injury
a b s t r a c t Endoplasmic reticulum (ER) stress is involved in the development of several liver diseases and tumors. This study investigated the underlying mechanisms of ␣-naphthyl isothiocyanate (ANIT)-induced liver injury with cholestasis in mice and found ER stress contributes to the injury. All animals were randomly divided into three groups. In the ANIT-intoxicated group, mice were intragastrically given 100 mg/kg ANIT (dissolved in corn oil), while the other groups received an equal volume of vehicle as control. After 24 and 48 h of ANIT administration, blood samples and liver tissues of all animals were collected for serum biochemistry and hepatic histopathological examinations to evaluate liver injuries with cholestasis. Hepatocellular apoptosis was assessed by the terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) assay. The expression of hepatic ER stress-related markers was determined by real-time PCR, immunohistochemical assay and Western blot. ANIT was found to significantly induce liver injury with cholestasis compared with control mice as evidenced by the increase of serum transaminases and total bilirubin (TBil), and histopathological changes in mice. ANIT remarkably induced hepatocellular apoptosis, upregulated the expression of caspase-9 and cytochrome c, and inhibited the gene and protein expression of proliferating cell nuclear antigen (PCNA). The gene expression of ER stress–related markers, including glucose-regulated protein 78 (GRP78), protein kinase R–like ER kinase (PERK), eukaryotic initiation factor 2␣ (eIF2␣), inositol requiring enzyme-1␣ (IRE-1␣) and activating transcription factor 6 (ATF6) was upregulated by ANIT in mice. ANIT also upregulated the protein expression of GRP78 and activated the phosphorylation of IRE1. These results suggested that ANIT induced liver injury with cholestasis partly due to its ability to activate the ER stress pathway. © 2016 Elsevier GmbH. All rights reserved.
1. Introduction Cholestasis is a common clinical syndrome and is reflected in low bile flow from the hepatocytes to the duodenum, which is induced mainly by infections, drugs, and autoimmune, metabolic or genetic disorders [1,2]. Without appropriate treatments, cholestasis ultimately leads to hypercholesterolemia and jaundice, and later
Abbreviations: ANIT, ␣-naphthyl isothiocyanate; AST, aspartate aminotransferase; TBil, total bilirubin; ALT, alanine aminotransferase; ER, endoplasmic reticulum; PKR, protein kinase dependent on RNA; PERK, PKR-like ER kinase; GRP78, glucose-regulated protein 78; eIF2␣, eukaryotic initiation factor 2␣; ATF6, activating transcription factor 6; CHOP, C/EBP homologous protein; IRE-1␣, inositol requiring enzyme-1␣; XIAP, X-linked inhibitor of apoptosis; Cyt-c, cytochrome c; PCNA, proliferation cell nuclear antigen; TUNEL, terminal deoxynucleotidyl transferase dUTP nick-end labeling; PVDF, polyvinylidene difluoride; TBS, tris-buffered saline; TBST, Triton X-100-TBS. ∗ Corresponding author. E-mail addresses: [email protected], [email protected] (X. Yao).
into aggravated outcomes including cholestatic hepatitis, hepatic fibrosis, cirrhosis or even liver failure [3,4]. Therefore, it is important to further study the pathogenesis of cholestasis, and look for new targets of cholestasis treatment, which will provide crucial clues for drug development. Previous studies showed that cholestasis appeared in various dysfunctions, but current studies mainly concentrate on dysregulation of bile acid transporters, oxidative stress, and inflammation in hepatocytes, which directly induces the apoptosis of hepatocytes [5,6]. Sustained or massive endoplasmic reticulum (ER) stress leads to apoptosis. Several apoptosis mediators are implicated in ER stress–associated cell death in liver disease [7–9]. However, whether hepatic ER stress is involved in hepatocellular apoptosis induced by cholestasis is still unknown. The mechanisms of ␣-naphthyl isothiocyanate (ANIT)-induced liver injury with cholestasis have been proposed but have not been entirely clarified yet. Therefore, in-depth investigations on related mechanisms of cholestasis are needed.
http://dx.doi.org/10.1016/j.prp.2016.05.001 0344-0338/© 2016 Elsevier GmbH. All rights reserved.
Please cite this article in press as: X. Yao, et al., ER stress contributes to alpha-naphthyl isothiocyanate-induced liver injury with cholestasis in mice, Pathol. – Res. Pract (2016), http://dx.doi.org/10.1016/j.prp.2016.05.001
G Model PRP-51575; No. of Pages 8
ARTICLE IN PRESS X. Yao et al. / Pathology – Research and Practice xxx (2016) xxx–xxx
2
In the present study, cholestasis in the liver of mice was modeled by the administrating ANIT, a well-characterized cholestatic agent [10]. The study concluded that the induction of ER stress is one of the underlying mechanisms of ANIT-induced liver injury with cholestasis. 2. Materials and methods
trol. After 24 and 48 h of ANIT administration, blood samples of all animals were collected by harvesting eyeball and liver tissues of all animals after 12-h food deprivation for further analysis. Liver tissues were rapidly dissected, and two pieces of tissues from the same lobe of liver from each animal were fixed properly in formaldehyde saline (10%) solution for one week in 4 ◦ C for histopathological examinations. The rest of the liver tissues were snap frozen in liquid nitrogen for biochemical assays, RNA, and protein isolation.
2.1. Reagents 2.3. Serum biochemistry ANIT was purchased from Tokyo Chemical Industry Co., Ltd. (Japan). Aspartate aminotransferase (AST), alanine aminotransferase (ALT), and total bilirubin (TBil) assay kits were obtained from Nanjing Jiancheng Bioengineering Institute (China). Terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) was purchased from Wuhan Boster Biological Engineering Co., Ltd. (China). The PrimeScriptTM RT Reagent kit was purchased from TAKARA Bio Inc. (Japan). UltraSYBR Mixture was purchased from Beijing ComWin Biotech Co.,Ltd. (China). Trizol was purchased from BioDev Tech Co., Ltd. (China). BCA protein assay kit was obtained from TianGen Biotech (BeiJing) Co., Ltd. (China). Radioimmunoprecipitation (RIPA) buffer (P0013) was purchased from Beyotime Institute of Biotechnology (China). All primers were synthesized by Beijing AuGCT Biological Technology Co., Ltd. (China). Glucoseregulated protein 78 (GRP78), protein kinase R–like ER kinase (PERK), phospho-PERK, eukaryotic initiation factor 2␣ (eIF2␣), phospho-eIF2␣, inositol requiring enzyme-1␣ (IRE1␣), phosphoIRE1␣, cytochrome c (cyt c), caspase-9, proliferating cell nuclear antigen (PCNA) and -actin antibodies were purchased from Abcam Co. (UK), Cell Signaling Technology (USA), R&D systems Inc. (USA) and Santa Cruz Biotechnology (USA). Other chemicals were purchased from the local market. 2.2. Animals Male ICR mice weighing 22–24 g were obtained from Beijing Vital River Experimental Animal Co., Ltd. (China). The animal study protocol was in compliance with the guidelines of China for animal care, which conform to the internationally accepted principles in the care and use of experimental animals. All animals were randomly divided into 3 groups with 10 mice in each group. In the ANIT-intoxicated group, mice were intragastrically given 100 mg/kg ANIT (dissolved in corn oil), while mice in the control group were given an equal volume of vehicle as con-
Blood samples for biochemical analysis were obtained after 24 and 48 h of ANIT administration. Serum ALT, AST and TBil levels were determined by biochemical analyzer (PUZS-300, Beijing Prolong New Technology Co., Ltd., China) using commercial assay kits according to the standard procedures. 2.4. Histopathology and TUNEL assay Formalin-fixed liver samples from all mice were embedded in paraffin, and 5 m-thick sections were cut and stained with hematoxylin and eosin (HE) for pathological morphological examination. For the terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) assay, paraffin sections of liver were examined by an in situ cell apoptosis detection kit. The sections were treated with proteinase K for 15 min, rinsed with Tris-buffered saline (TBS; pH7.4, 0.01 mol/L) for 3 × 2 min, and then incubated for 2 h at 37 ◦ C in terminal deoxynucleotidyl transferase and digoxigenin11-dUTP labeling buffer in a humid atmosphere. The sections were rinsed for 2 min with TBS (pH 7.4, 0.01 mol/L) three times and then blocked in a blocking buffer for 30 min at room temperature. The sections were covered with biotinylated anti-digoxin antibodies (1:100 dilution) for 30 min at 37 ◦ C and rinsed for 2 min with TBS (pH 7.4, 0.01 mol/L) three times. The sections were then stained with streptavidin–fluorescein isothiocyanate and rinsed for 5 min with TBS (pH 7.4, 0.01 mol/L) four times. At last, the sections were mounted in antifade solution and analyzed by confocal laser scanning microscopy. 2.5. RNA isolation and real-time polymerase chain reaction analysis Total RNA was extracted from the liver tissue using a TRIzol reagent according to the manufacturer’s protocol. Using the Prime-
Table 1 Polymerase chain reaction primer sets in real-time PCR. Gene
Primer sequences
Size (bp)
GenBankTM accession no.
GRP78
Forward GTTTGCTGAGGAAGACAAAAAGCTC Reverse CACTTCCATAGAGTTTGCTGATAATTG Forward CAGCGACAGAGCCAGAATAAC Reverse ACCGTCTCCAAGGTGAAAGG Forward CGCATCACCAAGTGGAAGTA Reverse CCTTCCAGCAAAGGAAGAGT Forward TGATGGCTGTCCAGTACACA Reverse GCAGATGATCCCTTCGAAAT Forward GTTCAGATGGAGCCCAAAGT Reverse CTGCATCATCATCTCCATCC Forward GACCTCAAGCCTTCCAACAT Reverse TTTCCATGAATCTGCTCTGG Forward ATCTCCACGGTCTGTTCGG Reverse GCCCTTTCTCCCTTCTTCTTA Forward CTAGTGAGCGAGCTGCAAGT Reverse CAGATCCTGCCTGCTGAATA Forward CGAAGCACCAAATCAAGAGA Reverse CGGCATATACGTGCAAATTC Forward CAGGCATTGCTGACAGGATG Reverse TGCTGATCCACATCTGCTGG
271
NM 001163434
147
NM 007837.4
170
NM 023913
151
NM 001081304
108
NM 026114.3
188
NM 010121
183
XM 975140.1
100
NM 015733.5
138
NM 011045.2
155
NM 007393
CHOP IRE1␣ ATF6 eIF2␣ PERK Cyt-c Caspase-9 PCNA -actin
Please cite this article in press as: X. Yao, et al., ER stress contributes to alpha-naphthyl isothiocyanate-induced liver injury with cholestasis in mice, Pathol. – Res. Pract (2016), http://dx.doi.org/10.1016/j.prp.2016.05.001
G Model PRP-51575; No. of Pages 8
ARTICLE IN PRESS X. Yao et al. / Pathology – Research and Practice xxx (2016) xxx–xxx
3
Fig. 1. ANIT induced the increase of serum biochemical indices in ANIT-intoxicated mice (n = 10). Blood samples were obtained at 24 and 48 h after ANIT administration. A, serum ALT; B, serum AST; C, serum TBil. **P < 0.01, *** P < 0.001 versus control group.
Script RT reagent kit, cDNA was reverse-transcribed from 1 g of total RNA. Quantitative real-time polymerase chain reaction (PCR) was carried out using the UltraSYBR Mixture real-time detection system. The primer sets for PCR are shown in Table 1. The 20 L reaction mixture included 0.5 L of forward primer (10 pmol/L), 0.5 L of reverse primer (10 pmol/L), 10 L of UltraSYBR Mixture, and 2 L of cDNA. Real-time PCR conditions were as follows: 95 ◦ C for 10 min, followed by 40 cycles at 95 ◦ C for 15 s and 60 ◦ C for 1 min. Fold induction values were calculated using the 2−Ct method according to the manufacturer’s instructions.
2.6. Western blot analysis The liver tissues were washed with phosphate-buffered saline and lysed on ice for 40 min in radioimmunoprecipitation buffer (10 mmol/L phosphate buffer, pH 7.4; 2 mmol/L ethylenediaminetetraacetic acid; 0.1% sodium dodecyl sulfate; 150 mmol/L NaCl; 1% sodium deoxycholate; and 1% Triton X-100) containing 1 mmol/L sodium orthovanadate and protease inhibitors. After centrifuging at 13,000 rpm for 15 min at 4 ◦ C, the supernatant was transferred to a new tube, and protein concentration was determined using the bicinchoninic assay.
Fig. 2. ANIT induced the change of histopathology in ANIT-intoxicated mice (n = 10). Liver specimens were collected at 24 and 48 h after ANIT administration and liver sections were stained with hematoxylin-eosin. A, control; B, ANIT-24 h; C, ANIT-48 h. Original magnification, ×200.
Please cite this article in press as: X. Yao, et al., ER stress contributes to alpha-naphthyl isothiocyanate-induced liver injury with cholestasis in mice, Pathol. – Res. Pract (2016), http://dx.doi.org/10.1016/j.prp.2016.05.001
G Model PRP-51575; No. of Pages 8 4
ARTICLE IN PRESS X. Yao et al. / Pathology – Research and Practice xxx (2016) xxx–xxx
Fig. 3. ANIT induced hepatocellular apoptosis in ANIT-intoxicated mice (TUNEL assay) (n = 10). Liver specimens were collected at 24 and 48 h after ANIT administration. A, control; B, ANIT-24 h; C, ANIT-48 h. Original magnification, ×100.
Fig. 4. ANIT induced hepatocellular apoptosis-related gene and protein expressions in ANIT-intoxicated mice (n = 10). Liver specimens were collected at 24 and 48 h after ANIT administration. A–B, mRNA expression; C–D, protein expression. Lanes 1, control group; lanes 2, ANIT-24 h group; lanes 3, ANIT-48 h group. *P < 0.05, **P < 0.01, *** P < 0.001 versus control group.
Western blot was carried out using a prepared protein of 40 g. Specific primary antibodies to GRP78, PERK, phosphoPERK, eIF2␣, phospho-eIF2␣, IRE1␣, phospho-IRE1␣, cyt c,
and caspase-9 and secondary antibodies, including horseradish peroxidase–conjugated anti-rabbit and anti-goat immunoglobulin G (IgG) antibody, were used to detect the expression of ER-related
Please cite this article in press as: X. Yao, et al., ER stress contributes to alpha-naphthyl isothiocyanate-induced liver injury with cholestasis in mice, Pathol. – Res. Pract (2016), http://dx.doi.org/10.1016/j.prp.2016.05.001
G Model PRP-51575; No. of Pages 8
ARTICLE IN PRESS X. Yao et al. / Pathology – Research and Practice xxx (2016) xxx–xxx
5
Fig. 5. ANIT inhibited PCNA expression in ANIT-intoxicated mice (n = 10). Liver specimens were collected for real-time PCR at 24 and 48 h after ANIT administration and liver sections were analyzed by immunohistochemistry assay. A, control; B, ANIT-24 h; C, ANIT-48 h. D, mRNA expression. **P < 0.01 versus control group.
Fig. 6. ANIT induced hepatic ER stress-related gene expressions in ANIT-intoxicated mice (n = 10). Liver specimens were collected at 24 and 48 h after ANIT administration, and gene expressions were analyzed by real-time PCR. * P < 0.05, **P < 0.01, *** P < 0.001 versus control group.
markers. -actin was used as an internal control. Finally, the immunoreactive bands were visualized by the ECL Western Blot Detection System (LAS 400 Mini, General Electric Company, USA)
analyzed by the Student–Newman–Keuls test for multiple comparisons. A P value < 0.05 was considered statistically significant. 3. Results
2.7. Immunohistochemistry 3.1. ANIT induced the increase of serum biochemical indices Formalin-fixed liver samples from all mice were embedded in paraffin, and 5 m-thick sections were cut. Paraffin sections of liver tissues were analyzed using the indirect immunoperoxidase technique. Briefly, the sections were treated with 0.3% H2 O2 in methanol for 10 min to block endogenous peroxide activity and then incubated with a 200-fold diluted solution of rabbit anti-rat PCNA overnight at 4 ◦ C. Then the sections were incubated with biotinylated goat anti-rabbit IgG as the secondary antibody at 37 ◦ C for 20 min followed by 3,3 -diaminobenzidine staining.
Liver injury with cholestasis was evidenced by the increases of serum ALT, AST, and TBil. As shown in Fig. 1, the serum ALT and AST levels in ANIT-intoxicated mice were 1.7- and 1.5-fold of those in control mice after 24 h of ANIT administration, respectively. At 48 h, the increasing trend of serum ALT and AST in ANIT-intoxicated mice was further augmented to 9- and 11-fold. In addition, the serum TBil level in ANIT-intoxicated mice remarkably increased to 20 and 225 times compared with that in control mice after 24 and 48 h of ANIT administration, respectively.
2.8. Statistical analysis 3.2. ANIT induced the changes of histopathology All results expressed as mean ± standard deviation (SD) were analyzed by one-way analysis of variance using the SPSS 13.0 statistical software package. The differences between means were
As shown in Fig. 2, compared with the control mice, liver pathological changes characterized by vacuole degeneration, congestion,
Please cite this article in press as: X. Yao, et al., ER stress contributes to alpha-naphthyl isothiocyanate-induced liver injury with cholestasis in mice, Pathol. – Res. Pract (2016), http://dx.doi.org/10.1016/j.prp.2016.05.001
G Model PRP-51575; No. of Pages 8
ARTICLE IN PRESS X. Yao et al. / Pathology – Research and Practice xxx (2016) xxx–xxx
6
severe hemorrhagic necrosis and degenerative changes with an infiltration of neutrophils and monocytes were observed in ANITintoxicated mice after 24 and 48 h of ANIT administration.
mRNA and protein expression of caspase-9 was also upregulated after 48 h of ANIT administration (Fig. 4).
3.3. ANIT induced hepatocellular apoptosis
3.4. ANIT inhibited the hepatocellular proliferation
A larger percentage of apoptotic cells were observed in ANITintoxicated mice compared with control mice using TUNEL staining at 24-h time point, while more apoptotic cells were detected at 48 h than at 24 h after ANIT administration (Fig. 3). Hepatic cyt c mRNA expression was upregulated at 24 and 48 h after ANIT administration, and the protein expression of cyt c in the liver tissue was only upregulated at 48 h in mice. Moreover, the
The expression of PCNA may indicate hepatocyte proliferation. Compared with control mice, the mRNA expression of PCNA was notably decreased after 48 h of ANIT administration in ANIT-intoxicated mice. To further examine the possibility that hepatocyte proliferation was inhibited following ANIT administration, we assessed hepatocyte PCNA expression in liver specimens. PCNA-positive nuclei were assessed by immunohistochemistry.
Fig. 7. ANIT induced hepatic ER stress-related protein expressions in ANIT-intoxicated mice (n = 10). Liver specimens were collected at 24 and 48 h after ANIT administration, and protein expressions were analyzed by western blot. *P < 0.05, **P < 0.01 versus control group.
Please cite this article in press as: X. Yao, et al., ER stress contributes to alpha-naphthyl isothiocyanate-induced liver injury with cholestasis in mice, Pathol. – Res. Pract (2016), http://dx.doi.org/10.1016/j.prp.2016.05.001
G Model PRP-51575; No. of Pages 8
ARTICLE IN PRESS X. Yao et al. / Pathology – Research and Practice xxx (2016) xxx–xxx
PCNA-positive nuclei were significantly decreased in ANIT-induced mice compared with the control mice (Fig. 5). 3.5. ANIT induced hepatic ER stress–related gene expressions Because severe ER stress initiates apoptosis, the expression of ER stress–related gene was tested in this study. As shown in Fig. 6, the expression of mRNA in the liver of PERK, ATF6, GRP78, and IRE1␣ was remarkably upregulated after 24 and 48 h of ANIT administration in mice. Additionally, the mRNA expression of eIF2␣ was notably upregulated only at 24-h time point. But the mRNA expression of C/EBP homologous protein (CHOP) was downregulated after 48 h of ANIT administration in mice. 3.6. ANIT induced hepatic ER stress–related protein expression To further investigate the changes of ER stress–related protein expression in the liver after ANIT administration, several key transcriptional markers of ER stress, including GRP78, PERK, pPERK, eIF2␣, p-eIF2␣, IRE1␣, and p-IRE1␣, were measured. As shown in Fig. 7, consistent with the gene expression, the protein expression of GRP78 was markedly upregulated after 48 h of ANIT administration in mice. Moreover, the phosphorylation of IRE1 was remarkably activated after 48 h of ANIT administration. The phosphorylation of eIF2␣ and PERK was not activated at 24 and 48 h time points. 4. Discussion The results of the present study showed that administering a single dose of ANIT (100 mg/kg) caused liver injury with cholestasis in mice, as evidenced by the increased levels of serum transaminase and TBil, and liver pathological changes characterized by vacuole degeneration, congestion, severe hemorrhagic necrosis, and infiltration of inflammatory cells. Additionally, a larger percentage of apoptotic cells in the liver were also induced by ANIT. Interruption of bile flow induced by ANIT leads to the accumulation of bile acids and other bile components in the liver and ultimately results in liver injury with cholestasis [11–13]. In the injured cholestatic liver, apoptosis has long been recognized as a direct consequence of bile acid–mediated injury [14]. Apoptosis shares general machinery with cell death, including death receptor–dependent (extrinsic) pathway and mitochondrial–dependent (intrinsic) pathway [15,16]. The initiation of apoptosis is mediated by the translocation of proapoptotic Bad to mitochondria followed by the downregulation of antiapoptotic, Bcl-2, which leads to an upregulation of cytosolic cyt c over mitochondrial cyt c. The enhanced discharge of cyt c promotes the cleavage of caspases and thereby induces apoptosis by intrinsic pathways [17]. In the present study, the expression of cyt c mRNA and protein was remarkably upregulated after ANIT administration in mice. Additionally, the expression of caspase-9 in both mRNA and protein levels was also upregulated in ANIT-intoxicated mice, while X-linked inhibitor of apoptosis protein (XIAP) did not change (data not shown). The mitochondrial- dependent pathway may be involved in hepatocellular apoptosis with cholestasis induced by ANIT. Severe ER stress also initiates apoptosis in developing many diseases such as liver diseases. In mammals, ER stress is sensed and the unfolded protein response is activated by three ER transmembrane proteins, PERK, ATF6, and IRE1 [18,19]. Under normal conditions, the three ER transmembrane proteins are maintained in an inactive state as they remain bound to the chaperone protein called binding immunoglobulin protein, also known as GRP78 [20]. PERK activation leads to the phosphorylation of the ␣-subunit of the translation initiation factor eIF2 and the subsequent attenuation of
7
translation initiation, and increases the expression of transcription factor 4 (ATF4), which can further activate proapoptotic transcription factors, such as CHOP [21,22]. To determine whether ER stress is involved in ANIT-induced liver injury with cholestasis, several markers of ER stress were measured in the present study. The result demonstrated that ANIT administration can induce the upregulation of gene expression of the ER stress markers (GRP78, PERK, ATF6, IRE1 and eIF2). Moreover, the protein expression of hepatic GRP78 was upregulated in ANIT-induced mice. The phosphoprotein expression of IRE1 was also upregulated in ANIT-induced mice. Therefore, ER stress response is involved in ANIT-induced liver injury with cholestasis, which may contribute to the apoptosis of liver cells. The serum TBil level was increased more after 48 h of ANIT administration than at the other time points, which was consistent with ER stress response and liver cell apoptosis. In addition, a large number of apoptotic cells are seen in the liver when it damages, which in turn induce hepatocyte proliferation. PCNA, indicating hepatocyte proliferation, was quantified by realtime PCR and immunohistochemical analysis [23,24]. Interestingly, the mRNA and protein expression of PCNA was markedly inhibited in ANIT-induced mice, especially in the late stage (48 h) of liver injury with cholestasis. The results suggested that ANIT-induced liver injury with cholestasis disturbs the hepatocyte proliferation and regeneration. In conclusion, ANIT can induce liver injury with cholestasis, which is closely associated with hepatic ER stress (GRP78, PERK, ATF6, IRE1 and eIF2) and apoptosis in mice, as well as the delayed hepatocyte proliferation, providing new scientific evidences for treating of liver injury with cholestasis. Acknowledgments This work was supported by the Project Supported by Zhejiang Provincial Public Technology Research Projects (No. 2015C33202), the Programs Supported by Ningbo Natural Science Foundation (No. 2012A610245), the Programs Supported by Ningbo Science and Technology Huimin projects (No. 2015C50020) and the Schoolenterprise Cooperation project during Engineer-country visit in 2015. We thank for all helps provided by Beijing Laboratory Animal Research Center for the experiment. References [1] G.M. Hirschfield, R.W. Chapman, T.H. Karlsen, F. Lammert, K.N. Lazaridis, A.L. Mason, The genetics of complex cholestatic disorders, Gastroenterology 144 (7) (2013) 1357–1374. [2] J.L. Boyer, New perspectives for the treatment of cholestasis: lessons from basic science applied clinically, J. Hepatol. 46 (3) (2007) 365–371. [3] C. Selmi, C.L. Bowlus, M.E. Gershwin, R.L. Coppel, Primary biliary cirrhosis, Lancet 377 (9777) (2011) 1600–1609. [4] K. Abshagen, M. König, A. Hoppe, I. Müller, M. Ebert, H. Weng, H.G. Holzhütter, U.M. Zanger, J. Bode, B. Vollmar, M. Thomas, S. Dooley, Pathobiochemical signatures of cholestatic liver disease in bile duct ligated mice, BMC Syst. Biol. 9 (1) (2015) 83–93. [5] X. Ma, Y.L. Zhao, Y. Zhu, Z. Chen, J.B. Wang, R.Y. Li, C. Chen, S.Z. Wei, J.Y. Li, B. Liu, R.L. Wang, Y.G. Li, L.F. Wang, X.H. Xiao, Paeonia lactiflora Pall. Protects against ANIT-induced cholestasis by activating Nrf2 via PI3 K/Akt signaling pathway, Drug Des Dev. Ther. 9 (2015) 5061–5074. [6] M. Sellinger, W. Xu, A. Pathil, W. Stremmel, W. Chamulitrat, Ursodeoxycholyl lysophosphatidylethanolamide inhibits cholestasis- and hypoxia-induced apoptosis by upregulating antiapoptosis proteins, Exp. Biol. Med. (Maywood) 240 (2) (2015) 252–260. [7] H. Malhi, R.J. Kaufman, Endoplasmic reticulum stress in liver disease, J. Hepatol. 54 (4) (2011) 795–809. [8] X. Xiong, X. Wang, Y. Lu, E. Wang, Z. Zhang, J. Yang, H. Zhang, X. Li, Hepatic steatosis exacerbated by endoplasmic reticulum stress-mediated downregulation of FXR in aging mice, J. Hepatol. 60 (4) (2014) 847–854. [9] J.P. Lu, X. Li, Y.L. Jin, M.X. Chen, Endoplasmic reticulum stress-mediated aldosterone-induced apoptosis in vascular endothelial cells, J. Huazhong Univ. Sci. Technol. Med. Sci. 34 (6) (2014) 821–824. [10] G.L. Plaa, B.G. Priestly, Intrahepatic cholestasis induced by drugs and chemicals, Pharmacol. Rev. 28 (3) (1976) 207–273.
Please cite this article in press as: X. Yao, et al., ER stress contributes to alpha-naphthyl isothiocyanate-induced liver injury with cholestasis in mice, Pathol. – Res. Pract (2016), http://dx.doi.org/10.1016/j.prp.2016.05.001
G Model PRP-51575; No. of Pages 8 8
ARTICLE IN PRESS X. Yao et al. / Pathology – Research and Practice xxx (2016) xxx–xxx
[11] G. Paumgartner, T. Pusl, Medical treatment of cholestatic liver disease, Clin. Liver Dis. 12 (1) (2008) 53–80. [12] S. Cipriani, B. Renga, C. D’Amore, M. Simonetti, A.A. De Tursi, A. Carino, M.C. Monti, V. Sepe, A. Zampella, S. Fiorucci, Impaired itching perception in murine models of cholestasis is supported by dysregulation of GPBAR1 signaling, PLoS One 15 (10(7)) (2015) e0129866. [13] T. Wang, Z.X. Zhou, L.X. Sun, X. Li, Z.M. Xu, M. Chen, G.L. Zhao, Z.Z. Jiang, L.Y. Zhang, Resveratrol effectively attenuates ␣-naphthyl-isothiocyanate-induced acute cholestasis and liver injury through choleretic and anti-inflammatory mechanisms, Acta Pharmacol. Sin. 35 (12) (2014) 1527–1536. [14] Y. Osawa, E. Seki, M. Adachi, A. Suetsugu, H. Ito, H. Moriwaki, M. Seishima, M. Nagaki, Role of acid sphingomyelinase of Kupffer cells in cholestatic liver injury in mice, Hepatology 51 (1) (2010) 237–245. [15] H. Hikita, T. Takehara, T. Kodama, S. Shimizu, M. Shigekawa, A. Hosui, T. Miyagi, T. Tatsumi, H. Ishida, W. Li, T. Kanto, N. Hiramatsu, S. Shimizu, Y. Tsujimoto, N. Hayashi, Delayed-onset caspase-dependent massive hepatocyte apoptosis upon fas activation in Bak/Bax-deficient mice, Hepatology 54 (1) (2011) 240–251. [16] K. Wang, Molecular mechanisms of liver injury: apoptosis or necrosis, Exp. Toxicol. Pathol. 66 (8) (2014) 351–356. [17] S. Dewanjee, T.K. Dua, R. Khanra, S. Das, S. Barma, S. Joardar, N. Bhattacharjee, M. Zia-Ul-Haq, H.Z. Jaafar, Water spinach, ipomoea aquatic (convolvulaceae), ameliorates lead toxicity by inhibiting oxidative stress and apoptosis, PLoS One 10 (10) (2015) e0139831.
[18] O.K. Kim, W. Jun, J. Lee, Mechanism of ER stress and inflammation for hepatic insulin resistance in obesity, Ann. Nutr. Metab. 67 (4) (2015) 218–227. [19] K. Zhang, R.J. Kaufman, From endoplasmic-reticulum stress to the inflammatory response, Nature 454 (7203) (2008) 455–462. [20] C.W. Woo, D. Cui, J. Arellano, B. Dorweiler, H. Harding, K.A. Fitzgerald, D. Ron, I. Tabas, Adaptive suppression of the ATF4-CHOP branch of the unfolded protein response by toll-like receptor signalling, Nat. Cell Biol. 11 (12) (2009) 1473–1480. [21] C.L. Gentile, M.J. Pagliassotti, The role of fatty acids in the development and progression of nonalcoholic fatty liver disease, J. Nutr. Biochem. 19 (9) (2008) 567–576. [22] C. Ji, N. Kaplowitz, Betaine decreases hyperhomocysteinemia, endoplasmic reticulum stress, and liver injury in alcohol-fed mice, Gastroenterology 124 (5) (2003) 1488–1499. [23] M. Hamano, H. Ezaki, S. Kiso, K. Furuta, M. Egawa, T. Kizu, N. Chatani, Y. Kamada, Y. Yoshida, T. Takehara, Lipid overloading during liver regeneration causes delayed. hepatocyte DNA replication by increasing ER stress in mice with simple hepatic steatosis, J. Gastroenterol. 49 (2) (2014) 305–316. [24] Q. Zhang, Y. Li, T. Liang, X. Lu, C. Zhang, X. Liu, X. Jiang, R.C. Martin, M. Cheng, L. Cai, ER stress and autophagy dysfunction contribute to fatty liver in diabetic mice, Int. J. Biol. Sci. 11 (5) (2015) 559–568.
Please cite this article in press as: X. Yao, et al., ER stress contributes to alpha-naphthyl isothiocyanate-induced liver injury with cholestasis in mice, Pathol. – Res. Pract (2016), http://dx.doi.org/10.1016/j.prp.2016.05.001