Eradication of planktonic Vibrio parahaemolyticus and its sessile biofilm by curcumin-mediated photodynamic inactivation

Food Control 113 (2020) 107181

Contents lists available at ScienceDirect

Food Control journal homepage: www.elsevier.com/locate/foodcont

Eradication of planktonic Vibrio parahaemolyticus and its sessile biofilm by curcumin-mediated photodynamic inactivation

T

Bowen Chena, Jiaming Huanga, Huihui Lia, Qiao-Hui Zengb, Jing Jing Wanga,b,c,d,∗, Haiquan Liua,c,d, Yingjie Pana,c,d, Yong Zhaoa,c,d,∗∗ a

College of Food Science and Technology, Shanghai Ocean University, Shanghai, 201306, China Department of Food Science, Foshan University, Foshan, 528000, China c Laboratory of Quality & Safety Risk Assessment for Aquatic Products on Storage and Preservation (Shanghai), Ministry of Agriculture and Rural Affairs, Shanghai, 201306, China d Shanghai Engineering Research Center of Aquatic-Product Processing & Preservation, Shanghai, 201306, China b

A R T I C LE I N FO

A B S T R A C T

Keywords: Photodynamic inactivation (PDI) Vibrio parahaemolyticus Biofilm Gene expression level Extracellular polymeric substance (EPS)

Vibrio parahaemolyticus is the leading pathogen in seafoods. This study established the efficient blue lightemitting diode (LED) photodynamic inactivation (PDI) to eradicate Vibrio parahaemolyticus and its biofilm with photosensitizer curcumin, and the antibacterial and antibiofilm mechanisms were elucidated by determining the DNA integrity, protein changes, morphological alteration, gene expression levels, chemical composition and structural parameters of biofilm, etc. Results showed that the planktonic V. parahaemolyticus could not be visibly detectable on the medium after the curcumin-mediated PDI treatment with 1.0 μM curcumin within 5 min (1.14 J/cm2), and its biofilm was almost completely eradiated with 20.0 μM curcumin within 60 min (13.68 J/ cm2). The cellular wall and proteins of V. parahaemolyticus were the vulnerable target for the PDI treatment. Meanwhile, the PDI efficiently inactivated the living cells, reduced the key chemical composition of extracellular polymeric substance and negatively altered the architectures of biofilm. Furthermore, the PDI treatment downregulated the expression of virulence genes (tdh and toxR) and biofilm formation genes (oxyR, aphA, luxR and opaR) of V. parahaemolyticus, which would impede the bacterial infection, colonization and biofilm formation. The study will enrich our knowledge of the PDI-induced inactivation of V. parahaemolyticus, hence unlock the design of novel PDI technology to eradicate bacteria in food industry.

1. Introduction Vibrio parahaemolyticus is recognized as a major foodborne pathogen in seafoods for causing gastroenteritis worldwide, especially in coastal countries and regions (Hubbard et al., 2016). In recent decades, the resistant bacteria has emerged in a variety of bacteria, including V. parahaemolyticus (Cabello, 2006). Generally, V. parahaemolyticus shows multiple-antibiotic resistance highly due to the misuse of antibiotics to control infections in aquaculture production, and both environmental and clinical isolates present similar antibiotic resistance profiles (Elmahdi, Dasilva, & Parveen, 2016). Moreover, V. parahaemolyticus strains with 10 antibiotics resistance were isolated in our laboratory. Worse still, bacteria in nature often exist as sessile communities called biofilm which is difficult to be eradicated. Meanwhile, the inherent resistance of biofilm to antibiotics and host immune attack are the root

∗

of many persistent and chronic bacterial infections (Whitchurch, Tolker-Nielsen, Ragas, & Mattick, 2002). Therefore, it is urgent to develop efficient methods to eradicate biofilm of multidrug resistant bacteria. In comparison with conventional non-thermal sterilization technologies including ultraviolet (UV), pulsed electric fields (PEFs), high hydrostatic pressure (HHP), etc. (Cebrian, Manas, & Condon, 2016; Kim, Mikš-Krajnik, Kumar, & Yuk, 2016), the PDI inactivation is currently considered as a novel and promising method to inactivate bacteria and fungi (Almeida et al., 2014; Dovigo et al., 2011) due to its environmental-friendly characteristic, low-energy consumption and low-cost inputs. Previously, Deng et al. (2016) reported that the PDI treatment reduced the single V. parahaemolyticus cells by 5 Log CFU/mL at 0.05 mg/mL methylene blue with visible light of 300 J/cm2. Additionally, V. parahaemolyticus was significantly decreased to non-

Corresponding author. College of Food Science and Technology, Shanghai Ocean University, Shanghai, 201306, China. Corresponding author. College of Food Science and Technology, Shanghai Ocean University, Shanghai, 201306, China. E-mail addresses: [email protected] (J.J. Wang), [email protected] (Y. Zhao).

∗∗

https://doi.org/10.1016/j.foodcont.2020.107181 Received 15 December 2019; Received in revised form 17 February 2020; Accepted 21 February 2020 Available online 22 February 2020 0956-7135/ © 2020 Elsevier Ltd. All rights reserved.

Food Control 113 (2020) 107181

B. Chen, et al.

detectable levels at 10 μM curcumin with 3.6 J/cm2 (Wu et al., 2016). However, the antibacterial mechanism of curcumin-mediated PDI for V. parahaemolyticus is still unclear. Moreover, the eradiation effects of PDI on sessile biofilm of pathogens are rarely reported. In addition, Kim and Yuk (Kim & Yuk, 2017) found that different Salmonella strains exhibited great heterogeneity of resistance to the PDI treatment. Therefore, the results from the single strain might underestimate or overestimate the ability of PDI to inactivate pathogens in food industry. In this study, we selected curcumin as a photosensitizer because curcumin is a green and safe natural substance of turmeric powder, and it has been now widely used as photosensitizer in medical and other fields (Duse, Pinnapireddy, Strehlow, Jarmila, & Bakowsky, 2017; Esatbeyoglu et al., 2012). More importantly, the curcumin (400–500 nm) and blue LED illumination (455–460 nm) have a better spectral overlap area, which can more effectively improve the inactivation ability of PDI system (Penha et al., 2017). Previous study of our group has proved that the curcumin-mediated PDI was efficient at eradicating Gram-positive Listeria monocytogenes and its biofilm, and related function mechanisms of PDI were primarily elaborated (Huang et al., 2020). However, the Gram nature of bacterial strains is widely considered to be a dominant factor determining the bacterial sensitivity to PDI. On this basis, the potential ability of the curcumin-mediated PDI to inactivate the cocktails of Gram-negative V. parahaemolyticus with multidrug resistance was investigated, and the antibacterial mechanism was explored by determining DNA level, protein changes, morphological alteration, virulence gene expression, etc. Moreover, the antibiofilm ability and mechanism of PDI were evaluated by monitoring the changes of extracellular polymeric substances (EPS), structural parameters and related regulatory genes of biofilm. Therefore, this study will systematically investigate the eradiation efficiency and mechanisms of PDI on the planktonic V. parahaemolyticus and its biofilm, and hence unlock the design of novel and efficient non-thermal PDI sterilization technology to inactivate bacteria in food industry.

LED was 3.80 mW/cm2 which was measured using an energy meter console (PM100D) (Newton, USA). The energy dosage was calculated using the following equation (Kim & Yuk, 2017): E = Pt where E = Dose (energy density) in J/cm2, P=Irradiance (power density) in W/cm2, and t = time in sec. 2.3. Biofilm formation 10 μL of V. parahaemolyticus (the original suspension was diluted to ~7 Log CFU/mL) and 990 μL tryptic soy broth (TSB) medium were transferred into 24-well plates to obtain the final concentration of ~5 Log CFU/mL. Subsequently, the 24-well plates were incubated at 25 °C statically to develop biofilm for 48 h. The biofilm was gently washed three times with 1 × PBS and stained with 1 mL of 0.1% crystal violet for 30 min at 25 °C, and then solubilized in 1 mL 95% ethanol for 30 min. The optical density of each well was measured at 600 nm (Krom, Cohen, McElhaney Feser, & Cihlar, 2007). 2.4. Experimental procedures of PDI inactivation

A four-strains cocktail of V. parahaemolyticus (ATCC 17802 was isolated from “Shirasu” food poisoning in Japan; VPC17, VPC36 and VPC47 were isolated from fecal specimens with acute diarrhea in our laboratory) was used (Table 1). All strains stored at −80 °C were recovered in 9 mL tryptic soy broth (TSB, Beijing Land Bridge Technology Co., Ltd, Beijing, China) supplemented with 3% NaCl (w/v) and incubated overnight at 37 °C. Enriched cultures were pooled into a 1.5 mL tube and centrifuged at 4000 g, 4 °C for 5 min. The resulting cell pellet was washed with phosphate-buffered saline (PBS, Sangon Biotech Co., Ltd, Shanghai, China) to produce a cocktail of ~8 Log CFU/mL.

Aliquots of original bacterial suspension (~8 Log CFU/mL) were incubated with appropriate curcumin (0–1.0 μM) at 25 °C for 20 min. Then, 500 μL of bacterial suspension were injected into 24-well plates and exposed to light for 0–30 min and 7–37 °C. In detail, different curcumin concentrations (0, 0.2, 0.5, 0.8 and 1.0 μM) were employed to investigate their effects on the inactivation ability of the curcuminmediated PDI on V. parahaemolyticus under 5 min irradiation (1.14 J/ cm2); different irradiation time including 0 min (0 J/cm2), 1 min (0.23 J/cm2), 3 min (0.69 J/cm2), 5 min (1.14 J/cm2), 10 min (2.28 J/ cm2) and 30 min (6.84 J/cm2) was used to explore their effects on the inactivation ability of PDI on V. parahaemolyticus with 0.5 μM curcumin. Meanwhile, the effects of PDI treatment temperatures (7, 10, 15, 25 and 37 °C) on the inactivation ability were also determined at the fixed treatment conditions in Fig. 1. After treatment, the inactivation of V. parahaemolyticus was evaluated by the spread plate method using thiosulfate citrate bile salts sucrose agar (TCBS, Beijing Land Bridge Technology Co., Ltd, Beijing, China) as selective culture medium. The plates were then incubated at 37 °C for 12 h and the cells were expressed by Log CFU/mL (Deng et al., 2016; Song et al., 2016). The mature biofilm of V. parahaemolyticus was incubated with 0–20 μM curcumin at 25 °C for 20 min in 24-well plates, which were subsequently exposed to light for 0–60 min. Samples treated without light and curcumin, only with light or curcumin were chosen as negative control (L-C-), illumination control (L + C-) and curcumin control (L-C+).

2.2. Light-emitting diodes (LEDs) system

2.5. Scanning electron microscopy (SEM)

The blue LEDs (10 W, 455–460 nm, Getian Opto-Electronics Co., Ltd., China) were surrounded by deep photo accessories to prevent the entry of external light. The distance between the LED source and the bacteria solutions was adjusted to 5.0 cm. The power density of blue

Bacterial suspension (500 μL) were centrifuged for 5 min at 10, 000 g. The resultant pellets were mixed with 500 μL glutaraldehyde (2.5%) and formaldehyde (4%) in 0.1 M cacodylate buffer for overnight at 4 °C. Subsequently biofilm was dehydrated in serial dilutions of

2. Materials and methods 2.1. Bacterial strain and culture conditions

Table 1 Information of 4 strains of Vibrio parahaemolyticus. Strains Name

trh

tdh

toxR

Phenotypic antimicrobial resistance

Resistance genes

Source

V. parahaemolyticus ATCC17802 VPC17 VPC36 VPC49

+ – + +

– + – +

+ + + +

– AK, S, K, KZ, AMC, FOX, AMP AK, S, CN, K, KZ, AMC, FOX, AK, CIP, LEV, S, CN, K, PRL, KZ, AMC, AMP

– blaSHV, tet(B), strA, qnrA, gryA, sulI tet(B), strA, qnrA, sulI tet(B), strA, sulI

“Shirasu” food poisoning fecal specimens with acute diarrhea fecal specimens with acute diarrhea fecal specimens with acute diarrhea

Abbreviations: AMP, Ampicillin; AMC, Co-amoxiclav; PRL, Piperacillin; AK, Amikacin; S, Streptomycin; K, Kanamycin; CN, Gentamicin; FOX, Cefoxitin; KZ, Cefazolin; CIP, Ciprofloxacin; LE, Levofloxacin Tablets. 2

Food Control 113 (2020) 107181

B. Chen, et al.

Fig. 1. Effects of the curcumin-medicated PDI on the viability of V. parahaemolyticus. (A) curcumin concentration; (B) illumination time; (C) and (D) treatment temperatures.

biotech Co., Ltd., China). Total RNA was then resuspended in 50 μL diethyl pyrocarbonate-treated water. The purity of RNA was determined by measuring OD230nm, OD260nm and OD280nm values using a BioDrop Touch dual spectrophotometer. Generally, the OD260nm/ OD280nm value should be in the range of 1.8–2.2, and the OD260nm/ OD230nm value should be around 2. The integrity of RNA was evaluated by 1% (wt/vol) agarose gel electrophoresis (Kim, Adeline Ng, Zwe, & Yuk, 2017). cDNA was reversely transcribed by using a HiScript® RT SuperMix with the primers for virulence genes (trh, tdh and toxR) and biofilm regulatory genes (oxyR, aphA, luxS and opaR) (Table 2). qPCR was performed on a Real-Time PCR system (Applied Biosystems, Foster City, USA). All qPCR reactions were performed in a total volume of 20 μL. Cycling parameters included an initial denaturation at 95 °C for 5 min, followed by 35 cycles of 95 °C for 30 s, 58 °C for 30 s and primer extension at 72 °C for 30 s. The changes in relative gene expression were calculated with the 2–ΔΔCT method.

ethanol solutions (30%, 50%, 70%, 90% and 100%) for 10 min. The specimens were coated with gold for observation by a Nova 450 SEM (FEI, Hillsboro, United States). 2.6. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDSPAGE) The bacterial cells were centrifuged at 8,000 g for 1 min, and then resuspended with 0.85% physiological saline, sonicated with a probe sonicator for 2 min. After centrifugation, 20 μL supernatant was mixed with 5 μL loading buffer and heated at 100 °C for 10 min. SDS-PAGE was performed on a discontinuous buffered system using 12% separating gel and 3% stacking gel. The gel was stained using Coomassie brilliant bluestain solution and destained in methanol-water solution containing 10% acetic acid (Wang et al., 2017). 2.7. DNA extraction and agarose gel electrophoresis The PDI-treated V. parahaemolyticus was centrifugated at 12,000 g for 2 min. The bacterial DNA was extracted using a DNA extraction kit (Tiangen Co., Ltd, Beijing, China). The products were separated by 2% agarose gel electrophoresis, stained with ethidium bromide, and visualized using Bio-Rad Imaging System (Bio-Rad, USA).

2.9. Confocal laser scanning microscopy (CLSM) All microscopy images were captured and acquired using the CLMS machine (LSM710, Carl Zeiss, Germany). The 40 × objective was used to monitor SYBR Green I fluorescence excited at 488 nm and emitted at 500–550 nm. Structural parameters of biofilm were extracted from three-dimensional CLSM images using ISA-2 software (Beyenal, Lewandowski, & Harkin, 2004a). For each sample, nine separate sites were acquired randomly.

2.8. RNA extraction, reverse transcription and qPCR (RT-qPCR) RNA was extracted using a Bacteria RNA Extraction Kit (Vazyme 3

Food Control 113 (2020) 107181

B. Chen, et al.

Table 2 The sequence of oligonucleotide primers. Gene

Primer name

Sequence

Product size (bp)

r2

Reference

recA

recA-F recA-R trh –F trh –R tdh –F tdh –R toxR –F toxR –R oxyR –F oxyR –R aphA –F aphA-R luxS –F luxS –R opaR –F opaR-R

GCTAGTAGAAAAAGCGGGTG GCAGGTGCTTCTGGTTGAG TTCAACGGTCTTCACAAAATCAGA AAACATATGTCCATTTCCGCTCTC TATCCATGTTGGCTGCATTCAAAAC AGCAGTACGCAAATCGGTAG CAAAATTTACCATGGGCCAA CAATCGTTGAACCAGAAGCG TCGTCAGCTAGAGGAAGG TGGTCGCGTAAGCAATGC ACACCCAACCGTTCGTGATG GTTGAAGGCGTTGCGTAGTAAG GATGGGATGTCGCACTGGTTT ACTTGCTGTTCAGAAGGCGTA TGTCTACCAACCGCACTAACC GCTCTTTCAACTCGGCTTCAC

165

0.988

Ma et al. (2015)

171

0.999

Hossain, Kim, and Kong (2013)

382

0.999

121

0.99

Cao, Yuan, Xu, and Cao (2013)

210

0.988

Chung et al. (2016)

162

0.989

Wang et al. (2013)

388

0.99

Wang, Zhu, Zhang, and Zeng (2014)

100

0.988

Zhang et al. (2016)

trh tdh toxR oxyR aphA luxS opaR

observed in the samples only treated by 1.14 J/cm2 (5 min) irradiation (L + C-) or 1.0 μM curcumin (L-C+). However, the V. parahaemolyticus cells were obviously (P < 0.05) decreased to 6.15 Log CFU/mL treated by 1.14 J/cm2 irradiation with 0.2 μM curcumin. With the curcumin increasing to 1.0 μM, the PDI treatment showed an enhanced and dosedependent bactericidal activity under 1.14 kJ/cm2 irradiation (Fig. 1A). Effects of LED irradiation on V. parahaemolyticus inactivation are shown in Fig. 1B. Compared with negative control (L-C-), no significant decrease was observed in the cells treated by 6.84 J/cm2 (30 min) irradiation (L + C-) or 0.5 μM curcumin (L-C+). After 0.23 J/cm2 (1 min) irradiation with 0.5 μM curcumin, the V. parahaemolyticus cells were significantly (P < 0.05) decreased to 7.42 Log CFU/mL. With the irradiation time increasing to 2.28 J/cm2 (10 min), the bacterial cells showed a further decrease. Moreover, no visible colony of V. parahaemolyticus could not be detectable on TCBS agar plates under 6.84 J/ cm2 (30 min) irradiation. Therefore, the PDI-induced inactivation of V. parahaemolyticus exhibited a typical photosensitizer concentration and irradiation dosage-dependent manner. Overall speaking, the combination of 1.0 μM curcumin and 5 min (1.14 J/cm2) irradiation was the superior PDI treatment condition to induce non-detectable planktonic V. parahaemolyticus cells. However, it seems that the treatment temperatures of the curcuminmediated PDI did not influence the inactivation of V. parahaemolyticus. Compared with all control samples, no significant difference was monitored in the cell reduction between different temperatures (Fig. 1C). Likewise, no obvious changes in the cell reduction were observed under all temperatures when the dosage was increased to 13.68 J/cm2 (60 min) (Fig. 1D).

2.10. Extracellular polymeric substance (EPS) analysis The mature biofilm was collected in 1 mL 10 mM KCl and pretreated with a probe sonicator for four cycles (5 s operation, 5 s pause, 45 W). The sonicated suspension was centrifuged (4,000 g, 20 min, 4 °C), and then filtered by a 0.22 μm membrane. The protein was quantified by Lowry Assay. The carbohydrate were quantified by the phenol-sulfuric acid method (Kim & Park, 2013). The eDNA was determined using the dsDNA Reagent and Kits (Thermo Fisher, Shanghai, China). EPS was also analyzed by a Raman Microscope (Bruker Optics, Ettlingen, Germany) (Han et al., 2017). The Raman measurements were recorded at 633 nm with an accumulation time of 60s in the range of 400–1400 cm−1 equipped with a diode laser. The acquisition and processing of Raman data were conducted using the Bruker OPUS software. 2.11. Statistical analysis The experimental data were expressed as the mean ± standard deviation. One-way analysis of variance was used to compare the value differences (P < 0.05) using SPSS 17.0 (SPSS Inc., Chicago, IL). 3. Results 3.1. Antibacterial efficacy of the curcumin-mediated PDI against V. parahaemolyticus Effects of photosensitizer concentration on the PDI against V. parahaemolyticus are shown in Fig. 1A. Non-irradiated cells of negative control were ~8.06 Log CFU/mL, and no significant change was

Fig. 2. The ability of biofilm formation of V. parahaemolyticus (A) and their eradication effects induced by the curcumin-medicated PDI with different irradiate time and curcumin concentration. 4

Food Control 113 (2020) 107181

B. Chen, et al.

Fig. 3. Effects of the curcumin-medicated PDI on eradicating the mature biofilm of V. parahaemolyticus. (A) CLSM characterization of negative control biofilm (A1) and treated biofilm by 6.84 J/cm2 (30 min) and 10 μM curcumin (A2), 6.84 J/cm2 (30 min) and 20 μM curcumin (A3) and 13.68 J/cm2 (60 min) and 20 μM curcumin (A4); (B–E) Changes in the bio-volumes, thickness, homogeneity, textural entropy and biofilm roughness, respectively.

amount and unevenly dispersed structures under 6.84 J/cm2 (30 min) irradiation with 10 μM and 20 μM curcumin (Fig. 3A-A2 and A3). Less amount and sparse biofilm of V. parahaemolyticus was observed under 13.68 J/cm2 (60 min) irradiation with 20 μM curcumin (Fig. 3A-A4). Quantitative analysis revealed that the bio-volume of biofilm was 2.7 × 105 μm3 in negative control (L-C-) (Fig. 3B). After the PDI treatment, the bio-volume of biofilm was greatly (P < 0.05) decreased to 1.5 × 105 μm3, 5.2 × 104 μm3, 2.9 × 104 μm3 under 6.84 J/cm2 (30 min) and 10 μM curcumin, 6.84 J/cm2 (30 min) and 20 μM curcumin and 13.68 J/cm2 (60 min) and 20 μM curcumin treatment, respectively. Furthermore, the biofilm thickness was significantly reduced from 3.2 μm in negative control to 0.11 μm under 13.68 J/cm2 (60 min) irradiation with 20 μM curcumin (Fig. 3C). The homogeneity of biofilm exhibited a great (P < 0.05) increase ranging from 0.19 to 0.53 (Fig. 3D). In Fig. 3E, the textural entropy (TE) values markedly (P < 0.05) decreased from 7.5 to 3.5 after the PDI treatment. In addition, the biofilm roughness significantly increased with the increase of curcumin and illumination dosage in Fig. 3F. These results indicated that the antibiofilm of the curcumin-mediated PDI against V. parahaemolyticus were in a high efficiency.

3.2. Antibiofilm efficacy of the curcumin-mediated PDI against V. parahaemolyticus The crystal violet staining assay determined that 48 h was the optimal incubation time for the biofilm formation (OD600 nm = 2.30) (Fig. 2A) which was selected in this study. In Fig. 2B, individual irradiation (L + C-) or curcumin treatment (L-C+) did not cause significant changes in the biofilm compared to negative control (L-C-). However, the curcumin-mediated PDI significantly (P < 0.05) reduced the biofilm from 1.29 to 0.54 under 6.84 J/cm2 (30 min) irradiation with the curcumin increasing from 5 μM to 20 μM (Fig. 2B). The eradication ability of the PDI was further enhanced reaching OD600 nm = 0.18 when the irradiation was increased to 13.68 J/cm2 (Fig. 2B). Therefore, the combination of 20.0 μM curcumin and 60 min (13.68 J/cm2) irradiation could be selected as the superior PDI treatment condition to eradicate the biofilm of planktonic V. parahaemolyticus. CLSM was used to qualitatively visualize the antibiofilm effects of the PDI treatment (Fig. 3). In negative control (L-C-), the V. parahaemolyticus biofilm presented an intensively distributed architecture (Fig. 3A-A1). However, the PDI-treated biofilm presented the reduced 5

Food Control 113 (2020) 107181

B. Chen, et al.

Fig. 4. Effects of the curcumin-medicated PDI on the genomic DNA of V. parahaemolyticus with different curcumin concentration and irradiate time (A and B).

from 1.14 J/cm2 (5 min) to 6.84 J/cm2 (30 min), the PDI treatment induced a slight decrease in the band intensity of proteins with 0.5 μM curcumin, especially for ~100 kDa protein (Black arrow) and ~45 kDa protein (Red arrow). When the curcumin was increased to 1.0 μM, an obvious decrease in the band intensity of proteins was observed (Fig. 5B), and even ~45 kDa protein (Red arrow) almost disappeared, suggesting that the PDI induced a great degradation of proteins. To further elevate the curcumin to 5.0 μM, most bands disappeared (Fig. 5C), and no significant difference was found between different dosages (1.14 J/cm2 (5 min), 2.28 J/cm2 (10 min) and 6.84 J/cm2 (30 min)). Therefore, the exogenous photosensitizer played a major role in killing V. parahaemolyticus compared to the irradiation dosage.

3.3. Genomic DNA damage and protein degradation Effects of the PDI on the genomic DNA of planktonic cells were measured in Fig. 4. The band intensity of genomic DNA from all control samples did not present any DNA cleavage (Lane 1, 2 and 3) (Fig. 4A). Furthermore, the band intensity of genomic DNA (Lane 4, 5, 6 and 7) did not also present obvious DNA cleavage under the 1.14 J/cm2 irradiation (Fig. 4A), when the curcumin increased from 0.5 μM to 10.0 μM. However, the band intensity of genomic DNA (Lane 16 and 17) slightly decreased with the increase of curcumin from 0.5 μM to 10.0 μM under 6.84 J/cm2 (30 min) irradiation (Fig. 4B). Meanwhile, no significant change in the genomic DNA was observed in all control samples (Lane 8, 9, 10, 11, 12, 13, 14 and 15), also implying that individual irradiation or curcumin did not display obvious toxicity against V. parahaemolyticus. SDS-PAGE was used to evaluate the cellular protein degradation of V. parahaemolyticus. In Fig. 5A, all control samples exhibited similar band number and intensity of proteins (Lane 1, 2 and 3) with 6.84 J/ cm2 (30 min) illumination (L + C-) or 0.5 μM curcumin (L-C+), evidencing that individual irradiation or curcumin did not possess negative effects on the protein integrity. With the increase of irradiation

3.4. Changes in the expression of virulence genes and biofilm regulatory genes In Fig. 6A, the PDI significantly down-regulated the expression levels of virulence genes tdh and toxR under 1.14 J/cm2 (5 min) irradiation with 5.0 μM curcumin, although the trh gene presented an upregulated expression level. In addition, the transcriptional levels of biofilm genes oxyR, aphA,

Fig. 5. Effects of the curcumin-medicated PDI on the total protein (A–C) of V. parahaemolyticus. 6

Food Control 113 (2020) 107181

B. Chen, et al.

Fig. 6. Effects of the curcumin-medicated PDI on the virulence genes expression of V. parahaemolyticus (A) and the relative gene expression levels of V. parahaemolyticus biofilm (B).

cm2 with 10 μM curcumin, 75.1% under 6.84 J/cm2 (30 min) with 20 μM curcumin and 90.7% under 13.68 J/cm2 (60 min) with 20 μM curcumin compared with control. The total carbohydrate content was significantly (P < 0.05) reduced by 29.2% under 6.84 J/cm2 (30 min) with 10 μM curcumin, 39.6% under 6.84 J/cm2 (30 min) with 20 μM curcumin and 51.3% under 13.68 J/cm2 (60 min) with 20 μM curcumin, respectively (Fig. 8B). Meanwhile, the eDNA content was significantly reduced by 59.4% under 6.84 J/cm2 (30 min) irradiation with 20 μM curcumin and 65.3% under 13.68 J/cm2 (60 min) irradiation with 20 μM curcumin (Fig. 8C). On the basis, the reduction degree of extracellular proteins was much higher than that of carbohydrates and eDNA, and their eradiation order could be ranked as extracellular proteins > eDNA > carbohydrates. Raman spectra of EPS treated by the PDI are depicted in Fig. 8D. The tentative peak assignments of the spectra are summarized in Table 3. EPS showed a decrease in the peak intensity at 852 cm−1 and 12001280 cm−1 which are the characteristic peak of proteins. Notably, the peaks at 1250 cm−1 were observed in control group and PDI-treated samples under 6.84 J/cm2 (30 min) irradiation with 10 μM curcumin. However, these peaks disappeared after the curcumin was increased to 20 μM or the irradiation was increased to 13.68 J/cm2 (60 min). Additionally, most of the Raman peaks belonged to carbohydrates: 560 cm−1 (C–O–C glycosidic ring def polysaccharide), 10901095 cm−1 (C–O–C glycosidic link) and 1050-1160 cm−1 (C–C, C–O ring breath, asym). Compared with negative control (L-C-), the peaks intensity of 560 cm−1, 1095 cm−1 and 1160 cm−1 became

luxR and opaR were determined in the treated samples by 6.84 J/cm2 (30 min) and 20 μM curcumin. In Fig. 6B, the expression levels of flagellar motor gene (oxyR) were significantly (P < 0.05) down-regulated by 13%. Meanwhile, the PDI treatment down-regulated the expression levels of Vibrio quorum sensing related genes including aphA, luxR and opaR by 9%, 30% and 12%, respectively. 3.5. Morphology alteration of V. parahaemolyticus cells In negative control (L-C-), the cells were plump and rod-shaped (Fig. 7A) characterized by SEM. No significant alterations of the V. parahaemolyticus cells were observed in irradiation control (L + C-) or curcumin control (L-C+) (Fig. 7B and C). After the PDI treatment, the morphological deformation and groove appeared in the cells under 1.14 J/cm2 (5 min) irradiation with 0.5 μM curcumin (Fig. 7D). Moreover, obviously deformed morphology and wizened cells were observed when the curcumin was increased to 1.0 μM (Fig. 7E). Therefore, the cell wall and cellular proteins in the V. parahaemolyticus cells were more vulnerable to be attacked than DNA by the curcuminmediated PDI. 3.6. Changes in the EPS of V. parahaemolyticus biofilm Overall, the PDI treatment significantly reduced the content of protein, total carbohydrate and eDNA. In Fig. 8A, the protein content of EPS was significantly (P < 0.05) decreased by 59.7% under 6.84 J/

Fig. 7. Effects of the curcumin-medicated PDI on the cell wall of V. parahaemolyticus. (A) L-C-; (B) L-C+; (C) L + C-; (D) 1.14 J/cm2 (5 min) and 0.5 μM curcumin; (E) 1.14 J/cm2 (5 min) and 1.0 μM curcumin. 7

Food Control 113 (2020) 107181

B. Chen, et al.

Fig. 8. Chemical composition and contents of EPS which represent integrity in V. parahaemolyticus biofilm, with untreated, treated biofilm by 6.84 J/ cm2 (30 min) and 10 μM curcumin, 6.84 J/cm2 (30 min) and 20 μM curcumin,13.68 J/cm2 (60 min) and 20 μM curcumin. (A) Total protein, (B) total carbohydrates (OD490 nm/OD595 nm), (C) eDNA in EPS of V. parahaemolyticus biofilm and (D) Raman spectrum.

was observed after 28.8 J/cm2 blue LED irradiation with 50 μM curcumin (Hu et al., 2018a). It was noticed that two main protein bands showed completely different sensitivity to the PDI treatment in this study. The protein bands with ~45 kDa showed high sensitivity to the PDI treatment, indicated by a high degradation of proteins, while the protein bands with ~40 kDa showed a resistance to the PDI treatment. Subsequent studies are ongoing to reveal the information and functions of these proteins to clarify the attacking targets of the curcuminmediated PDI. The reactive oxygen species (ROS) from the PDI can react with various amino acid residues in proteins resulting in loss of histidine residues, radical-induced cross-linkers producing dityrosine moieties, formation of protein-centered alkyl, alkoxyl, alkylperoxyl, and ROO• radicals, and cleavage of peptide bonds. Especially, the sulfur-containing amino acids, cysteine, and methionine are particularly susceptible (Hu, Huang, Wang, Wang, & Hamblin, 2018b). For DNA, Hirakawa, Ota, Hirayama, Oikawa, and Kawanishi (2014) reported that the photoactivated photosensitizer caused DNA cleavage at guanine residues via electrostatic interaction with nucleic acids. Moreover, the Raman results in this study also showed that a significant decrease was observed in the guanine (G), cytosine (C) and uracil (U) residues of eDNA (Fig. 8D), implying that the PDI treatment destroyed the components of DNA and hence degraded the DNA chains. Although these,

dramatically weaker after PDI treatment. Meanwhile, the decreased peak intensity at 788 cm−1 (cytosine (C) and uracil (U)), 1095 cm−1 (ring breathing and symmetric/PO2− stretching) and 1320 cm−1 (guanine (G)) indicated the degradation of DNA. 4. Discussion The curcumin is the active constituent of turmeric powder which is an essential ingredient in curry, and it contains 3–5% of curcuminoids of which 50–60% correspond to curcumin (Esatbeyoglu et al., 2012). Therefore, the curcumin-mediated PDI can be a safe and promising technology to eradicate V. parahaemolyticus in food industry. Cellular DNA is thought to be the major target of ROS generated by LED illumination (Kim & Yuk, 2017). In our previous study, the DNA and protein bands of L. monocytogenes were almost completely degraded under 3.24 J/cm2 irradiation with 5 μM curcumin (Huang et al., 2020). For V. parahaemolyticus, clear DNA bands still existed even under 6.84 J/cm2 irradiation with 10 μM curcumin (Fig. 4). However, the PDI induced a great degradation of cellular proteins, especially when the irradiation increased from 1.14 J/cm2 (5 min) to 6.84 J/cm2 (30 min) with 5 μM curcumin. Similar changes of the DNA and proteins were also verified in Gram-negative Burkholderia cepacia, showing that the DNA bands were slightly decreased, and the great degradation of proteins Table 3 Assignment of the Raman bands of biofilm matrix. Peak position (cm−1)

Assignment

Macromolecular assignment

References

560–582

C–O–C glycosidic ring def polysaccharide; COO− wag; C–C skeletal cytosine (C), uracil (U) Ring breath Tyr C–C str, C–O–C glycosidic link; ring breath, sym/PO2− str, sym C–C, C–O ring breath, asym Amide III Guanine (G)

Carbohydrates

Ivleva, Wagner, Horn, Niessner, and Haisch (2008)

DNA/RNA Proteins Carbohydrates DNA/RNA Carbohydrates Proteins DNA/RNA

Maquelin et al. (2002)

780–785 852 1090–1095 1150–1160 1200–1280 1320

(De Gussem, Vandenabeele, Verbeken, & Moens, 2005; Maquelin et al., 2002) De Gussem et al. (2005) Maquelin et al. (2002) Notingher, Verrier, Haque, Polak, and Hench (2003)

Abbreviations: def, deformation vibration; wag, wagging; str, stretching; Tyr, tyrosine; breath, breathing; sym, symmetric; asym, asymetric. 8

Food Control 113 (2020) 107181

B. Chen, et al.

breathing tyrosine, Amide III phenylalanine of proteins and the guanine (G), cytosine (C) and uracil (U) of DNA/RNA. These results further supported that the PDI treatment induced the destruction of the chemical composition of EPS by degrading DNA, proteins or altering the conformation of functional groups, etc. Therefore, the PDI treatment was a valid non-thermal technology attacking multiple targets of biofilm and could bring fatal destruction to the stability and integrity of biofilm. In addition, the curcumin-mediated PDI greatly (P < 0.05) downregulated the expression levels of tdh gene. Similar to tdh gene, the PDI treatment also significantly down-regulated the expression levels of toxR gene. Meanwhile, we have also noticed the obvious up-regulation of trh gene after PDI treatment, but the possible reason and regulatory mechanism were still not clear. At present, the subsequent study in our research group is ongoing to investigate the interesting results of virulence genes regulation. Additionally, the curcumin-mediated PDI down-regulated the expression levels of biofilm formation genes including oxyR, aphA, luxR and opaR. OxyR contributes to early stages of biofilm formation by influencing fimbrial gene expression. The biofilm formation and swimming mobility were significantly inhibited in the oxyR mutant of V. parahaemolyticus (Chung, Fen, Yu, & Wong, 2016). AphA is the major Vibrio quorum sensing regulator at the low cell density (LCD), while LuxR or OpaR is the one operating at the high cell density (HCD) (Zhang & Orth, 2013). At LCD, AphA is abundantly expressed to activate the transcription of virulence and biofilm genes, which promotes the bacterial colonization and infection; when HCD is reached, LuxR or OpaR is abundantly produced and thus inhibits the transcription of virulence and biofilm genes (Wang et al., 2013). On this basis, all these results implied that the PDI treatment would greatly impede the bacterial colonization, swimming mobility and formation of biofilm.

the differences in the wall structures of Gram-negative and Gram-positive bacteria were considered as the main factor influencing the inactivation efficiency of PDI (Ghate et al., 2015). However, the study of Ghate et al. (2013) concluded that the inactivation efficiency of PDI should be collectively determined by the bacteria species, photosensitizer properties (e.g. hydrophilic or hydrophobic), overlap of emission spectrum (Light) and absorption spectrum (photosensitizer), etc. (Ghate et al., 2013, 2019). On this basis, the PDI treatment significantly inactivated Gram-negative V. parahaemolyticus mainly by inducing the protein degradation (Fig. 5) and the rupture of cell structures (Fig. 7). The main reasons were concluded as follows: Firstly, the curcumin absorbed blue LED light (455–460 nm) in an absorption spectrum range of 400–500 nm (Penha et al., 2017), which was crucial to the success of the PDI treatment; Secondly, the cell wall of Gramnegative bacteria was composed of a relatively impermeable outer membrane containing lipopolysaccharides (hydrophobic) in its outer leaflet and phospholipids (hydrophobic) in its inner leaflet (Mendonca, Amoroso, & Knabel, 1994), which was much effective to be attached by the liposoluble curcumin (hydrophobic) (Ghate, Zhou, & Yuk, 2019); Thirdly, considering the PDI-induced degradation difference of DNA and protein in Gram-negative V. parahaemolyticus (Figs. 4 and 5) and Gram-positive L. monocytogenes (Huang et al., 2020) as above mentioned, it could be inferred that most generated ROS by curcumin on the bacterial membrane attacked lipids and proteins in bacterial membrane, which might be insufficient to reach and oxidize DNA in the cytoplasm (Kim & Yuk, 2017). Therefore, the cellular outer membrane and proteins of V. parahaemolyticus became the vulnerable targets by the liposoluble curcumin-mediated PDI. More importantly, the curcumin-mediated PDI exhibited a high efficiency to eradicate the V. parahaemolyticus biofilm (Figs. 2 and 3A). The PDI treatment negatively changed the architectural structure and markedly reduced the adhesion ability of the biofilm. For example, the increase in biofilm thickness was greatly attributed to the adhesion of bacteria to the biofilm. Conversely, a decrease in biofilm thickness meant that the adhered bacteria were detached from the biofilm. Meanwhile, the PDI induced the increased homogeneity of biofilm indicating the decreased number of cell clusters (Beyenal, Donovan, Lewandowski, & Harkin, 2004b). Therefore, the PDI treatment eradicated a great amount of live V. parahaemolyticus cells. In addition, the textural entropy (TE) was calculated to measure the randomness of biofilms. Generally, the higher the textural entropy, the more heterogeneous is the biofilm tissues (Beyenal et al., 2004a), implying that the decreased TE resulted in the reduced heterogeneity (Fig. 3E). Roughness gives a measurement of the variations of biofilm thickness and was an indicator of the superficial biofilm heterogeneity (Bridier, DuboisBrissonnet, Boubetra, Thomas, & Briandet, 2010). In Fig. 3F, the values of biofilm roughness significantly (P < 0.05) increased after the PDI treatment, indicating that a high interfacial heterogeneity of biofilm. The increased superficial roughness would greatly facilitate the adhesion of photosensitizer to the biofilm, which further enhanced the bactericidal ability of the PDI treatment (Huang et al., 2020). EPS mainly consists of polysaccharides, proteins, nucleic acids, and is the first line of defense against antibiotics, biocides, etc. (Nett, Sanchez, Cain, & Andes, 2010). Destruction of EPS allow the disinfectant to successfully target living cells to inactivate them in biofilms (Shen et al., 2016). In Fig. 8, the PDI significantly reduced the extracellular proteins and polysaccharides of the biofilm. Likewise, the PDI possessed a stronger ability to decrease eDNA which is required for the initial establishment of bacterial biofilm (Whitchurch et al., 2002). To date, the best described protein is the extracellular adhesin CdrA which promotes biofilm formation and stabilize structural integrity by interacting with exopolysaccharide Psl (Passos da Silva et al., 2019). In addition, three matrix proteins in Vibrio cholerae contribute to biofilm stability in combination with Vibrio exopolysaccharide (VPS) (Yildiz, Fong, Sadovskaya, Grard, & Vinogradov, 2014). Moreover, a significant decrease was observed in the carbohydrate C–O–C group, ring

5. Conclusions The curcumin-mediated PDI efficiently inactivated the planktonic multidrug resistant V. parahaemolyticus, and the bacterial cell wall and intracellular proteins not the genomic DNA of the V. parahaemolyticus cells were the vulnerable target for the PDI treatment. Moreover, the PDI possessed a stronger ability to eradicate the V. parahaemolyticus biofilm through inactivating the live cells, reducing the chemical composition of EPS and negatively altering the structure of biofilm. The PDI treatment greatly down-regulated the expression of virulence genes and biofilm formation genes of V. parahaemolyticus. Therefore, the curcumin-mediated PDI is a valid technique in controlling the pathogens and eradicating their mature biofilm. CRediT authorship contribution statement Bowen Chen: Investigation, Software, Resources, Data curation. Jiaming Huang: Investigation, Software, Resources, Data curation. Huihui Li: Investigation, Software, Resources, Data curation. Qiao-Hui Zeng: Writing - review & editing, Supervision. Jing Jing Wang: Conceptualization, Funding acquisition, Writing - original draft. Haiquan Liu: Writing - review & editing, Supervision. Yingjie Pan: Conceptualization, Funding acquisition, Writing - original draft. Yong Zhao: Conceptualization, Funding acquisition, Writing - original draft. Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Acknowledgements This research was supported by the National Key R&D Program of 9

Food Control 113 (2020) 107181

B. Chen, et al.

China (2018YFC1602205), the National Natural Science Foundation of China (31571917), Shanghai Agriculture Applied Technology Development Program (T20170404), Shanghai Ocean University Funding (A1-3201-19-300502), Foshan City Science and Technology Plan Project (2018AB003681).

of the National Academy of Sciences, 113, 6283–6288. Hu, X., Huang, Y. Y., Wang, Y., Wang, X., & Hamblin, M. R. (2018b). Antimicrobial photodynamic therapy to control clinically relevant biofilm infections. Frontiers in Microbiology, 9, 1299. Hu, J., Lin, S., Tan, B. K., Hamzah, S. S., Lin, Y., Kong, Z., et al. (2018a). Photodynamic inactivation of Burkholderia cepacia by curcumin in combination with EDTA. Food Research International, 111, 265–271. Ivleva, N. P., Wagner, A. E., Horn, H., Niessner, R., & Haisch, C. (2008). In situ surfaceenhanced Raman scattering analysis of biofilm. Analytical Chemistry, 80, 8538–8544. Kim, M. J., Adeline Ng, B. X., Zwe, Y. H., & Yuk, H. G. (2017). Photodynamic inactivation of Salmonella enterica Enteritidis by 405 ± 5-nm light-emitting diode and its application to control salmonellosis on cooked chicken. Food Control, 82, 305–315. Kim, M. J., Mikš-Krajnik, M., Kumar, A., & Yuk, H. G. (2016). Inactivation by 405 ± 5 nm light emitting diode on Escherichia coli O157:H7, Salmonella Typhimurium, and Shigella sonnei under refrigerated condition might be due to the loss of membrane integrity. Food Control, 59, 99–107. Kim, H. S., & Park, H. D. (2013). Ginger extract inhibits biofilm formation by Pseudomonas aeruginosa PA14. PloS One, 8(9), e76106. Kim, M. J., & Yuk, H. G. (2017). Antibacterial mechanism of 405-nanometer light-emitting diode against Salmonella at refrigeration temperature. Applied and Environmental Microbiology, 83 e02582-16. Krom, B. P., Cohen, J. B., McElhaney Feser, G. E., & Cihlar, R. L. (2007). Optimized candidal biofilm microtiter assay. Journal of Microbiological Methods, 68, 421–423. Maquelin, K., Kirschner, C., Choo-Smith, L. P., Braak, N.v.d., Endtz, H. P., Naumann, D., et al. (2002). Identification of medically relevant microorganisms by vibrational spectroscopy. Journal of Microbiological Methods, 51, 255–271. Ma, Y. J., Sun, X. H., Xu, X. Y., Zhao, Y., Pan, Y. J., Hwang, C. A., et al. (2015). Investigation of reference genes in Vibrio parahaemolyticus for gene expression analysis using quantitative RT-PCR. PloS One, 10(12), e0144362. Mendonca, A. F., Amoroso, T. L., & Knabel, S. J. (1994). Destruction of gram-negative food-borne pathogens by high pH involves disruption of the cytoplasmic membrane. Applied and Environmental Microbiology, 60, 4009–4014. Nett, J. E., Sanchez, H., Cain, M. T., & Andes, D. R. (2010). Genetic basis of Candida biofilm resistance due to drug-sequestering matrix glucan. The Journal of Infectious Diseases, 202, 171–175. Notingher, I., Verrier, S., Haque, S., Polak, J. M., & Hench, L. L. (2003). Spectroscopic study of human lung epithelial cells (A549) in culture: Living cells versus dead cells. Biopolymers, 72, 230–240. Passos da Silva, D., Matwichuk, M. L., Townsend, D. O., Reichhardt, C., Lamba, D., Wozniak, D. J., et al. (2019). The Pseudomonas aeruginosa lectin LecB binds to the exopolysaccharide Psl and stabilizes the biofilm matrix. Nature Communications, 10, 2183. Penha, C. B., Bonin, E., da Silva, A. F., Hioka, N., Zanqueta, É. B., Nakamura, T. U., et al. (2017). Photodynamic inactivation of foodborne and food spoilage bacteria by curcumin. Lebensmittel-Wissenschaft und -Technologie- Food Science and Technology, 76, 198–202. Shen, Y., Huang, C., Monroy, G. L., Janjaroen, D., Derlon, N., Lin, J., et al. (2016). Response of simulated drinking water biofilm mechanical and structural properties to long-term disinfectant exposure. Environmental Science and Technology, 50, 1779–1787. Song, X. Y., Ma, Y. J., Fu, J. J., Zhao, A. J., Guo, Z. R., Malakar, P. K., et al. (2016). Effect of temperature on pathogenic and non-pathogenic Vibrio parahaemolyticus biofilm formation. Food Control, 73, 485–491. Wang, L., Ling, Y., Jiang, H., Qiu, Y., Qiu, J., Chen, H., et al. (2013). AphA is required for biofilm formation, motility, and virulence in pandemic Vibrio parahaemolyticus. International Journal of Food Microbiology, 160, 245–251. Wang, J. J., Liu, G., Huang, Y. B., Zeng, Q. H., Hou, Y., Li, L., et al. (2017). Dissecting the disulfide linkage of the N-terminal domain of HMW 1Dx5 and its contributions to dough functionality. Journal of Agricultural and Food Chemistry, 65, 6264–6273. Wang, Y., Zhu, S., Zhang, C., & Zeng, M. (2014). Detection of quorum sensing in Vibrio parahaemolyticus isolated from Macrobrachium rosenbergii. Biotechnology Bulletin, 3, 146–150. Whitchurch, C. B., Tolker-Nielsen, T., Ragas, P. C., & Mattick, J. S. (2002). Extracellular DNA required for bacterial biofilm formation. Science, 295(5559) 1487-1487. Wu, J., Mou, H., Xue, C., Leung, A. W., Xu, C., & Tang, Q. J. (2016). Photodynamic effect of curcumin on Vibrio parahaemolyticus. Photodiagnosis and Photodynamic Therapy, 15, 34–39. Yildiz, F., Fong, J., Sadovskaya, I., Grard, T., & Vinogradov, E. (2014). Structural characterization of the extracellular polysaccharide from Vibrio cholerae O1 El-Tor. PloS One, 9(1), e86751. Zhang, L., & Orth, K. (2013). Virulence determinants for Vibrio parahaemolyticus infection. Current Opinion in Microbiology, 16, 70–77. Zhang, Y., Zhang, L., Hou, S., Huang, X., Sun, F., & Gao, H. (2016). The master quorumsensing regulator OpaR is activated indirectly by H-NS in Vibrio parahaemolyticus. Current Microbiology, 73, 71–76.

References Almeida, J., Tome, J. P., Neves, M. G., Tome, A. C., Cavaleiro, J. A., Cunha, A., et al. (2014). Photodynamic inactivation of multidrug-resistant bacteria in hospital wastewaters: Influence of residual antibiotics. Photochemical and Photobiological Sciences, 13, 626–633. Beyenal, H., Donovan, C., Lewandowski, Z., & Harkin, G. (2004b). Three-dimensional biofilm structure quantification. Journal of Microbiological Methods, 59, 395–413. Beyenal, H., Lewandowski, Z., & Harkin, G. (2004a). Quantifying biofilm structure: Facts and fiction. Biofouling, 20, 1–23. Bridier, A., Dubois-Brissonnet, F., Boubetra, A., Thomas, V., & Briandet, R. (2010). The biofilm architecture of sixty opportunistic pathogens deciphered using a high throughput CLSM method. Journal of Microbiological Methods, 82, 64–70. Cabello, F. C. (2006). Heavy use of prophylactic antibiotics in aquaculture: A growing problem for human and animal health and for the environment. Environmental Microbiology, 8, 1137–1144. Cao, D., Yuan, M., Xu, L., & Cao, J. (2013). Detection of Vibrio parahaemolyticus toxR and tdh genes in foods by dual-color fluorescent real-time PCR. Journal of Food Safety and Quality, 5, 1451–1457. Cebrian, G., Manas, P., & Condon, S. (2016). Comparative resistance of bacterial foodborne pathogens to non-thermal technologies for food preservation. Frontiers in Microbiology, 7, 734. Chung, C. H., Fen, S. Y., Yu, S. C., & Wong, H. C. (2016). Influence of oxyR on growth, biofilm formation, and mobility of Vibrio parahaemolyticus. Applied and Environmental Microbiology, 82, 788–796. De Gussem, K., Vandenabeele, P., Verbeken, A., & Moens, L. (2005). Raman spectroscopic study of Lactarius spores (Russulales, Fungi). Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy, 61, 2896–2908. Deng, X., Tang, S., Wu, Q., Tian, J., Riley, W. W., & Chen, Z. (2016). Inactivation of Vibrio parahaemolyticus by antimicrobial photodynamic technology using methylene blue. Journal of the Science of Food and Agriculture, 96, 1601–1608. Dovigo, L. N., Pavarina, A. C., Mima, E. G., Giampaolo, E. T., Vergani, C. E., & Bagnato, V. S. (2011). Fungicidal effect of photodynamic therapy against fluconazole-resistant Candida albicans and Candida glabrata. Mycoses, 54, 123–130. Duse, L., Pinnapireddy, S. R., Strehlow, B., Jarmila, J., & Bakowsky, U. (2017). Low level led photodynamic therapy using curcumin loaded tetraether liposomes. European Journal of Pharmaceutics and Biopharmaceutics, 126, 233–241. Elmahdi, S., Dasilva, L. V., & Parveen, S. (2016). Antibiotic resistance of Vibrio parahaemolyticus and Vibrio vulnificus in various countries: A review. Food Microbiology, 57, 128–134. Esatbeyoglu, T., Huebbe, P., Ernst, I. M., Chin, D., Wagner, A. E., & Rimbach, G. (2012). Curcumin-from molecule to biological function. Angewandte Chemie International Edition, 51, 5308–5332. Ghate, V., Leong, A. L., Kumar, A., Bang, W. S., Zhou, W., & Yuk, H. G. (2015). Enhancing the antibacterial effect of 461 and 521 nm light emitting diodes on selected foodborne pathogens in trypticase soy broth by acidic and alkaline pH conditions. Food Microbiology, 48, 49–57. Ghate, V., Ng, K. S., Zhou, W., Yang, H., Khoo, G. H., Yoon, W. B., et al. (2013). Antibacterial effect of light emitting diodes of visible wavelengths on selected foodborne pathogens at different illumination temperatures. International Journal of Food Microbiology, 166, 399–406. Ghate, V., Zhou, W., & Yuk, H. G. (2019). Perspectives and trends in the application of photodynamic inactivation for microbiological food safety. Comprehensive Reviews in Food Science and Food Safety, 18, 402–424. Han, Q., Song, X., Zhang, Z., Fu, J., Wang, X., Malakar, P. K., et al. (2017). Removal of foodborne pathogen biofilms by acidic electrolyzed water. Frontiers in Microbiology, 8, 988. Hirakawa, K., Ota, K., Hirayama, J., Oikawa, S., & Kawanishi, S. (2014). Nile blue can photosensitize DNA damage through electron transfer. Chemical Research in Toxicology, 27, 649–655. Hossain, M. T., Kim, Y. O., & Kong, I. S. (2013). Multiplex PCR for the detection and differentiation of Vibrio parahaemolyticus strains using the groEL, tdh and trh genes. Molecular and Cellular Probes, 27, 171–175. Huang, J., Chen, B., Li, H., Zeng, Q. H., Wang, J. J., Liu, H., et al. (2020). Enhanced antibacterial and antibiofilm functions of the curcumin-mediated photodynamic inactivation against Listeria monocytogenes. Food Control, 108. Hubbard, T. P., Chao, M. C., Abel, S., Blondel, C. J., Abel Zur Wiesch, P., Zhou, X., et al. (2016). Genetic analysis of Vibrio parahaemolyticus intestinal colonization. Proceedings

10