ES7, encoding a ferredoxin-dependent glutamate synthase, functions in nitrogen metabolism and impacts leaf senescence in rice

Accepted Manuscript Title: ES7, encoding a ferredoxin-dependent glutamate synthase, functions in nitrogen metabolism and impacts leaf senescence in rice Authors: Zhenzhen Bi, Yingxin Zhang, Weixun Wu, Xiaodeng Zhan, Ning Yu, Tingting Xu, Qunen Liu, Zhi Li, Xihong Shen, Daibo Chen, Shihua Cheng, Liyong Cao PII: DOI: Reference:

S0168-9452(16)30654-9 http://dx.doi.org/doi:10.1016/j.plantsci.2017.03.003 PSL 9571

To appear in:

Plant Science

Received date: Revised date: Accepted date:

16-11-2016 1-3-2017 8-3-2017

Please cite this article as: Zhenzhen Bi, Yingxin Zhang, Weixun Wu, Xiaodeng Zhan, Ning Yu, Tingting Xu, Qunen Liu, Zhi Li, Xihong Shen, Daibo Chen, Shihua Cheng, Liyong Cao, ES7, encoding a ferredoxin-dependent glutamate synthase, functions in nitrogen metabolism and impacts leaf senescence in rice, Plant Science http://dx.doi.org/10.1016/j.plantsci.2017.03.003 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ES7, encoding a ferredoxin-dependent glutamate synthase, functions in nitrogen metabolism and impacts leaf senescence in rice

Zhenzhen Bi a, b, 1, Yingxin Zhang a, b, 1, Weixun Wu a, b, Xiaodeng Zhan a, b, Ning Yu a,b, Tingting Xu a, b

a

, Qunen Liu a, b, Zhi Li a, b, Xihong Shen a, b, Daibo Chen a, b, Shihua Cheng a, b, *, Liyong Cao a, b, *

State Key Laboratory of Rice Biology, China National Rice Research Institute, Hangzhou,

Zhejiang 310006, China b

Key Laboratory for Zhejiang Super Rice Research, China National Rice Research Institute,

Hangzhou, Zhejiang 310006, China Email addresses: Zhenzhen Bi: [email protected] Yingxing Zhang: [email protected] Weixun Wu: [email protected] Xiaodeng Zhan: [email protected] Ning Yu: [email protected] Tingting Xu: [email protected] Qunen Liu: [email protected] Zhi Li: [email protected] Xihong Shen: [email protected] Daibo Chen: [email protected] Shihua Cheng: [email protected] Liyong Cao: [email protected] 1

Zhenzhen Bi and Yingxin Zhang contributed equally to this work.

*

Corresponding authors: [email protected] (L. Cao), 86-571-63370329; [email protected] (S. Cheng), 86-571-63370188.

1

Highlight 

Cloned a ferredoxin-dependent glutamate synthase gene ES7 in indica cultivar 93-11.



Leaf senescence was accelerated in es7.



ES7 is essential for nitrogen metabolism and effects chlorophyll synthesis.



ES7 also associated with photorespiration.

Abstract

Glutamate synthase (GOGAT) is a key enzyme for nitrogen metabolism and ammonium assimilation in plants. In this study, an early senescence 7 (es7) mutant was identified and characterized. The leaves of the es7 mutant begin to senesce at the tillering stage about 60 day after sowing, and become increasingly senescent as the plants develop at the heading stage. When es7 plants are grown under photorespiration-suppressed conditions (high CO2), the senescence phenotype and chlorophyll content are rescued. qRT-PCR analysis showed that senescenceassociated genes were up-regulated significantly in es7. A map-based cloning strategy was used to identify ES7, which encodes a ferredoxin-dependent glutamate synthase (Fd-GOGAT). ES7 was expressed constitutively, and the ES7 protein was localized in chloroplast. qRT-PCR analysis indicated that several genes related to nitrogen metabolism were differentially expressed in es7. Further, we also demonstrated that chlorophyll synthesis-associated genes were significantly down-regulated in es7. In addition, when seedlings are grown under increasing nitrogen concentrations (NH4NO3) for 15 days, the contents of chlorophyll a, chlorophyll b and total chlorophyll were significantly lower in es7. Our results demonstrated that ES7 is involved in nitrogen metabolism, effects chlorophyll synthesis, and may also associated with photorespiration, impacting leaf senescence in rice.

KeyWords:

Ferredoxin-dependent glutamate synthase; nitrogen metabolism; chlorophyll

metabolism; photorespiration ; leaf senescence; ES7

2

1. Introduction Nitrogen is a key macronutrient required by plants for growth and development, and important for the yield and productivity of crops [1, 2]. Rice plants grown in paddy fields use ammonium as the major source of inorganic nitrogen [3]. It is established that the glutamine synthetase /glutamate synthase (GS/GOGAT) cycle is the only route for primary ammonium assimilation in plants grown under normal conditions [4, 5]. In rice, most of the ammonium is taken up by roots, which is mainly primary assimilated by glutamine synthetase1 (GS1) and NADH-dependent glutamate synthase1 (NADH-GOGAT1) in roots [6, 7]. In developing sink organs such as young leaves and grains, the remobilized glutamine (Gln) is converted into glutamate (Glu) via the GOGAT pathway. Glu is a key donor for the synthesis of amino acids and nitrogeneous compounds [8]. Meanwhile, Gln is synthesized from the catabolic products of proteins, nucleic acids and chlorophyll [9]. Therefore, GOGAT is a key enzyme for ammonium assimilation in plants[3]. There are two types of GOGAT in plants, NADH-dependent glutamate synthases (NADH-GOGAT) and ferredoxin-dependent glutamate synthases (Fd-GOGAT). The Arabidopsis Fd-GOGAT1 (AtGLU1) is a chloroplastic enzyme, plays a major role in assimilating the ammonium derived from photorespiration. This enzyme also plays a major role in primary nitrogen assimilation in leaves [10]. In rice, there are two NADH-GOGAT and only one Fd-GOGAT [11]. OsNADH-GOGAT1 is mainly expressed in roots, spikelets and other non-photosynthetic tissues, and is important for ammonium response in roots and the early stages of panicle ripening [3]. In contrast, OsNADH-GOGAT2 is only expressed in mature leaf blades and sheathes. The data suggest that they may have distinct functions [3, 11-14]. OsFd-GOGAT is thought to function in modulating nitrogen assimilation and carbon–nitrogen balance [15]. The role of OsFd-GOGAT in disease resistance has been revealed recently [16]. Previous study have reported that nitrogen is a crucial component of a variety of cellular metabolites in all organisms, including amino acids, proteins, chlorophylls and nucleic acids [17]. Nitrogen availability also plays an important role in leaf senescence, functioning as an external signal [18, 19]. Optimal nitrogen supply promotes leaf growth and delays senescence [20]. However, when plants are grown under nitrogen deficient conditions, senescence is induced (nitrogen deficiency induced senescence, NDI senescence) [21-23]. The nitrogen in the old leaves will become a source to supply nitrogen for new, growing leaves. During this process, high molecular 3

weight nitrogen resources are degraded and converted into Gln, asparagine, Glu and other small molecules, which are then transported to developing tissues [19]. In recent years, many senescence-related genes have been identified in rice, such as NYC1, NOL, NYC4, RCCR1 and OsPAO [24-27] , which are chlorophyll-degradation related genes, whose associated gene products are involved in the degradation of chlorophyll. OsGluRS, OsCHLH, OsCHLI, OsCHLD, OsDVR, OsPORA, OsPORA and other chlorophyll synthesis associated genes have also been reported [28-33]. However, the function and the molecular mechanism of NDI leaf senescence are still unknown. Only few genes have been linked to nitrogen nutrition associated with leaf senescence in Arabidopsis thaliana. AtGLR1.1, a putative ionotropic glutamate receptor. AtIPT3, a key enzyme involved in nitrogen-dependent cytokinin biosynthesis [34-36]. The ability of the plant to sense nitrogen and overall nutritional status is very important. Therefore, gaining a deeper understanding of the mechanism that plants utilize for NDI leaf senescence is a key research area. In this study, we isolated the lesion mimic and early senescence1 (lmes1) mutant in an indica cultivar 93-11 based on fine mapping that was carried out previously [37]. We cloned the LMES1 gene from 93-11, and our data revealed a single point mutation in ferredoxin-dependent glutamate synthase (OsFd-GOGAT) that causes altered splicing, resulting in a 19 amino acid deletion. The mutant has a NDI leaf senescence phenotype, so we propose to rename the mutant early senescence 7 (es7) in this study. The es7 mutant also exhibits a photorespiration-deficient phenotype, when grown under photorespiration-suppressed conditions (high CO2), the senescence phenotype and chlorophyll content are rescued. Here we show the results of the phenotypic characterization, functional verification, gene expression analysis of ES7, and the expression of genes related to nitrogen metabolism, chlorophyll metabolism and senescence. The es7 mutant has a defect in nitrogen metabolism and chlorophyll synthesis, and even external application nitrogen is unable to delay the senescence, indicating that OsFd-GOGAT has an important role in nitrogen metabolism and photorespiration, and is linked to chlorophyll synthesis in rice.

4

2. Materials and methods

2.1 Plant materials and growth conditions The es7 (lmes1) mutant was isolated from a

60

Co γ-ray treatment rice mutant library (Oryza

sativa L. ssp. India cv.93-11) previously generated in our lab [37]. The es7-N mutant was isolated from an ethyl methane sulfonate (EMS) mutagenized rice mutant library (Oryza sativa L. ssp. Japonica cv. ZhongHua11). The plants were grown in a paddy field under natural conditions in Hangzhou, Zhejiang province and in Lingshui, Hainan Province, China. After germination, rice seedlings were grown in hydroponic culture in a controlled environment chamber (ambient CO2 concentration, 0.03%, photorespiration conditions), using a 12 hours light/12 hours dark cycle with a constant temperature of 28 ℃ and 70% relative humidity. To impose the photorespiration suppressed conditions, high CO2 (0.3%) gas was introduced into the growth chamber.

2.2 Measurement of pigment content Pigments were extracted from fresh leaves with 80% acetone and measured using a spectrophotometer (BACKMAN COULTER DU800, USA) with wavelengths of 470, 645 and 663 nm. Total chlorophyll (Chl), Chlorophyll a (Chl a) and chlorophyll b (Chl b) contents were analyzed according to the method described by Arnon and Porra et al. [38]. All experiments were repeated three times independently.

2.3 Determination of physiological parameters The activities of catalase (CAT), total antioxidant capacity (T-AOC), glutamine synthetase (GS), glutaminase (GLS), glutamate dehydrogenase (GDH), Nitric Oxide Synthase (NOS) and the concentration of NO2-, and H2O2 were determined using commercial assay kits acquired from Nanjing Jiancheng Bioengineering Institute (China). The enzyme activity of GOGAT was measured with an Enzyme Linked Immunosorbnent Assay Kit purchased from COMIN (Suzhou, China). Determination of the free amino acid contents were carried out in flag leaves at the heading stage. The leaves were extracted with 5% trichloroacetic acid (TCA) and analyzed with an Agilent HPLC-1100 (USA). All experiments were carried out using flag leaves at the heading stage and repeated three times independently. 5

2.4 Cloning of ES7 and rice transformation The ES7 gene was mapped to an 88-kb region between markers ZL-3 and ZL-22 on chromosome 7 according to the methods described by Li et al. [37]. Candidate genes were amplified by PCR and sequenced from both wild-type (93-11) and the es7 mutant, the resultant sequences were compared and differences were analyzed. For genetic complementation, genomic DNA was isolated from 93-11 leaves, and a 18.868-kb genomic DNA fragment, containing the ES7 coding region, along with the upstream and downstream sequences, was amplified by PCR using the ES7-COM primers (Supplementary Table S1). The resultant fragment was introduced into the binary vector pCAMBIA1300 using the In-Fusion HD Cloning Kit (Clontech, Japan), to construct the complementation vector. To create the OsES7-pro::GUS construct, a 3273-bp 5’ upstream region of the ES7 gene from start codon (ATG) was amplified by PCR using ES7-pro primers (Supplementary Table S1), and cloned into pCAMBIA 1305-GUS using the EcoR Ⅰand Nco Ⅰrestriction enzyme sites. Furthermore, a CRISPR/Cas9 vector was constructed using the target sequence AATGACTCCGGTGACGGTTCA GGA, and the BGK03 vector (Biogle Company, China). All of the constructs were verified by DNA sequencing. All the vectors were introduced into WT or es7 mutant via Agrobacterium-mediated rice transformation [39].

2.5 GUS assay GUS histochemical staining was performed as described previously [40]. Briefly, rice samples were stained with GUS staining solution consisting of 100mM NaPO4 buffer (pH 7.0), 5mM K4K3, 0.1% Triton X-100, 10mM EDTA (pH 8.0), and 1mM X-gluc. Samples were incubated at 37℃ in the dark for 10 hours. Then 95% ethanol was used to remove Chlorophyll, and tissues were observed with a Carl Zeiss SteREO Lumar V12 stereomicroscope (Markku Saari, Germany).

2.6 Subcellular localization analysis For subcellular localization analysis, the full length coding sequence of ES7 without the stop codon, was amplified by PCR using ES7-GFP primers ( Supplementary Table S1), and cloned into p35S::GFP using the XbaⅠand BamHⅠrestriction sites, which fused ES7 to N-terminus of green fluorescent protein (GFP). The fusion constructs p35S::ES7-GFP and the empty vector p35S::GFP 6

control, were transformed into rice protoplasts as described [41, 42]. The fluorescence was observed using laser confocal microscopy (ZEISS LSM 700, Germany). 2.7 RNA extraction and gene expression analysis Total RNA was extracted from rice tissues using the RNAprep pure plant kit (Tiangen, China) for qRT-PCR. cDNA was synthesized from total RNA using the ReverTra Ace qPCR-RT kit (Toyobo, Japan), according to the manufacturer’s instructions. qRT-PCR was performed using SYBR premix Ex Taq Ⅱ (Takala, Japan) in a LightCycler 480Ⅱ (Roche, Sweden). The primers used for RT-PCR are listed in Supplementary Table S1. Rice actin1 was used as an internal control. Data were analyzed following the relative quantification method [43]. Values are the means ± SD of three biological replicates. The Student’s t test was used for statistical analysis.

3. Results

3.1 The phenotype and physiological analysis of es7 The early senescence 7 mutant was isolated by screening M2 lines from a gamma ray-induced mutant population of indica cultivar 93-11 [44]. When leaf senescence occurs, leaf color changes from green to yellow. The upper three leaves of the es7mutant began to exhibit senescence at the tillering stage about 60 day after sowing while 93-11 exhibit normal. As development progressed, the es7 mutant began to shown more areas of yellowing and senescence in the second, third and fourth upper leaves at the heading stage, compared to 93-11 (Fig. 1A and B). These results were observed consistently in both Hangzhou in Zhejiang province and in Lingshui in Hainan province. Based on results of Li et al. [37], we examined multiple senescence-related parameters including CAT, T-AOC, and H2O2 content. At the heading stage, CAT and T-AOC activity were significantly lower in es7 plants. These decreases occurred consistently in flag leaves, second upper leaves, and third upper leaves. The content of H2O2, by contrast, was significantly higher in es7 plants in all three sampled leaves, (Fig. 1D-F). Finally, es7 plants also had a lower grain yield in comparison to 93-11 (Fig. 1C).

7

3.2 Leaf senescence occurred in es7 To validate that the yellowing phenotype is directly related to early senescence in es7, the relative expression of several known senescence-associated genes, Osh36, OsI57, Osh69 and OsI85 were examined by qRT-PCR in flag leaves. These senescence-inducible genes were significantly up-regulated in es7 [45] (Fig. 2 A-D). Osh36 and OsI85, which are marker genes for leaf senescence [46], were highly up-regulated in es7, increasing up to 18 and 104 fold respectively (Fig. 2A and D). These results suggest that early senescence was occurred in es7 plants.

3.3 Map-based cloning of ES7 To investigate the molecular basis of the early senescence phenotype of the es7 mutant, we crossed es7 with 93-11. The F1 plants exhibited normal green phenotypes, however, in the F2 population 169 plants had normal green phenotypes and 47 plants displayed the early senescence phenotype. The ratio fit to the expected value of 3:1 (χ2 =1.21<χ2 0.05 =3.84, P=0.27). The results indicate that es7 is controlled by a single recessive gene. To isolate the ES7 gene, a map-based cloning approach was used. Based on previous work, the ES7 gene was localized to a 88-kb region between two InDel markers, ZL-3 and ZL-22 [37]. Twelve open reading frames are contained within this region (Fig. 3A). Based on our PCR sequencing results, a single base substitution from G to A at position 1292 was identified in the second exon of LOC_Os07g46460 in genome (Fig. 3B), which encodes a putative ferredoxindependent glutamate synthase (Fd-GOGAT). This mutation alters the splice site between the second exon and second intron, leading to a deletion of 57 bases in the mRNA transcript, which results in a deletion of 19 amino acids in the translated protein (Supplementary Fig. S1 and S2). The Fd-GOGAT protein has two mainly conserved domains, one containing the purF-type glutamine amide transfer region, and the other one containing the FMN binding region. The modified region of the ES7 protein variant occurs in the first conserved purF-type glutamine amide transfer domain [11], which has been shown to influence the function of the Fd-GOGAT enzyme. To confirm that this mutation causes the early senescence phenotype, we generated transgenic plants expressing the entire wild-type ES7coding region 14.429-kb, a 3273-bp upstream region and a 1166-bp downstream region in the es7 background. Notably, all fifteen transgenic plants exhibited normal green leaves (Fig. 4A and B). The Chl content was restored to wild-type levels (Fig. 4C), 8

and the expression of ES7 was also restored to wild-type levels in four complementation lines (Fig. 4D). These results showed that the cloned candidate gene OsFd-GOGAT was indeed responsible for the es7 phenotype. To further support these results, a second es7 mutant allele (es7-N) mutant was identified from the japonica cultivar ZhongHua11 (ZH11) mutant library in our lab, which displayed the same senescence phenotype as the es7 mutant. DNA sequence analysis indicated that es7-N has a single point mutation of A to G at position 2165 in the third exon of the ES7 gene in genome, which resulted in the substitution of Ile with a Val residue (Supplementary Fig. S1 and S2). This mutation also occurred in the conserved purF-type glutamine amide transfer domain. The identity of ES7-N was further confirmed by a genetic complementation test, as described above for es7 (Fig. 4E-G). Finally, thirty transgenic plants were obtained, and the plants also exhibited normal green leaves. Furthermore, a CRISPR/Cas9 vector was constructed to knock out the ES7 gene. Sequencing analysis indicated that homozygous mutant of CRISPR/Cas9 had one single base deletion at position 2404 in genome, resulted in a termination codon at 1207 to 1209 in the mRNA transcript. This leads to a premature translation termination at position 343 of the amino acid sequence, resulted in a deletion of the second conserved domain, which containing the FMN binding region (Supplementary Fig. S1 and S2). However, the homozygous mutants of CRISPR/Cas9 were severely stunted and eventually died at the seedling stage (Fig. 4H). In summary, these results suggested that the mutation in OsFd-GOGAT was indeed responsible for the es7 phenotype. Taken together, these data indicate that the production of the functional ES7 protein is very important for normal plant growth and development, and the conserved domain purF-type glutamine amide transfer region and the FMN binding region plays a major role in the function of this enzyme activity.

3.4 ES7 is ubiquitously expressed To determine the expression pattern of ES7, qRT-PCR was performed using ES7-specific primers (Fd-GOGAT-F/R; Supplementary Table S1). qRT-PCR analysis revealed that ES7 was expressed in the culms, leaves, sheaths and stipes, but showed almost no expression in panicles and roots. ES7 is highly expressed in leaves, especially in the green leaves (Fig. 5A). To further investigate tissue specific expression of ES7, the OsES7-pro::GUS vector was introduced into ZH11. 9

GUS was detected in transgenic plants. Strong GUS expression was observed in culms, leaves, sheaths, and stipes, but GUS activity was weak in panicles and roots, which is consistent with the RT-PCR results (Fig. 5B-G).

3.5 ES7 protein is localized in the chloroplast Bioinformatics analysis suggested that ES7 is localized in the chloroplast. To confirm the subcellular localization of ES7, the control vector p35S::GFP and p35S::ES7-GFP vector were introduced into rice protoplasts. It was found that the green fluorescent signal from ES7-GFP fusion proteins was merged with the autofluorescence signal of chlorophyll, which indicated that the ES7 protein is localized to the chloroplast (Fig. 6E-H). However, the GFP fluorescence signal was present throughout the nucleus and the cytoplasm in the cells transformed with p35S::GFP (Fig. 6A-D). These confirm that ES7 protein is localized in the chloroplast.

3.6 ES7 is involved in nitrogen metabolism ES7 is a ferredoxin-dependent glutamate synthase (Fd-GOGAT) that functions in ammonium assimilation [47]. To understand the role of ES7 in these processes, expression analysis of nitrogen metabolism related genes were carried out using qRT-PCR [48]. In es7 mutant plants, the expression of Fd-GOGAT was decreased. Interestingly the GS2 gene, which was chloroplastic GS, functions with Fd-GOGAT in the chloroplast of green tissues, also down-regulated corresponding (Fig. 7A). In order to compensate for the function of Fd-dependent type GOGAT in ammonium assimilation, another NADH-dependent type GOGAT was up-regulated. The GS1 gene, which localized in the cytosol and functions in primary assimilation in roots with NADH-GOGAT [3], was also shown to be up-regulated (Fig. 7B). Even OsGDHs which play a role under excess of ammonium, are highly expressed. Therefore, these data indicate that nitrogen metabolism is defective in es7, leading to a significant difference in the expression of nitrogen metabolism related genes. Along with the observed changes in gene expression, the enzymatic activities and product contents were also modified in the flag leaves at the heading stage. Study reported that Fd-GOGAT amounts for more than 96% of total GOGAT activity in green leaves in Arabidopsis [49]. The total GOGAT activity was measured to evaluate the Fd-GOGAT activity. The result revealed that es7 10

mutant exhibited only 26.3% of the GOGAT activity compared to 93-11 (Fig. 8A). Enzymatic activity of GS, which mostly due to GS2, was also significantly decreased. While enzymatic activity of glutamate dehydrogenase (GDH), and amounts of NO2- were significantly higher in es7 (Fig. 8B-D). These data were consistent with the expression of Fd-GOGAT, GS2, GDH, NR and NiR. With the decreased activities of GOGAT and GS, the reassimilation of nitrogen in leaves was impeded. The contents of free amino acids were measured in flag leaves at the heading stage, which showed that Glu and other most amino acids were significantly decreased in es7 (Table 1). Interestingly, the Gln content was also significantly decreased. These results suggest that ES7 is required for nitrogen assimilation and amino acid metabolism in leaves.

3.7 ES7 effects on chlorophyll synthesis To understand the molecular basis between early senescence and nitrogen metabolism in es7, the relative expression of select chlorophyll synthesis-associated genes including HEMA, HEMC, HEMD, HEME1, HEME2, GSA, CHLG, CHLD, CHLI, CHLH, PORA, PORB and OsDVR, were examined by using qRT-PCR in flag leaves (Fig. 9A). These genes, which function in chlorophyll synthesis, were significantly down-regulated in es7. Further, the expression of chlorophyll degradation-associated genes including NYC1, NOL, NYC4, RCCR1 and OsPAO, were also examined. In es7, the gene expression levels of NYC1, NOL and NYC4 were significantly down-regulated, whereas RCCR1 and OsPAO were up-regulated (Fig. 9B). These may be responsible for the reduced chlorophyll content in es7. Next, the chlorophyll content of 93-11 and es7 mutant plants were examined which were grown in different nitrogen concentration (NH4NO3) in hydroponic culture at the seedling stage for 15 days. The normal concentration of nitrogen is 2.9 mM. The contents of Chl a, Chl b and total Chl were significantly lower in es7 relative to 93-11 (Fig. 10). This was observed even at conditions where the concentration of nitrogen was doubled, indicating that external application nitrogen is not capable of delaying the senescence in es7. Taken together, these results indicate that es7 mutant had a defect in chlorophyll synthesis.

11

3.8 es7 mutant exhibited normal growth under high CO2 conditions Fd-GOGAT has been reported to implicate in photorespiration and primary nitrogen assimilation in leaves in Arabidopsis [10]. To evaluate the role of OsFd-GOGAT in photorespiration, 93-11 and es7 mutant plants were grown under ambient CO2 (photorespiration conditions) and high CO2 (photorespiration suppressed conditions) for 15 days after germination. The results showed that the contents of chlorophyll were significantly lower in es7 under ambient CO2, but were exhibited a normal chlorophyll contents under high CO2 (Fig. 11); which displayed a photorespiration-deficient phenotype, that plants grew normally under high CO2, but were chlorotic under ambient CO2 [50, 51].

4. Discussion Plants with an early senescence phenotype usually exhibit some agronomically impactful traits such as changes in leaf color, degradation of chloroplast, accumulation of H2O2, cell death, changes of senescence-related parameters and finally can result in reduced grain yield. Isolation and characterization of early senescence mutants have increased our understanding of the mechanisms of leaf senescence, which is an agronomically important process [27, 52, 53]. In the present study, we isolated a rice early senescence mutant es7, that exhibited decreased chlorophyll content, decreased activities of CAT and T-AOC, increased H2O2 content, and significant up-regulation of senescence-inducible genes (Fig. 1 and 2). Sequence and complementation analysis shown that the mutation is located in a ferredoxin-dependent glutamate synthase (OsFd-GOGAT) in chromosome 7, leading to a defect in the first conserved domain of OsFd-GOGAT (Fig. 3 and 4, Supplementary Fig. S1 and S2). Previous studies showed that mutation of OsFd-GOGAT, the leaves conferred resistance in disease in japonica, and OsFd-GOGAT showed a highly and specifically differentiated patterns between japonica and indica [16, 54]. While our functional complementation results showed that the ES7 gene has the same function both in indica and japonica, and defects of the ES7 protein induced early senescence in leaves. However, the mutant generated by CRISPR/Cas9, which there’s no functional ES7 protein produced, die at the seedling stage (Fig. 4). Similar to the lethal phenotype in Arabidopsis [10]. Therefore, these data prove that functional ES7 has an important role in the normal growth of rice. The GS/GOGAT cycle is considered the only route for the primary assimilation of ammonium in 12

plants [4, 5]. In rice, GS1 and NADH-GOGAT1 are the key players in the primary assimilation of ammonium taken up by roots [3, 7, 14]. NADH-GOGAT2 has an important role in remobilization of nitrogen in the senescent rice leaves [13]. GS2 and Fd-GOGAT are function in the chloroplasts of green tissues, reassimilation of the ammonium that is liberated during photorespiration [5, 10]. Our subcellular localization analysis conformed that ES7 was localized in chloroplasts (Fig. 6), which is consistent with its biological function. In es7 mutant, the expression and enzyme activity of Fd-GOGAT and GS2 were both down-regulated. While OsNADH-GOGAT, OsGS1:2, OsGS1:3, and even OsGDHs which play a role under excess of ammonium, are highly expressed but were unable to compensate for the disruption in the GS/GOGAT cycle (Fig. 7 and 8). With decreased activity of GOGAT, Glu content was decreased significantly. Interestingly, the content of Gln was also decreased. This may be because the GS/GOGAT cycle is a coordinated process. In this cycle, Glu is also as a substrate of Gln biosynthesis. With the decreased substrate and activity of GS, the Gln content was decreased as well. Glu is a key donor for the synthesis of amino acids and nitrogeneous compounds [8], and many other free amino acids were also decreased (Table 1). These results indicate that the ES7 has a major role in nitrogen metabolism and amino acid metabolism. Glu is the precursor of chlorophyll synthesis in developing leaves, and is synthesized via the GS/GOGAT cycle [54, 55]. When plants are grown in paddy fields, ammonium is the major source of nitrogen, and nitrogen deficiency generally lead to growth reduction and early senescence [19, 21, 22]. Similarly, when rice seedlings were grown in different concentrations of ammonium for 15 days, the contents of all Chls were increased in es7 and 93-11. However, Chl contents were still significantly lower in es7 relative to 93-11 (Fig. 10). Furthermore, qRT-PCR analysis showed that genes involved in chlorophyll synthesis were significantly down-regulated in es7, while chlorophyll degradation-related genes showed disordered (Fig. 9). These results indicate that ES7 plays an important role in chlorophyll synthesis, which may shed light on the early senescence phenotype observed in es7 plants. Previous study showed that the Arabidopsis Fd-GOGAT1 gene is associated with photorespiration and primary nitrogen assimilation. The Fd-GOGAT1 mutant gls is chlorotic and eventually dies when grown in air, but appear similar to the wile type when they were grown in high CO2, a photorespiration suppressed conditions, which is an obvious photorespiration-deficient phenotype [10]. The senescence phenotype of photorespiratory mutants were effect of toxic 13

metabolite accumulation or increased levels of reactive oxygen species, and these phenotypes can be rescued under high CO2 [50, 51]. In another study, Arabidopsis Fd-GOGAT1 is reported to be targeted to both chloroplasts and mitochondria. Fd-GOGAT1 interacts with photorespiration serine hydroxymethyltransferase1 (SHMT1) in the mitochondria, and this interaction is necessary for photorespiratory SHMT activity [56]. The es7 mutant also exhibits a photorespiration-deficient phenotype, showing normal chlorophyll content in high CO2 conditions (Fig. 11). It is possible that rice Fd-GOGAT may also dual targeted to chloroplasts and mitochondria. In chloroplasts, OsFd-GOGAT coordinated action with GS, responsible for the reassimilation of ammonia derived from photorespiration, produced Glu which is a precursor and donor for other amino acids and nitrogeneous compounds. In mitochondria, photorespiration SHMT activity may also requires the mitochondrial accumulation of OsFd-GOGAT. Mutation of OsFd-GOGAT destroyed the interaction between OsFd-GOGAT and SHMT, resulted in a deficiency in photorespiration and the es7 mutant had a photorespiration-deficient phenotype. In conclusion, we identified ES7, which encodes a ferredoxin-dependent glutamate synthase (OsFd-GOGAT) highly expressed in green leaves. The es7 mutant exhibit an early senescence phenotype, this phenotype can be rescued when plants are grown under high CO2. In es7, both the expression and enzyme activity of Fd-GOGAT and GS are decreased, with the decreased of Glu content, Gln and most other animo acids are also descreased. Moreover, the expression of genes involved in chlorophyll synthesis were significantly down-regulated, even external application nitrogen is not capable of rescuing this chlorophyll phenotype. These evidences suggested that ES7 functions in nitrogen metabolism, effects chlorophyll biosynthesis, and may associated with photorespiration.

Author contribution statement

LC, SC and YZ conceived and designed the experiments. ZB

conducted the experiments and received help from TX in the measurement of physiological parameters. NY and YZ isolated the es7-N mutant. QL and ZL did the fine mapping. ZB analyzed the data and wrote the manuscript with the help of WW. XS applied the seeds of rice mutant library. YZ, WW, XZ, DC helped to revise the manuscript. All of the authors read and approved the final manuscript.

14

Conflict of interest

Acknowledgments

The authors declare that they have no competing interests.

We would like to thank Professor Dianxin Wu (Zhejiang University) for

kindly providing mutant materials. This work was supported by the National Key Transform Program (2014ZX08001-002), Zhejiang Provincial Natural Science Foundation of China (Grant LY16C130005), the Agricultural Science and Technology Innovation Program of Chinese Academy of Agricultural Sciences (CAAS-ASTIP-2013-CNRRI), the National Natural Science Foundation of China (Grant No. 31501290).

15

References [1] M. Andrews, P.J. Lea, J.A. Raven, K. Lindsey, Can genetic manipulation of plant nitrogen assimilation enzymes result in increased crop yield and greater N-use efficiency? An assessment, Ann Appl Biol. 145(2004) 25–40. [2] G. Xu, X. Fan, A.J. Miller, Plant nitrogen assimilation and use efficiency, Annual review of plant biology, 63 (2012) 153-182. [3] M. Tabuchi, T. Abiko, T. Yamaya, Assimilation of ammonium ions and reutilization of nitrogen in rice (Oryza sativa L.), J Exp Bot. 58 (2007) 2319-2327. [4] R.J. Ireland, P.J. Lea, The enzymes of glutamine, glutamate, asparagine and aspartate metabolisms. In: Singh BK (ed) Plant amino acids. Biochemistry and biotechnology. Marcel Dekker Inc., New York, 1999, pp. 49–109. [5] P.J. Lea, B.J. Miflin, Glutamate synthase and the synthesis of glutamate in plants. Plant Physiol Biochem. 41 (2003) 555–564. [6] S. Kiyomiya, H. Nakanishi, H. Uchida, A. Tsuji, S. Nishiyama, M. Futatsubashi, H. Tsukada, N.S. Ishioka, S. Watanabe, T. Ito, Real time visualization of 13N-translocation in rice under different environmental conditions using positron emitting Ttacer imaging system, Plant Physiology, 125 (2001) 378-379. [7] K. Funayama, S. Kojima, M. Tabuchi-Kobayashi, Y. Sawa, Y. Nakayama, T. Hayakawa, T. Yamaya, Cytosolic Glutamine Synthetase1;2 is Responsible for the Primary Assimilation of Ammonium in Rice Roots, Plant and Cell Physiology, 54 (2013) 934-943. [8] A.K. Tobin, T. Yamaya, Cellular compartmentation of ammonium assimilation in rice and barley, J. Exp. Bot. 52 (2001) 591-604. [9] Lea PJ, Sodek L, Parry MAJ, Shewry PR, Halford NG, Asparagine in plants. Ann Appl Biol. 150 (2007) 1-26. [14] K.T. Coschigano, R. Melo-Oliveira, J. Lim, G.M. Coruzzi, Arabidopsis gls mutants and distinct Fd-GOGAT genes. Implications for photorespiration and primary nitrogen assimilation, The Plant cell, 10 (1998) 741-752. [11] T. Hakakawa, K.I. Takahiro Sakai, N. Hirose, H. Nakajima, M. Takezawa, K. Naito, M. Hino Nakayama, T. Akagawa, S. Goto, T. Yamaya, Organization and structure of ferredoxindependent glutamate synthase gene and intracellulr localization of enzyme protein in rice plants, 16

Plant Biotechnology, 20 (2003) 43-55. [12] W. Tamura, Y. Hidaka, M. Tabuchi, S. Kojima, T. Hayakawa, T. Sato, M. Obara, M. Kojima, H. Sakakibara, T. Yamaya, Reverse genetics approach to characterize a function of NADHglutamate synthase1 in rice plants, Amino Acids, 39 (2010) 1003-1012. [13] W. Tamura, S. Kojima, A. Toyokawa, H. Watanabe, M. Tabuchikobayashi, T. Hayakawa, T. Yamaya, Disruption of a Novel NADH-Glutamate Synthase2 Gene Caused Marked Reduction in Spikelet Number of Rice, Frontiers in Plant Science, 2 (2011) 1085-1091. [14] T. Yamaya, M. Kusano, Evidence supporting distinct functions of three cytosolic glutamine synthetases and two NADH-glutamate synthases in rice, Journal of Experimental Botany, 65 (2014) 5519-5525. [15] X. Yang, J. Nian, Q. Xie, J. Feng, F. Zhang, H. Jing, J. Zhang, G. Dong, Y. Liang, J. Peng, G. Wang, Q. Qian, J. Zuo, Rice Ferredoxin-Dependent Glutamate Synthase Regulates Nitrogen-Carbon Metabolomes and Is Genetically Differentiated between japonica and indica Subspecies, Molecular plant, 9 (2016) 1520-1534. [16] H. Chen, C. Li, L. Liu, J. Zhao, X. Cheng, G. Jiang, W. Zhai, The Fd-GOGAT1 mutant gene lc7 confers resistance to Xanthomonas oryzae pv. Oryzae in rice, Scientific reports, 6 (2016) 26411. [17] N.M. Crawford, B.G. Forde, Molecular and developmental biology of inorganic nitrogen nutrition, The Arabidopsis book, 1 (2002) e0011. [18] J. Schildhauer, K. Wiedemuth, K. Humbeck, Supply of nitrogen can reverse senescence processes and affect expression of genes coding for plastidic glutamine synthetase and lysine-ketoglutarate reductase/saccharopine dehydrogenase, Plant Biol (Stuttg), 10 (2008) 76-84. [19] R. Shi, G. Weber, J. Köster, M. Reza Hajirezaei, C. Zou, F. Zhang, N. von Wirén, Senescenceinduced iron mobilization in source leaves of barley (Hordeum vulgare) plants, New Phytol., 195 (2012) 372–383 [20] C. Diaz, S. Purdy, A. Christ, J.F. Morot-Gaudry, A. Wingler, C. Masclaux-Daubresse, Characterization of markers to determine the extent and variability of leaf senescence in Arabidopsis. A metabolic profiling approach, Plant Physiol, 138 (2005) 898-908. [21] A. Wingler, S. Purdy, J.A. MacLean, N. Pourtau, The role of sugars in integrating 17

environmental signals during the regulation of leaf senescence, J Exp Bot, 57 (2006) 391-399. [22] M. Peng, Y.M. Bi, T. Zhu, S.J. Rothstein, Genome-wide analysis of Arabidopsis responsive transcriptome to nitrogen limitation and its regulation by the ubiquitin ligase gene NLA, Plant Molecular Biology, 65 (2007) 775-797. [23] Schulte auf’m Erley G., Begum N., Worku M., Ba¨nzinger M., Horst W.J., Leaf senescence induced by nitrogen deficiency as an indicator of genotypic differences in nitrogen efficiency in tropical maize. Journal of Plant Nutrition and Soil Science, 170 (2007) 106–114. [24] Y. Sato, R. Morita, S. Katsuma, M. Nishimura, A. Tanaka, M. Kusaba, Two short‐chain dehydrogenase/reductases, NON‐YELLOW COLORING 1 and NYC1‐LIKE, are required for chlorophyll b and light‐harvesting complex II degradation during senescence in rice, The Plant Journal, 57 (2009) 120-131. [25] M. Kusaba, H. Ito, R. Morita, S. Iida, Y. Sato, M. Fujimoto, S. Kawasaki, R. Tanaka, H. Hirochika, M. Nishimura, A. Tanaka, Rice NON-YELLOW COLORING1 is involved in light-harvesting complex II and grana degradation during leaf senescence, The Plant cell, 19 (2007) 1362-1375. [26] H. Yamatani, Y. Sato, Y. Masuda, Y. Kato, R. Morita, K. Fukunaga, Y. Nagamura, M. Nishimura, W. Sakamoto, A. Tanaka, M. Kusaba, NYC4 , the rice ortholog of Arabidopsis THF1, is involved in the degradation of chlorophyll - protein complexes during leaf senescence, The Plant Journal, 74 (2013) 652-662. [27] Y. Yang, J. Xu, L. Huang, Y. Leng, L. Dai, Y. Rao, L. Chen, Y. Wang, Z. Tu, J. Hu, PGL, encoding chlorophyllide a oxygenase 1, impacts leaf senescence and indirectly affects grain yield and quality in rice, Journal of Experimental Botany, 67 (2016) 1297-1310. [28] W. Liu, Y. Fu, G. Hu, H.Si, L. Zhu, C. Wu, Z. Sun, Identification and fine mapping of a thermosensitive chlorophyll deficient mutant in rice (Oryza sativa L.), Planta, 226 (2007) 785-795. [29] H. Zhang, J. Li, J. H. Yoo, S.C. Yoo, S.H. Cho, H.J. Koh, H.S. Heo, N.C. Koh, Rice Chlorina-1 and Chlorina-9encode ChlD and ChlI subunits of Mg-chelatase, a key enzyme for chlorophyll synthesis and chloroplast development, Plant molecular biology, 62 (2006) 325-337. [30] C.H. Goh, K.H. Jung, S.K. Roberts, M.R. McAinsh, A.M. Hetherington, Y. Park, K.H. Suh, G. An, H.G. Nam, Mitochondria provide the main source of cytosolic ATP for activation of

18

outward-rectifying K+ channels in mesophyll protoplast of chlorophyll-deficient mutant rice (OsCHLH) seedlings, Journal of Biological Chemistry, 279 (2004) 6874-6882. [31] P. Wang, J. Gao, C. Wan, F. Zhang, Z. Xu, X. Huang, X. Sun, X. Deng, Divinyl chlorophyll (ide) a can be converted to monovinyl chlorophyll (ide) a by a divinyl reductase in rice, Plant physiology, 153 (2010) 994-1003. [32] P. Wang, C. Wan, Z. Xu, P. Wang, C. Su, X. Ma, Y. Xiao, J. Zhu, X. Gao, X. Deng, One divinyl reductase reduces the 8-vinyl groups in various intermediates of chlorophyll biosynthesis in a given higher plant species, but the isozyme differs between species. Plant physiology, 161 (2013) 521-534. [33] Y. Sakuraba, M.L. Rahman, S.H. Cho, Y.S. Kim, H.J. Koh, S.C. Yoo, N.C. Paek, The rice faded green leaf locus encodes protochlorophyllide oxidoreductase B and is essential for chlorophyll synthesis under high light conditions. The Plant Journal, 2013, 74(1): 122-133. [34] J. Kang, F.J. Turano, The putative glutamate receptor 1.1 (AtGLR1.1) functions as a regulator of carbon and nitrogen metabolism in Arabidopsis thaliana, Proceedings of the National Academy of Sciences of the United States of America, 100 (2003) 6872-6877. [35] K. Takei, N. Ueda, K. Aoki, T. Kuromori, T. Hirayama, K. Shinozaki, T. Yamaya, H. Sakakibara, AtIPT3 is a key determinant of nitrate-dependent cytokinin biosynthesis in Arabidopsis, Plant and cell physiology, 45 (2004) 1053-1062. [36] L.M. Weaver, S. Gan, B. Quirino, R.M. Amasino, A comparison of the expression patterns of several senescence-associated genes in response to stress and hormone treatment, Plant molecular biology, 37 (1998) 455-469. [37] Z. Li, Y. Zhang, L. Liu, Q. Liu, Z. Bi, N. Yu, S. Cheng, L. Cao, Fine mapping of the lesion mimic and early senescence 1 ( lmes1 ) inrice ( Oryza sativa ), Plant Physiology and Biochemistry,

80 (2014) 300-307.

[38] R.J. Porra, W. Schäfer, E. Cmiel, I. Katheder, H. Scheer, The derivation of the formyl-group oxygen of chlorophyll b in higher plants from molecular oxygen, European Journal of Biochemistry, 219 (1994) 671–679. [39] S. Chen, W. Jin, M. Wang, Z. Fan, Z. Jie, Q. Jia, Y. Wu, F. Liu, W. Ping, Distribution and characterization of over 1000 T-DNA tags in rice genome, Plant Journal, 36 (2003) 105–113. [40] R.A. Jefferson, T.A. Kavanagh, M.W. Bevan, GUS fusions: beta-glucuronidase as a sensitive 19

and versatile gene fusion marker in higher plants, The EMBO journal, 6 (1987) 3901-3907. [41] S. Yoo, Y. Cho, J. Sheen, Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis, Nature protocols, 2 (2007) 1565-1572. [42] B. Rebecca, C. Mawsheng, P. Chang-Jin, A novel system for gene silencing using siRNAs in rice leaf and stem-derived protoplasts., Plant Methods, 2 (2006) 13-21. [43] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method, Methods, 25 (2001) 402-408. [44] Yoshimura A, Ideta O, Iwata N, Linkage map of phenotype and RFLP markers in rice. Plant Mol Biol., 35 (1997) 49-60. [45] R.H. Lee, C.H. Wang, L.T. Huang, S.C. Chen, Leaf senescence in rice plants: cloning and characterization of senescence up-regulated genes, J Exp Bot., 52 (2001) 1117-1121. [46] C. Liang, Y. Wang, Y. Zhu, J. Tang, B. Hu, L. Liu, S. Ou, H. Wu, X. Sun, J. Chu, C. Chu, OsNAP connects abscisic acid and leaf senescence by fine-tuning abscisic acid biosynthesis and directly targeting senescence-associated genes in rice, Proceedings of the National Academy of Sciences, 111 (2014) 10013-10018. [47] M. Feraud, C. Masclaux-Daubresse, S. Ferrario-Mery, K. Pageau, M. Lelandais, C. Ziegler, E. Leboeuf, T. Jouglet, L. Viret, A. Spampinato, V. Paganelli, M.B. Hammouda, A. Suzuki, Expression of a ferredoxin-dependent glutamate synthase gene in mesophyll and vascular cells and functions of the enzyme in ammonium assimilation in Nicotiana tabacum (L.), Planta, 222 (2005) 667-677. [48] H. Cai, J. Xiao J, Q. Zhang, X. Lian, Co-suppressed glutamine synthetase2 gene modifies nitrogen metabolism and plant growth in rice. Chinese Sci Bull 55 (2010) 875-886. [49] A. Suzuki and S. Rothstein, Structure and regulation of ferredoxin-dependent glutamase synthase from Arabidopsis thaliana. Cloning of cDNA expression in different tissues of wild-type and gltS mutant strains, and light induction. Eur J Biochem. 243 (1997) 708–718. [50] Q. Zhou, Q. Yu, Z. Wang, Y. Pan, W. Lv, L. Zhu, R. Chen, G. He, Knockdown of GDCH gene reveals reactive oxygen species-induced leaf senescence in rice, Plant, cell & environment, 36 (2013) 1476-1489. [51] Y. Dellero, M. Jossier, N. Glab, C.Oury, G. Tcherkez

M. Hodges, Decreased glycolate

oxidase activity leads to altered carbon allocation and leaf senescence after a transfer from 20

high CO2 to ambient air in Arabidopsis thaliana, Journal of Experimental Botany, 67 (2016) 3149–3163. [52] Y. Zhou, W. Huang, L. Liu, T. Chen, F. Zhou, Y. Lin, Identification and functional characterization of a rice NAC gene involved in the regulation of leaf senescence, BMC plant biology, 13 (2013) 132. [53] Q.N. Huang, Y.F. Shi, X.B. Zhang, L.X. Song, B.H. Feng, H.M. Wang, X. Xu, X.H. Li, D. Guo, J.L. Wu, Single base substitution in OsCDC48 is responsible for premature senescence and death phenotype in rice, Journal of Integrative Plant Biology, 58 (2015) 12–28. [54] B.G. Forde and P.J. Lea, Glutamate in plants: metabolism, regulation, and signalling, J. Exp. Bot., 58 (2007) 2339–2358. [55] S. Akira, B.K. David, Glutamate synthase: structural, mechanistic and regulatory properties, and role in the amino acid metabolism, Photosynthesis Research, 83 (2005) 191-217. [56] A. Jamai, P.A. Salome, S.H. Schilling, A.P. Weber, C.R. McClung, Arabidopsis photorespiratory serine hydroxymethyltransferase activity requires the mitochondrial accumulation of ferredoxin-dependent glutamate synthase, Plant Cell, 21 (2009) 595–606.

21

Fig.1. Phenotype of wild-type (93-11) and the es7 mutant at the heading stage. A. Phenotypes of wild-type 93-11 and es7 at the heading stage. B. A close up of the upper three leaves. C. Grain yield per plant. D, CAT activity. E. T-AOC activity. F. The content of H2O2. F, Flag leaf; S, Second upper leaf; T, Third upper leaf. Scale bars = 20cm. Data is expressed as the mean ±SD. *, P≤0.05; **, P≤0.01.

22

Fig.2. Expression levels of senescence-associated genes. A. Osh36. B. OsI57. C. Osh69. D. OsI85. Data is expressed as the mean ±SD. *, P≤0.05; **, P≤0.01.

23

Fig. 3. Map-based cloning and identification of the ES7 gene. A. ES7 was fine-mapped to a region on chromosome 7 containing 12 putative ORFs. B. Gene structure of 93-11. Sequence analysis revealed a single-nucleotide substitution in LOC_Os07g46460 at position 1292 (G to A) in the second exon.

24

Fig. 4. Functional complementation and CRISPR/Cas9 knock-out of ES7. A-C. Phenotypes of wild-type (93-11) and the es7 mutant and the complementation line (COM) at the heading stage (A), a close up view of the upper three leaves (B), and Chl content (C). D. The relative expression of ES7 in 93-11, es7 and complementation (COM) plants. E-H. Phenotypes of Wild-type (ZH11) (E), ZH11 background mutant es7-N (F), the complementation (COM) line (G), and CRISPR/Cas9 knock-out in the ZH11 background (H). F, flag leaf; S, second upper leaf; T, third upper leaf. Scale bars = 20cm. Data is expressed as the mean ±SD. *, P≤0.05; **, P≤0.01.

25

Fig. 5. Gene expression analysis of ES7. A. qRT-PCR analysis of the relative expression of ES7 in wild-type (93-11) rice. B-G. GUS staining analysis of the ES7 promoter in various tissues, leaf (B), stem (C, D), stipe (E), panicle (F) and seedlings (G). Data is expressed as the mean ±SD.

26

Fig. 6. Subcellular localization of ES7 protein. A-D. Subcellular localization of 35S::GFP. E-H. Subcellular localization of 35S::OsES7-GFP. GFP fluorescence images (A, E), chlorophyll autofluorescence images (B, F), visible images (C, G) and merged images of A-C and E-G (D, H). Scale bar = 10μm.

27

Fig. 7. Expression levels of select genes involved in nitrogen metabolism. A. Down regulated genes in nitrogen metabolism. B. Up regulated genes in nitrogen metabolism. Fd-, Fd-GOGAT; NADH-, NADH-GOGATs. NR, nitrate reductase; NiR, nitrite reductase; AAT1/2/3/4, aspartate transaminase 1/2/3/4. Data is expressed as the mean ±SD. *, P≤0.05; **, P ≤0.01.

28

Fig. 8. Enzymatic activity and the product content in nitrogen metabolism A. GOGAT activity. B. GS activity. C. GDH activity. D. The content of NO2-. Data is expressed as the mean ±SD. *, P≤0.05; **, P≤0.01.

29

Fig. 9. qRT-PCR analysis of chlorophyll synthesis and degradation associated genes. A. Expression of chlorophyll synthesis-associated genes. B. Expression of chlorophyll degradation-associated genes. Data is expressed as the mean ±SD. *, P≤0.05; **, P≤0.01.

30

Fig. 10. Chl content of plants grown in difference nitrogen concentrations at the seeding stage for 15 days. A. Chl a content. B. Chl b content. C. Total Chl content. Data is expressed as the mean ±SD. *, P≤0.05; **, P≤0.01.

31

Fig. 11. Chl content of plants grown under high CO2. A. Chl a content. B. Chl b content. C. Total Chl content. Ambient CO2 (0.03%), high CO2 (0.3%). Data is expressed as the mean ±SD. *, P≤0.05; **, P≤ 0.01.

32

Table 1 The contents of free amino acid in flag leaves at the heading stage

amino acid

93-11 (μg/g)

Asp

248.3±1.21

Glu Ser His

es7 (μg/g) 74.50±0.71**

672.39±1.79 17.25±0.60

99.74±2.16** 9.82±0.96**

4.21±0.01

9.14±1.92**

Gly

310.53±1.79

Thr

1.78±0.30

7.79±0.01**

Arg

85.84±0.01

3.39±0.01**

Ala

163.26±0.60

16.93±6.23**

Tyr

19.57±0.30

2.88±1.20**

Cys

4.21±0.01

3.39±0.01**

Val

134.65±0.60

27.94±3.59**

Met

4.20±0.01

3.40±0.01**

Phe

28.82±0.89

6.27±2.06**

Ile

5.89±2.38

3.39±0.01**

4 2.51±7.90**

Lys

23.77±0.30

3.39±0.01**

Pro

63.12±1.19

16.09±0.24**

Asn

35.71±0.84

8.04±2.49**

Gln

121.18±4.17

23.71±6.89**

Trp

4.21±0.01

3.39±0.01**

1973.44±3.90

369.07±28.59**

Total

Mean and SD values were obtained from three biological replicates. *, P≤0.05; **, P≤0.01.

33