Essential and overlapping roles for laminin α chains in notochord and blood vessel formation

Developmental Biology 289 (2006) 64 – 76 www.elsevier.com/locate/ydbio

Essential and overlapping roles for laminin a chains in notochord and blood vessel formation Steven M. Pollard c,1, Michael J. Parsons c,2, Makoto Kamei b, Ross N.W. Kettleborough a,c, Kevin A. Thomas a,c, Van N. Pham b, Moon-Kyoung Bae b, Annabelle Scott a, Brant M. Weinstein b, Derek L. Stemple a,c,* a

c

Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SA, UK b Laboratory of Molecular Genetics, NICHD, NIH, Bethesda, MD 20892, USA Division of Developmental Biology, National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA, UK Received for publication 22 April 2005, revised 23 September 2005, accepted 3 October 2005

Abstract Laminins are major constituents of basement membranes and have wide ranging functions during development and in the adult. They are a family of heterotrimeric molecules created through association of an a, h and g chain. We previously reported that two zebrafish loci, grumpy (gup) and sleepy (sly), encode laminin h1 and g1, which are important both for notochord differentiation and for proper intersegmental blood vessel (ISV) formation. In this study we show that bashful (bal) encodes laminin a1 (lama1). Although the strongest allele, bal m190, is fully penetrant, when compared to gup or sly mutant embryos, bal mutants are not as severely affected, as only anterior notochord fails to differentiate and ISVs are unaffected. This suggests that other a chains, and hence other isoforms, act redundantly to laminin 1 in posterior notochord and ISV development. We identified cDNA sequences for lama2, lama4 and lama5 and disrupted the expression of each alone or in mutant embryos also lacking laminin a1. When expression of laminin a4 and laminin a1 are simultaneously disrupted, notochord differentiation and ISVs are as severely affected as sly or gup mutants. Moreover, live imaging of transgenic embryos expressing enhanced green fluorescent protein in forming ISVs reveals that the vascular defects in these embryos are due to an inability of ISV sprouts to migrate correctly along the intersegmental, normally laminin-rich regions. D 2005 Elsevier Inc. All rights reserved. Keywords: Laminin; Notochord; Blood vessels; Basement membrane; Cell differentiation

Introduction The notochord is among the first organs to form during vertebrate development and functions as both a mechanical structure important for locomotion and as an axial signalling centre that patterns adjacent tissues. Large-scale zebrafish mutagenesis screens identified many mutations affecting notochord development (Odenthal et al., 1996; Stemple, * Corresponding author. Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SA, UK. Fax: +44 1223 494919. E-mail address: [email protected] (D.L. Stemple). 1 Current address: Institute for Stem Cell Research, Roger Land Building, University of Edinburgh, King’s Buildings, West Mains Road, Edinburgh EH9 3JQ, UK. 2 Current address: Department of Surgery, Johns Hopkins University School of Medicine, Baltimore, MD 21287, USA. 0012-1606/$ - see front matter D 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.ydbio.2005.10.006

2005; Stemple et al., 1996). We have focused our studies on those mutants in which the notochord fails to differentiate fully. The zebrafish notochord is an ideal system in which to study cell differentiation, as it is a simple organ comprising only one cell type. Notochordal cells are one of the first cell types to fully differentiate during development, and arise from cells specified as chordamesoderm during the formation of the embryonic shield, which is the teleost dorsal organiser. Notochord differentiation involves gross morphological changes that provide the notochord with its mechanical strength, including acquisition of a large central vacuole and formation of a peri-notochordal basement membrane. The transition from chordamesoderm to differentiated notochord also involves changes in gene expression. For example, both echidna hedgehog (ehh) and sonic hedgehog (shh) are strongly expressed by chordamesoderm, but are extinguished as

S.M. Pollard et al. / Developmental Biology 289 (2006) 64 – 76

notochord cells differentiate (Coutinho et al., 2004; Parsons et al., 2002b; Stemple et al., 1996). Zebrafish embryos have proven also to be a valuable model for studies of vascular development (Vogel and Weinstein, 2000). Angiogenesis is the process by which new blood vessels form from pre-existing ones through the process of sprouting. Studies in mouse and zebrafish have shown VEGF and its receptors, VEGFR1 and VEGFR2, encoded by the flk and flt genes, respectively, are key regulators of angiogenesis (Fouquet et al., 1997; Habeck et al., 2002). Fli-1 lies downstream of this signalling pathway, and is one of the earliest markers of hemangioblasts (Brown et al., 2000). Transgenic Fli-GFP zebrafish provide a useful tool for monitoring vessel formation in living embryos (Isogai et al., 2003; Lawson and Weinstein, 2002). A clear example of angiogenesis during zebrafish development is formation of primary ISVs, which sprout from the dorsal aorta, grow dorsally along the vertical myosepta, and then branch and interconnect to form the dorsal longitudinal anastomotic vessel (Childs et al., 2002; Isogai et al., 2003). Mutant embryos lacking notochord such as floating head and no tail fail to form a dorsal aorta and consequently lack primary intersegmental vessels (Fouquet et al., 1997). Our previous studies of zebrafish mutants, grumpy (gup) and sleepy (sly), identified an important role for laminins in the formation of peri-notochordal basement membrane, notochord differentiation and ISV formation (Parsons et al., 2002b). In the absence of laminin h1 or g1, the peri-notochordal basement membrane fails to form and consequently the notochord does not differentiate properly. Moreover, while the dorsal aorta is formed normally, ISV sprouts are not seen and the ISVs fail to form. Laminins are a family of glycoproteins and are among the first extracellular matrix proteins required for normal development. Through polymerisation, laminins form a sheet-like matrix that is a major component of basement membranes. Laminins are obligate heterotrimeric protein complexes consisting of a, h and g chains, of which there are multiple forms. To date, five a, four h and three g genes have been identified in humans and mice, which through restricted combinations, give rise to at least 15 known laminin isoforms (Colognato and Yurchenco, 2000; Libby et al., 2000). Each of the five known laminin a chains (a1 – a5) can associate with the h1:g1 combination to produce the isoforms laminin 1, 2, 6, 8 and 10, respectively. By far, the best characterised of these is laminin 1 (a1:h1:g1), which was the first isoform identified. A variety of laminin functions have been discovered through genetic studies in humans and mice. Characterisation of mutant phenotypes has shown that laminins are involved in processes as diverse as cell migration, differentiation, metabolism and cell polarisation (Li et al., 2003). Several problems are encountered, however, when attempting to determine the function of specific laminin isoforms. For example, studies of laminin in mouse are hampered by an early requirement for laminin (Miner et al., 2004; Smyth et al., 1998, 1999). Expression of laminin genes is often overlapping and potentially redundant. Indeed, compensatory expression of one chain in the absence of another has been reported (Miner et al., 1998). Moreover, since laminins are heterotrimeric, conclusive assignment of function to a particular

65

ahg combination is difficult. One exception is laminin 5 (a3h2g2), where mutations in each of the chains result in a similar set of defects, collectively termed junctional epidermolysis bullosa (Pulkkinen et al., 1994, 1995a,b; Ryan et al., 1999). For the most extensively studied isoform, laminin 1, mutations in the genes encoding laminin a1 (Lama1), laminin h1 (Lamb1) and laminin g1 (Lamc1) each lead to a periimplantation lethal phenotype (Miner et al., 2004; Smyth et al., 1999). Mouse embryos lacking laminin a1 are slightly less severely affected than those lacking the h1, g1 chains. In lamb1 / and lamc1 / mutant mice embryonic basement membrane fails to form, parietal endoderm does not differentiate and embryos do not survive beyond embryonic day 5.5. By contrast, in lama1 / mutant mice the embryonic basement membrane forms and parietal endoderm differentiates, however Reichert’s membrane fails to form and embryos die by embryonic day 7 (Amenta et al., 1983; Hogan et al., 1980; Miner et al., 2004; Smyth et al., 1998, 1999). Embryonic basement membrane formation probably occurs in lama1 / mutant mice because laminin a5 partially compensates for the loss of laminin a1 (Miner et al., 2004). Transgenic overexpression of laminin a5 in lama1 / mutants improves the phenotype, such that gastrulation is initiated, however, Reichert’s membrane fails to form and embryos die. The laminin h1 and g1 chains pair with each of the a chains to form different isoforms with diverse functions. Loss of laminin a2 in humans, for example, leads to congenital muscular dystrophy (Helbling-Leclerc et al., 1995; Xu et al., 1994). Laminin 8, which is formed by the combination of laminin a4 with h1:g1 chains, is widely expressed in vascular endothelial basement membranes and is important for aspects of angiogenesis. Capillary basement membranes of mutant mice lacking laminin a4 are weakened and the rupturing of microvascular walls leads to widespread haemorrhaging during embryonic and neonatal periods (Thyboll et al., 2002). Within the first week after birth, however, the vascular phenotype of lama4 / mice disappears, most likely explained by the expression and deposition of laminin 10 (a5:h1:g1), which is the other major endothelial basement membrane laminin (Frieser et al., 1997; Sixt et al., 2001; Sorokin et al., 1994, 1997). Here, we show that the zebrafish locus bashful (bal) encodes zebrafish laminin a1. We also show that laminin a1, laminin a4 and laminin a5, most likely in association with h1:g1 chains forming laminin 1, laminin 8, and laminin 10, respectively, are essential for normal development of both notochord and intersegmental vessels. Studies of laminin function using zebrafish as a model system have allowed us to bypass some of the difficulties associated with mammalian studies and ask questions regarding laminin isoform function at later stages of vertebrate embryogenesis. Materials and methods Embryo collection General maintenance, collection and staging of the zebrafish were carried out according to the Zebrafish Book (Westerfield, 1994). The

66

S.M. Pollard et al. / Developmental Biology 289 (2006) 64 – 76

approximate stages are given in hours post-fertilisation (hpf) at 28-C according to the morphological criteria (Kimmel et al., 1995).

Preparation of genomic DNA from mutant embryos Single embryos were digested by incubation in 100 Al of lysis buffer (0.5% SDS, 0.1 M EDTA pH 8.0, 10 mM Tris pH 8, 100 Ag/ml Proteinase K) for 5 h at 55-C, followed by 5 min at 95-C to inactivate the Proteinase K. DNA was purified using Sephacryl S-400 (sigma) in Multiscreen-GV, column plates (0.22 Am hydrophilic, low protein binding, Durapore Membranes). DNA was diluted 1:10 and 5 Al used in a 20 Al PCR reaction.

Oligonucleotide labelling For SSLP analysis, both primers were radiolabelled. Each labelling reaction consisted of 0.5 Al 10 T4 polynucleotide kinase buffer, 2.9 Al of 10 AM oligonucleotide, 0.1 Al T4 polynucleotide kinase (10 U/Al) and 1.5 Al g32P dATP, 6000 Ci/mmol, 10 mCi/Al; incubated it for 30 min at 37-C.

PCR All PCR reactions were performed in 96-well plates with a final reaction volume of 20 Al. For a 20 Al reaction we used 14.3 Al PCR mix, 0.15 Al of each labelled oligonucleotide, 0.2 Al of Taq polymerase (5 U/Al) and 5 Al of DNA template. The PCR mix was made by adding 122 Al of 10 Taq buffer, 9.8 Al of 25 AM dNTPs, 740.8 Al of distilled water to final volume of 872.6 Al. PCR conditions used consisted of 35 cycles of 92-C for 1 min 58-C for 1 min 72-C for 1.5 min. PCR products were separated on a 6% polyacrylamide denaturing gel and exposed directly to film at 70-C.

PAC, BAC and YAC library screening and YAC end rescue

5 – 10 min. No further fixation was used. Secondary antibodies conjugated to HRP were used and detected using DAB supplemented with NiCl2. Whole-mount in situ hybridisation reactions were carried out according to published protocols (Thisse et al., 1993). Digoxigenin labelled lama1 antisense RNA was transcribed from a template comprising 439 bp of 5VUTR and the first 270 bp of ORF linearised with BamHI and transcribed with T7 (fragment generated by 5V RACE and subcloned into pCRII-TOPO (Invitrogen). For lama4 labelled antisense RNA a 521-bp template (generated by 5V RACE), linearised with XbaI and transcribed using SP6 promoter. For lama5 a 1.1-kb antisense RNA probe was generated using a cDNA clone (GenBank accession no. AA545720) obtained from RZPD as the template. Other riboprobes used were: fli-1 (Brown et al., 2000), ehh (Currie and Ingham, 1996), VE-cadherin (M. Kamei, unpublished results), ephrin-B2a (Lawson et al., 2001), flt4 (Thompson et al., 1998) and VEGF 165 (Lawson et al., 2002). Transverse sections were obtained by manual sectioning with a scalpel blade. Images were acquired using a Leica MZ12 equipped with a QImaging MicroPublisher digital camera using Adobe Photoshop software or QCapture (QImaging) software.

Morpholino sequences Antisense morpholino oligonucleotides (MO) (Gene Tools, LLC) were designed complementary to the 5Vsequence near the start of translation or at splice junctions (Nasevicius and Ekker, 2000). For live images embryos were anaesthetised with tricaine and mounted in methylcellulose under coverslips. The MOs used were: lama1 MO1: ATCTCCATCATCGCTCAAACTAAAG lama1 MO2: TCATCCTCATCTCCATCATCGCTCA lama1 spMOa: AGGAAACAAACCTGAGGACAGATGG lama1 spMOb: ACGCCTGATTTACCTTTGGGATTCT lama2 MO: GCCACTAAACTCCGCGTGTCCATGT

Zebrafish Yeast Artificial Chromosome DNA pools were purchased from Research Genetics and the zebrafish BAC library was obtained from Genome Systems. Both libraries were utilised according to the manufacturer’s instructions. YAC end rescue was performed to obtain genomic sequence (Talbot and Schier, 1999).

lama4 MO1: GCCATGATTCCCCCTGCAACAACTT lama4 spMOa: GTGGTCCCGACAATCCTGAAACAGA lama4 spMOb: TTTAAGACTCACCTGTTAGACTCCA lama5 MO: CTCGTCCTGATGGTCCCCTCGCCAT lama5 spMO: GCCTTCCACATTTTCCTGAAAGAGA

Genetic mapping and cloning Multiphoton microscopy Initial meiotic mapping using simple sequence length polymorphic markers (SSLPs) localised the bal locus to LG24 near Z7292 (2/742 meioses) (GenBank accession no. G40535) and Z7895 (0/742 meioses) (GenBank accession no. G40607). End-rescue and sequencing for a YAC clone 5E7 revealed a CA-repeat marker that was used for further genetic mapping. Analysis of >2000 meioses restricted the bal locus to an interval of 0.3 cM, between Z7292 and Z7895. BAC clones were identified within this interval and end-sequenced. BAC 143J17 contained a 141-bp sequence with significant homology to mouse lama1, which encodes the laminin a1 chain. To clone fulllength lama1 and lama4 cDNA, we used sequences obtained from the zebrafish genome project (http://www.ensembl.org/Danio_rerio/) in combination with long-range PCR, 5Vand 3VRACE. Using the LN54 radiation hybrid panel we mapped the lama4 gene to a telomere of LG20, ¨20cR from the SSLP marker Z10177. The primers used to map lama4 were:

Confocal microscopic imaging of Tg( fli1:EGFP)y1 zebrafish embryos was performed using a Radiance 2000 imaging system (BioRad). Multiphoton imaging of EGFP was performed using 950 nm pulsed mode-locked laser emission from a tunable Ti-Sapphire laser (Tsunami laser, Spectra Physics).

Accession numbers Sequences have been submitted to GenBank and the Accession Numbers are lama1 (AY862413), lama4 (AY862414) and lama5 (DQ232730).

Results The bashful locus encodes the zebrafish laminin a1 chain

A4RH1 CTCCATTTCCCACCAACAAG A4RH2 AAACCAGGTGCACACCTTTC A4RH3 ATTGCACTGGCACTCTGAAA A4RH4 GAAAGGTGTGCACCTGGTTT

Antibody staining and whole mount in situ hybridisation For immunostaining, using a rabbit polyclonal anti mouse laminin 1 antibody (Sigma L-9393) (1:400), embryos were fixed in 4% paraformaldehyde (PFA) overnight at 4-C and then stored in methanol at 20-C. After several washes in PBT embryos were briefly digested in Proteinase K (10 Ag/ml) for

We undertook a positional cloning approach to identify the bal gene. Meiotic mapping and chromosome walking with BAC end sequencing identified an exon of laminin a1 near a telomere of linkage group 24. Through cloning and sequencing of fragments we predict a full-length laminin a1 cDNA of 9686 bp encoding a protein of 3061 amino acids (¨336 kDa predicted mass) (Fig. 1). We cloned and sequenced corresponding cDNA fragments from bal m190 mutants and identified a non-sense mutation resulting from a G to T

S.M. Pollard et al. / Developmental Biology 289 (2006) 64 – 76

67

Fig. 1. Positional cloning identifies lama1 as a candidate for bashful. Meiotic mapping restricted the bal m190 locus to an interval of ¨0.3 cM between Z7292 and Z7895. The indicated fractions show the number of recombinant mutants identified over the number of meioses analysed. YACs (blue) and BACs (red) were isolated using the Z7292 and Z7895 markers. End sequencing of BAC 143J17 identified an exon of lama1, which encodes laminin a1 chain. Shown also are schematic diagrams of predicted laminin a1 and laminin a4 proteins. A point mutation (G Y T) was detected in the lama1 gene of bal mutants that leads to a premature stop codon at residue G890. Coloured domains are: a predicted signal peptide is indicated in red, LamNT (blue): laminin N-terminal domain (Pfam Acc: PF00055), E (purple): Laminin EGF repeat (Pfam Acc: PF00053), LamB (orange): laminin B domain (Pfam Acc: PF00053), LamCC (green): Laminin coiled-coil domains (Pfam Acc: PF06006 and PF06009), LamG (yellow): Laminin a chain C-terminal globular domains (Pfam Acc: PF00054 and PF02210) (Bateman et al., 2004).

transition at amino acid position 890 (GGAgly Y TGAstop). The same mutation was identified in two independent cDNA clones and in the corresponding exon of bal m190 genomic DNA. This mutation results in loss of a Fok1 restriction endonuclease site, which was useful as a restriction fragment length polymorphism (RFLP). Using this RFLP marker, we found no recombination events in >2000 meioses. Taken together with our previous results concerning the gup (encoding laminin h1) and sly (encoding laminin g1) loci, we can conclude that the laminin 1 (a1h1g1) isoform is necessary for proper notochord development. We previously reported that loss of either the h1 or g1 chain leads to a severe reduction in laminin 1 immunoreactivity in whole zebrafish embryos (Figs. 2H, I, L, M) (Parsons et al., 2002b). We therefore used a polyclonal antibody generated against mouse laminin 1 to assess levels of immunoreactivity in bal mutants (Fig. 2). The phenotype of bal mutants is weaker than either gup or sly in that only anterior regions of the notochord fail to form (Figs. 2D, K). Correspondingly, bal mutant embryos have reduced levels of laminin 1 immunoreactivity surrounding the abnormal anterior notochord and nearly wild-type levels of immunoreactivity in posterior notochord (Fig. 2E). There is a sharp boundary between mutant and wild-type notochord that corresponds precisely with immunoreactivity. In addition,

bal mutants have severely reduced laminin 1 immunoreactivity in all vertical myosepta (Fig. 2E). Despite the severe reduction of laminin immunoreactivity in the intersomitic regions, bal mutant embryos are able to form ISVs as seen by expression of fli-1 mRNA (Fig. 2F). This contrasts the lack of intersomitic fli-1 expression in gup (laminin h1) and sly (laminin g1) mutants (Figs. 2J, N). Thus, similar to the notochord phenotype, the bal ISV phenotype is less severe than for either gup or sly. As further confirmation that the bal locus encodes laminin a1, we tested whether injection of an antisense morpholino oligonucleotide (MO) directed against lama1 would phenocopy bal (data not shown). Injection of 3 ng of lama1 MO was sufficient to copy both the morphological phenotype of bal mutants as well as the loss of laminin immunoreactivity surrounding morphologically mutant notochord and intersegmental vessels. Moreover, as with bal mutants, lama1 MOinjected embryos displayed the notochord differentiation defect only in anterior tissue. Laminin a1 chain can be supplied from non-notochordal sources We examined the expression of laminin a1 mRNA during embryonic development (Figs. 3A – G). We could detect no

68

S.M. Pollard et al. / Developmental Biology 289 (2006) 64 – 76

Fig. 2. Morphological and molecular analysis of bal, gup and sly mutant embryos. Lateral views show wild-type (WT) (A, G), bal (D, K), gup (H) and sly (L) embryos at 3 day post fertilisation. Staining with a polyclonal antibody generated against mouse laminin 1 (a1h1g1) detects expression pattern in 24 hpf WT (B) embryos. Laminin immunoreactivity in 24 hpf bal mutant embryos (E) is at wild-type levels within the posterior notochord (arrowhead), but severely reduced immunoreactivity is seen in the non-differentiated anterior notochord, and intersomitic boundaries. In 24 hpf gup (I) and sly (M) embryos, laminin 1 immunoreactivity is abolished. The developing vasculature is marked by expression of fli-1 mRNA in 24 hpf WT (C) and bal (F), gup (J) and sly (N) mutant embryos.

maternal lama1 mRNA, and first observed widespread expression at shield stage. By tailbud stage, lama1 expression becomes more restricted to cells adaxial to the chordamesoderm, as well as in somites, though no expression is detectable in the chordamesoderm itself. At 24 hpf expression is extinguished in somites and is detectable only within the hypochord and tailbud. This pattern of expression is consistent with the observed bal notochord differentiation and CNS defects (Karlstrom et al., 1996; Odenthal et al., 1996; Stemple et al., 1996). The adaxial expression and lack of chordamesoderm lama1 expression suggests that the laminin a1 chain is supplied to the peri-notochordal basement membrane from non-notochordal sources. We previously showed that the laminin h1 and g1 chains could be supplied from either the notochord itself or non-notochordal tissues. We therefore tested the tissue autonomy of bal by embryonic shield transplantation (Parsons et al., 2002b; Saude et al., 2000). We found that bal mutant donor notochord in an otherwise wild-type background is able to differentiate properly, suggesting, as with the h1 and g1 chains, the laminin a1 chain can be supplied by non-notochordal sources (Figs. 3H – J).

Laminin a4 and a5 chains function redundantly with laminin a1 in notochord differentiation One possible explanation for the remaining laminin immunoreactivity seen in bal, as well as its weaker phenotype, is that another laminin a chain functions redundantly to laminin a1 within the posterior notochord. To test this we identified the remaining zebrafish laminin a genes in genomic and EST databases. We were able to find sequences encoding fragments of a2, a4 and a5 but we found no sequence corresponding to a3. We investigated whether these additional genes (lama2, lama4, lama5) are required for normal notochord development by assessing mRNA expression by whole-mount in situ hybridisation and through antisense MO knockdown of each chain in wild-type and bal backgrounds. For lama2, encoding laminin a2, we observed expression of the mRNA restricted to developing somites. No expression was detectable within the chordamesoderm or notochord, and antisense MO knockdown resulted in no notochord defect, as assessed by morphology, basement membrane integrity (laminin-1 immunoreactivity), or chordamesoderm markers, ehh and ntl (data not shown). However, lama2 MO-injected

S.M. Pollard et al. / Developmental Biology 289 (2006) 64 – 76

69

Fig. 3. Expression of lama1 mRNA and genetic mosaic experiments reveal that laminin a1 is supplied from non-notochordal tissues. Whole-mount in situ hybridisation for lama1 mRNA in wild-type zebrafish embryos at: 8-cell stage (A), shield stage (B), 5-somite stage (C, dorsal view), 15-somite stage (D), 25-somite stage (E) and 24 hpf (F, dorsal view of head; G, lateral view of trunk and tail). Embryonic shield transplantation from a Rhodamine-dextran labelled bal mutant donor (J), into wild-type host (H), gives rise to a secondary axis containing a rescued anterior notochord (red fluorescence) (I). Morphologically wild-type notochord in both the primary (host) axis and secondary (donor) axis are indicated with white arrowheads.

embryos did display defective organisation of the muscle tissue by 28 hpf, and responded poorly to touch, with uncoordinated movements (data not shown). This phenotype is reminiscent of dystroglycan knock-down in zebrafish (Parsons et al., 2002a), and is consistent with the muscular dystrophy phenotype characteristic of mammalian laminin a2 loss of function (Helbling-Leclerc et al., 1995; Xu et al., 1994). Messenger RNA encoding laminin a5 is expressed maternally (Fig. 4A). Zygotic expression commences at tailbud stage with a striking restricted expression of within the chordamesoderm (Fig. 4B). By the 20-somite stage expression was also observed within the mid – hindbrain region, forebrain, yolk sac extension and fins, suggesting widespread function of this laminin chain (Fig. 4C). Expression within the notochord is extinguished by this stage remaining only in the most posterior immature notochord. This expression pattern is strongly suggestive of a role for laminin a5 in notochord differentiation. Antisense MO knockdown of lama5 (3 ng), resulted in a consistent phenotype, in which brain morphology was disorganised and the posterior yolk extension was reduced (Fig. 4E). Surprisingly, in these lama5 MO-injected embryos, the notochord appeared morphologically normal and equivalent to control-injected embryos (Figs. 4D, E, H and G). Further analysis of notochord tissue, however, revealed maintenance of

expression of the early chordamesoderm markers ehh and ntl (Fig. 4K, and not shown). This phenotype was not due to a global delay in development as we observed melanophores expressing melanin differentiating on schedule in both lama5 MO-injected and control MO-injected embryos by about 28 hpf. Morphologically wild-type notochord with aberrant expression of earlier chordamesoderm markers was unexpected, as this phenotype has never been observed in other notochord differentiation mutants. Together these results reveal a specific requirement for laminin a5 chain in control of gene expression during the progression from chordamesoderm to notochord. Further, these results show that distinct aspects of the notochord differentiation program, namely, morphology (vacuole inflation and peri-notochordal basement membrane formation) and gene expression are controlled independently by laminin a1 and a5 chains, respectively. Higher doses of lama5 MO (6 ng) resulted in severe disruption to embryos during gastrulation, preventing analysis of notochord differentiation (not shown). This phenotype was also observed with a splice blocking MO (lama5 spMO) (data not shown). To assess whether there is redundancy between these two chains, we performed MO knockdown of lama5 and lama1 simultaneously, through microinjection of lama5 MO into a heterozygous bal cross. This resulted in 24.8% of embryos,

70

S.M. Pollard et al. / Developmental Biology 289 (2006) 64 – 76

Fig. 4. Expression and morpholino antisense knockdown of lama5 in zebrafish embryos. Whole-mount in situ hybridisation of lama5 mRNA in zebrafish embryos at 64-cell stage (A), tailbud stage (B, dorsal) and 20-somite stage (C, lateral). Injection of antisense MO directed against lama5 mRNA results in CNS disruptions and defective extension of the yolk sac by 28 hpf (E) compared to control MO injected (D). Notochord, however, appears fully differentiated, by morphology and laminin-1 immunoreactivity (H) compared to control MO-injected notochord (G). Embryos injected with lama5 MO display strong persistent expression of the early chordamesoderm marker, ehh (K), whose expression is extinguished by this stage in control MO-injected embryos (J). Injection of lama5 MO into bal mutant embryos results in severe disruption of many tissues (F), though laminin-1 immunoreactivity is retained (I).

likely homozygous bal mutants, (n = 241, two independent experiments) with an extremely severe pleiotropic phenotype (Fig. 4F). Notochord, somites and fin folds are reduced and highly disorganised, fin folds are absent, and massive cell death occurs within the CNS and epidermis. Serving as a control, 17.8% of injected sibling embryos, most likely homozygous wild-type embryos, displayed a phenotype equivalent to lama5 knockdown in wild-type embryos (as Fig. 4E). The severe defects are likely to be the result of redundancy between laminin a1 and laminin a5 chains in a wide range of tissues. We obtained full-length cDNA sequence for lama4 and using a 5VcDNA as template for an in situ probe we analysed mRNA expression during development (Fig. 5). Unlike lama1, lama4 mRNA is expressed maternally (Fig. 5A). During early stages laminin a4 mRNA is expressed in somitic tissue (Figs. 5B, C, D) and later becomes restricted to the dorsal aorta (Fig.

5F), consistent with a role in notochord as well as vascular development. We therefore designed MOs to disrupt laminin a4, to test whether this would enhance the bal phenotype (Fig. 6). Injecting lama4 MO into a wild-type cross at low and high doses (3 ng and 6 ng) results in embryos with a relatively mild trunk phenotype, but causes a reduction in the size of the brain, a region where lama4 mRNA is widely expressed (Figs. 6C and 5E). The notochord develops normally, extinguishing expression of ehh by 24 hpf as in control embryos (Figs. 6G, K). Laminin 1 immunoreactivity is unaffected and the characteristic vacuoles of mature notochord cells inflate normally in lama4 MO-injected embryos (Figs. 6C, I). We injected the low dose of lama4 MO (3 ng) into progeny of crosses between two bal m190 heterozygous adults. Thus, any double a1/a4 loss-of-function phenotype could be observed in the one-quarter of progeny homozygous for the bal m190 mutation. We found that 22.8% of the lama4 MO-

S.M. Pollard et al. / Developmental Biology 289 (2006) 64 – 76

71

Fig. 5. Expression of lama4 mRNA during zebrafish development. Whole mount in situ hybridisation shows localisation of lama4 mRNA in 16-cell (A), tailbud (B), 15-somite (C, lateral and D, dorsal view of trunk) and 24 hpf (E, dorsal view of head; F, section through trunk) wild-type embryos.

injected embryos (n = 136) were severely affected compared to control MO-injected embryos (Figs. 6B, D). In control MO-injected bal mutant embryos, expression of the chordamesoderm marker ehh is extinguished by 24 hpf as in wildtype siblings, suggesting that this aspect of notochord differentiation is controlled independently of laminin a1 (Fig. 6H). In contrast, ehh expression is abnormally persistent in lama4 MO-injected bal mutant embryos, vacuoles fail to inflate properly along the entire length of the undifferentiated notochord and laminin 1 immunoreactivity is severely reduced (Figs. 6D, J, L), a phenotype identical to that of gup and sly mutant embryos (Parsons et al., 2002b). In addition, co-injection of lama1 MO and lama4 MO into wild-type embryos produces an identical notochord differentiation defect; loss of laminin 1 immunoreactivity, persistent expression of ehh and failure to inflate vacuoles properly (data not shown). Redundant roles for a1 and a4 in intersegmental blood vessel formation Aside from the notochord, it is clear that the laminin a chains we have investigated have broader roles during development. One striking difference between the relatively mild bal phenotype compared to gup and sly mutants is in the formation of intersegmental vessels. Normally, by 24 hpf, fli-1-expressing primary intersegmental vessel sprouts emerge from the dorsal aorta and migrate dorsally between the somites along the vertical myosepta, eventually branching rostrally and caudally and linking together in the dorsal trunk to form the dorsal longitudinal anastomotic vessels (DLAV) (Brown et al., 2000; Childs et al., 2002; Fouquet et al.,

1997; Habeck et al., 2002; Isogai et al., 2003). Previously, we demonstrated that gup (laminin h1) and sly (laminin g1) mutants fail to form these vessels, suggesting that intersegmental vessel formation is dependent upon one or more laminin isoforms containing h1 and g1 chains (Parsons et al., 2002b) (Figs. 2J, N). Immunostaining reveals that laminin 1 is present at high levels along the vertical myosepta through which the intersegmental vessels migrate. Other studies in mouse have shown that laminin a4 is widely expressed in microvessels and when disrupted results in a failure of microvessel formation (Thyboll et al., 2002). We find that zebrafish lama4 is also expressed in dorsal aorta but not cardinal vein (Fig. 5F). By disrupting laminin a4 in bal mutants we examined the effect of loss of both laminin chains on formation of intersegmental vessels in zebrafish embryos. In bal mutants or lama4 MO-injected embryos fli-1 expressing sprouts emerge at the appropriate time and migrate normally (Figs. 7A –C). However, in bal mutants injected with lama4 MO, these sprouts are absent or severely delayed (Fig. 7D). Co-injection of lama1 and lama4 MOs into wild type embryos also produces similar defects in intersegmental vessel growth (Figs. 8B, K). These results show that the presence of either laminin 1 (a1h1g1) or laminin 8 (a4h1g1) is required for proper formation of intersegmental blood vessels. Endothelial cells are specified correctly but do not migrate properly in embryos lacking laminin a1 and laminin a4 The ISV formation defects observed in double lama1/4 loss of function embryos could reflect either a lack of proper substrate for migrating endothelial cells or lack of proper

72

S.M. Pollard et al. / Developmental Biology 289 (2006) 64 – 76

Fig. 6. Morpholino antisense knockdown of laminin a4 in bal mutants reveals redundant roles in notochord differentiation. Lateral views of 48 hpf control MOinjected embryos from a heterozygous bal cross showing a morphologically WT (A) and a bal mutant (B) (arrowhead; non-differentiated anterior notochord) embryo. From the same heterozygous bal cross, lama4 MO-injected embryos are also shown, ¨75% of embryos show a brain defect but no obvious notochord phenotype (C), whereas ¨25% of embryos have a severe notochord defect (D), with the entire anterior – posterior extent of the notochord disrupted. Whole mount laminin 1 antibody staining at 24 hpf shows expression of immunoreactivity in morphologically WT (E) and bal (F) mutant control MO-injected embryos. While ¨75% of lama4 MO-injected embryos have wild-type laminin 1 immunoreactivity (I), ¨25% (bal mutants) show severe loss of laminin 1 (J) (two independent experiments, total n = 136). Staining for expression of echidna hedgehog (ehh) at 24 hpf reveals the status of notochord differentiation in control MO-injected wildtype (G) and bal (H) mutant embryos. While lama4 MO-injected WT (K) embryos normally extinguish ehh expression, lama4 MO-injected bal mutant (L) embryos persistently express ehh.

specification of dorsal aorta endothelial cells. To address the latter possibility we analysed specific markers of endothelial and arterial-venous specification by in situ hybridisation of 24 hpf control or lama1/4 double MO-injected embryos (Figs. 8A –H). As in control MO-injected embryos, both axial vessels in lama1/4 double MO-injected embryos express the endothelial marker VE-cadherin, while expression of ephrinB2 and flt4 becomes properly restricted to the dorsal aorta and posterior cardinal vein, respectively (Figs. 8A – F). Thus, specification and differentiation of axial vessels occurs correctly, suggesting a defect in cell migration. The critical proangiogenic ligand, vascular endothelial growth factor (VEGF), is also expressed in similar fashion in the somites of both control and lama1/4 double loss of function embryos, indicating that failure to form ISVs does not result from loss or reduction of this positive factor (Figs. 8G, H). To examine the migration of inter-

segmental vessel endothelial cells in more detail we performed multiphoton imaging of trunk vessels in fli-EGFP transgenic fish (Isogai et al., 2003; Lawson and Weinstein, 2002). The embryos co-injected with 2 ng each of lama1 and lama4 MOs initiate sprouts in the appropriate intersegmental positions, but these sprouts show significantly less protrusive activity and grow more slowly, stalling at the level of the horizontal myoseptum (Fig. 8K) before eventually continuing dorsally (Fig. 8L). At later stages, most sprouts do reach the level of the DLAV, but they do not properly assemble this vessel and many misguided vessel branches are observed growing away from the vertical myosepta (Fig. 8L). The lower doses of MO used in this experiment result in a hypomorphic phenotype, in which ISV sprouts more readily form, but their pathfinding is disrupted. These results suggest that laminin function is required for both robust migration of intersegmental endothelial sprouts

S.M. Pollard et al. / Developmental Biology 289 (2006) 64 – 76

73

Fig. 7. Laminin a1 and laminin a4 chains function redundantly during ISV sprouting. At 24 hpf, wild-type embryos (A) and bal mutant embryos injected with control MO (B) as well as wild-type embryos injected with lama4 MO (C) show normal fli-1 expression in both axial and intersegmental vessels. In contrast, bal mutants injected with lama4 MO (D) lack fli-1 staining of intersegmental vessels.

and for maintaining the path of these vessels along the vertical myosepta. Discussion Our efforts to understand factors controlling notochord differentiation led us to clone the bashful gene. Mutant bal embryos display a host of defects similar to grumpy and sleepy mutants. We previously showed that gup and sly encode the laminin h1 and g1 chains, respectively. Our finding that the bal locus encodes the zebrafish laminin a1 chain identifies the specific laminin isoform a1h1g1 (laminin 1) as necessary for notochord differentiation. It had been recognised that bal mutant embryos display a weaker phenotype than either gup or sly, possessing differentiated notochord in posterior regions. Also, in contrast to gup or sly mutant embryos, we found that bal mutants form normal intersegmental blood vessels, despite a lack of laminin 1 immunoreactivity in vertical myosepta. Knowing that the strong allele bal m190 is predicted to produce a short N-terminal peptide encoding only part of the laminin a1 short arm, we expect that bal m190 is a null allele. No maternal expression of lama1 was detected and consistent with that we found lama1 MO injections produce a phenotype no stronger than bal m190. The presence of five laminin a genes in the mouse and human genomes, suggested that laminin a1 chain must be redundant to another a chain. The expression pattern of both laminin a4 and laminin a5 mRNA indicated that these were the most likely other laminin a chains to play a role redundant to laminin a1. This was confirmed through MO knockdown experiments, which

revealed a requirement of at least three different laminin isoforms within the peri-notochordal basement membrane. We saw that the bal notochord differentiation defects are enhanced when laminin a1 and a4 chain are co-ordinately disrupted. Temporally, notochord cells differentiate in an anterior to posterior fashion, thus it is likely that the laminin a4 chain is expressed too late to compensate for the loss of a1 in the earliest differentiating anterior notochord. The anterior level at which peri-notochordal basement membrane is disrupted is, however, unlikely to have any functional significance as this varies considerably within groups of embryos from a single mating and between different alleles. Redundant functions for these two genes may well be a reflection of highly conserved domains (Colognato and Yurchenco, 2000), though it is possible that each chain has unique functions yet to be uncovered. Although compensation for loss of laminin chains has been observed in other systems, we found no evidence for increased notochordal expression of laminin a4 in bal mutants to compensate for loss of laminin a1 chain (Bolcato-Bellemin et al., 2003). We found that loss of laminin a5 chain results in a specific notochord differentiation phenotype. Namely, the regulation of gene expression of chordamesoderm expressed genes, such as echidna hedgehog, is disrupted, resulting in a prolonged expression of mRNA. This phenotype has been observed previously for laminin h1 and a1 chains, though in each case there is parallel disruption of notochord morphology (basement membrane and vacuole inflation). For low-dose lama5 MOinjected embryos, we find the notochord appears morphologically normal, indicating that the formation of the peri-

74

S.M. Pollard et al. / Developmental Biology 289 (2006) 64 – 76

Fig. 8. Axial vessels are correctly specified but intersegmental vessels fail to properly sprout and extend in laminin a1 and a4 loss of function embryos. In situ hybridisation of embryos injected with control MO (A, C, E, G) or co-injected with lama1 MO and lama4 MO (B, D, F, H) stained for VE-cadherin (A, B), ephrinB2 (C, D), flt4 (E, F) or VEGF (G, H) expression. In double laminin a1 and a4 loss of function embryos, the dorsal aorta (red arrows) and posterior cardinal vein (blue arrows) properly express markers of endothelial differentiation (A, B) and arterial (C, D) and venous (E, F) identity. The proangiogenic factor VEGF is also comparably expressed in somitic tissue (black arrows) in double morphants (G, H). Multiphoton imaging of trunk vessels in Fli-EGFP transgenic embryos injected with control MO at 24 (I) or 48 hpf (J) or coinjected with lama 1 MO and lama4 MOs at 36(K) or 60 hpf (L). Primary intersegmental sprouts initiate but do not extend and show much less protrusive activity. All panels show lateral views of the mid-trunk region, with anterior to the left, except for panels G and H, which show dorsal views of the mid-trunk region in flat-mounted embryos, with the left side up.

notochordal basement membrane, through polymerisation of laminin, serves not only as an essential mechanical structure but may also mediate a differentiation signal. A similar persistence of shh expression has been observed in one-eyed pinhead (oep) mutant embryos (Schier et al., 1997). Given that oep encodes a co-receptor for Nodal signals, it is possible that some aspect of notochord differentiation is controlled by Nodal signalling (Gritsman et al., 1999). Taken together, our laminin a5 results and the persistent expression of early marker genes in oep mutants suggest that notochord differentiation is dependent on basement membrane and Nodal signalling. Indeed ligands may be associated with the basement membrane or require basement membrane components for proper activity similar to the dependence of FGF signalling on proteoglycans (Ornitz et al., 1992; Yayon et al., 1991). The peri-notochordal basement membrane has also been described in the chick, monkey and human embryos (Camon et al., 1990; Jerome and Hendrickx, 1988; Shinohara and Tanaka, 1988). It is an ancient structure and is seen in the ascidian, Ciona instestinalis, representing a primitive chordate body plan (Miyamoto and Crowther, 1985). It is likely then that the perinotochordal basement membrane has a conserved role, not only as a mechanical support, but also as a signalling structure indicating an end-point of chordamesoderm transition to mature notochord. It will be interesting to identify whether this type of laminin-dependent feedback signal, is a general feature of basement membranes during organogenesis. Expression of laminin a chains in mouse embryos is more restricted than expression of h or g chains, which suggests a

more specific function for the a chains. This conclusion is also supported by the fact that the laminin a chains possess most of the laminin receptor binding sites. Thus, restricted expression patterns may reflect the specific functions carried out by cellsurface receptors. The results of this and our previous study are consistent with the mouse data in that the laminin h1 and laminin g1 chains are widely distributed, while a chains show a more restricted pattern of expression. The notochord transplant results and adaxial expression of lama1 suggests that the laminin components of the peri-notochordal basement membrane may not be supplied solely from the chordamesoderm itself, but from adjacent tissues. Assembly and secretion of laminin 1 component chains has been examined and the data indicate that while a1 can be secreted on its own, the h1 and g1 chains can only be secreted when assembled into an a:h:g heterotrimeric complex (Yurchenco et al., 1997). In future, juxtaposition of embryonic zebrafish tissues mutant in specific chains will help to understand how specific isoforms assemble and function in specific tissues. We identified a further functional overlap between laminin a1 and laminin a4 chains in the formation of intersegmental vessels. These vessels do not form properly in gup (laminin h1) and sly (laminin g1) mutants, or in laminin a1/a4 double lossof-function embryos. We find that this is due to defective growth of endothelial sprouts from the dorsal aorta, since the endothelial cells express appropriate markers of endothelial and arterial-venous identity and the proangiogenic factor VEGF is properly expressed in trunk somitic tissue in double lama1/ lama4 MO-injected embryos. Recent evidence has suggested

S.M. Pollard et al. / Developmental Biology 289 (2006) 64 – 76

that developing blood vessels use some of the same cues to help direct their growth and migration that are employed by migrating neuronal growth cones (Weinstein, 2005). We have shown that semaphorin signalling plays an important role in repulsive guidance of growing intersegmental vessel sprouts in the trunk, analogous to its role in repulsive guidance of neuronal growth cones (Torres-Vazquez et al., 2004). Loss of the endothelial semaphorin receptor plexinD1 results in intersegmental vessel guidance defects, although they extend dorsally at a normal rate and show some residual patterning. In addition to negative or repulsive cues, additional factors also play important positive or permissive roles in the nervous system, including laminin. Netrin, a well-studied axonal guidance molecule, is highly similar to the short-arm of laminin g1 (Serafini et al., 1994). The bal, gup and sly mutants were all independently identified on the basis of a failure in retino-tectal pathfinding (Karlstrom et al., 1996; Schier et al., 1996). Dystroglycan, a laminin receptor, is essential for correct neuronal migration in the murine brain (Moore et al., 2002). Our results suggest that laminin also has an important role in intersegmental vessel growth. Intersegmental sprouts emerge at intersegmental boundaries, but their growth is retarded and they branch inappropriately away from the vertical myosepta at later stages. The vertical myosepta that these vessels grow along contain high levels of laminin, and it appears that intersegmental endothelial cells use this laminin matrix as a positive or permissive cue in addition to the negative cue provided by semaphorin signalling that helps direct their growth along this boundary. Interestingly, targeted deletion of laminin a4 chain in the mouse also results in defects in microvessel formation, although the defects are not as severe as those we have observed, suggesting that more severe vessel defects in these knockout mice are masked by a redundancy with laminin a1. The phenotypic similarities and differences between bal, gup and sly and analysis of laminin a4 chain reveal redundant functions for laminin isoforms during early embryogenesis. The cloning of these three mutant loci along with morpholino technology has allowed us to characterise and assign functions to particular vertebrate laminins while circumventing the difficulties in studying laminin chain function in the mouse. Further characterisation of other aspects of the three mutants, bal, gup and sly combined with antisense and other reverse genetic approaches should allow a comprehensive analysis of specific and redundant roles for all laminin chains and isoforms during zebrafish development. Acknowledgments We thank Elisabeth Busch-Nentwich, Katharine Hartley and Katherine Joubin for critical reviews of the manuscript. SP, MP, KT, and DS, were supported by the Medical Research Council, UK. RK, KT, AS, and DS are supported by the Wellcome Trust. References Amenta, P.S., Clark, C.C., Martinez-Hernandez, A., 1983. Deposition of fibronectin and laminin in the basement membrane of the rat parietal

75

yolk sac: immunohistochemical and biosynthetic studies. J. Cell Biol. 96, 104 – 111. Bateman, A., Coin, L., Durbin, R., Finn, R.D., Hollich, V., Griffiths-Jones, S., Khanna, A., Marshall, M., Moxon, S., Sonnhammer, E.L.L., Studholme, D.J., Yeats, C., Eddy, S.R., 2004. The Pfam protein families database. Nucleic Acids Res. 32, D138 – D141. Bolcato-Bellemin, A.L., Lefebvre, O., Arnold, C., Sorokin, L., Miner, J.H., Kedinger, M., Simon-Assmann, P., 2003. Laminin alpha5 chain is required for intestinal smooth muscle development. Dev. Biol. 260, 376 – 390. Brown, L.A., Rodaway, A.R., Schilling, T.F., Jowett, T., Ingham, P.W., Patient, R.K., Sharrocks, A.D., 2000. Insights into early vasculogenesis revealed by expression of the ETS-domain transcription factor Fli-1 in wild-type and mutant zebrafish embryos. Mech. Dev. 90, 237 – 252. Camon, J., Degollada, E., Verdu, J., 1990. Ultrastructural aspects of the production of extracellular matrix components by the chick embryonic notochord in vitro. Acta Anat. (Basel) 137, 114 – 123. Childs, S., Chen, J.N., Garrity, D.M., Fishman, M.C., 2002. Patterning of angiogenesis in the zebrafish embryo. Development 129, 973 – 982. Colognato, H., Yurchenco, P.D., 2000. Form and function: the laminin family of heterotrimers. Dev. Dyn. 218, 213 – 234. Coutinho, P., Parsons, M.J., Thomas, K.A., Hirst, E.M., Saude, L., Campos, I., Williams, P.H., Stemple, D.L., 2004. Differential requirements for COPI transport during vertebrate early development. Dev. Cell 7, 547 – 558. Currie, P.D., Ingham, P.W., 1996. Induction of a specific muscle cell type by a hedgehog-like protein in zebrafish. Nature 382, 452 – 455. Fouquet, B., Weinstein, B.M., Serluca, F.C., Fishman, M.C., 1997. Vessel patterning in the embryo of the zebrafish: guidance by notochord. Dev. Biol. 183, 37 – 48. Frieser, M., Nockel, H., Pausch, F., Roder, C., Hahn, A., Deutzmann, R., Sorokin, L.M., 1997. Cloning of the mouse laminin alpha 4 cDNA. Expression in a subset of endothelium. Eur. J. Biochem. 246, 727 – 735. Gritsman, K., Zhang, J., Cheng, S., Heckscher, E., Talbot, W.S., Schier, A.F., 1999. The EGF-CFC protein one-eyed pinhead is essential for nodal signaling. Cell 97, 121 – 132. Habeck, H., Odenthal, J., Walderich, B., Maischein, H., Schulte-Merker, S., 2002. Analysis of a zebrafish VEGF receptor mutant reveals specific disruption of angiogenesis. Curr. Biol. 12, 1405 – 1412. Helbling-Leclerc, A., Zhang, X., Topaloglu, H., Cruaud, C., Tesson, F., Weissenbach, J., Tome, F.M., Schwartz, K., Fardeau, M., Tryggvason, K., et al., 1995. Mutations in the laminin alpha 2-chain gene (LAMA2) cause merosin-deficient congenital muscular dystrophy. Nat. Genet. 11, 216 – 218. Hogan, B.L., Cooper, A.R., Kurkinen, M., 1980. Incorporation into Reichert’s membrane of laminin-like extracellular proteins synthesized by parietal endoderm cells of the mouse embryo. Dev. Biol. 80, 289 – 300. Isogai, S., Lawson, N.D., Torrealday, S., Horiguchi, M., Weinstein, B.M., 2003. Angiogenic network formation in the developing vertebrate trunk. Development 130, 5281 – 5290. Jerome, C.P., Hendrickx, A.G., 1988. Ultrastructure of the rostral notochord of the 35-day rhesus monkey (Macaca mulatta) embryo. Acta Anat. (Basel) 132, 35 – 40. Karlstrom, R.O., Trowe, T., Klostermann, S., Baier, H., Brand, M., Crawford, A.D., Grunewald, B., Haffter, P., Hoffmann, H., Meyer, S.U., Muller, B.K., Richter, S., van Eeden, F.J., Nusslein-Volhard, C., Bonhoeffer, F., 1996. Zebrafish mutations affecting retinotectal axon pathfinding. Development 123, 427 – 438. Kimmel, C.B., Ballard, W.W., Kimmel, S.R., Ullmann, B., Schilling, T.F., 1995. Stages of embryonic development of the zebrafish. Dev. Dyn. 203, 253 – 310. Lawson, N.D., Weinstein, B.M., 2002. In vivo imaging of embryonic vascular development using transgenic zebrafish. Dev. Biol. 248, 307 – 318. Lawson, N.D., Scheer, N., Pham, V.N., Kim, C.H., Chitnis, A.B., CamposOrtega, J.A., Weinstein, B.M., 2001. Notch signaling is required for arterial-venous differentiation during embryonic vascular development. Development 128, 3675 – 3683. Lawson, N.D., Vogel, A.M., Weinstein, B.M., 2002. sonic hedgehog and vascular endothelial growth factor act upstream of the Notch pathway during arterial endothelial differentiation. Dev. Cell 3, 127 – 136.

76

S.M. Pollard et al. / Developmental Biology 289 (2006) 64 – 76

Li, S., Edgar, D., Fassler, R., Wadsworth, W., Yurchenco, P.D., 2003. The role of laminin in embryonic cell polarization and tissue organization. Dev. Cell 4, 613 – 624. Libby, R.T., Champliaud, M.F., Claudepierre, T., Xu, Y., Gibbons, E.P., Koch, M., Burgeson, R.E., Hunter, D.D., Brunken, W.J., 2000. Laminin expression in adult and developing retinae: evidence of two novel CNS laminins. J. Neurosci. 20, 6517 – 6528. Miner, J.H., Cunningham, J., Sanes, J.R., 1998. Roles for laminin in embryogenesis: exencephaly, syndactyly, and placentopathy in mice lacking the laminin alpha5 chain. J. Cell Biol. 143, 1713 – 1723. Miner, J.H., Li, C., Mudd, J.L., Go, G., Sutherland, A.E., 2004. Compositional and structural requirements for laminin and basement membranes during mouse embryo implantation and gastrulation. Development 131, 2247 – 2256. Miyamoto, D.M., Crowther, R.J., 1985. Formation of the notochord in living ascidian embryos. J. Embryol. Exp. Morphol. 86, 1 – 17. Moore, S.A., Saito, F., Chen, J., Michele, D.E., Henry, M.D., Messing, A., Cohn, R.D., Ross-Barta, S.E., Westra, S., Williamson, R.A., Hoshi, T., Campbell, K.P., 2002. Deletion of brain dystroglycan recapitulates aspects of congenital muscular dystrophy. Nature 418, 422 – 425. Nasevicius, A., Ekker, S.C., 2000. Effective targeted gene Fknockdown_ in zebrafish. Nat. Genet. 26, 216 – 220. Odenthal, J., Haffter, P., Vogelsang, E., Brand, M., van Eeden, F.J., FurutaniSeiki, M., Granato, M., Hammerschmidt, M., Heisenberg, C.P., Jiang, Y.J., Kane, D.A., Kelsh, R.N., Mullins, M.C., Warga, R.M., Allende, M.L., Weinberg, E.S., Nusslein-Volhard, C., 1996. Mutations affecting the formation of the notochord in the zebrafish, Danio rerio. Development 123, 103 – 115. Ornitz, D.M., Yayon, A., Flanagan, J.G., Svahn, C.M., Levi, E., Leder, P., 1992. Heparin is required for cell-free binding of basic fibroblast growth factor to a soluble receptor and for mitogenesis in whole cells. Mol. Cell. Biol. 12, 240 – 247. Parsons, M.J., Campos, I., Hirst, E.M., Stemple, D.L., 2002a. Removal of dystroglycan causes severe muscular dystrophy in zebrafish embryos. Development 129, 3505 – 3512. Parsons, M.J., Pollard, S.M., Saude, L., Feldman, B., Coutinho, P., Hirst, E.M., Stemple, D.L., 2002b. Zebrafish mutants identify an essential role for laminins in notochord formation. Development 129, 3137 – 3146. Pulkkinen, L., Christiano, A.M., Airenne, T., Haakana, H., Tryggvason, K., Uitto, J., 1994. Mutations in the gamma 2 chain gene (LAMC2) of kalinin/laminin 5 in the junctional forms of epidermolysis bullosa. Nat. Genet. 6, 293 – 297. Pulkkinen, L., Gerecke, D.R., Christiano, A.M., Wagman, D.W., Burgeson, R.E., Uitto, J., 1995a. Cloning of the beta 3 chain gene (LAMB3) of human laminin 5, a candidate gene in junctional epidermolysis bullosa. Genomics 25, 192 – 198. Pulkkinen, L., McGrath, J.A., Christiano, A.M., Uitto, J., 1995b. Detection of sequence variants in the gene encoding the beta 3 chain of laminin 5 (LAMB3). Hum. Mutat. 6, 77 – 84. Ryan, M.C., Lee, K., Miyashita, Y., Carter, W.G., 1999. Targeted disruption of the LAMA3 gene in mice reveals abnormalities in survival and late stage differentiation of epithelial cells. J. Cell Biol. 145, 1309 – 1323. Saude, L., Woolley, K., Martin, P., Driever, W., Stemple, D.L., 2000. Axisinducing activities and cell fates of the zebrafish organizer. Development 127, 3407 – 3417. Schier, A.F., Neuhauss, S.C., Harvey, M., Malicki, J., Solnica-Krezel, L., Stainier, D.Y., Zwartkruis, F., Abdelilah, S., Stemple, D.L., Rangini, Z., Yang, H., Driever, W., 1996. Mutations affecting the development of the embryonic zebrafish brain. Development 123, 165 – 178. Schier, A.F., Neuhauss, S.C., Helde, K.A., Talbot, W.S., Driever, W., 1997. The one-eyed pinhead gene functions in mesoderm and endoderm formation in zebrafish and interacts with no tail. Development 124, 327 – 342.

Serafini, T., Kennedy, T.E., Galko, M.J., Mirzayan, C., Jessell, T.M., TessierLavigne, M., 1994. The netrins define a family of axon outgrowthpromoting proteins homologous to C. elegans UNC-6. Cell 78, 409 – 424. Shinohara, H., Tanaka, O., 1988. Development of the notochord in human embryos: ultrastructural, histochemical, and immunohistochemical studies. Anat. Rec. 220, 171 – 178. Sixt, M., Engelhardt, B., Pausch, F., Hallmann, R., Wendler, O., Sorokin, L.M., 2001. Endothelial cell laminin isoforms, laminins 8 and 10, play decisive roles in T cell recruitment across the blood – brain barrier in experimental autoimmune encephalomyelitis. J. Cell Biol. 153, 933 – 946. Smyth, N., Vatansever, H.S., Meyer, M., Frie, C., Paulsson, M., Edgar, D., 1998. The targeted deletion of the LAMC1 gene. Ann. N. Y. Acad. Sci. 857, 283 – 286. Smyth, N., Vatansever, H.S., Murray, P., Meyer, M., Frie, C., Paulsson, M., Edgar, D., 1999. Absence of basement membranes after targeting the LAMC1 gene results in embryonic lethality due to failure of endoderm differentiation. J. Cell Biol. 144, 151 – 160. Sorokin, L., Girg, W., Gopfert, T., Hallmann, R., Deutzmann, R., 1994. Expression of novel 400-kDa laminin chains by mouse and bovine endothelial cells. Eur. J. Biochem. 223, 603 – 610. Sorokin, L.M., Pausch, F., Frieser, M., Kroger, S., Ohage, E., Deutzmann, R., 1997. Developmental regulation of the laminin alpha5 chain suggests a role in epithelial and endothelial cell maturation. Dev. Biol. 189, 285 – 300. Stemple, D.L., 2005. Structure and function of the notochord: an essential organ for chordate development. Development 132, 2503 – 2512. Stemple, D.L., Solnica-Krezel, L., Zwartkruis, F., Neuhauss, S.C., Schier, A.F., Malicki, J., Stainier, D.Y., Abdelilah, S., Rangini, Z., Mountcastle-Shah, E., Driever, W., 1996. Mutations affecting development of the notochord in zebrafish. Development 123, 117 – 128. Talbot, W.S., Schier, A.F., 1999. Positional cloning of mutated zebrafish genes. Methods Cell Biol. 60, 259 – 286. Thisse, C., Thisse, B., Schilling, T.F., Postlethwait, J.H., 1993. Structure of the zebrafish snail1 gene and its expression in wild-type, spadetail and no tail mutant embryos. Development 119, 1203 – 1215. Thompson, M.A., Ransom, D.G., Pratt, S.J., MacLennan, H., Kieran, M.W., Detrich III, H.W., Vail, B., Huber, T.L., Paw, B., Brownlie, A.J., Oates, A.C., Fritz, A., Gates, M.A., Amores, A., Bahary, N., Talbot, W.S., Her, H., Beier, D.R., Postlethwait, J.H., Zon, L.I., 1998. The cloche and spadetail genes differentially affect hematopoiesis and vasculogenesis. Dev. Biol. 197, 248 – 269. Thyboll, J., Kortesmaa, J., Cao, R., Soininen, R., Wang, L., Iivanainen, A., Sorokin, L., Risling, M., Cao, Y., Tryggvason, K., 2002. Deletion of the laminin alpha4 chain leads to impaired microvessel maturation. Mol. Cell. Biol. 22, 1194 – 1202. Torres-Vazquez, J., Gitler, A.D., Fraser, S.D., Berk, J.D., Van, N.P., Fishman, M.C., Childs, S., Epstein, J.A., Weinstein, B.M., 2004. Semaphorin-plexin signaling guides patterning of the developing vasculature. Dev. Cell 7, 117 – 123. Vogel, A.M., Weinstein, B.M., 2000. Studying vascular development in the zebrafish. Trends Cardiovasc. Med. 10, 352 – 360. Weinstein, B.M., 2005. Vessels and nerves: marching to the same tune. Cell 120, 299 – 302. Westerfield, M., 1994. The Zebrafish Book. University of Oregon Press, Eugene, OR. Xu, H., Wu, X.R., Wewer, U.M., Engvall, E., 1994. Murine muscular dystrophy caused by a mutation in the laminin alpha 2 (Lama2) gene. Nat. Genet. 8, 297 – 302. Yayon, A., Klagsbrun, M., Esko, J.D., Leder, P., Ornitz, D.M., 1991. Cell surface, heparin-like molecules are required for binding of basic fibroblast growth factor to its high affinity receptor. Cell 64, 841 – 848. Yurchenco, P.D., Quan, Y., Colognato, H., Mathus, T., Harrison, D., Yamada, Y., O’Rear, J.J., 1997. The alpha chain of laminin-1 is independently secreted and drives secretion of its beta- and gamma-chain partners. Proc. Natl. Acad. Sci. U. S. A. 94, 10189 – 10194.