- Email: [email protected]
Establishment and characterisation of two cDNA-derived strains of classical swine fever virus, one highly virulent and one avirulent
Virus Research 98 (2003) 105–116
Establishment and characterisation of two cDNA-derived strains of classical swine fever virus, one highly virulent and one avirulent Daniel Mayer, Travis M. Thayer, Martin A. Hofmann, Jon-Duri Tratschin∗ Institute of Virology and Immunoprophylaxis, CH-3147 Mittelhäusern, Switzerland Received 18 April 2003; received in revised form 30 July 2003; accepted 12 August 2003
Abstract The virulence of classical swine fever virus (CSFV) strains including established laboratory strains as well as field isolates ranges from avirulent to highly virulent. Here, we describe the construction and characterisation of two cDNA-derived CSFV strains, each corresponding to one of these extremes. The recombinant virus vEy-37 caused acute disease indistinguishable from that provoked by infection with the highly virulent parent strain Eystrup. In contrast, vRiems-3, a molecular clone of the CSFV vaccine strain Riems, was avirulent and induced protective immunity in pigs. After repeated passage of vEy-37 in porcine kidney SK-6 cells adaptive mutations in the Erns gene were observed. The respective reconstructed mutant virus grew to titres that were almost 4 log units higher when compared to vEy-37. The mutation in the Erns gene had only a minor effect on the virulence of the virus. The complete genomic sequences of the two CSFV strains, Eystrup and Riems, have been deposited in GenBank (accession number AF326963 for CSFV Eystrup, AY259122 for CSFV Riems/IVI). © 2003 Elsevier B.V. All rights reserved. Keywords: Classical swine fever virus; Molecular clone; Virulence
1. Introduction Classical swine fever virus (CSFV) is the etiological agent of a highly contagious disease of pigs. Together with bovine viral diarrhoea virus and border disease virus CSFV belongs to the genus Pestivirus within the family Flaviviridae. The other two genera of the family are Flavivirus and Hepacivirus (van Regenmortel et al., 2000). The virulence of CSFV including established laboratory strains as well as field isolates ranges from completely avirulent to highly virulent in a continuous spectrum. van Oirschot (1988) proposed a classification into avirulent, low virulent, moderately virulent, and highly virulent strains. Avirulent strains are completely non-pathogenic but induce a protective immunity, whereas highly virulent strains cause acute disease resulting in 100% mortality within less than 10 days, irrespective of age and weight of the infected pigs. CSFV ∗
Corresponding author. Tel.: +41-31-8489211; fax: +41-31-8489222. E-mail addresses: [email protected] (D. Mayer), [email protected] (T.M. Thayer), [email protected] (M.A. Hofmann), [email protected] (J.-D. Tratschin). 0168-1702/$ – see front matter © 2003 Elsevier B.V. All rights reserved. doi:10.1016/j.virusres.2003.08.020
strains classified as virulent or moderately virulent generally cause subacute or chronic disease. The acute form of classical swine fever (CSF) is a haemorrhagic disease with an incubation period of 3–5 days which is characterised by leukopenia, constipation followed by diarrhoea, petechial haemorrhages, skin cyanosis and neurological symptoms (Mittelholzer et al., 2000; Moennig, 2000). In subacute and chronic forms of CSF similar but milder symptoms are observed (van Oirschot, 1994). We have proposed a classification of virulence based on body temperature and clinical score in experimentally infected specified pathogen-free (SPF) pigs. To determine the clinical score a system was established which accounts for 10 typical symptoms of CSF (Mittelholzer et al., 2000). The genetic determinants responsible for the varying virulence in CSFV remain to be determined. Comparison of strains at the level of the genomic nucleotide sequence did not reveal a correlation between virulence and primary sequence. Multiple duplications of uridine nucleotides in the 3 nontranslated region (NTR) of the genome of several lapinized CSFV strains also do not correlate with virulence since other vaccine strains lack such insertions (Bjorklund
106
D. Mayer et al. / Virus Research 98 (2003) 105–116
et al., 1998). Attenuation of CSFV by site-directed mutagenesis of cloned viral cDNA has been obtained in at least two cases. By mutagenesis of the active site of the RNAse residing in the viral glycoprotein Erns Meyers et al. (1999) generated mutant CSFV that was fully competent for replication in cell culture. This virus was avirulent and induced protective immunity in pigs. Similarly, we have shown that mutants of the moderately virulent strain Alfort/187 as well as of the highly virulent strain Eystrup which lacked the Npro gene replicated in cell culture to similar titres as the parent virus but were avirulent in pigs. Virulence was rescued by reintroduction of the Npro gene derived from an avirulent strain. Thus, the presence but not the origin of Npro was critical for virulence (Mayer et al., 2003), indicating that Npro is not responsible for the varying virulence between CSFV strains but has a function in the induction of CSF in pigs. This is further corroborated by the finding that CSFV Npro deletion mutants, as opposed to the respective wild type viruses, induced type I interferon (IFN) in porcine macrophages (Ruggli et al., 2003). Hulst et al. (2000) have studied adaptive mutations in the Erns gene occurring by cell culture passage of the highly virulent CSFV strain Brescia. The virus mutants grew to higher titres in swine kidney SK-6 cells and acquired the capacity to attach to the surface of these cells by Erns -mediated interaction with heparan sulphate molecules on the cell surface. The altered phenotype was the result of a change of a Ser to an Arg residue in the C-terminal part of Erns . As cell culture-selected mutants of foot-and-mouth disease virus and of Sindbis virus that are able to bind to heparan sulphate have been reported to be attenuated (Sa-Carvalho et al., 1997; Klimstra et al., 1998), it was assumed that the respective CSFV mutants might also be attenuated. However, introduction of the respective Ser to Arg mutation into the Erns protein of a virulent Brescia clone did not reduce the virulence of the respective virus (Hulst et al., 2001). It has also been proposed that in addition to genetic determinants the outcome of CSF might depend on other factors (Dahle and Liess, 1995). Thus, age and health status of the individual pig, the route of infection, the presence of other pestiviruses in the inoculum, and its origin (being either virus obtained directly from diseased animals or by cell culture passage) could play a role. Finally, breed-related factors have been suggested to influence the severity of CSF (Depner et al., 1997). In our hands, highly virulent CSFVs such as strains Eystrup or Koslov always cause lethal CSF within 8–10 days when SPF pigs of approximately 30 kg bodyweight were infected (Mittelholzer et al., 2000). The cDNA-derived CSFV described so far range in their virulence from avirulent (Moormann et al., 1996; Hulst et al., 2000) to virulent (Meyers et al., 1996; Ruggli et al., 1996; Hulst et al., 2001). However, a recombinant CSFV strain, which is able to kill experimentally infected pigs within less than 10 days and, therefore, can be classified as highly virulent, has not been reported yet.
Here, we describe the construction and characterisation of cDNA clones of the highly virulent CSFV strain Eystrup and of the avirulent vaccine strain Riems/IVI. We show that both recombinant viruses maintain their respective phenotype after infection of pigs. These clones will serve as a virus pair for detection and analysis of genetically determined virulence factors in CSFV.
2. Material and methods 2.1. Cells The swine kidney cell line SK-6 (Kasza et al., 1972), kindly provided by M. Pensaert (Faculty of Veterinary Medicine, Ghent, Belgium), was grown in minimal essential medium (Gibco) containing Earle’s salts (EMEM) and 7% horse serum (Gibco). To obtain foetal swine nasal epithelial (FSNE) cells nasal epithelial tissue excised from SPF foetuses was treated with 1.2 U/ml dispase II (Roche) in phosphate buffered saline, pH 7.2 (PBS). After treatment for 30 min to 1 h the individualised cells were seeded at a concentration of 2×105 cells/ml in EMEM/7% horse serum. Low passages of FSNE cells were used for subsequent experiments. Monocyte-derived macrophages (M) were isolated from peripheral blood mononuclear cells of SPF pigs by culturing monocytes at 4×106 cells/ml for 2 h in Dulbecco’s modified Eagle medium (DMEM), 10% (v/v) porcine serum, 2 mM l-glutamine and 25 mM HEPES as described (Knoetig et al., 1999). The adherent cells were washed once with PBS and cultured in the above medium for at least 72 h to allow differentiation into M (McCullough et al., 1999). 2.2. Viruses CSFV strain Riems, provided by G. Schirrmeier, Riemser Arzneimittel GmbH, Insel Riems, Germany, was passaged once in SK-6 cells. It is referred to as Riems/IVI in the following to differentiate from another Riems strain (referred to as Riems/Giessen) for which the sequence has been deposited (GenBank accession number U45477). CSFV strain Eystrup contained in the serum of an experimentally infected pig and obtained from H.-J. Thiel, Justus-Liebig-Universität, Giessen, Germany, was passaged three times in SK6 cells. 2.3. RNA extraction, reverse transcription and PCR Viral RNA was obtained by Trizol (Invitrogen) extraction of cells infected with the respective viruses and reverse-transcribed using Expand Reverse Transcriptase (Roche Diagnostics) and either of the two following oligonucleotide primers designed on the basis of the sequence of CSFV strain Alfort/187 (Ruggli et al., 1996): PR1 (5 -CCT CAG GTT AGA TGG ATC CTC-3 ) complemen-
D. Mayer et al. / Virus Research 98 (2003) 105–116
tary to nucleotides (nts) 6454–6434, and URSX1 (5 -TTC CTC GAG CCCGGG CCG TTA GGA AAT TAC CTT-3 ). URSX1 is complementary to the 21, 3 -terminal nts of the genome (underlined) and contains 12 additional 5 -terminal nts including an SrfI restriction site (italics). The cDNA was purified on MicroSpin S-400 columns (Amersham Biosciences) and amplified by PCR using either the expand LT PCR kit (Roche Diagnostics) or Pfu Turbo polymerase (Stratagene). PCR products were visualised by agarose gel electrophoresis before extraction and purification with the QIAquick Gel Extraction kit (Qiagen). 2.4. Sequencing and assembly of full-length cDNA clones Fragments obtained by reverse transcription (RT)-PCR were cloned into the pCR-TopoXL vector (Invitrogen). The respective inserts were sequenced with the Thermo SequenaseTM DYEnamic direct cycle sequencing kit (Amersham Biosciences) and analysed on a LI-COR 4200 sequencer using e-Seq and AlignIR software (LI-COR Biosciences). Subclones were assembled to the respective full-length clones termed pEy-37 and pRiems-3 in the low copy number plasmid pACNR1180 (Ruggli et al., 1996) by ligation of appropriate restriction endonuclease fragments and assembly PCR. 2.5. Analysis of 5 and 3 ends of the genome The 5 end was amplified by ligation-anchored PCR essentially as described by Troutt et al. (1992). Briefly, the oligonucleotide PEST2 (Wirz et al., 1993) served as a primer for RT. To the 3 end of the cDNA the 5 -phosphorylated DNA oligonucleotide RT7G (5 -CTA TAG TGA GTC GTA TTA AGA TCT GTC GAC GCG TC-3 ) was ligated. The sense primer LT7G, partially complementary to RT7G (5 -CGC GTC GAC AGA TCT TAA TAC GAC TCA CTA TAG-3 ) and the antisense primer GR1 (5 -AAA CTG CAG CCC AGT TCG GCC GTC-3 ) containing the sequence complementary to nts 95–79 of the genome (underlined) were used to perform 40 cycles of PCR on the extended cDNA. In analogy to the ligation-anchored PCR described above a ligation-anchored RT-PCR was designed to determine the sequence of the 3 end of the viral genome. The oligodeoxynucleotide Ey3 ligext (5 -ATA ACT CTA ACT TCG GAC GCA CGG-3 ) was ligated to the full-length viral RNA and RT was performed with the primer Ey3 ligRT (5 -CCG TGC GTC CGA AGT TAG AGT-3 ), which is partially complementary to Ey3 ligext. The resulting cDNA was subjected to 50 cycles of PCR using the primers ACL12200 (5 -ACC TCA WGT TAC CAC ACT AC-3 , nts 12200–12219 of the genome) and Ey3 ligRT. The respective PCR fragments containing either of the ends of the genome were cloned into pCR-TopoXL and sequenced.
107
2.6. Alignment and phylogenetic analysis of CSFV sequences The following full-length genome sequences of 14 CSFV strains obtained from GenBank were aligned with the sequences of strain Eystrup and Riems/IVI using the GeneWorks package (IntelliGenetics, Mountain View, CA, USA): ALD (accession number D49532), Alfort 187 (X87939), Alfort A19 (U90951), Alfort/Tübingen (J04358), Brescia/IVI (AF091661), Brescia/Lelystad (M31768), CAP (X96550), C strain (Z46258), Glentorf (U45478), GPE- (D42109), HCLV (AF091507), P97 (L49347), Riems/Giessen (U45477), Shimen (AF092448). The PAUP 4.0 program (Sinauer Associates Inc. Publishers, Sunderland, MA, USA) was used to obtain a phylogenetic tree by the neighbour-joining method (Saitou and Nei, 1987) including the Jukes and Cantor correction for multiple base changes (Jukes and Cantor, 1969). To test the reliability of the branches in the tree a bootstrap analysis (1000 replicates) was performed using the same software. For drawing of the tree the TreeView software (Page, 1996) was used.
2.7. In vitro synthesis of viral RNA, transfection of SK-6 cells and virus rescue The cDNA clones pEy-37 and pRiems-3 were linearised with restriction endonuclease SrfI (Stratagene) cleaving exactly at the 3 end of the viral genome. The reactions were extracted with phenol/chloroform and the DNA precipitated with ethanol. Authentic viral RNA was obtained by runoff transcription with the T7 MEGAscript kit (Ambion) from the T7 RNA polymerase promoter contained in the respective clones. After DNase I digestion, transcripts were purified through a MicroSpin S-400 column and quantified photometrically using an Ultrospec 2100 pro UV-Vis Spectrophotometer (Amersham Biosciences). RNA-specific infectivity was measured by an infectious centre assay as described by Mendez et al. (1998). The specific infectivity was expressed as focus forming units (FFU)/g RNA. For transfection of in vitro synthesised RNA, SK-6 cells were washed twice with cold PBS, 0.9 mM CaCl2 , 0.5 mM MgCl2 and resuspended in the same buffer to a density of 2 × 107 cells/ml. One microgram of the RNA was transfected by electroporation using a Gene Pulser (Bio Rad) and a 2 mm cuvette containing 400 l of the cell suspension (8 × 106 cells) by applying two electric pulses (500 F, 200 V, no pulse controller). Cells were allowed to recover for 5 min at room temperature, resuspended in EMEM/7% horse serum and seeded in appropriate cell culture plates or flasks. The medium was replaced after overnight incubation at 37 ◦ C. Virus was rescued from the cells between 48 and 72 h after transfection by two cycles of freeze–thawing. The cell lysates were used as inoculum for virus passage, titration, replication kinetics and experimental infection of pigs.
108
D. Mayer et al. / Virus Research 98 (2003) 105–116
2.8. Virus titration For titration, cells (SK-6, M or FSNE) were infected with 10-fold dilutions of the respective virus. The titre was calculated 48 post infection (p.i.) by staining the cells with the monoclonal antibody (mAb) HC/TC 26 directed against glycoprotein E2 (Greiser-Wilke et al., 1990) in an indirect immunoperoxidase assay (IPA) (Mittelholzer et al., 1997) for SK-6 and FSNE cells or by an indirect immunofluorescence assay (Ruggli et al., 1996) for M. 2.9. Virus replication kinetics For the characterisation of the replication kinetics of the cDNA-derived viruses SK-6 cells seeded in 24-well plates were infected at a multiplicity of infection of 0.1. Cells were incubated for 1 h at 37 ◦ C before washing and incubation in fresh medium. At the indicated times p.i. the respective cell cultures were frozen to stop virus replication and the virus titrated in SK-6 cells.
thrin or biotin; Southern Biotechnology Associates), and streptavidin-spectralred for fluorescence-3 (Southern Biotechnology Associates; Summerfield and McCullough, 1997). For the acquisition of data a FACScan flow cytometer was used and the CellQuest programme for subsequent analysis (both Becton Dickinson, Mountain View, CA, USA). 2.12. Virus isolation and serology For virus isolation sera obtained from infected animals were diluted threefold in EMEM and used to inoculate SK-6 cells. Cell culture supernatants were collected at 48 h p.i. and cells stained for CSFV-specific E2 antigen by IPA. Positive sera were titrated in SK-6 cells. Alternatively, virus contained in serum samples was quantified by measuring the CSFV-specific RNA by real time TaqMan PCR (Hofmann, in press). CSFV-specific serum antibody titres were determined using an E2 capture ELISA (Moser et al., 1996).
2.10. Characterisation of virulence 3. Results SPF pigs of approximately 35 kg bodyweight were infected with 104.0 TCID50 (titrated in SK-6 cells) of CSFV Eystrup, vEy-37 or vRiems-3 per pig or with 107.5 of vEy-Erns RI, respectively. Virus used for inoculation was diluted in 5 ml EMEM and one half of the dose was administered each, intranasally and orally. For each virus to be tested three littermates of SPF pigs kept in separate isolation units were infected. Body temperature and clinical score were daily monitored. Twice a week whole blood was collected for serum preparation, EDTA blood for white blood cell count and for preparation of leukocytes (Summerfield et al., 1998). 2.11. Quantification of peripheral blood leukocytes (PBLs) and identification of B- and T-lymphocytes An aliquot of EDTA blood was diluted in TÜRK’s solution (Merck), and PBLs were counted in a Bürker’s counting chamber. For phenotyping of B- and T-lymphocytes the following mAbs were used (reviewed in Saalmüller, 1996): anti-SWC1 (mAb 11/8/1, kindly provided by Dr. A. Saalmüller, BFAV Tübingen, Germany), anti-SWC3 (mAb 74-22-15, VMRD Inc., Pullmann, WA, USA), anti-SWC8 (mAb MIL3, Serotec), and anti-CD3 (3E8, VMRD). For the identification of B-lymphocytes, a SWC1/SWC8/ SWC3 triple immunofluorescence analysis was performed. B-cells were identified as SWC1- SWC3- SWC8high cells. In a separate immunofluorescence analysis T-lymphocytes were defined CD3+ cells (Summerfield et al., 2001). Indirect mAb labelling for triple immunofluorescence was performed in a three-step procedure, using isotype-specific conjugates (goat anti-mouse IgG, F(ab )2 fragments, conjugated with FITC, phycoery-
3.1. Nucleotide sequence of the CSFV Eystrup and Riems/IVI genome For both CSFV strains, Eystrup and Riems/IVI, the complete consensus sequence was obtained by sequencing at least three individual clones of each fragment generated by three independent RT-PCRs (Fig. 1). Sequencing of the ends of the two genomes revealed that each of the 21 terminal nucleotides of the 5 and the 3 ends were identical for both virus strains as well as for CSFV Alfort/187 (Ruggli et al., 1996). Therefore, corresponding primers designed from the Alfort/187 sequence were used to amplify the terminal fragments of the respective genomes. The complete genomic sequences of CSFV Eystrup and CSFV Riems/IVI were compared at the nucleotide level to a total of 14 sequences of genotypes I and II strains available in GenBank. The phylogenetic tree obtained by the neighbour-joining method is drawn in Fig. 2. Strain Eystrup was found to be most closely related to strain ALD (98.6% nucleotide sequence identity), another highly virulent genotype I strain and most distantly related to strain P97 (85.5%), a moderately virulent strain belonging to genotype II. The sequence we have determined for the strain Riems/IVI shows 99.6% identity with the published sequence for the vaccine strain referred to as Riems/Giessen, whereas the strain P97 again shows the lowest sequence identity. The sequence identity between strains Eystrup and Riems/IVI is 96.2%. The overall length of the genomes of the Eystrup virus (12,301 nt) and the Riems/IVI virus (12,289 nt) differs only in the 3 NTR (234 nt versus 222 nt) whereas the 5 NTR (373 nt) and the open reading frame (11,694 nt) are identical in length. The difference in the 3’ NTRs is due to the
D. Mayer et al. / Virus Research 98 (2003) 105–116
109
vEy-37 genome SrfI CTAACGGCCCGGGC BamHI (6437)
NgoMIV (2440)
T7 promoter genome TACGACTCACTATAGTATAC
SpeI (11867) Assembly PCR
BpuMI (9521)
vRiems-3
BamHI (6437)
NgoMIV (2440)
(A)
(B)
5‘NTR
p7 Npro C Erns E1
E2
NS2
NS3
NS4A NS4B
6
7
3‘NTR NS5A
NS5B
(C)
0
1
2
3
4
5
8
9
10
11
12kb
Fig. 1. Cloning strategy for cDNA clones of CSFV strain Eystrup (A) and strain Riems/IVI (B). Overlapping cDNA fragments were assembled by ligation of appropriate restriction fragments or by assembly PCR as indicated. The T7 RNA polymerase promoter located immediately upstream of the 5 end of the genome as well as the SrfI site (bold) at the 3 end of the genome are only shown for vEy-37. The genome sequences are underlined (A); numbers correspond to the nucleotide position on the CSFV genome. The organisation of the CSFV genome including a scale in kilobases (kb) is depicted in (C). Nontranslated regions (NTR) and viral genes with their respective encoded proteins are indicated.
varying length of the uridine (U)-rich region composed of several poly-U stretches and adenine-uridine (AUn ) motifs (Fig. 3A).
infectivities of the RNAs determined in an infectious centre assay were 6.2 × 106 and 5.9 × 106 FFU/g RNA, respectively.
3.2. Construction of full-length cDNA clones and generation of recombinant virus
3.3. Recombinant vEy-37 is as virulent as the parent CSFV strain Eystrup
Based on the consensus sequences including the termini of the viral genomes, cloning strategies were applied to assemble the respective complete cDNA clones by DNA ligation using suitable restriction endonuclease sites or by assembly PCR (Fig. 1). The clones were designed exactly as described for pA187-1 (Ruggli et al., 1996), i.e. the viral cDNA linked at the 5 end to a T7 RNA polymerase promoter for in vitro transcription of authentic viral RNA was cloned in the low copy number plasmid pACNR1180. At the 3 end of the viral DNA an SrfI restriction site was introduced allowing the generation of authentic viral RNA by runoff transcription. The assembled full-length cDNA plasmid clones were termed pEy-37 and pRiems-3, respectively. Electroporation into SK-6 cells of viral RNA transcribed in vitro gave rise to synthesis of infectious progeny virus. The respective titres were 103.9 TCID50 /ml for the virus vEy-37 derived from pEy-37, and 103.7 TCID50 /ml for the virus vRiems-3 derived from pRiems-3. The specific
The virulence of vEy-37 (Fig. 4A) was compared to that of the parent Eystrup virus (Fig. 4E) in experimental infections of groups of three pigs with 104.0 TCID50 of the respective virus per pig. For both viruses all animals developed severe CSF within 6 days including fever of over 40 ◦ C and severe leukopenia (Fig. 4B and F). The blood of the animals infected with vEy-37 was analysed for T- and B-lymphocytes (Fig. 4C and D). Absolute T- and B-lymphocyte counts dropped to 10–15% within 4 days p.i. All animals showed pronounced central nervous symptoms like staggering and convulsions of the head. One of the vEy-37-infected animals died on day 4 p.i. after blood sampling from the jugular vein (Fig. 4A). Such casualties have been occasionally observed in animals experimentally infected with highly virulent CSFVs after having developed severe thrombocytopenia and leukopenia, as was the case in the respective pig (our unpublished observations). Apart from the signs of acute CSF, necropsy of this animal revealed extended haemorrhages in the throat region. All other animals infected with either
110
D. Mayer et al. / Virus Research 98 (2003) 105–116
Fig. 2. Neighbour-joining phylogenetic tree of full-length CSFV sequences. The tree was constructed by comparison of the genomic sequences of CSFV Eystrup and Riems/IVI with 14 full-length sequences of CSFV deposited in GenBank (see Section 2). The phylogenetic distance between the respective viruses is indicated at the bottom. Bootstrap values above 90% obtained from 1000 replicates are shown at the respective branch points. Highly virulent strains (shaded), moderately virulent strains (framed), and avirulent strains (no symbol) are indicated.
vEy-37or the parent Eystrup strain had to be sacrificed in a moribund state on day 7 p.i. when clinical scores of 16–20 were reached (Fig. 4A and E). 3.4. Recombinant vRiems-3 induces protective immunity in pigs The animals infected with 104.0 TCID50 vRiems-3 did not show any clinical signs at any time of the trial (Fig. 4G). Initially, the PBL count even increased and only slight leukopenia was observed (Fig. 4H). Whereas the absolute T-lymphocyte count did not markedly decrease or even increased (Fig. 4I), B-lymphocyte counts dropped temporarily but recovered on day 7 p.i. (Fig. 4J). All animals developed antibody titres against CSFV between 2 and 3 weeks p.i. (Fig. 4H). To assess whether a protective immunity had been induced a challenge infection with vEy-37 was performed 21 days after inoculation with vRiems-3. No clinical signs were observed after challenge infection (Fig. 4G) but in two animals an increase in the anti-E2 antibody titre indicating a booster effect was recorded (Fig. 4H). PBL counts for
these animals were always within the physiological range (Fig. 4H). 3.5. Erns adaptive mutants of vEy-37 obtained in SK-6 cells replicate to higher titres To assess the genetic stability of vEy-37 rescued from cells transfected with pEy-37-derived RNA, the virus was passaged 10 times in SK-6 cells (vEy-37 VP10). Surprisingly, after two to four passages virus titres were recorded that were approximately 100 times higher when compared to the virus titre before passage. In the following passages, the titres remained stable. RT-PCR on RNA extracted from vEy-37 VP10 using the same primers as for cloning the Eystrup genome was performed, and the resulting PCR fragments covering the entire viral genome were sequenced. To properly determine the length of the poly-U tract localised in the 3 NTR and for later construction of recombinant viruses, the PCR fragments representing this region of the genome were cloned in pCR-TopoXL. Nucleotide sequence analysis revealed two base changes in the Erns gene which
D. Mayer et al. / Virus Research 98 (2003) 105–116
111
Fig. 3. Nucleotide sequence alignment of the poly-uridine tract region located in the 3 NTR and partial amino acid alignment of glycoprotein Erns . Sequences of selected CSFV strains obtained from GenBank were aligned to the sequences of the strains Eystrup, vEy-37 VP10 and Riems/IVI. The varying length of the poly-uridine tract region in the 3 NTR is emphasized (A). Heterogeneity of the Erns amino acid sequence at position 476/477 of the viral polyprotein is marked with bold letters (B).
caused the replacement of amino acid residues Ser/Thr (ST) to Arg/Ile (RI) at positions 476/477 of the viral polyprotein (Fig. 3B). In addition, the aforementioned poly-U tract was elongated due to insertion of between 2 and 4 U (Fig. 3A, three additional U shown). No other mutations were found in the entire genome of the virus that had been passaged 10 times in SK-6 cells. To determine whether the mutant Erns had an effect on the viability and/or the virulence of the virus, the mutation found in vEy-37 VP10 was introduced into pEy-37 resulting in pEy-Erns RI. Synthetic RNA obtained from linearised pEy-Erns RI was transfected into SK-6 cells. Its specific infectivity was similar to that of the RNA obtained from pEy-37 (data not shown). Titration of the progeny virus vEy-Erns RI in SK-6 cells resulted in a titre of 107.5 TCID50 /ml. In contrast, the titre obtained for vEy-37 was only 103.7 TCID50 /ml (Table 1). Titres for virus obtained directly from transfected SK-6 cells were also determined
in M and in FSNE cells. The results listed in Table 1 show that in these cells the titres were similar for the two viruses. Furthermore, viral RNA contained in the extracts of transfected SK-6 cells was quantified by real time RT-PCR. Again, no significant difference was detected for the two viruses (data not shown). These findings suggest that after transfection of the respective RNAs into SK-6 cells Table 1 Titration in different cell types of vEy-37 and vEy-Erns RI obtained from transfected SK-6 cells log TCID50 /ml after titration in
vEy-37 vEy-Erns RI
M
SK-6
FSNE
6.5 6.5
3.7 7.5
5.3 5.5
Numbers indicate mean values from two experiments.
112 D. Mayer et al. / Virus Research 98 (2003) 105–116 Fig. 4. Experimental infection of pigs with cDNA-derived viruses vEy-37 and vRiems-3. Three animals each were infected with either vEy-37 (A–D), vRiems-3 (G–J), or the parent Eystrup virus (E and F) for comparison. Body temperature (closed symbols) and clinical score (open symbols) were recorded daily (A, E and G). Peripheral blood leukocytes (PBL) were counted twice weekly (B, F and H). For pigs infected with either vEy-37 or vRiems-3, B- (D and J) and T-lymphocyte counts (C and I) were determined by FCM analysis. CSFV-specific immunity of pigs inoculated with vRiems-3 was challenged on day 21 p.i. by infection with vEy-37 (G and H; arrows). Antibody titres against viral glycoprotein E2 for these three pigs are drawn. Values above the dashed line are considered positive (H; bars).
D. Mayer et al. / Virus Research 98 (2003) 105–116
113
8
log TCID50/ml
7 6 5 4
vEy-37 vEy-ErnsRI vEy-37 VP10 vRiems-3
3 2 1 0 0
12
22
38
46
hours post infection Fig. 5. Replication kinetics of vEy-37, vEy-37 VP10, vEy-Erns RI and vRiems-3. SK-6 cells seeded in 24-well plates were infected at a multiplicity of infection of 0.01. Virus was harvested at the indicated hours post infection by freeze–thawing of the cultures and titrated in SK-6 cells. The data were obtained in one experiment in which all four viruses were analysed in parallel. Virus titres are shown as log TCID50 /ml. A dashed line indicates the detection limit.
the efficiency of viral replication was similar for the two viruses. The kinetics of viral replication for vEy-37, vEy-Erns RI and vRiems-3 obtained directly from transfected cells as well as for vEy-37 VP10 were determined in SK-6 cells (Fig. 5). The results show similar growth characteristics for vEy-37 VP10 and the corresponding reconstructed virus vEy-Erns RI. These viruses that are of the Erns RI-type clearly grew more efficiently when compared to vEy-37 and vRiems-3, which are of the Erns ST-type and showed a pronounced delay in replication. Final titres reached at 46 h p.i. were 106.9 and 106.5 TCID50 /ml for the Erns mutants vEy-Erns RI and vEy-37 VP10, respectively. For vEy-37 and vRiems-3 corresponding values of 105.7 and 105.1 TCID50 /ml were recorded.
3.6. Assessment of virulence of vEy-Erns RI To assess the virulence of vEy-Erns RI three pigs were infected each with 106.5 TCID50 of the virus obtained from transfected SK-6 cells and titrated in M. This dosage corresponds to that used in the experimental infection with vEy-37 (Fig. 4A–D), when M instead of SK-6 cells were used to determine the titre (see also Table 1). All three animals developed severe CSF with clinical scores of up to 17 around day 9 (Fig. 6A). One animal died after blood sampling on day 4 p.i. Surprisingly, the other two animals recovered from the disease, but one of them remained in a wasting state until final slaughtering on day 35 p.i. Similar to animals infected with vEy-37, PBL counts dropped but recovered quickly in the two surviving animals (Fig. 6B). 35 x 106
(A)
41.0 25
39.0
20 38.0
15
37.0
10
36.0
5
35.0
0 -3
0
3
6
9
12 15 18 21 24 27 30 33
106 PBL / ml blood
30
40.0
clinical score
body temperature ˚C
42.0
(B)
20 18 16 14 12 10 8 6 4 2 0
160 120 80 40
antibody titre (% reactivity)
vEy-ErnsRI
0
0
4
7
11
14
18
21
25
28
32
days post infection Fig. 6. Experimental infection of pigs with vEy-Erns RI. Three animals each were infected with vEy-Erns RI. Clinical scores (open symbols) and rectal temperature (closed symbols) were recorded daily (A). Peripheral blood leukocyte (PBL) counts were determined twice weekly. Antibody titres against viral glycoprotein E2 of the two surviving pigs are presented as bars. Values above the dashed line are considered positive (B).
114
D. Mayer et al. / Virus Research 98 (2003) 105–116
One animal showed a very strong increase of blood lymphocytes on day 21 p.i. which probably was due to bacterial superinfection of the skin, since it developed generalised pyodermia. E2 antibody titres scored positive on day 11 p.i. in both surviving animals (Fig. 6B).
4. Discussion To establish authentic cDNA clones of two strains representing a highly virulent as well as an avirulent CSFV, the consensus sequence was determined for the strain Eystrup and for the vaccine strain Riems/IVI. Comparative phylogenetic analysis including the complete genomic sequences of a total of 16 CSFV strains of varying virulence did not reveal any genetic clustering related to virulence (Fig. 2). Also, focusing on the 3 NTR, where an extended poly-U tract has been reported for several vaccine strains, provided no evidence for a grouping of virulent and avirulent strains confirming published data (Bjorklund et al., 1998). Interestingly, Riems/IVI was found to have a shorter U-rich region than any of the other strains for which the complete sequence is known (see examples in Fig. 3A). It lacks 6 of the AUn motifs found in the other strains, yet it has a U26 sequence interrupted by one single cytidine. A similar motif is found in the 3 NTR of the C-strain (U18 interrupted by two cytidines). After experimental infection of pigs, the recombinant virus vEy-37 proved to be as virulent as the parent Eystrup virus strain (Fig. 4A–F). All three animals infected with vEy-37 were moribund within 8 days after oronasal infection (Fig. 4A). Previously, virulent viruses rescued from molecular clones have been reported for the strains CSFV Alfort/Tübingen (Meyers et al., 1999) and Brescia (Hulst et al., 2001). Although these viruses caused CSF they did not meet the main criterion for a highly virulent strain representing the ability to induce lethal disease within less than 10 days after infection (van Oirschot, 1988). The only molecularly cloned CSFV, vA187-1, we had available so far was derived from the strain Alfort/187 (Ruggli et al., 1996). It consistently caused clinical signs but no lethal disease in SPF pigs (Mittelholzer et al., 2000). To obtain a recombinant CSFV representing the opposite phenotype of vEy-37 with regard to virulence, a cDNA clone of the vaccine strain Riems/IVI was established. The virus derived from this clone, vRiems-3, did not cause any signs of disease but induced a distinct antibody response and complete protection from disease after challenge with vEy-37 (Fig. 4). Similarly, deSmit et al. (2000) have reported a cDNA clone derived from the C-strain, an established CSFV vaccine, which also retained its phenotypic characteristics including absence of virulence and immunogenic properties. Although vEy-37 and vRiems-3 display completely opposite phenotypes, depletion of B-lymphocytes occurred in animals infected with either of the two viruses, whereas T-lymphocytes seemed not to be affected in animals infected
with vRiems-3 (Fig. 4). Summerfield et al. (2001) reported for both, the highly virulent CSFV strain Brescia and for the moderately virulent strain Uelzen, that B- as well as T-lymphocytes were rapidly depleted before viraemia was detected in infected pigs. For the moderately virulent CSFV strain Alfort it was reported that depletion occurred predominantly for B-lymphocytes (Susa et al., 1992). These and our findings suggest that B-lymphocytes might be very vulnerable in CSFV-infection, even when a vaccine strain is used (Fig. 4J). Furthermore, the fact that viraemia was never observed in the animals inoculated with vRiems-3 supports the assumption that depletion of B-lymphocytes is not due to their infection with CSFV (Summerfield et al., 2001). Passage of vEy-37 in SK-6 cells led to a significant increase in virus titre. Sequence analysis of the entire genome of the virus obtained after 10 passages (vEy-37 VP10) revealed mutations at only two locations. One was an insertion of between 2 and 4 uridines in the 3 NTR (Fig. 3A), the other a mutation of 2 nts in the Erns coding sequence which caused a shift from ST to RI at position 476/477 in the Erns glycoprotein (Fig. 3B). By introduction of this double amino acid change into pEy-37 the virus vEy-Erns RI was generated. Titration in SK-6 cells of vEy-Erns RI recovered from SK-6 cells transfected with the respective RNA resulted in a titer that was almost 4 log units higher when compared to that of vEy-37 (Table 1). Analysis of the kinetics of virus replication in SK-6 cells revealed that vEy-37 VP10 and vEy-Erns RI grew faster and to higher titres than vEy-37 and vRiems-3, thus confirming the advantage of the Erns RI-mutants in SK-6 cells (Fig. 5). Hulst et al. (2000) reported the same change of a Ser residue to an Arg residue at position 476 of the viral polyprotein after passage of cDNA-derived CSFV Brescia in SK-6 cells. In analogy to our findings, this Erns mutant also grew to higher titres in SK-6 cells. These authors showed that the amino acid change in the Erns glycoprotein from Ser to Arg resulted in a newly acquired capability of the virus to use membrane-associated heparan sulphate (HS) as receptor on SK-6 cells. Although M are supposed to express HS on their cell surface, this phenomenon was not observed in the latter cells, indicating that infection of M with CSFV proceeds by an HS-independent mechanism (Hulst et al., 2001). Titration in porcine M and FSNE cells of vEy-37 and vEy-Erns RI obtained after tranfection of SK-6 cells (Table 1) and quantification of the respective viral RNA by real time RT-PCR indicated, that similar amounts of progeny virus were produced in SK-6 cells for either of the two virus variants. Considering the data of Hulst et al. (2000), this suggests that the increase in replication efficiency we observed for the mutant vEy-Erns RI in SK-6 cells is due to the use of HS as cell surface receptor rather than to impaired replication of vEy-37. The virulence of the Erns mutant vEy-Erns RI was assessed by experimental infection of SPF pigs (Fig. 6). The animals developed severe CSF but two of them recovered. This is in accordance to infections with a molecular clone of CSFV
D. Mayer et al. / Virus Research 98 (2003) 105–116
Brescia, where one of three pigs infected with the Erns R mutant survived, whereas the Erns S wt virus killed all animals (Hulst et al., 2001). However, in the latter experiment the inoculated dose for both viruses was based on SK-6 cells titres, and thus probably 100 times less pig infectious doses were used for animals infected with Erns R mutant compared to the Erns S wt virus. In our experiment with the Eystrup RI-mutant, we observed the slightly attenuated phenotype even though infectious doses calculated on the basis of M titres were used, which probably better mirrors the situation in an animal infection. We conclude that the mutation from ST to RI in the Erns glycoprotein of the highly virulent CSFV strain Eystrup has only a weak attenuating effect. The fact that the vaccine strain Riems/IVI is of the Erns ST type but is completely avirulent (Figs. 3 and 4), also supports the assumption that this mutation in the Erns gene does not contribute to the attenuation and therefore is certainly not a major determinant of virulence in CSFV. The antibody response induced by vRiems-3, which is derived from a classical vaccine strain, was detectable in one animal on day 14 p.i. and in the others on day 21 p.i., whereas sera of the surviving animals infected with vEy-Erns RI scored positive already on day 11 p.i. (Fig. 5A). Obviously, a virulent CSFV like vEy-Erns RI causes viraemia and induces an early specific antibody response in surviving animals. In summary, we have generated a cDNA clone of a highly virulent CSFV strain, which maintains its phenotype. We have also established a cDNA clone of the vaccine strain Riems/IVI and shown that the derived virus is able to protect pigs from CSF. These two cDNA clones provide the basis for the construction of chimeric viruses and will be useful tools to elucidate the genetic determinants of virulence in CSFV which remain to be established.
Acknowledgements We thank H.-J. Thiel and G. Schirrmeier for providing virus strains, A. Summerfield and M. Horn for the help with the FCM analysis. This work was supported by the Swiss Federal Veterinary Office and the Swiss National Science Foundation (grant 31-56719.99). References Bjorklund, H.V., Stadejek, T., Vilcek, S., Belak, S., 1998. Molecular characterisation of the 3 noncoding region of classical swine fever virus vaccine strains. Virus Genes 16, 307–312. deSmit, A.J., vanGennip, H.G.P., Miedema, G.K.W., vanRijn, P.A., Terpstra, C., Moormann, R.J.M., 2000. Recombinant classical swine fever (CSF) viruses derived from the Chinese vaccine strain (C-strain) of CSF virus retain their avirulent and immunogenic characteristics. Vaccine 18, 2351–2358. Dahle, J., Liess, B., 1995. Comparative study with cloned classical swine fever virus strains Alfort and Glentorf: clinical, pathological, virological and serological findings in weaner pigs. Wien. Tierärztl. Monatsschr. 62, 1–6.
115
Depner, K.R., Hinrichs, U., Bickhardt, K., Greiser-Wilke, I., Pohlenz, J., Moennig, V., Liess, B., 1997. Influence of breed-related factors on the course of classical swine fever virus infection. Vet. Rec. 140, 506–507. Greiser-Wilke, I., Moennig, V., Coulibaly, C.O., Dahle, J., Leder, L., Liess, B., 1990. Identification of conserved epitopes on a hog cholera virus protein. Arch. Virol. 111, 213–225. Hofmann, M.A. Construction of an infectious chimeric classical swine fever virus containing the 5’UTR of bovine viral diarrhea virus, and its application as a universal internal positive control in real-time RT-PCR. J. Virol. Methods, in press. Hulst, M.M., vanGennip, H.G.P., Moormann, R.J.M., 2000. Passage of classical swine fever virus in cultured swine kidney cells selects virus variants that bind to heparan sulphate due to a single amino acid change in envelope protein E-rns. J. Virol. 74, 9553–9561. Hulst, M.M., vanGennip, H.G.P., Vlot, A.C., Schooten, E., deSmit, A.J., Moormann, R.J.M., 2001. Interaction of classical swine fever virus with membrane-associated heparan sulphate: role for virus replication in vivo and virulence. J. Virol. 75, 9585–9595. Jukes, T.H., Cantor, C.R., 1969. Evolution of protein molecules. In: Munro, H.N. (Ed.), Mammalian Protein Metabolism. Academic Press, New York, pp. 21–132. Kasza, L., Shadduck, J.A., Christofinis, G.J., 1972. Establishment, viral susceptibility and biological characteristics of a swine kidney cell line SK-6. Res. Vet. Sci 13, 46–51. Klimstra, W.B., Ryman, K.D., Johnston, R.E., 1998. Adaptation of Sindbis virus to BHK cells selects for use of heparan sulphate as an attachment receptor. J. Virol. 72, 7357–7366. Knoetig, S.M., Summerfield, A., Spagnuolo-Weaver, M., McCullough, K.C., 1999. Immunopathogenesis of classical swine fever: role of monocytic cells. Immunology 97, 359–366. Mayer, D., Hofmann, M.A., Tratschin, J.D., 2003. Attenuation of classical swine fever virus by deletion of the viral Npro gene. Vaccine, in press. McCullough, K.C., Basta, S., Knoetig, S., Gerber, H., Schaffner, R., Kim, Y.B., Saalmuller, A., Summerfield, A., 1999. Intermediate stages in monocyte-macrophage differentiation modulate phenotype and susceptibility to virus infection. Immunology 98, 203–212. Mendez, E., Ruggli, N., Collett, M.S., Rice, C.M., 1998. Infectious bovine viral diarrhea virus (strain NADL) RNA from stable cDNA clones: a cellular insert determines NS3 production and viral cytopathogenicity. J. Virol. 72, 4737–4745. Meyers, G., Thiel, H.J., Rümenapf, T., 1996. Classical swine fever virus: recovery of infectious viruses from cDNA constructs and generation of recombinant cytopathogenic defective interfering particles. J. Virol. 70, 1588–1595. Meyers, G., Saalmüller, A., Büttner, M., 1999. Mutations abrogating the RNase activity in glycoprotein E(rns) of the pestivirus classical swine fever virus lead to virus attenuation. J. Virol. 73, 10224–10235. Mittelholzer, C., Moser, C., Tratschin, J.D., Hofmann, M.A., 1997. Generation of cytopathogenic subgenomic RNA of classical swine fever virus in persistently infected porcine cell lines. Virus Res. 51, 125– 137. Mittelholzer, C., Moser, C., Tratschin, J.D., Hofmann, M.A., 2000. Analysis of classical swine fever virus replication kinetics allows differentiation of highly virulent from avirulent strains. Vet. Microbiol. 74, 293–308. Moennig, V., 2000. Introduction to classical swine fever: virus, disease and control policy. Vet. Microbiol. 73, 93–102. Moormann, R.J., van Gennip, H.G., Miedema, G.K., Hulst, M.M., van Rijn, P.A., 1996. Infectious RNA transcribed from an engineered full-length cDNA template of the genome of a pestivirus. J. Virol. 70, 763–770. Moser, C., Ruggli, N., Tratschin, J.D., Hofmann, M.A., 1996. Detection of antibodies against classical swine fever virus in swine sera by indirect ELISA using recombinant envelope glycoprotein E2. Vet. Microbiol. 51, 41–53. Page, R.D.M., 1996. TreeView: an application to display phylogenetic trees on personal computers. Comput. Appl. Biosci. 12, 357–358.
116
D. Mayer et al. / Virus Research 98 (2003) 105–116
Ruggli, N., Tratschin, J.D., Mittelholzer, C., Hofmann, M.A., 1996. Nucleotide sequence of classical swine fever virus strain Alfort/187 and transcription of infectious RNA from stably cloned full-length cDNA. J. Virol. 70, 3478–3487. Ruggli, N., Tratschin, J.D., Schweizer, M., McCullough, K.C., Hofmann, M.A., Summerfield, A., 2003. Classical swine fever virus interferes with cellular antiviral defense: evidence for a novel function of Npro . J. Virol. 77, 7645–7654. Sa-Carvalho, D., Rieder, E., Baxt, B., Rodarte, R., Tanuri, A., Mason, P.W., 1997. Tissue culture adaptation of foot-and-mouth disease virus selects viruses that bind to heparin and are attenuated in cattle. J. Virol. 71, 5115–5123. Saalmüller, A., 1996. Characterisation of swine leukocyte differentiation antigens. Immunol. Today 17, 352–354. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. 4, 406–409. Summerfield, A., McCullough, K.C., 1997. Porcine bone marrow myeloid cells: phenotype and adhesion molecule expression. J. Leukoc. Biol. 62, 176–185. Summerfield, A., Knoetig, S.M., McCullough, K.C., 1998. Lymphocyte apoptosis during classical swine fever: implication of activation-induced cell death. J. Virol. 72, 1853–1861. Summerfield, A., McNeilly, F., Walker, I., Allan, G., Knoetig, S.M., McCullough, K.C., 2001. Depletion of CD4(+) and CD8(high+) T-cells
before the onset of viraemia during classical swine fever. Vet. Immunol. Immunopathol. 78, 3–19. Susa, M., Konig, M., Saalmuller, A., Reddehase, M.J., Thiel, H.J., 1992. Pathogenesis of classical swine fever: B-lymphocyte deficiency caused by hog cholera virus. J. Virol. 66, 1171–1175. Troutt, A.B., McHeyzer-Williams, M.G., Pulendran, B., Nossal, G.J., 1992. Ligation-anchored PCR: a simple amplification technique with single-sided specificity. Proc. Natl. Acad. Sci. U.S.A. 89, 9823– 9825. van Oirschot, J.T., 1988. Description of the virus infection. In: Liess, B. (Ed.), Classical swine fever and related viral infections. Martinus Nijhoff Publishing, Boston, Dordrecht, Lancaster, pp. 1–25. van Oirschot, J.T., 1994. Hog cholera virus. In: Webster, R.G., Granoff, A. (Eds.), Encyclopedia of Virology. Academic Press, London, San Diego, pp. 649–654. van Regenmortel, M.H.V., Fauquet, C.M., Bishop, D.H.L., Carstens, E.B., Estes, M.K., Lemon, S.M., Maniloff, J., Mayo, M.A., McGeoch, D.J., Pringle, C.R., Wickner, R.B., 2000. Virus Taxonomy. The Classification and Nomenclature of Viruses. The Seventh Report of the International Committee on Taxonomy of Viruses. Academic Press, San Diego, 1162 pp. Wirz, B., Tratschin, J.D., Muller, H.K., Mitchell, D.B., 1993. Detection of hog cholera virus and differentiation from other pestiviruses by polymerase chain reaction. J. Clin. Microbiol. 31, 1148–1154.
Establishment and characterisation of two cDNA-derived strains of classical swine fever virus, one highly virulent and one avirulent Daniel Mayer, Travis M. Thayer, Martin A. Hofmann, Jon-Duri Tratschin∗ Institute of Virology and Immunoprophylaxis, CH-3147 Mittelhäusern, Switzerland Received 18 April 2003; received in revised form 30 July 2003; accepted 12 August 2003
Abstract The virulence of classical swine fever virus (CSFV) strains including established laboratory strains as well as field isolates ranges from avirulent to highly virulent. Here, we describe the construction and characterisation of two cDNA-derived CSFV strains, each corresponding to one of these extremes. The recombinant virus vEy-37 caused acute disease indistinguishable from that provoked by infection with the highly virulent parent strain Eystrup. In contrast, vRiems-3, a molecular clone of the CSFV vaccine strain Riems, was avirulent and induced protective immunity in pigs. After repeated passage of vEy-37 in porcine kidney SK-6 cells adaptive mutations in the Erns gene were observed. The respective reconstructed mutant virus grew to titres that were almost 4 log units higher when compared to vEy-37. The mutation in the Erns gene had only a minor effect on the virulence of the virus. The complete genomic sequences of the two CSFV strains, Eystrup and Riems, have been deposited in GenBank (accession number AF326963 for CSFV Eystrup, AY259122 for CSFV Riems/IVI). © 2003 Elsevier B.V. All rights reserved. Keywords: Classical swine fever virus; Molecular clone; Virulence
1. Introduction Classical swine fever virus (CSFV) is the etiological agent of a highly contagious disease of pigs. Together with bovine viral diarrhoea virus and border disease virus CSFV belongs to the genus Pestivirus within the family Flaviviridae. The other two genera of the family are Flavivirus and Hepacivirus (van Regenmortel et al., 2000). The virulence of CSFV including established laboratory strains as well as field isolates ranges from completely avirulent to highly virulent in a continuous spectrum. van Oirschot (1988) proposed a classification into avirulent, low virulent, moderately virulent, and highly virulent strains. Avirulent strains are completely non-pathogenic but induce a protective immunity, whereas highly virulent strains cause acute disease resulting in 100% mortality within less than 10 days, irrespective of age and weight of the infected pigs. CSFV ∗
Corresponding author. Tel.: +41-31-8489211; fax: +41-31-8489222. E-mail addresses: [email protected] (D. Mayer), [email protected] (T.M. Thayer), [email protected] (M.A. Hofmann), [email protected] (J.-D. Tratschin). 0168-1702/$ – see front matter © 2003 Elsevier B.V. All rights reserved. doi:10.1016/j.virusres.2003.08.020
strains classified as virulent or moderately virulent generally cause subacute or chronic disease. The acute form of classical swine fever (CSF) is a haemorrhagic disease with an incubation period of 3–5 days which is characterised by leukopenia, constipation followed by diarrhoea, petechial haemorrhages, skin cyanosis and neurological symptoms (Mittelholzer et al., 2000; Moennig, 2000). In subacute and chronic forms of CSF similar but milder symptoms are observed (van Oirschot, 1994). We have proposed a classification of virulence based on body temperature and clinical score in experimentally infected specified pathogen-free (SPF) pigs. To determine the clinical score a system was established which accounts for 10 typical symptoms of CSF (Mittelholzer et al., 2000). The genetic determinants responsible for the varying virulence in CSFV remain to be determined. Comparison of strains at the level of the genomic nucleotide sequence did not reveal a correlation between virulence and primary sequence. Multiple duplications of uridine nucleotides in the 3 nontranslated region (NTR) of the genome of several lapinized CSFV strains also do not correlate with virulence since other vaccine strains lack such insertions (Bjorklund
106
D. Mayer et al. / Virus Research 98 (2003) 105–116
et al., 1998). Attenuation of CSFV by site-directed mutagenesis of cloned viral cDNA has been obtained in at least two cases. By mutagenesis of the active site of the RNAse residing in the viral glycoprotein Erns Meyers et al. (1999) generated mutant CSFV that was fully competent for replication in cell culture. This virus was avirulent and induced protective immunity in pigs. Similarly, we have shown that mutants of the moderately virulent strain Alfort/187 as well as of the highly virulent strain Eystrup which lacked the Npro gene replicated in cell culture to similar titres as the parent virus but were avirulent in pigs. Virulence was rescued by reintroduction of the Npro gene derived from an avirulent strain. Thus, the presence but not the origin of Npro was critical for virulence (Mayer et al., 2003), indicating that Npro is not responsible for the varying virulence between CSFV strains but has a function in the induction of CSF in pigs. This is further corroborated by the finding that CSFV Npro deletion mutants, as opposed to the respective wild type viruses, induced type I interferon (IFN) in porcine macrophages (Ruggli et al., 2003). Hulst et al. (2000) have studied adaptive mutations in the Erns gene occurring by cell culture passage of the highly virulent CSFV strain Brescia. The virus mutants grew to higher titres in swine kidney SK-6 cells and acquired the capacity to attach to the surface of these cells by Erns -mediated interaction with heparan sulphate molecules on the cell surface. The altered phenotype was the result of a change of a Ser to an Arg residue in the C-terminal part of Erns . As cell culture-selected mutants of foot-and-mouth disease virus and of Sindbis virus that are able to bind to heparan sulphate have been reported to be attenuated (Sa-Carvalho et al., 1997; Klimstra et al., 1998), it was assumed that the respective CSFV mutants might also be attenuated. However, introduction of the respective Ser to Arg mutation into the Erns protein of a virulent Brescia clone did not reduce the virulence of the respective virus (Hulst et al., 2001). It has also been proposed that in addition to genetic determinants the outcome of CSF might depend on other factors (Dahle and Liess, 1995). Thus, age and health status of the individual pig, the route of infection, the presence of other pestiviruses in the inoculum, and its origin (being either virus obtained directly from diseased animals or by cell culture passage) could play a role. Finally, breed-related factors have been suggested to influence the severity of CSF (Depner et al., 1997). In our hands, highly virulent CSFVs such as strains Eystrup or Koslov always cause lethal CSF within 8–10 days when SPF pigs of approximately 30 kg bodyweight were infected (Mittelholzer et al., 2000). The cDNA-derived CSFV described so far range in their virulence from avirulent (Moormann et al., 1996; Hulst et al., 2000) to virulent (Meyers et al., 1996; Ruggli et al., 1996; Hulst et al., 2001). However, a recombinant CSFV strain, which is able to kill experimentally infected pigs within less than 10 days and, therefore, can be classified as highly virulent, has not been reported yet.
Here, we describe the construction and characterisation of cDNA clones of the highly virulent CSFV strain Eystrup and of the avirulent vaccine strain Riems/IVI. We show that both recombinant viruses maintain their respective phenotype after infection of pigs. These clones will serve as a virus pair for detection and analysis of genetically determined virulence factors in CSFV.
2. Material and methods 2.1. Cells The swine kidney cell line SK-6 (Kasza et al., 1972), kindly provided by M. Pensaert (Faculty of Veterinary Medicine, Ghent, Belgium), was grown in minimal essential medium (Gibco) containing Earle’s salts (EMEM) and 7% horse serum (Gibco). To obtain foetal swine nasal epithelial (FSNE) cells nasal epithelial tissue excised from SPF foetuses was treated with 1.2 U/ml dispase II (Roche) in phosphate buffered saline, pH 7.2 (PBS). After treatment for 30 min to 1 h the individualised cells were seeded at a concentration of 2×105 cells/ml in EMEM/7% horse serum. Low passages of FSNE cells were used for subsequent experiments. Monocyte-derived macrophages (M) were isolated from peripheral blood mononuclear cells of SPF pigs by culturing monocytes at 4×106 cells/ml for 2 h in Dulbecco’s modified Eagle medium (DMEM), 10% (v/v) porcine serum, 2 mM l-glutamine and 25 mM HEPES as described (Knoetig et al., 1999). The adherent cells were washed once with PBS and cultured in the above medium for at least 72 h to allow differentiation into M (McCullough et al., 1999). 2.2. Viruses CSFV strain Riems, provided by G. Schirrmeier, Riemser Arzneimittel GmbH, Insel Riems, Germany, was passaged once in SK-6 cells. It is referred to as Riems/IVI in the following to differentiate from another Riems strain (referred to as Riems/Giessen) for which the sequence has been deposited (GenBank accession number U45477). CSFV strain Eystrup contained in the serum of an experimentally infected pig and obtained from H.-J. Thiel, Justus-Liebig-Universität, Giessen, Germany, was passaged three times in SK6 cells. 2.3. RNA extraction, reverse transcription and PCR Viral RNA was obtained by Trizol (Invitrogen) extraction of cells infected with the respective viruses and reverse-transcribed using Expand Reverse Transcriptase (Roche Diagnostics) and either of the two following oligonucleotide primers designed on the basis of the sequence of CSFV strain Alfort/187 (Ruggli et al., 1996): PR1 (5 -CCT CAG GTT AGA TGG ATC CTC-3 ) complemen-
D. Mayer et al. / Virus Research 98 (2003) 105–116
tary to nucleotides (nts) 6454–6434, and URSX1 (5 -TTC CTC GAG CCCGGG CCG TTA GGA AAT TAC CTT-3 ). URSX1 is complementary to the 21, 3 -terminal nts of the genome (underlined) and contains 12 additional 5 -terminal nts including an SrfI restriction site (italics). The cDNA was purified on MicroSpin S-400 columns (Amersham Biosciences) and amplified by PCR using either the expand LT PCR kit (Roche Diagnostics) or Pfu Turbo polymerase (Stratagene). PCR products were visualised by agarose gel electrophoresis before extraction and purification with the QIAquick Gel Extraction kit (Qiagen). 2.4. Sequencing and assembly of full-length cDNA clones Fragments obtained by reverse transcription (RT)-PCR were cloned into the pCR-TopoXL vector (Invitrogen). The respective inserts were sequenced with the Thermo SequenaseTM DYEnamic direct cycle sequencing kit (Amersham Biosciences) and analysed on a LI-COR 4200 sequencer using e-Seq and AlignIR software (LI-COR Biosciences). Subclones were assembled to the respective full-length clones termed pEy-37 and pRiems-3 in the low copy number plasmid pACNR1180 (Ruggli et al., 1996) by ligation of appropriate restriction endonuclease fragments and assembly PCR. 2.5. Analysis of 5 and 3 ends of the genome The 5 end was amplified by ligation-anchored PCR essentially as described by Troutt et al. (1992). Briefly, the oligonucleotide PEST2 (Wirz et al., 1993) served as a primer for RT. To the 3 end of the cDNA the 5 -phosphorylated DNA oligonucleotide RT7G (5 -CTA TAG TGA GTC GTA TTA AGA TCT GTC GAC GCG TC-3 ) was ligated. The sense primer LT7G, partially complementary to RT7G (5 -CGC GTC GAC AGA TCT TAA TAC GAC TCA CTA TAG-3 ) and the antisense primer GR1 (5 -AAA CTG CAG CCC AGT TCG GCC GTC-3 ) containing the sequence complementary to nts 95–79 of the genome (underlined) were used to perform 40 cycles of PCR on the extended cDNA. In analogy to the ligation-anchored PCR described above a ligation-anchored RT-PCR was designed to determine the sequence of the 3 end of the viral genome. The oligodeoxynucleotide Ey3 ligext (5 -ATA ACT CTA ACT TCG GAC GCA CGG-3 ) was ligated to the full-length viral RNA and RT was performed with the primer Ey3 ligRT (5 -CCG TGC GTC CGA AGT TAG AGT-3 ), which is partially complementary to Ey3 ligext. The resulting cDNA was subjected to 50 cycles of PCR using the primers ACL12200 (5 -ACC TCA WGT TAC CAC ACT AC-3 , nts 12200–12219 of the genome) and Ey3 ligRT. The respective PCR fragments containing either of the ends of the genome were cloned into pCR-TopoXL and sequenced.
107
2.6. Alignment and phylogenetic analysis of CSFV sequences The following full-length genome sequences of 14 CSFV strains obtained from GenBank were aligned with the sequences of strain Eystrup and Riems/IVI using the GeneWorks package (IntelliGenetics, Mountain View, CA, USA): ALD (accession number D49532), Alfort 187 (X87939), Alfort A19 (U90951), Alfort/Tübingen (J04358), Brescia/IVI (AF091661), Brescia/Lelystad (M31768), CAP (X96550), C strain (Z46258), Glentorf (U45478), GPE- (D42109), HCLV (AF091507), P97 (L49347), Riems/Giessen (U45477), Shimen (AF092448). The PAUP 4.0 program (Sinauer Associates Inc. Publishers, Sunderland, MA, USA) was used to obtain a phylogenetic tree by the neighbour-joining method (Saitou and Nei, 1987) including the Jukes and Cantor correction for multiple base changes (Jukes and Cantor, 1969). To test the reliability of the branches in the tree a bootstrap analysis (1000 replicates) was performed using the same software. For drawing of the tree the TreeView software (Page, 1996) was used.
2.7. In vitro synthesis of viral RNA, transfection of SK-6 cells and virus rescue The cDNA clones pEy-37 and pRiems-3 were linearised with restriction endonuclease SrfI (Stratagene) cleaving exactly at the 3 end of the viral genome. The reactions were extracted with phenol/chloroform and the DNA precipitated with ethanol. Authentic viral RNA was obtained by runoff transcription with the T7 MEGAscript kit (Ambion) from the T7 RNA polymerase promoter contained in the respective clones. After DNase I digestion, transcripts were purified through a MicroSpin S-400 column and quantified photometrically using an Ultrospec 2100 pro UV-Vis Spectrophotometer (Amersham Biosciences). RNA-specific infectivity was measured by an infectious centre assay as described by Mendez et al. (1998). The specific infectivity was expressed as focus forming units (FFU)/g RNA. For transfection of in vitro synthesised RNA, SK-6 cells were washed twice with cold PBS, 0.9 mM CaCl2 , 0.5 mM MgCl2 and resuspended in the same buffer to a density of 2 × 107 cells/ml. One microgram of the RNA was transfected by electroporation using a Gene Pulser (Bio Rad) and a 2 mm cuvette containing 400 l of the cell suspension (8 × 106 cells) by applying two electric pulses (500 F, 200 V, no pulse controller). Cells were allowed to recover for 5 min at room temperature, resuspended in EMEM/7% horse serum and seeded in appropriate cell culture plates or flasks. The medium was replaced after overnight incubation at 37 ◦ C. Virus was rescued from the cells between 48 and 72 h after transfection by two cycles of freeze–thawing. The cell lysates were used as inoculum for virus passage, titration, replication kinetics and experimental infection of pigs.
108
D. Mayer et al. / Virus Research 98 (2003) 105–116
2.8. Virus titration For titration, cells (SK-6, M or FSNE) were infected with 10-fold dilutions of the respective virus. The titre was calculated 48 post infection (p.i.) by staining the cells with the monoclonal antibody (mAb) HC/TC 26 directed against glycoprotein E2 (Greiser-Wilke et al., 1990) in an indirect immunoperoxidase assay (IPA) (Mittelholzer et al., 1997) for SK-6 and FSNE cells or by an indirect immunofluorescence assay (Ruggli et al., 1996) for M. 2.9. Virus replication kinetics For the characterisation of the replication kinetics of the cDNA-derived viruses SK-6 cells seeded in 24-well plates were infected at a multiplicity of infection of 0.1. Cells were incubated for 1 h at 37 ◦ C before washing and incubation in fresh medium. At the indicated times p.i. the respective cell cultures were frozen to stop virus replication and the virus titrated in SK-6 cells.
thrin or biotin; Southern Biotechnology Associates), and streptavidin-spectralred for fluorescence-3 (Southern Biotechnology Associates; Summerfield and McCullough, 1997). For the acquisition of data a FACScan flow cytometer was used and the CellQuest programme for subsequent analysis (both Becton Dickinson, Mountain View, CA, USA). 2.12. Virus isolation and serology For virus isolation sera obtained from infected animals were diluted threefold in EMEM and used to inoculate SK-6 cells. Cell culture supernatants were collected at 48 h p.i. and cells stained for CSFV-specific E2 antigen by IPA. Positive sera were titrated in SK-6 cells. Alternatively, virus contained in serum samples was quantified by measuring the CSFV-specific RNA by real time TaqMan PCR (Hofmann, in press). CSFV-specific serum antibody titres were determined using an E2 capture ELISA (Moser et al., 1996).
2.10. Characterisation of virulence 3. Results SPF pigs of approximately 35 kg bodyweight were infected with 104.0 TCID50 (titrated in SK-6 cells) of CSFV Eystrup, vEy-37 or vRiems-3 per pig or with 107.5 of vEy-Erns RI, respectively. Virus used for inoculation was diluted in 5 ml EMEM and one half of the dose was administered each, intranasally and orally. For each virus to be tested three littermates of SPF pigs kept in separate isolation units were infected. Body temperature and clinical score were daily monitored. Twice a week whole blood was collected for serum preparation, EDTA blood for white blood cell count and for preparation of leukocytes (Summerfield et al., 1998). 2.11. Quantification of peripheral blood leukocytes (PBLs) and identification of B- and T-lymphocytes An aliquot of EDTA blood was diluted in TÜRK’s solution (Merck), and PBLs were counted in a Bürker’s counting chamber. For phenotyping of B- and T-lymphocytes the following mAbs were used (reviewed in Saalmüller, 1996): anti-SWC1 (mAb 11/8/1, kindly provided by Dr. A. Saalmüller, BFAV Tübingen, Germany), anti-SWC3 (mAb 74-22-15, VMRD Inc., Pullmann, WA, USA), anti-SWC8 (mAb MIL3, Serotec), and anti-CD3 (3E8, VMRD). For the identification of B-lymphocytes, a SWC1/SWC8/ SWC3 triple immunofluorescence analysis was performed. B-cells were identified as SWC1- SWC3- SWC8high cells. In a separate immunofluorescence analysis T-lymphocytes were defined CD3+ cells (Summerfield et al., 2001). Indirect mAb labelling for triple immunofluorescence was performed in a three-step procedure, using isotype-specific conjugates (goat anti-mouse IgG, F(ab )2 fragments, conjugated with FITC, phycoery-
3.1. Nucleotide sequence of the CSFV Eystrup and Riems/IVI genome For both CSFV strains, Eystrup and Riems/IVI, the complete consensus sequence was obtained by sequencing at least three individual clones of each fragment generated by three independent RT-PCRs (Fig. 1). Sequencing of the ends of the two genomes revealed that each of the 21 terminal nucleotides of the 5 and the 3 ends were identical for both virus strains as well as for CSFV Alfort/187 (Ruggli et al., 1996). Therefore, corresponding primers designed from the Alfort/187 sequence were used to amplify the terminal fragments of the respective genomes. The complete genomic sequences of CSFV Eystrup and CSFV Riems/IVI were compared at the nucleotide level to a total of 14 sequences of genotypes I and II strains available in GenBank. The phylogenetic tree obtained by the neighbour-joining method is drawn in Fig. 2. Strain Eystrup was found to be most closely related to strain ALD (98.6% nucleotide sequence identity), another highly virulent genotype I strain and most distantly related to strain P97 (85.5%), a moderately virulent strain belonging to genotype II. The sequence we have determined for the strain Riems/IVI shows 99.6% identity with the published sequence for the vaccine strain referred to as Riems/Giessen, whereas the strain P97 again shows the lowest sequence identity. The sequence identity between strains Eystrup and Riems/IVI is 96.2%. The overall length of the genomes of the Eystrup virus (12,301 nt) and the Riems/IVI virus (12,289 nt) differs only in the 3 NTR (234 nt versus 222 nt) whereas the 5 NTR (373 nt) and the open reading frame (11,694 nt) are identical in length. The difference in the 3’ NTRs is due to the
D. Mayer et al. / Virus Research 98 (2003) 105–116
109
vEy-37 genome SrfI CTAACGGCCCGGGC BamHI (6437)
NgoMIV (2440)
T7 promoter genome TACGACTCACTATAGTATAC
SpeI (11867) Assembly PCR
BpuMI (9521)
vRiems-3
BamHI (6437)
NgoMIV (2440)
(A)
(B)
5‘NTR
p7 Npro C Erns E1
E2
NS2
NS3
NS4A NS4B
6
7
3‘NTR NS5A
NS5B
(C)
0
1
2
3
4
5
8
9
10
11
12kb
Fig. 1. Cloning strategy for cDNA clones of CSFV strain Eystrup (A) and strain Riems/IVI (B). Overlapping cDNA fragments were assembled by ligation of appropriate restriction fragments or by assembly PCR as indicated. The T7 RNA polymerase promoter located immediately upstream of the 5 end of the genome as well as the SrfI site (bold) at the 3 end of the genome are only shown for vEy-37. The genome sequences are underlined (A); numbers correspond to the nucleotide position on the CSFV genome. The organisation of the CSFV genome including a scale in kilobases (kb) is depicted in (C). Nontranslated regions (NTR) and viral genes with their respective encoded proteins are indicated.
varying length of the uridine (U)-rich region composed of several poly-U stretches and adenine-uridine (AUn ) motifs (Fig. 3A).
infectivities of the RNAs determined in an infectious centre assay were 6.2 × 106 and 5.9 × 106 FFU/g RNA, respectively.
3.2. Construction of full-length cDNA clones and generation of recombinant virus
3.3. Recombinant vEy-37 is as virulent as the parent CSFV strain Eystrup
Based on the consensus sequences including the termini of the viral genomes, cloning strategies were applied to assemble the respective complete cDNA clones by DNA ligation using suitable restriction endonuclease sites or by assembly PCR (Fig. 1). The clones were designed exactly as described for pA187-1 (Ruggli et al., 1996), i.e. the viral cDNA linked at the 5 end to a T7 RNA polymerase promoter for in vitro transcription of authentic viral RNA was cloned in the low copy number plasmid pACNR1180. At the 3 end of the viral DNA an SrfI restriction site was introduced allowing the generation of authentic viral RNA by runoff transcription. The assembled full-length cDNA plasmid clones were termed pEy-37 and pRiems-3, respectively. Electroporation into SK-6 cells of viral RNA transcribed in vitro gave rise to synthesis of infectious progeny virus. The respective titres were 103.9 TCID50 /ml for the virus vEy-37 derived from pEy-37, and 103.7 TCID50 /ml for the virus vRiems-3 derived from pRiems-3. The specific
The virulence of vEy-37 (Fig. 4A) was compared to that of the parent Eystrup virus (Fig. 4E) in experimental infections of groups of three pigs with 104.0 TCID50 of the respective virus per pig. For both viruses all animals developed severe CSF within 6 days including fever of over 40 ◦ C and severe leukopenia (Fig. 4B and F). The blood of the animals infected with vEy-37 was analysed for T- and B-lymphocytes (Fig. 4C and D). Absolute T- and B-lymphocyte counts dropped to 10–15% within 4 days p.i. All animals showed pronounced central nervous symptoms like staggering and convulsions of the head. One of the vEy-37-infected animals died on day 4 p.i. after blood sampling from the jugular vein (Fig. 4A). Such casualties have been occasionally observed in animals experimentally infected with highly virulent CSFVs after having developed severe thrombocytopenia and leukopenia, as was the case in the respective pig (our unpublished observations). Apart from the signs of acute CSF, necropsy of this animal revealed extended haemorrhages in the throat region. All other animals infected with either
110
D. Mayer et al. / Virus Research 98 (2003) 105–116
Fig. 2. Neighbour-joining phylogenetic tree of full-length CSFV sequences. The tree was constructed by comparison of the genomic sequences of CSFV Eystrup and Riems/IVI with 14 full-length sequences of CSFV deposited in GenBank (see Section 2). The phylogenetic distance between the respective viruses is indicated at the bottom. Bootstrap values above 90% obtained from 1000 replicates are shown at the respective branch points. Highly virulent strains (shaded), moderately virulent strains (framed), and avirulent strains (no symbol) are indicated.
vEy-37or the parent Eystrup strain had to be sacrificed in a moribund state on day 7 p.i. when clinical scores of 16–20 were reached (Fig. 4A and E). 3.4. Recombinant vRiems-3 induces protective immunity in pigs The animals infected with 104.0 TCID50 vRiems-3 did not show any clinical signs at any time of the trial (Fig. 4G). Initially, the PBL count even increased and only slight leukopenia was observed (Fig. 4H). Whereas the absolute T-lymphocyte count did not markedly decrease or even increased (Fig. 4I), B-lymphocyte counts dropped temporarily but recovered on day 7 p.i. (Fig. 4J). All animals developed antibody titres against CSFV between 2 and 3 weeks p.i. (Fig. 4H). To assess whether a protective immunity had been induced a challenge infection with vEy-37 was performed 21 days after inoculation with vRiems-3. No clinical signs were observed after challenge infection (Fig. 4G) but in two animals an increase in the anti-E2 antibody titre indicating a booster effect was recorded (Fig. 4H). PBL counts for
these animals were always within the physiological range (Fig. 4H). 3.5. Erns adaptive mutants of vEy-37 obtained in SK-6 cells replicate to higher titres To assess the genetic stability of vEy-37 rescued from cells transfected with pEy-37-derived RNA, the virus was passaged 10 times in SK-6 cells (vEy-37 VP10). Surprisingly, after two to four passages virus titres were recorded that were approximately 100 times higher when compared to the virus titre before passage. In the following passages, the titres remained stable. RT-PCR on RNA extracted from vEy-37 VP10 using the same primers as for cloning the Eystrup genome was performed, and the resulting PCR fragments covering the entire viral genome were sequenced. To properly determine the length of the poly-U tract localised in the 3 NTR and for later construction of recombinant viruses, the PCR fragments representing this region of the genome were cloned in pCR-TopoXL. Nucleotide sequence analysis revealed two base changes in the Erns gene which
D. Mayer et al. / Virus Research 98 (2003) 105–116
111
Fig. 3. Nucleotide sequence alignment of the poly-uridine tract region located in the 3 NTR and partial amino acid alignment of glycoprotein Erns . Sequences of selected CSFV strains obtained from GenBank were aligned to the sequences of the strains Eystrup, vEy-37 VP10 and Riems/IVI. The varying length of the poly-uridine tract region in the 3 NTR is emphasized (A). Heterogeneity of the Erns amino acid sequence at position 476/477 of the viral polyprotein is marked with bold letters (B).
caused the replacement of amino acid residues Ser/Thr (ST) to Arg/Ile (RI) at positions 476/477 of the viral polyprotein (Fig. 3B). In addition, the aforementioned poly-U tract was elongated due to insertion of between 2 and 4 U (Fig. 3A, three additional U shown). No other mutations were found in the entire genome of the virus that had been passaged 10 times in SK-6 cells. To determine whether the mutant Erns had an effect on the viability and/or the virulence of the virus, the mutation found in vEy-37 VP10 was introduced into pEy-37 resulting in pEy-Erns RI. Synthetic RNA obtained from linearised pEy-Erns RI was transfected into SK-6 cells. Its specific infectivity was similar to that of the RNA obtained from pEy-37 (data not shown). Titration of the progeny virus vEy-Erns RI in SK-6 cells resulted in a titre of 107.5 TCID50 /ml. In contrast, the titre obtained for vEy-37 was only 103.7 TCID50 /ml (Table 1). Titres for virus obtained directly from transfected SK-6 cells were also determined
in M and in FSNE cells. The results listed in Table 1 show that in these cells the titres were similar for the two viruses. Furthermore, viral RNA contained in the extracts of transfected SK-6 cells was quantified by real time RT-PCR. Again, no significant difference was detected for the two viruses (data not shown). These findings suggest that after transfection of the respective RNAs into SK-6 cells Table 1 Titration in different cell types of vEy-37 and vEy-Erns RI obtained from transfected SK-6 cells log TCID50 /ml after titration in
vEy-37 vEy-Erns RI
M
SK-6
FSNE
6.5 6.5
3.7 7.5
5.3 5.5
Numbers indicate mean values from two experiments.
112 D. Mayer et al. / Virus Research 98 (2003) 105–116 Fig. 4. Experimental infection of pigs with cDNA-derived viruses vEy-37 and vRiems-3. Three animals each were infected with either vEy-37 (A–D), vRiems-3 (G–J), or the parent Eystrup virus (E and F) for comparison. Body temperature (closed symbols) and clinical score (open symbols) were recorded daily (A, E and G). Peripheral blood leukocytes (PBL) were counted twice weekly (B, F and H). For pigs infected with either vEy-37 or vRiems-3, B- (D and J) and T-lymphocyte counts (C and I) were determined by FCM analysis. CSFV-specific immunity of pigs inoculated with vRiems-3 was challenged on day 21 p.i. by infection with vEy-37 (G and H; arrows). Antibody titres against viral glycoprotein E2 for these three pigs are drawn. Values above the dashed line are considered positive (H; bars).
D. Mayer et al. / Virus Research 98 (2003) 105–116
113
8
log TCID50/ml
7 6 5 4
vEy-37 vEy-ErnsRI vEy-37 VP10 vRiems-3
3 2 1 0 0
12
22
38
46
hours post infection Fig. 5. Replication kinetics of vEy-37, vEy-37 VP10, vEy-Erns RI and vRiems-3. SK-6 cells seeded in 24-well plates were infected at a multiplicity of infection of 0.01. Virus was harvested at the indicated hours post infection by freeze–thawing of the cultures and titrated in SK-6 cells. The data were obtained in one experiment in which all four viruses were analysed in parallel. Virus titres are shown as log TCID50 /ml. A dashed line indicates the detection limit.
the efficiency of viral replication was similar for the two viruses. The kinetics of viral replication for vEy-37, vEy-Erns RI and vRiems-3 obtained directly from transfected cells as well as for vEy-37 VP10 were determined in SK-6 cells (Fig. 5). The results show similar growth characteristics for vEy-37 VP10 and the corresponding reconstructed virus vEy-Erns RI. These viruses that are of the Erns RI-type clearly grew more efficiently when compared to vEy-37 and vRiems-3, which are of the Erns ST-type and showed a pronounced delay in replication. Final titres reached at 46 h p.i. were 106.9 and 106.5 TCID50 /ml for the Erns mutants vEy-Erns RI and vEy-37 VP10, respectively. For vEy-37 and vRiems-3 corresponding values of 105.7 and 105.1 TCID50 /ml were recorded.
3.6. Assessment of virulence of vEy-Erns RI To assess the virulence of vEy-Erns RI three pigs were infected each with 106.5 TCID50 of the virus obtained from transfected SK-6 cells and titrated in M. This dosage corresponds to that used in the experimental infection with vEy-37 (Fig. 4A–D), when M instead of SK-6 cells were used to determine the titre (see also Table 1). All three animals developed severe CSF with clinical scores of up to 17 around day 9 (Fig. 6A). One animal died after blood sampling on day 4 p.i. Surprisingly, the other two animals recovered from the disease, but one of them remained in a wasting state until final slaughtering on day 35 p.i. Similar to animals infected with vEy-37, PBL counts dropped but recovered quickly in the two surviving animals (Fig. 6B). 35 x 106
(A)
41.0 25
39.0
20 38.0
15
37.0
10
36.0
5
35.0
0 -3
0
3
6
9
12 15 18 21 24 27 30 33
106 PBL / ml blood
30
40.0
clinical score
body temperature ˚C
42.0
(B)
20 18 16 14 12 10 8 6 4 2 0
160 120 80 40
antibody titre (% reactivity)
vEy-ErnsRI
0
0
4
7
11
14
18
21
25
28
32
days post infection Fig. 6. Experimental infection of pigs with vEy-Erns RI. Three animals each were infected with vEy-Erns RI. Clinical scores (open symbols) and rectal temperature (closed symbols) were recorded daily (A). Peripheral blood leukocyte (PBL) counts were determined twice weekly. Antibody titres against viral glycoprotein E2 of the two surviving pigs are presented as bars. Values above the dashed line are considered positive (B).
114
D. Mayer et al. / Virus Research 98 (2003) 105–116
One animal showed a very strong increase of blood lymphocytes on day 21 p.i. which probably was due to bacterial superinfection of the skin, since it developed generalised pyodermia. E2 antibody titres scored positive on day 11 p.i. in both surviving animals (Fig. 6B).
4. Discussion To establish authentic cDNA clones of two strains representing a highly virulent as well as an avirulent CSFV, the consensus sequence was determined for the strain Eystrup and for the vaccine strain Riems/IVI. Comparative phylogenetic analysis including the complete genomic sequences of a total of 16 CSFV strains of varying virulence did not reveal any genetic clustering related to virulence (Fig. 2). Also, focusing on the 3 NTR, where an extended poly-U tract has been reported for several vaccine strains, provided no evidence for a grouping of virulent and avirulent strains confirming published data (Bjorklund et al., 1998). Interestingly, Riems/IVI was found to have a shorter U-rich region than any of the other strains for which the complete sequence is known (see examples in Fig. 3A). It lacks 6 of the AUn motifs found in the other strains, yet it has a U26 sequence interrupted by one single cytidine. A similar motif is found in the 3 NTR of the C-strain (U18 interrupted by two cytidines). After experimental infection of pigs, the recombinant virus vEy-37 proved to be as virulent as the parent Eystrup virus strain (Fig. 4A–F). All three animals infected with vEy-37 were moribund within 8 days after oronasal infection (Fig. 4A). Previously, virulent viruses rescued from molecular clones have been reported for the strains CSFV Alfort/Tübingen (Meyers et al., 1999) and Brescia (Hulst et al., 2001). Although these viruses caused CSF they did not meet the main criterion for a highly virulent strain representing the ability to induce lethal disease within less than 10 days after infection (van Oirschot, 1988). The only molecularly cloned CSFV, vA187-1, we had available so far was derived from the strain Alfort/187 (Ruggli et al., 1996). It consistently caused clinical signs but no lethal disease in SPF pigs (Mittelholzer et al., 2000). To obtain a recombinant CSFV representing the opposite phenotype of vEy-37 with regard to virulence, a cDNA clone of the vaccine strain Riems/IVI was established. The virus derived from this clone, vRiems-3, did not cause any signs of disease but induced a distinct antibody response and complete protection from disease after challenge with vEy-37 (Fig. 4). Similarly, deSmit et al. (2000) have reported a cDNA clone derived from the C-strain, an established CSFV vaccine, which also retained its phenotypic characteristics including absence of virulence and immunogenic properties. Although vEy-37 and vRiems-3 display completely opposite phenotypes, depletion of B-lymphocytes occurred in animals infected with either of the two viruses, whereas T-lymphocytes seemed not to be affected in animals infected
with vRiems-3 (Fig. 4). Summerfield et al. (2001) reported for both, the highly virulent CSFV strain Brescia and for the moderately virulent strain Uelzen, that B- as well as T-lymphocytes were rapidly depleted before viraemia was detected in infected pigs. For the moderately virulent CSFV strain Alfort it was reported that depletion occurred predominantly for B-lymphocytes (Susa et al., 1992). These and our findings suggest that B-lymphocytes might be very vulnerable in CSFV-infection, even when a vaccine strain is used (Fig. 4J). Furthermore, the fact that viraemia was never observed in the animals inoculated with vRiems-3 supports the assumption that depletion of B-lymphocytes is not due to their infection with CSFV (Summerfield et al., 2001). Passage of vEy-37 in SK-6 cells led to a significant increase in virus titre. Sequence analysis of the entire genome of the virus obtained after 10 passages (vEy-37 VP10) revealed mutations at only two locations. One was an insertion of between 2 and 4 uridines in the 3 NTR (Fig. 3A), the other a mutation of 2 nts in the Erns coding sequence which caused a shift from ST to RI at position 476/477 in the Erns glycoprotein (Fig. 3B). By introduction of this double amino acid change into pEy-37 the virus vEy-Erns RI was generated. Titration in SK-6 cells of vEy-Erns RI recovered from SK-6 cells transfected with the respective RNA resulted in a titer that was almost 4 log units higher when compared to that of vEy-37 (Table 1). Analysis of the kinetics of virus replication in SK-6 cells revealed that vEy-37 VP10 and vEy-Erns RI grew faster and to higher titres than vEy-37 and vRiems-3, thus confirming the advantage of the Erns RI-mutants in SK-6 cells (Fig. 5). Hulst et al. (2000) reported the same change of a Ser residue to an Arg residue at position 476 of the viral polyprotein after passage of cDNA-derived CSFV Brescia in SK-6 cells. In analogy to our findings, this Erns mutant also grew to higher titres in SK-6 cells. These authors showed that the amino acid change in the Erns glycoprotein from Ser to Arg resulted in a newly acquired capability of the virus to use membrane-associated heparan sulphate (HS) as receptor on SK-6 cells. Although M are supposed to express HS on their cell surface, this phenomenon was not observed in the latter cells, indicating that infection of M with CSFV proceeds by an HS-independent mechanism (Hulst et al., 2001). Titration in porcine M and FSNE cells of vEy-37 and vEy-Erns RI obtained after tranfection of SK-6 cells (Table 1) and quantification of the respective viral RNA by real time RT-PCR indicated, that similar amounts of progeny virus were produced in SK-6 cells for either of the two virus variants. Considering the data of Hulst et al. (2000), this suggests that the increase in replication efficiency we observed for the mutant vEy-Erns RI in SK-6 cells is due to the use of HS as cell surface receptor rather than to impaired replication of vEy-37. The virulence of the Erns mutant vEy-Erns RI was assessed by experimental infection of SPF pigs (Fig. 6). The animals developed severe CSF but two of them recovered. This is in accordance to infections with a molecular clone of CSFV
D. Mayer et al. / Virus Research 98 (2003) 105–116
Brescia, where one of three pigs infected with the Erns R mutant survived, whereas the Erns S wt virus killed all animals (Hulst et al., 2001). However, in the latter experiment the inoculated dose for both viruses was based on SK-6 cells titres, and thus probably 100 times less pig infectious doses were used for animals infected with Erns R mutant compared to the Erns S wt virus. In our experiment with the Eystrup RI-mutant, we observed the slightly attenuated phenotype even though infectious doses calculated on the basis of M titres were used, which probably better mirrors the situation in an animal infection. We conclude that the mutation from ST to RI in the Erns glycoprotein of the highly virulent CSFV strain Eystrup has only a weak attenuating effect. The fact that the vaccine strain Riems/IVI is of the Erns ST type but is completely avirulent (Figs. 3 and 4), also supports the assumption that this mutation in the Erns gene does not contribute to the attenuation and therefore is certainly not a major determinant of virulence in CSFV. The antibody response induced by vRiems-3, which is derived from a classical vaccine strain, was detectable in one animal on day 14 p.i. and in the others on day 21 p.i., whereas sera of the surviving animals infected with vEy-Erns RI scored positive already on day 11 p.i. (Fig. 5A). Obviously, a virulent CSFV like vEy-Erns RI causes viraemia and induces an early specific antibody response in surviving animals. In summary, we have generated a cDNA clone of a highly virulent CSFV strain, which maintains its phenotype. We have also established a cDNA clone of the vaccine strain Riems/IVI and shown that the derived virus is able to protect pigs from CSF. These two cDNA clones provide the basis for the construction of chimeric viruses and will be useful tools to elucidate the genetic determinants of virulence in CSFV which remain to be established.
Acknowledgements We thank H.-J. Thiel and G. Schirrmeier for providing virus strains, A. Summerfield and M. Horn for the help with the FCM analysis. This work was supported by the Swiss Federal Veterinary Office and the Swiss National Science Foundation (grant 31-56719.99). References Bjorklund, H.V., Stadejek, T., Vilcek, S., Belak, S., 1998. Molecular characterisation of the 3 noncoding region of classical swine fever virus vaccine strains. Virus Genes 16, 307–312. deSmit, A.J., vanGennip, H.G.P., Miedema, G.K.W., vanRijn, P.A., Terpstra, C., Moormann, R.J.M., 2000. Recombinant classical swine fever (CSF) viruses derived from the Chinese vaccine strain (C-strain) of CSF virus retain their avirulent and immunogenic characteristics. Vaccine 18, 2351–2358. Dahle, J., Liess, B., 1995. Comparative study with cloned classical swine fever virus strains Alfort and Glentorf: clinical, pathological, virological and serological findings in weaner pigs. Wien. Tierärztl. Monatsschr. 62, 1–6.
115
Depner, K.R., Hinrichs, U., Bickhardt, K., Greiser-Wilke, I., Pohlenz, J., Moennig, V., Liess, B., 1997. Influence of breed-related factors on the course of classical swine fever virus infection. Vet. Rec. 140, 506–507. Greiser-Wilke, I., Moennig, V., Coulibaly, C.O., Dahle, J., Leder, L., Liess, B., 1990. Identification of conserved epitopes on a hog cholera virus protein. Arch. Virol. 111, 213–225. Hofmann, M.A. Construction of an infectious chimeric classical swine fever virus containing the 5’UTR of bovine viral diarrhea virus, and its application as a universal internal positive control in real-time RT-PCR. J. Virol. Methods, in press. Hulst, M.M., vanGennip, H.G.P., Moormann, R.J.M., 2000. Passage of classical swine fever virus in cultured swine kidney cells selects virus variants that bind to heparan sulphate due to a single amino acid change in envelope protein E-rns. J. Virol. 74, 9553–9561. Hulst, M.M., vanGennip, H.G.P., Vlot, A.C., Schooten, E., deSmit, A.J., Moormann, R.J.M., 2001. Interaction of classical swine fever virus with membrane-associated heparan sulphate: role for virus replication in vivo and virulence. J. Virol. 75, 9585–9595. Jukes, T.H., Cantor, C.R., 1969. Evolution of protein molecules. In: Munro, H.N. (Ed.), Mammalian Protein Metabolism. Academic Press, New York, pp. 21–132. Kasza, L., Shadduck, J.A., Christofinis, G.J., 1972. Establishment, viral susceptibility and biological characteristics of a swine kidney cell line SK-6. Res. Vet. Sci 13, 46–51. Klimstra, W.B., Ryman, K.D., Johnston, R.E., 1998. Adaptation of Sindbis virus to BHK cells selects for use of heparan sulphate as an attachment receptor. J. Virol. 72, 7357–7366. Knoetig, S.M., Summerfield, A., Spagnuolo-Weaver, M., McCullough, K.C., 1999. Immunopathogenesis of classical swine fever: role of monocytic cells. Immunology 97, 359–366. Mayer, D., Hofmann, M.A., Tratschin, J.D., 2003. Attenuation of classical swine fever virus by deletion of the viral Npro gene. Vaccine, in press. McCullough, K.C., Basta, S., Knoetig, S., Gerber, H., Schaffner, R., Kim, Y.B., Saalmuller, A., Summerfield, A., 1999. Intermediate stages in monocyte-macrophage differentiation modulate phenotype and susceptibility to virus infection. Immunology 98, 203–212. Mendez, E., Ruggli, N., Collett, M.S., Rice, C.M., 1998. Infectious bovine viral diarrhea virus (strain NADL) RNA from stable cDNA clones: a cellular insert determines NS3 production and viral cytopathogenicity. J. Virol. 72, 4737–4745. Meyers, G., Thiel, H.J., Rümenapf, T., 1996. Classical swine fever virus: recovery of infectious viruses from cDNA constructs and generation of recombinant cytopathogenic defective interfering particles. J. Virol. 70, 1588–1595. Meyers, G., Saalmüller, A., Büttner, M., 1999. Mutations abrogating the RNase activity in glycoprotein E(rns) of the pestivirus classical swine fever virus lead to virus attenuation. J. Virol. 73, 10224–10235. Mittelholzer, C., Moser, C., Tratschin, J.D., Hofmann, M.A., 1997. Generation of cytopathogenic subgenomic RNA of classical swine fever virus in persistently infected porcine cell lines. Virus Res. 51, 125– 137. Mittelholzer, C., Moser, C., Tratschin, J.D., Hofmann, M.A., 2000. Analysis of classical swine fever virus replication kinetics allows differentiation of highly virulent from avirulent strains. Vet. Microbiol. 74, 293–308. Moennig, V., 2000. Introduction to classical swine fever: virus, disease and control policy. Vet. Microbiol. 73, 93–102. Moormann, R.J., van Gennip, H.G., Miedema, G.K., Hulst, M.M., van Rijn, P.A., 1996. Infectious RNA transcribed from an engineered full-length cDNA template of the genome of a pestivirus. J. Virol. 70, 763–770. Moser, C., Ruggli, N., Tratschin, J.D., Hofmann, M.A., 1996. Detection of antibodies against classical swine fever virus in swine sera by indirect ELISA using recombinant envelope glycoprotein E2. Vet. Microbiol. 51, 41–53. Page, R.D.M., 1996. TreeView: an application to display phylogenetic trees on personal computers. Comput. Appl. Biosci. 12, 357–358.
116
D. Mayer et al. / Virus Research 98 (2003) 105–116
Ruggli, N., Tratschin, J.D., Mittelholzer, C., Hofmann, M.A., 1996. Nucleotide sequence of classical swine fever virus strain Alfort/187 and transcription of infectious RNA from stably cloned full-length cDNA. J. Virol. 70, 3478–3487. Ruggli, N., Tratschin, J.D., Schweizer, M., McCullough, K.C., Hofmann, M.A., Summerfield, A., 2003. Classical swine fever virus interferes with cellular antiviral defense: evidence for a novel function of Npro . J. Virol. 77, 7645–7654. Sa-Carvalho, D., Rieder, E., Baxt, B., Rodarte, R., Tanuri, A., Mason, P.W., 1997. Tissue culture adaptation of foot-and-mouth disease virus selects viruses that bind to heparin and are attenuated in cattle. J. Virol. 71, 5115–5123. Saalmüller, A., 1996. Characterisation of swine leukocyte differentiation antigens. Immunol. Today 17, 352–354. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. 4, 406–409. Summerfield, A., McCullough, K.C., 1997. Porcine bone marrow myeloid cells: phenotype and adhesion molecule expression. J. Leukoc. Biol. 62, 176–185. Summerfield, A., Knoetig, S.M., McCullough, K.C., 1998. Lymphocyte apoptosis during classical swine fever: implication of activation-induced cell death. J. Virol. 72, 1853–1861. Summerfield, A., McNeilly, F., Walker, I., Allan, G., Knoetig, S.M., McCullough, K.C., 2001. Depletion of CD4(+) and CD8(high+) T-cells
before the onset of viraemia during classical swine fever. Vet. Immunol. Immunopathol. 78, 3–19. Susa, M., Konig, M., Saalmuller, A., Reddehase, M.J., Thiel, H.J., 1992. Pathogenesis of classical swine fever: B-lymphocyte deficiency caused by hog cholera virus. J. Virol. 66, 1171–1175. Troutt, A.B., McHeyzer-Williams, M.G., Pulendran, B., Nossal, G.J., 1992. Ligation-anchored PCR: a simple amplification technique with single-sided specificity. Proc. Natl. Acad. Sci. U.S.A. 89, 9823– 9825. van Oirschot, J.T., 1988. Description of the virus infection. In: Liess, B. (Ed.), Classical swine fever and related viral infections. Martinus Nijhoff Publishing, Boston, Dordrecht, Lancaster, pp. 1–25. van Oirschot, J.T., 1994. Hog cholera virus. In: Webster, R.G., Granoff, A. (Eds.), Encyclopedia of Virology. Academic Press, London, San Diego, pp. 649–654. van Regenmortel, M.H.V., Fauquet, C.M., Bishop, D.H.L., Carstens, E.B., Estes, M.K., Lemon, S.M., Maniloff, J., Mayo, M.A., McGeoch, D.J., Pringle, C.R., Wickner, R.B., 2000. Virus Taxonomy. The Classification and Nomenclature of Viruses. The Seventh Report of the International Committee on Taxonomy of Viruses. Academic Press, San Diego, 1162 pp. Wirz, B., Tratschin, J.D., Muller, H.K., Mitchell, D.B., 1993. Detection of hog cholera virus and differentiation from other pestiviruses by polymerase chain reaction. J. Clin. Microbiol. 31, 1148–1154.