Establishment and controlled differentiation of neural crest stem cell lines using conditional transgenesis

r 2007, Copyright the Authors Differentiation (2007) 75:580–591 DOI: 10.1111/j.1432-0436.2007.00164.x Journal compilation r 2007, International Society of Differentiation

OR IGI N A L A R T IC L E

Jochen Maurer . Sebastian Fuchs . Richard Ja¨ger . Bodo Kurz . Lukas Sommer . Hubert Schorle

Establishment and controlled differentiation of neural crest stem cell lines using conditional transgenesis

Received July 12, 2006; accepted in revised form December 24, 2006

Abstract Murine neural crest stem cells (NCSCs) are a multipotent transient population of stem cells. After being formed during early embryogenesis as a consequence of neurulation at the apical neural fold, the cells rapidly disperse throughout the embryo, migrating along specific pathways and differentiating into a wide variety of cell types. In vitro the multipotency is lost rapidly, making it difficult to study differentiation potential as well as cell fate decisions. Using a transgenic mouse line, allowing for spatio-temporal control of the transforming c-myc oncogene, we derived a cell line (JoMa1), which expressed NCSC markers in a transgene-activity dependent manner. JoMa1 cells express early NCSC markers and can be instructed to differentiate into neurons, glia, smooth muscle cells, melanocytes, and also chondrocytes. A cell-line, clonally derived from JoMa1 culture, termed JoMa1.3 showed identical behavior and was studied in more detail. This

system therefore represents a powerful tool to study NCSC biology and signaling pathways. We observed that when proliferative and differentiation stimuli were given, enhanced cell death could be detected, suggesting that the two signals are incompatible in the cellular context. However, the cells regain their differentiation potential after inactivation of c-MycERT. In summary, we have established a system, which allows for the biochemical analysis of the molecular pathways governing NCSC biology. In addition, we should be able to obtain NCSC lines from crossing the c-MycERT mice with mice harboring mutations affecting neural crest development enabling further insight into genetic pathways controlling neural crest differentiation.

. ) Jochen Maurer
Richard Ja¨ger
Hubert Schorle (* Department of Developmental Pathology Institute for Pathology University of Bonn Medical School Sigmund-Freud-Strasse 25 53127 Bonn, Germany Tel: 149 228 287 6342 Fax: 149 228 287 9757 E-mail: [email protected]

Introduction

Sebastian Fuchs
Lukas Sommer Institute of Cell Biology Swiss Federal Institute of Technology ETH-Ho¨nggerberg HPM E38 CH-8093 Zu¨rich, Switzerland Bodo Kurz Anatomisches Institut, Christian-Albrechts-Universita¨t zu Kiel Olshausenstr 40 24098 Kiel, Germany

Key words neural crest stem cells
c-MycERT
multipotent
JoMa1
JoMa1.3

The neural crest (NC) is a unique feature of vertebrate life. Initially a small population of cells, migrating out of the neural tube as a consequence of neurulation at the apical neural fold the NC cells undergo extensive migration to reach their target tissues and morphological changes to generate a wide variety of phenotypes (for review, see Bronner-Fraser, 1994). Multipotent NC progenitor cells were shown to be the origin of all the phenotypically distinct cells derived from the NC in vitro (Sieber-Blum and Cohen, 1980; Baroffio et al., 1988; Stemple and Anderson, 1992; Ito et al., 1993) and in vivo (Bronner-Fraser and Fraser, 1988, 1989, 1991). It was shown by several studies that such multipotent precursor cells (Stemple and Anderson, 1992; Morrison et al., 1999) as well as post-migratory NC stem cells (NCSCs) (Bixby et al., 2002; Kruger et al., 2002;

581

Trentin et al., 2004) have self-renewal capacity, suggesting that they are stem cells. In mice, NCSCs are defined by expression of two markers: p75 (low-affinity nerve growth factor receptor) and the transcription factor Sox10 (Stemple and Anderson, 1992; Rao and Anderson, 1997; Paratore et al., 2001; Kim et al., 2003). Cells expressing both markers have the potential to differentiate into various cell types in vivo. It is known that the NC generates smooth muscle cells, chromaffine cells, cells of the glia and neuronal lineage as well as melanocytes, chondrocytes, and bone cells in vivo (Anderson et al., 1997; Dorsky et al., 2000; Sieber-Blum, 2000; Dupin et al., 2001). In vitro NC cells were shown to differentiate along a specific pathway, that is, the neuronal lineage when certain extrinsic cues were applied. Bone morphogenetic protein 2 (BMP2) was shown to induce neurogenesis in culture, glial growth factor (GGF) drives the cells into glial, transforming growth factor-b (TGFb) into smooth muscle differentiation (Shah et al., 1994, 1996). Several groups published data on melanocyte differentiation of NC cells (Reid et al., 1996; Dupin et al., 2000; Takano et al., 2002) and demonstrated that Endothelin 3 is an essential factor in that pathway (Lahav et al., 1996, 1998). Recent work showed, that chondrogenesis can also be induced in trunk NC cells (McGonnell and Graham, 2002; Ido and Ito, 2006) as does our study presented here. In vivo and in vitro NC cells loose their self renewal and pluripotent characteristics very rapidly (Lo and Anderson, 1995). In order to overcome this obstacle retroviral transduction of a transforming oncogene has been shown to result in an immortalized murine NC cell line, named MONC-1 (Rao and Anderson, 1997). While the MONC-1 line has been used for NC studies (Sommer et al., 1995; Jain et al., 1998; Chen and Lechleider, 2004), it has been noted that higher passages of these cells are unstable (Rao and Anderson, 1997). Furthermore, the protocol used (retroviral transduction) for primary NC cells is tedious and has not been applied on further mouse models. In addition, MONC1 keeps expressing v-myc proto-oncogen in a constitutive fashion even during differentiation—a fact that might eventually interfere with instructive differentiation signals. Here we show a strategy which was successful in generating an immortalized NCSC line using a transgenic mouse (ROSADneo; Ja¨ger et al., 2004) expressing a conditional 4-OHT (Tamoxifen) inducible allele of c-Myc (c-MycERT; Pelengaris et al., 1999; Rudolph et al., 2000). Using this approach, we have isolated NCSC lines, which express p75 and Sox10 stem cell markers and proliferate robustly as long as c-MycERT is active in a 4-OHT dependant manner. One line named JoMa1 has been kept over 42 passages (2.5 years) in culture and could be differentiated into neurons, glia, melanocytes, smooth muscle cells,

and chondrocytes in response to instructive signals in the media and/or by changing the substrate. A clonally derived cell line termed JoMa1.3 showed identical behavior. These lines will be useful in further deciphering the molecular pathways governing NC cell differentiation. In addition the transgenic line used can be bred into other genetic backgrounds addressing loss-or gainof-function questions related to NC biology.

Methods NC culture medium (NCC-medium) In all experiments, a modification of the medium described by Stemple and Anderson (1992) was used. Dulbecco’s modified Eagle’s medium (DMEM) (4,500 mg/ml Glucose, L-Glutamin, Pyruvate): Ham’s F12 (1:1) was supplemented with: 1% N2-Supplement (Invitrogen, Karlsruhe, Germany), 2% B27-Supplement (Invitrogen), 10 ng/ml EGF (Upstate Biotech, Lake Placid, NY), 1 ng/ml FGF (Upstate Biotech), 100 U/ml Penicilin–Streptomycin (Invitrogen) and 10% Chick-Embryo-Extract (Stemple and Anderson, 1992). For immortalization conditions 200 nM 4-OHT (Sigma-Aldrich, Taufkirchen, Germany) was added to NCC-medium. NCCs To establish primary NCCS embryos of ROSADneo mice (Ja¨ger et al., 2004) were killed. Trunk portions of neural tubes from individual embryos age E8.75 were prepared as previously published (Huszar et al., 1991). Routine culture of NC cells NCCs were grown on cell culture dishes coated with fibronectin. On NCSC cultures NCC-medium supplemented with 200 nm 4-OHT was changed daily. Cells were passaged after 3–4 days in culture when 70% confluence was reached (4  106 cells/10 cm dish). Cells were washed twice with phosphate-buffered saline (PBS) and incubated with 0.25% Trypsin/ethylenediamine-tetra-acetic acid at 371C for 3 min. Digest was stopped by adding equi-volume of DMEM/fetal calf serum (FCS). Cells were centrifuged at 800  g for 3 min using no brakes when stopping. Cells were then resuspended in NCC-medium and plated onto fibronectin-coated dishes (10 cm plates with 2  106 cells). Generation of neurons, glia, and smooth muscle cells Cells were trypsinized and plated at 30% confluency onto dishes sequentially coated with poly-D-Lysin (1 mg/ml, Sigma-Aldrich) for 30 sec at room temperature, air-dried and washed with sterile H2O and fibronectin (1 mg/ml) for 20 sec at room temperature. Cells were fed with NCC-medium for 24 hr, thereafter differentiation specific supplements were added. BMP2 (50 ng/ml, R&D, Abingdon, UK) was given to induce neuronal differentiation. Glial differentiation was induced by adding GGF (1 nM, R&D). Differentiation into smooth muscle cells was achieved by administering TGFb (1 ng/ml, R&D) to the NCC-medium. Cells were assayed for differentiation specific markers after 6 days (BMP2, GGF, and TGFb) in culture. RNA was extracted for reverse transcription-polymerase chain reaction (RT-PCR) analysis. Generation of melanocytes To generate melanocytes JoMa1 cells were plated onto fibronectincoated dishes. NCC-medium with reduced CEE (2%) but supple-

582 mented with 10% FCS and 100 nM Endothelin 3 (Sigma-Aldrich) was used. Medium was changed every other day. After 10 days in culture cells were assayed for melanocyte differentiation by DOPA reaction (Hirobe, 1995) and RNA was isolated for RT-PCR analysis. Generation of chondrocytes To induce chondrogenic differentiation a protocol described by Scherer et al. (2004) was used. Briefly, 1  106 JoMa1 cells were centrifuged with 800  g for 3 min. Pelleted cells were fed with DMEM, 10% FCS, 100 U/ml Penicilin–Streptomycin, 100 ng/ml ascorbic acid, 10 mg/ml, TGFb, and 0.1 mMol Dexamethasone (all three from Sigma-Aldrich) to induce chondrogenesis. Change of medium was done every third day. RNA of cultures was isolated after 21 days and used for RT-PCR. Cultures were fixed after 3 weeks and chondrogenic differentiation was assessed by immunohistochemistry. Genotyping After dissection, remaining tissue was collected, lysed and DNA was extracted as described (Werling and Schorle, 2002). Genotyping was performed with PCR detecting the ROSADneo allele (Ja¨ger et al., 2004) primers (Proligo, Sigma-Aldrich, Munich, Germany) used for genotyping: wt1s (CTCCCAAAGTCGCTCTGAGTTGTTA), SA1as (GACATCATCAAGGAAACCCTGGACT), wt1as (CCC ATTTTCCTTATTTGCCCCTG GACT). PCR-protocol: 941C 2 min; (941C 45 sec, 601C 30 sec, 721C 30 sec)  35. Cell cultures were tested by RT-PCR. RNA was extracted using NucleoSpin II Kit (Macherey-Nagel, Du¨ren, Germany). For cDNA synthesis Cloned-AMV first strand synthesis kit from Invitrogen was used. A list of the genes tested and the corresponding primers and PCR programs is shown below.

Glia marker: GFAPfor (ATGCCACGTTTCTCCTTGTC) GFAPrev (ATCTTGGAGCTTCTGCCTCA) Smooth muscle marker: Calponinfor (GAAATACGACCATCAGCGGG) Calponinrev (CCAGTTTGGGATCATAGAGG) g-actinfor (GGCTTTGCAGGAGATGATGC) g-actinrev (GAGGTAGTCTGTGAGATCCC) Melanocyte marker: Tyrfor1 (AGCATGCACAATGCCTTACA) Tyrrev1 (GAGCGGTATGAAAGGAACCA) Chondrocyte marker: Col2a1for (TTCTGCAACATGGAGACAGG) Col2a1rev (GCTGTTCTTGCAGTGGTAGG) Sox9for (TGAACGCCTTCATGGTGTGG) Sox9rev (GTTCTTCACCGACTTCCTCC) b-actin-Primer: b-actinfor (CCATCCTGCGTCTGGACCTG) b-actinrev (GTAACAGTCCGCCTAGAAGC) GAPDH-Primer: G3PDHfor (GTGAAGGTCGGTGTGAACG) G3PDHrev (GGTGAAGACACCAGTAGACTC-3) All Primers were used under standard PCR conditions (941C 2 min; [941C 45 sec, 601C 30 sec, 721C 60 sec]  35 cycles). Immunohistochemistry A complete list of antibodies used in this study is given in Table 1.

NCSC-marker: Snailfor (GCCCTGCATCTGTAAGGTGT) Snailrev (TGTCCTGGATGACAGAACCA) Slugfor (GGAGAGACTGCAGCCCAAGC) Slugrev (GTGTGCCACACAGCAGCCAG) Sox10for (CCCACACTACACCGACCAG) Sox10rev (GTCGTATATACTGGCTGCTCCC) P75for (ATGGATCACAAGGTCTACCCC) P75rev (GGAGCAATAGACAGGAATGAGG) Neuronal marker: Nefhfor (GCAGCCAAAGTGAACACAGA) Nefhrev (CCATCTCCCACTTGGTGTTT) Mash1for1 (TTGAACTCTATGGCGGGTTC) Mash1rev1 (GGGCTTAGGTTCAGACACCA)

Apoptosis assay by fluorescence-activated cell sorting (FACS) analysis To analyze cell death by FACS the Annexin V-PE Apoptosis Detection Kit I from BD Pharmingen (Cat.: 559763, Heidelburg, Germany) was used according to manufacturers instructions.

Results In order to establish NCCs , murine neural tubes had to be extracted at embryonic day 8.75. Mice heterozygous

Table 1 Antibodies used for identification of neural crest cells and cell lines Antibody name

Source

Generated in species

Antigen recognized

Cell type recognized

p75 (AB1554) Sox10

Chemicon M. Wegner

Rabbit Mouse

p75 nerve growth factor receptor

GFAP (Z0034) S100 (Z0311) SMA (A2547) NF145 (AB1987) Col2 (AB8887) c-myc (N-262)

Dako Dako Sigma Chemicon Chemicon Santa Cruz

Rabbit Rabbit Mouse Rabbit Chicken Rabbit

Glial fibrillary acid protein S100 A and B Smooth muscle actin Neurofilament 145 kD Collagen type II Human c-myc

Neuronal precursors, NCSCs Migratory, postmigratory NCSCs and glia Schwann, glia Glia, Schwann Smooth muscle cells Neuron Chondrocytes Transformed cell line

NCSC, neural crest stem cell. Chemicon/Millipore, Schwalbach, Germany; Dako Deutschland, Hamburg, Germany; Sigma-Aldrich, Munich, Germany; Santa Cruz Biotechnology, Heidelberg, Germany.

583

A

B

1

2

3

4

5 MycER c-Myc

40

passages

50

Gel

JoMa1

30

C 20

1

2

3

4 cyclinD2

10

18S

1 wt

het

hom 28S

Fig. 1 (A) Neural crest cultures (NCCs) were initiated and propagated with 4-OHT present. Number of passages is indicated in the graph. Each dot represents an individual culture. Wild-type cultures (wt) could be passaged only once before they seized to proliferate (n 5 7). Heterozygous cultures (het) could be passaged between three and eight times before they seized to proliferate (n 5 6). Cultures of homozygous (hom) cells could be passaged several times (up to date of submission) (n 5 14). Lower passage homozygous cell lines were frozen and do not represent cultures that seized to proliferate. Filled circles represent cultures that seized to proliferate; open circles mark cultures that were frozen at the passages indicated and did not stop proliferating. (B) Nuclear localization of MycERT is lost upon 4-OHT withdrawal. Western Blot of nuclear extracts from JoMa1 cells at different timepoints with and without 4-OHT. Lane (1), MycERT protein is strongly expressed in the nuclear fraction of protein extracts from JoMa1 cells with 4-OHT

present. Lane (2 and 3), JoMa1 cells without 4-OHT for 3 days in NCC-medium (2) and in NCC-medium1transforming growth factor-b (TGFb) (3). Lane (4 and 5), JoMa1 cells without 4-OHT for 5 days in NCC-medium (4) and in NCC-medium1TGFb (5). In all lanes, Endogenous c-Myc is detectable in comparable amounts. Below, Comassie staining of the sodium dodecyl sulfate-polyacrylamide gel electrophoresis indicating equal amount of protein extract in all lanes. (C) CyclinD2 level is reduced in JoMa1 cells upon withdrawal of 4-OHT. Northern Blot showing level of CyclinD2 RNA in JoMa1 cells at different timepoints with and without 4-OHT. Lane (1), CyclinD2 expression in JoMa1 cells under 4-OHT conditions. Lane (2 and 3), cells 3 days without 4-OHT in NCC-medium (2) and NCC-medium1TGFb (3). Lane (4) Cells for 5 days in NCC-medium without 4-OHT. Below: photograph of the agarose gel is shown to verify equal amounts of RNA loaded.

for the ROSADneo allele were mated and neural tubes from individual embryos were dissected at E8.75 and put into culture (see ‘‘Materials and methods’’ for detailed description). Genotyping identified wild-type cultures and cultures either carrying one (heterozygous) or two (homozygous) alleles of the c-MycERT transgene. Neural tubes were removed after 48 hr, when primary NC cells had been migrating out onto the culture dish. Medium was switched to NCC-medium, the transgene was induced by supplementing medium with 4-OHT. Cultures were passaged when cells reached 70% confluency. As shown in Figure 1A cultures with cells homozygous for the MycERT allele could be passaged 42 times (up to date of publication). In contrast cells carrying one allele of MycERT could be passaged eight times and subsequently seized to proliferate, while wild-type cultures could be passaged only once and stopped proliferating after 3 days. This result suggested that only

cultures with two copies of MycERT kept proliferating, indicating that these cultures received the amount of transgene needed to induce proliferation constantly. It also shows that heterozygous cultures have limited proliferative potential and wild-type cells cannot be propagated at all. While the latter result was expected, the difference between homo- and heterozygous cultures indicated a gene dosage dependent effect. The experiments resulted in several independent cultures with cells homozygous for the MycERT allele giving rise to NC lines, each derived from an individual embryo. One line was named JoMa1 and analyzed further. Established cell lines may eventually acquire spontaneous mutations leading to transformation. Such an event would render the inducible system used no longer effective; the cells would loose their dependence on 4-OHT for proliferation. In order to test, whether inducibility would be changed due to mutations accumulating during cell culture, at passages 12, 18, 25, 36,

584

and 40 4-OHT was omitted and growth parameters were compared. Cells of all passages tested showed robust proliferation in presence of 4-OHT. When 4-OHT was withdrawn proliferation stopped analogous to results published earlier (Ja¨ger et al., 2004). This result showed that the cells had not accumulated changes affecting the c-MycERT inducible system.

MycERT protein is lost in the nucleus upon 4-OHT withdrawal A study by Mai and Garini (2005) could show nuclear localization of MycERT after 4-OHT mediated activation. This result suggested that the activity of MycERT is regulated in a 4-OHT dependent manner. Hence, nuclear and cytoplasmic protein extracts of JoMa1 cells were prepared to compare levels of MycERT with and without 4-OHT. With 4-OHT present, a strong band for MycERT could be identified in the nuclear fraction, upon withdrawal of 4-OHT, the amount of MycERTprotein in the nucleus declined rapidly and could not be detected after 5 days. Endogenous c-Myc is expressed in equal amounts at all timepoints analyzed (Fig. 1B), indicating that there is no feedback or compensation mechanism. MycERT-protein could not be detected in the cytoplasmic fraction at any time point (data not shown). Thus we could show that MycERT is present in the nucleus with 4-OHT in the culture medium and is lost from the nucleus upon 4-OHT withdrawal suggesting that in the presence of 4-OHT MycERT was stabilized and accumulated in the nucleus. When 4-OHT was omitted, MycERT was removed from the nucleus and presumably rapidly degraded, since there was no band in the cytosolic fraction detectable.

Myc-target CyclinD2 is down-regulated subsequentially Myc is described to exert its proliferative signal in part through up-regulation of CyclinD2, a gene necessary for cell-cycle progression (Perez-Roger et al., 1999). To analyze further if the inactivation of MycERT had an effect on CyclinD2 levels we performed Northern Blot analysis of RNA extracts from JoMa1 cells which were grown in the presence or absence of 4-OHT. As seen in Figure 1C Cyclin D2 was present in cells with 4-OHT, but was lost 5 days after removal of 4-OHT. This result is in strong correlation with MycERT half-life and suggests that CyclinD2 expression is regulated by 4-OHT-dependent MycERT (compare with Fig. 1B). Taken together, we provided proof of principle for the c-MycERT allele: the MycERT protein was detected in nuclei of JoMa1 cells in a 4-OHT dependent manner and its presence correlated with levels of a cognate myc-target, CyclinD2, an indicator for cell-cycle progression and proliferation.

JoMa1 cells express NCSC markers JoMa1 cells grew as monolayers, cells displayed a stellate like morphology, typical for NC cells (Rao and Anderson, 1997). As NCSCs have been described to express the markers p75 (low affinity nerve growth-factor receptor) (Stemple and Anderson, 1992) and Sox10 (Rao and Anderson, 1997; Paratore et al., 2001) we tested, whether the JoMa1 line would be positive for these markers using immunohistochemistry and RTPCR. As seen in Figure 2A (top) labeling of JoMa1 cells (passage 36) with antibodies against p75 and Sox10 revealed that the majority of the cells were double positive for both markers. Statistical analysis showed that 95% of the cells were double-positive for Sox10 and p75, 5% showed p75 staining alone and no cell stained singlepositive for Sox10. Earlier and later passages were investigated in the same way with similar results (data not shown). In order to further verify the NCSC nature of the JoMa1 cell line we performed RT-PCR using primers for p75, Sox10, and the hLh transcription factors slug and snail, markers known to be expressed in early NC cells (Nieto et al., 1994; Basch et al., 2000). A clear signal for p75, Sox10, slug, and a weaker for snail could be detected (Fig. 2A, bottom, upper panel). Further markers indicative for differentiated NCC (Mash-1, Nefh, gactin, Calponin, Tyrosinase, and Collagen2a1) could not be detected (Fig. 2A, bottom, lower panel). In vitro, several differentiation routines had been adopted to work for primary NC cells from rat, mouse, and chicken (Shah et al., 1994; Shah and Anderson, 1997; Lahav et al., 1998; Paratore et al., 2002). We tested the plasticity of the JoMa1 cell line subjecting it to conditions promoting the main derivatives of neural crest, that is, smooth muscle cells, glia, neurons, melanocytes, and chondrocytes.

TGFb induces smooth muscle differentiation in JoMa1 cell cultures TGFb was shown to induce NCSCs to acquire a smoothmuscle cell fate in culture (Shah et al., 1996). Therefore, by using culture conditions specific for smooth muscle differentiation TGFb was added to NCC medium on JoMa1 cells for 6 days. After 4 days, we observed changes in morphology like flattening and stretching of the cells and a day later fiber-like parallel structures in the cell matrix became apparent, morphological hallmarks of smooth muscle cells. After 6 days under differentiation conditions cells were fixed and stained with smoothmuscle actin antibody (SMA). SMA-positive staining could be shown in over 90% of the cells (Fig. 2B, top). In addition RT-PCR showed a strong expression of g-actin, a marker for smooth muscle differentiation (Chen and Lechleider, 2004) and a weaker expression of Calponin, a protein known to be abundantly expressed in smooth

585

B

A

Sn

ail

h1

s Ma

g

Slu

GA

tin

c fh Ne γ-a

PD

H

lp Ca

So

on

x1

0 p7

5

GA

PD

ctin

H

γ-a

H nin PD lpo GA Ca

e

as

in

sin

yro

T

1

l2a

Co

GA

PD

H

C

D

h Nef

So

Fig. 2 JoMa1 cells express neural crest stem cell markers and can be differentiated into various lineages. (A, top) Immunohistochemistry with p75 (Cy3) and Sox10 (fluorescein isothiocyanate [FITC]) on JoMa1 cells (p31). Colors of secondary antibodies are indicated. (A, bottom) reverse transcription-polymerase chain reaction (RTPCR) of RNA extracts of JoMa1 cells (passage 31). Expression of Snail, Slug, GAPDH, p75, and Sox10 shown as indicated. GAPDH control in Lane 6. Below, control-PCR shows no expression of indicated differentiation specific markers. Scale bar in (A) indicates 60 mm. (B, top) cells were treated with transforming growth factor-b (TGFb) for 6 consecutive days. Staining with SMA (smooth muscle actin, FITC) and NF145 (neurofilament 145 kD, Cy3). Cell nuclei are visualized by 4 0 , 6-diamidine-2 0 -phenylindole dihydrochloride (DAPI) staining. (B, bottom) RT-PCR of RNA extracts from differentiated JoMa1 cells: g-actin, Calponin and the correlating GAPDH expression is shown. Colors of secondary antibodies are indicated. Scale bar indicates 40 mm. (C, top) Cells were treated with BMP2 for 6 consecutive days. Differentiated JoMa1 cells were positive for NF145 antibody staining (neurofilament, Cy3). Colors

GA PD H

G

l2

F

x9

E

h-1 APDH G Mas

Co

se H ina PD ros y T GA

of secondary antibodies are indicated. (C, bottom) RT-PCR detected expression of Nefh (neurofilament triplet marker) and Mash1 (marker for autonomic neurons). GAPDH expression is shown. Scale bar in both micrographs indicates 30 mm. (D, top) JoMa1 cells under melanocyte differentiation conditions. Melanoblasts were visualized with DOPA-reaction (dark brown) and indicated by arrows in brightfield image. (D, bottom) Expression of tyrosinase and GAPDH. Scale bars represent 60 mm. (E, F) Cells were treated with glial growth factor for 6 consecutive days. Cells were stained with glial fibrillary acid protein (GFAP) antibody (E) or S100 antibody (F). Both antibodies were visualized by a FITC coupled secondary AB. DAPI staining revealed cell nuclei. Colors of secondary antibodies are indicated. Scale bars represent 40 mm (G, top) JoMa1 cells under chondrocyte differentiation conditions for 3 weeks. Cultures were paraffin-embedded and 10 mm sections were incubated with Collagen II antibody and nuclei were visualized with DAPI. Color of secondary antibody is indicated. (G, bottom) RNA extracts from chondrocyte cultures showed expression of Sox9, Collagen II and GAPDH in RT-PCR. Scale bars indicate 10 mm.

586

muscle cells (Fig. 2B, bottom). We concluded that JoMa1 cells are able to differentiate into smooth muscle cells in a TGFb dependent manner.

Neurogenesis can be induced in JoMa1 cell culture by BMP2 BMP2 was shown to instruct NC cells to differentiate mainly into the neuronal lineage (Shah et al., 1996; Hagedorn et al., 1999, 2000; Sommer, 2001). In BMP2 induced NCCs also up to 25% smooth muscle differentiation was found (Shah et al., 1994, 1996) It was shown by Hagedorn et al. that smooth muscle differentiation was occurring when cell density was low. Clusters of cells differentiated into autonomic neurons whereas single cells preferentially generated smooth muscle cells. We tested whether JoMa1 cell would acquire a neurogenic fate in the presence of BMP2 in the culture medium. After 2 days in culture cells with a bipolar shape, round-up appearance as well as more flattened look could be detected indicative for neuronal (bipolar) and smooth-muscle (flattened) differentiation. After 6 days in culture, clusters of NF145 (neurofilament 145 kD, a cytoskeletal protein expressed by both horizontal cells and ganglion cell axons) positive cells could be detected, surrounded by SMA-positive smooth muscle cells (Fig. 2C, top). Only in the spots where cells were confluent neuronal differentiation did occur. RNA of Nefh (neurofilament triplet marker) could be detected as well as Mash-1, a marker for autonomic neurons (Fig. 2C, bottom). JoMa1 cells therefore have the capacity to generate cells of the neuronal lineage and, as Mash-1 can be detected, at least autonomic neurons.

JoMa1 cells can be differentiated into glia and/or Schwann cells NCSCs can generate peripheral glia cells. Shah et al. (1994) could show that GGF restricts NCSCs to a glial fate. To determine if JoMa1 cells were able to differentiate into the glial lineage, cells were replated onto dishes coated with fibronectin and poly-D-lysin and fed with NC medium to which GGF was added. Conditions were kept stable for 6 consecutive days and cell morphology was assessed every day. After 4 days in culture the morphology of the cells began to change and cells became elongated and lined up in streams, a sign for glial differentiation. After 6 days cells were immunoassayed with glial fibrillary acid protein (GFAP) and S100 antibodies (Figs. 2E,2F). Virtually all cells in culture were positive for S100 (2F), a glial/Schwann cell marker and some cells were positive for GFAP (2E). We concluded from these experiments that JoMa1 cells differentiated into the glial lineage in the presence of GGF.

JoMa1 cells can be differentiated into melanocyte precursors As NC cell are known to generate almost all of the pigment cells of the body, we addressed the question whether JoMa1 cells have the capability to differentiate into melanoblasts and melanocytes. Lahav et al. (1996, 1998) drove NC cells into the melanocyte lineage by administration of Endothelin 3 to the cell culture. Using NCC medium supplemented with Endothelin 3 and FCS (10%), we differentiated cells over a period of 6–10 days. Differentiation was assessed by DOPA staining as well as RT-PCR using melanocyte specific markers. Several cells reacted positive as judged from DOPA reaction (Fig. 2D, top). To confirm this, RT-PCR, specific for tyrosinase, a protein expressed by melanoblasts and essential for pigmentation, was applied. As shown in Figure 2D (bottom), a signal for tyrosinase could be detected which, together with the DOPA reaction indicates that JoMa1 cells have the potential to produce melanocyte precursors. JoMa1 cells can be driven into the chondrocyte lineage Cells of the cranial NC are able to differentiate into chondrocytes. JoMa1 cells, derived from the trunk neural crest, should by definition not be able to produce chondrocytes. However, this view was challenged by McGonnell and Graham (2002) showing chondrocytic differentiation of trunk NC in aves. Mesenchymal stem cells, the progenitors of bone and cartilage, can be induced to differentiate using high-density cultures grown under hypoxic conditions. We applied this protocol on high-density, low-oxygen cultures of JoMa1 cells and checked for chondrocyte differentiation after 1, 2, and 3 weeks. H/E staining of sections showed that in some clusters, cells acquired chondrocyte morphology. Cells undergoing chondrogenic differentiation are known to express Sox9 early in differentiation and in later stages Collagen 2 (Sarkar et al., 2001; Petiot et al., 2002; Akiyama Ddagger et al., 2005). Hence, we subjected the specimen to immunohistochemistry and could show that Collagen2 was expressed in clusters of differentiated JoMa1 cells (Fig. 2G, top). RT-PCR revealed a strong signal for Collagen 2 and a weak but detectable Sox9 signal (Fig. 2G, bottom) suggesting, that these cells were mature chondrocytes. Clonally derived subline JoMa1.3 displays NCSC properties As JoMa1 was derived from a neural tube explant we were not able to exclude that even passage 42 JoMa1 cells might represent a mixture of multipotent NCSCs and restricted progenitors. Hence, a clonally derived subline (JoMa1.3) was established using a limited dilu-

587

B

A

C

nin ctin lpo β-a Ca

tin

c γ-a

Nefh

h-1 Mas

tin β-ac

E

D

G

F

P

tin

β-ac

e nas t Dc

osi

Tyr

Kit

ctin

β-a

I

GFA

9 Sox

H

Col2

in

t β-ac

I

Fig. 3 JoMa1.3 cells express neural crest stem cell markers and can be differentiated into various lineages. (A) Immunohistochemistry with p75 (Cy3) and Sox10 (fluorescein isothiocyanate [FITC]) on JoMa1.3 cells (p46). Colors of secondary antibodies are indicated. Scale bar indicates 20 mm (B, top) Cells were treated with transforming growth factor-b (TGFb) for 5 consecutive days. Staining with SMA (smooth muscle actin, FITC) and NF145 (neurofilament 145 kD, Cy3). Cell nuclei are visualized by 4 0 , 6-diamidine-2 0 phenylindole dihydrochloride (DAPI) staining. (B, bottom) reverse transcription-polymerase chain reaction (RT-PCR) of RNA extracts from differentiated JoMa1.3 cells: g-actin, Calponin and the correlating b-actin expression is shown. Colors of secondary antibodies are indicated. Scale bar indicates 40 mm. (C, top) Cells were treated with BMP2 for 6 consecutive days. Differentiated JoMa1 cells were positive for NF145 antibody staining (neurofilament, Cy3). Colors of secondary antibodies are indicated. (C, bottom) RT-PCR detected expression of Nefh (neurofilament triplet marker) and Mash-1 (marker for autonomic neurons). b-actin expression is shown. Scale bar in both micrographs indicates 40 mm. (D, E)

Cells were treated with glial growth factor (GGF) for 7 consecutive days. (D, top) Cells were stained with glial fibrillary acid protein (GFAP) antibody. (D, bottom) Cells differentiated with GGF express GFAP RNA. (E) Differentiation with GGF induces Schwann cells. Cells were coimmuno-stained with S100 and p75. Secondary antibodies were FITC and Cy3 coupled. DAPI staining revealed cell nuclei. Colors of secondary antibodies are indicated. Scale bars represent 20 mm. (F, top) JoMa1 cells under melanocyte differentiation conditions. Melanoblasts were visualized with DOPA-reaction (dark brown) and indicated by arrows in brightfield image. (D, bottom) Expression of tyrosinase, Dct, c-Kit, and b-actin. Scale bars represent 80 mm. (G, top) JoMa1 cells under chondrocyte differentiation conditions for 3 weeks. Cultures were paraffin-embedded and 10 mm sections were incubated with Collagen II antibody and nuclei were visualized with DAPI. Color of secondary antibody is indicated. (G, bottom) RNA extracts from chondrocyte cultures showed expression of Sox9, Collagen II, and GAPDH in RT-PCR. Scale bars indicate 10 mm.

tion protocol. JoMa1.3 cells showed p75 and Sox10 double-expression in 90% of the cells (Fig. 3A). Induction of smooth muscle differentiation by TGFb lead to a high-pure culture of cells expressing SMA (Fig. 3B, top) and g-actin and Calponin (Fig. 3B, bottom). JoMa1.3 could be differentiated into neurons using

BMP2. The differentiated cells expressed neurofilament marker NF145 (Fig. 3C, top) and Mash-1 and Nefh RNA (Fig. 3C, bottom). Using GGF JoMa1.3 cells could be differentiated into Glia and Schwann cells, the former were shown by detecting GFAP via immunohistochemistry (Fig. 3D, top) and RT-PCR (Fig. 3D,

588

A

results indicate that JoMa1.3 represents a NCSC culture with self-renewal and differentiation capabilities. With 4-OHT present differentiation of JoMa1 and Joma1.3 cells leads to enhanced cell death

B

Fig. 4 Concomitant addition of transforming growth factor-b (TGFb) and 4-OHT leads to enhanced cell death. Cells were fixated and stained after 2 days with NF145 (Cy3) and smooth muscle-actin (SMA) (fluorescent isothiocyanate) antibodies. Nuclei were visualized by 4 0 , 6-diamidine-2 0 -phenylindole dihydrochloride (DAPI). (A) Phase contrast micrograph. (B) Cells labeled with NF145 and SMA. Arrow in (A) and (B) indicates differentiating cell with abnormal morphology and incoherent staining typical for this condition. Colors of secondary antibodies are indicated. Scale bar indicates 80 mm.

Immortalized NC cell lines generated in mice had been obtained using a constitutively active v-myc (Rao and Anderson, 1997). There, cells could be differentiated albeit v-myc activity. On the other hand Jain et al., demonstrated that Myc expression promotes cellular proliferation and blocks cellular differentiation in osteosarcoma and hematopoietic tumors (Jain et al., 2002). Inactivation of Myc in these studies resulted in proliferative arrest and differentiation of tumor cells. When Myc was reactivated the tumor cells underwent apoptosis. So we addressed the question whether JoMa1 cultures are able to differentiate under both proliferation–stimulation and differentiation conditions. JoMa1 cells were fed media, which was supplemented with both, proliferation (4-OHT) and differentiation (TGFb) stimuli. Over the first 2 days enhanced cell death in the culture was observed. Remaining cells had a star-like appearance (Fig. 4A); some cells were positive for SMA, only staining the compact part of the cytoplasm not the cell protrusions (Fig. 4B). After 6 days in culture virtually no cells were left. This observation was quantified using AnnexinV-PE/ 7-AAD-FITC-staining. While cultures kept under 4-OHT-stimuli showed in 44% dead cells, adding both stimuli to the culture (4-OHT and TGFb) resulted in increased cell death (93% dead cells) after 5 days. Thus, we conclude that in contrast to observations published earlier using MONC-1 cells (Rao and Anderson, 1997), JoMa1 and JoMa1.3 cells were not able to comply with a proliferation signal like c-MycERT and a differentiation stimulus at the same time.

Discussion bottom), the latter were detected by immunohistochemistry. Cells double positive for S100 and p75 represent Schwann cells (Fig. 3E). JoMa1.3 cells could also be driven into the melanocyte lineage with Endothelin 3. DOPA-positive JoMa1.3 cells could be detected in the culture after 10 days (Fig. 3F, top). These cells expressed Tyrosinase, Dct and Kit, markers of the melanocytic lineage (Fig. 3F, bottom). The cells showed also chondrogenic potential. Using hypoxic culture methods for 21 days JoMa1.3 cells were shown to express Collagen2a1 in immunohistochemistry (Fig. 3G, top) as well as in RT-PCR (Fig. 3G, bottom). In addition, Sox9, a marker for early chondrogenesis, was detected via RT-PCR (Fig. 3G, bottom). Taken together these

We presented in this study new cell lines, named JoMa1 and JoMa1.3, derived from murine trunk neural crest. We could show that these lines, which carry two alleles of the MycERT transgene, kept their proliferative capacity over more than 42 passages dependent on MycERT activity. We demonstrated that inactivation of MycERT lead to loss of MycERT protein in the nucleus and subsequent downregulation of CyclinD2, through which part of the proliferation signal is exerted. Further, we could show that JoMa1 and JoMa1.3 cells express NCSC markers like p75, Sox10, Slug and snail, suggesting that these cell lines are NCSC lines. That notion was strengthened by a set of experiments showing that JoMa1 and Joma1.3 cells could be driven into the neuronal, glial, smooth muscle, melanocyte and

589

into the chondrocytic lineage. Finally, we showed that MycERT stimulus needs to be inactivated in order to differentiate JoMa1 and JoMa1.3 cells into their derivatives. With active MycERT differentiation stimuli lead to enhanced cell death. We have examined several passages in their response to the inducible c-MycERT and found the oncogene responsible for determining the proliferative state of the cells at all timepoints. We therefore see several advantages for JoMa1 and JoMa1.3 cells in comparison with the MONC-1 cells: JoMa1 and JoMa1.3 allow for more accurate studies of molecular and cellular processes as the transforming oncogene can be switched off and therefore can not interfere with other cues acting on the cells. Both lines display stem cell characteristics at all passages examined whereas from MONC-1 only early passages should be used due to instability of the stem cell phenotype in later passages (Rao and Anderson, 1997). In Xenopus Myc has been shown to act as an inducer for NC cells. It was expressed strongly in very early stages of NC induction as a consequence of activation of the Wnt signaling pathway (Bellmeyer et al., 2003). This study also showed that loss of Myc precedes the loss of Slug, thought to be the central mediator of early NC induction. Hence conditional overexpression of cMyc in the JoMa1 and JoMa1.3 cells might help maintaining them in an undifferentiated NCSC compartment in addition to a proliferative signal induced by the oncogene. In further experiments, we showed that JoMa1 and Joma1.3 cells could be instructed to adopt a specific fate by administration of extrinsic cues. We show that TGFb instructed JoMa1 and Joma1.3 cells to acquire mainly a smooth muscle cell fate, BMP2 drives the cells into neurogenesis and GGF drives both lines into the glial lineage as shown in earlier studies (Shah et al., 1994, 1996). Chondrogenesis was a long time attributed to the cranial NC only, because grafting experiments showed that trunk NC could not contribute to cranial skeletal elements (Le Douarin et al., 1977; Nakamura and Ayer-le Lievre, 1982). We showed in our experiments chondrocytic differentiation from a trunk NCSC line adopting a protocol utilized for mesenchymal stem cells. This finding is in agreement with data from aves (McGonnell and Graham, 2002). In addition, Ido and Ito demonstrated generation of chondrocytes from murine primary trunk NCCs in a FGF-dependent manner (Ido and Ito, 2006). Both studies used primary neural trunk explant cultures. This left the question whether the chondrocytes observed there were generated from a separate population of NC cells. The fact that the clonally derived JoMa1.3 cells are capable of chondrocytic differentiation strongly argues in favor of a common multipotent precursor hypothesis and against a separate unipotent precursor. Hence, our data strengthen the hypothesis that NC cells from all axial levels have sim-

ilar potential, but cell fate is usually controlled by environmental factors in the embryo. JoMa1 and Joma1.3 cells were subjected to conditions favoring melanocyte formation as demonstrated with primary NC cells (Reid et al., 1996; Wehrle-Haller et al., 2001; Takano et al., 2002). The markers for melanocytic differentiation DOPA, Dct, c-Kit and tyrosinase could be detected in JoMa1 and JoMa1.3 cultures, indicative of melanocyte formation. This study is the first to show immortalization of neural crest cells with an inducible MycERT. Rao and Anderson (1997) described a mouse NCSC line (MONC-1) in 1997. In MONC-1 cells, immortalization was achieved with a constant overexpression of v-myc. These cells could be differentiated into the neuronal, glial, and melanocyte lineage while v-myc was active. Our experiments indicated that proliferative stimulus via Myc and differentiation stimuli in parallel induce overt cell death. Our results were in agreement with data from Arvanitis and Felsher (2005). They showed that differentiating tumor cells undergo apoptosis upon c-Myc re-expression. JoMa1 and Joma1.3 cells bear the advantage of having an inducible oncogene, which, when ‘‘switched on’’ keeps the cells in a multipotent, proliferative state and when ‘‘switched off’’ allowing for differentiation events to occur. We could show in this study that JoMa1 and Joma1.3 cells maintain their differentiation potential at all passages examined, while MONC-1 cells are reported to acquire a certain differentiation resistance over time (Rao and Anderson, 1997). Therefore JoMa1 and JoMa1.3 cells might be the better choice for differentiation studies of the NC lineage. JoMa1 and 1.3 cell lines will allow for experiments further elucidating genetic programs governing NCSC biology. Future research will focus on transplantation studies with genetically engineered JoMa1 and 1.3 cells to determine the in vivo differentiation capacity. Using the protocol described here, derivation of new NCSC lines from mice harboring mutations affecting NC development (like AP2a, Schorle et al., 1996; Zhang et al., 1996; Msx1, Foerst-Potts and Sadler, 1997; or Delta, De Bellard et al., 2002) will provide further insight into NC cell biology and might help to unravel the signaling pathways involved in NC specification. To complete the set of future experiments, we want to compare JoMa1 and JoMa1.3 cells with deficient NC stem cells on genome and proteome level to look for new target genes involved in NC differentiation. Acknowledgments We thank Christiane Esch for technical assistance, reagents and critical comments on Immunohistochemistry performed for this manuscript; Michael Wegner for providing the Sox10 antibody; Financial Support: The work was funded by a Grant from the Deutsche Forschungsgemeinschaft awarded to H. S. (DFG # Scho 503/6 and DFG # Scho 503/7) and was supported by the Swiss National Science Foundation and National Center of Competence in Reserch ‘‘Neural Plasticity and Repair’’ (to L. S. and S. F.).

590

References Akiyama Ddagger, H., Kim Ddagger, J.E., Nakashima, K., Balmes, G., Iwai, N., Deng, J.M., Zhang, Z., Martin, J.F., Behringer, R.R., Nakamura, T. and de Crombrugghe, B. (2005) Osteo-chondroprogenitor cells are derived from Sox9 expressing precursors. Proc Natl Acad Sci USA 102:14665–14670. Anderson, D.J., Groves, A., Lo, L., Ma, Q., Rao, M., Shah, N.M. and Sommer, L. (1997) Cell lineage determination and the control of neuronal identity in the neural crest. Cold Spring Harb Symp Quant Biol 62:493–504. Arvanitis, C. and Felsher, D.W. (2005) Conditionally MYC: insights from novel transgenic models. Cancer Lett 226: 95–99. Baroffio, A., Dupin, E. and Le Douarin, N.M. (1988) Cloneforming ability and differentiation potential of migratory neural crest cells. Proc Natl Acad Sci USA 85:5325–5329. Basch, M.L., Selleck, M.A. and Bronner-Fraser, M. (2000) Timing and competence of neural crest formation. Dev Neurosci 22: 217–227. Bellmeyer, A., Krase, J., Lindgren, J. and LaBonne, C. (2003) The protooncogene c-myc is an essential regulator of neural crest formation in xenopus. Dev Cell 4:827–839. Bixby, S., Kruger, G.M., Mosher, J.T., Joseph, N.M. and Morrison, S.J. (2002) Cell-intrinsic differences between stem cells from different regions of the peripheral nervous system regulate the generation of neural diversity. Neuron 35:643–656. Bronner-Fraser, M. (1994) Neural crest cell formation and migration in the developing embryo. Faseb J 8:699–706. Bronner-Fraser, M. and Fraser, S. (1989) Developmental potential of avian trunk neural crest cells in situ. Neuron 3: 755–766. Bronner-Fraser, M. and Fraser, S.E. (1988) Cell lineage analysis reveals multipotency of some avian neural crest cells. Nature 335:161–164. Bronner-Fraser, M. and Fraser, S.E. (1991) Cell lineage analysis of the avian neural crest. Development (Suppl 2): 17–22. Chen, S. and Lechleider, R.J. (2004) Transforming growth factorbeta-induced differentiation of smooth muscle from a neural crest stem cell line. Circ Res 94:1195–1202. De Bellard, M.E., Ching, W., Gossler, A. and Bronner-Fraser, M. (2002) Disruption of segmental neural crest migration and ephrin expression in delta-1 null mice. Dev Biol 249:121–130. Dorsky, R.I., Moon, R.T. and Raible, D.W. (2000) Environmental signals and cell fate specification in premigratory neural crest. Bioessays 22:708–716. Dupin, E., Glavieux, C., Vaigot, P. and Le Douarin, N.M. (2000) Endothelin 3 induces the reversion of melanocytes to glia through a neural crest-derived glial-melanocytic progenitor. Proc Natl Acad Sci USA 97:7882–7887. Dupin, E., Real, C. and Ledouarin, N. (2001) The neural crest stem cells: control of neural crest cell fate and plasticity by endothelin3. An Acad Bras Cienc 73:533–545. Foerst-Potts, L. and Sadler, T.W. (1997) Disruption of Msx-1 and Msx-2 reveals roles for these genes in craniofacial, eye, and axial development. Dev Dyn 209:70–84. Hagedorn, L., Floris, J., Suter, U. and Sommer, L. (2000) Autonomic neurogenesis and apoptosis are alternative fates of progenitor cell communities induced by TGFbeta. Dev Biol 228: 57–72. Hagedorn, L., Suter, U. and Sommer, L. (1999) P0 and PMP22 mark a multipotent neural crest-derived cell type that displays community effects in response to TGF-beta family factors. Development 126:3781–3794. Hirobe, T. (1995) Structure and function of melanocytes: microscopic morphology and cell biology of mouse melanocytes in the epidermis and hair follicle. Histol Histopathol 10:223–237. Huszar, D., Sharpe, A. and Jaenisch, R. (1991) Migration and proliferation of cultured neural crest cells in W mutant neural crest chimeras. Development 112:131–141.

Ido, A. and Ito, K. (2006) Expression of chondrogenic potential of mouse trunk neural crest cells by FGF2 treatment. Dev Dyn 235:361–367. Ito, K., Morita, T. and Sieber-Blum, M. (1993) In vitro clonal analysis of mouse neural crest development. Dev Biol 157: 517–525. Ja¨ger, R., Maurer, J., Jacob, A. and Schorle, H. (2004) Cell typespecific conditional regulation of the c-myc proto-oncogene by combining Cre/loxP recombination and tamoxifen-mediated activation. Genesis 38:145–150. Jain, M., Arvanitis, C., Chu, K., Dewey, W., Leonhardt, E., Trinh, M., Sundberg, C.D., Bishop, J.M. and Felsher, D.W. (2002) Sustained loss of a neoplastic phenotype by brief inactivation of MYC. Science 297:102–104. Jain, M.K., Layne, M.D., Watanabe, M., Chin, M.T., Feinberg, M.W., Sibinga, N.E., Hsieh, C.M., Yet, S.F., Stemple, D.L. and Lee, M.E. (1998) In vitro system for differentiating pluripotent neural crest cells into smooth muscle cells. J Biol Chem 273:5993– 5996. Kim, J., Lo, L., Dormand, E. and Anderson, D.J. (2003) SOX10 maintains multipotency and inhibits neuronal differentiation of neural crest stem cells. Neuron 38:17–31. Kruger, G.M., Mosher, J.T., Bixby, S., Joseph, N., Iwashita, T. and Morrison, S.J. (2002) Neural crest stem cells persist in the adult gut but undergo changes in self-renewal, neuronal subtype potential, and factor responsiveness. Neuron 35:657–669. Lahav, R., Dupin, E., Lecoin, L., Glavieux, C., Champeval, D., Ziller, C. and Le Douarin, N.M. (1998) Endothelin 3 selectively promotes survival and proliferation of neural crest-derived glial and melanocytic precursors in vitro. Proc Natl Acad Sci USA 95:14214–14219. Lahav, R., Ziller, C., Dupin, E. and Le Douarin, N.M. (1996) Endothelin 3 promotes neural crest cell proliferation and mediates a vast increase in melanocyte number in culture. Proc Natl Acad Sci US 93:3892–3897. Le Douarin, N.M., Teillet, M.A. and Le Lievre, C. (1977) Influence of the tissue environment on the differentiation of neural crest cells. Soc Gen Physiol Ser 32:11–27. Lo, L. and Anderson, D.J. (1995) Postmigratory neural crest cells expressing c-RET display restricted developmental and proliferative capacities. Neuron 15:527–539. Mai, S. and Garini, Y. (2005) Oncogenic remodeling of the threedimensional organization of the interphase nucleus: c-Myc induces telomeric aggregates whose formation precedes chromosomal rearrangements. Cell Cycle 4:1327–1331. McGonnell, I.M. and Graham, A. (2002) Trunk neural crest has skeletogenic potential. Curr Biol 12:767–771. Morrison, S.J., White, P.M., Zock, C. and Anderson, D.J. (1999) Prospective identification, isolation by flow cytometry, and in vivo self-renewal of multipotent mammalian neural crest stem cells. Cell 96:737–749. Nakamura, H. and Ayer-le Lievre, C.S. (1982) Mesectodermal capabilities of the trunk neural crest of birds. J Embryol Exp Morphol 70:1–18. Nieto, M.A., Sargent, M.G., Wilkinson, D.G. and Cooke, J. (1994) Control of cell behavior during vertebrate development by Slug, a zinc finger gene. Science 264:835–839. Paratore, C., Goerich, D.E., Suter, U., Wegner, M. and Sommer, L. (2001) Survival and glial fate acquisition of neural crest cells are regulated by an interplay between the transcription factor Sox10 and extrinsic combinatorial signaling. Development 128:3949–3961. Paratore, C., Hagedorn, L., Floris, J., Hari, L., Kleber, M., Suter, U. and Sommer, L. (2002) Cell-intrinsic and cell-extrinsic cues regulating lineage decisions in multipotent neural crest-derived progenitor cells. Int J Dev Biol 46:193–200. Pelengaris, S., Littlewood, T., Khan, M., Elia, G. and Evan, G. (1999) Reversible activation of c-Myc in skin: induction of a complex neoplastic phenotype by a single oncogenic lesion. Mol Cell 3:565–577.

591 Perez-Roger, I., Kim, S.H., Griffiths, B., Sewing, A. and Land, H. (1999) Cyclins D1 and D2 mediate myc-induced proliferation via sequestration of p27(Kip1) and p21(Cip1). Embo J 18:5310–5320. Petiot, A., Ferretti, P., Copp, A.J. and Chan, C.T. (2002) Induction of chondrogenesis in neural crest cells by mutant fibroblast growth factor receptors. Dev Dyn 224:210–221. Rao, M.S. and Anderson, D.J. (1997) Immortalization and controlled in vitro differentiation of murine multipotent neural crest stem cells. J Neurobiol 32:722–746. Reid, K., Turnley, A.M., Maxwell, G.D., Kurihara, Y., Kurihara, H., Bartlett, P.F. and Murphy, M. (1996) Multiple roles for endothelin in melanocyte development: regulation of progenitor number and stimulation of differentiation. Development 122:3911–3919. Rudolph, B., Hueber, A.O. and Evan, G.I. (2000) Reversible activation of c-Myc in thymocytes enhances positive selection and induces proliferation and apoptosis in vitro. Oncogene 19:1891– 1900. Sarkar, S., Petiot, A., Copp, A., Ferretti, P. and Thorogood, P. (2001) FGF2 promotes skeletogenic differentiation of cranial neural crest cells. Development 128:2143–2152. Scherer, K., Schunke, M., Sellckau, R., Hassenpflug, J. and Kurz, B. (2004) The influence of oxygen and hydrostatic pressure on articular chondrocytes and adherent bone marrow cells in vitro. Biorheology 41:323–333. Schorle, H., Meier, P., Buchert, M., Jaenisch, R. and Mitchell, P.J. (1996) Transcription factor AP-2 essential for cranial closure and craniofacial development. Nature 381:235–238. Shah, N.M. and Anderson, D.J. (1997) Integration of multiple instructive cues by neural crest stem cells reveals cell-intrinsic biases in relative growth factor responsiveness. Proc Natl Acad Sci USA 94:11369–11374. Shah, N.M., Groves, A.K. and Anderson, D.J. (1996) Alternative neural crest cell fates are instructively promoted by TGFbeta superfamily members. Cell 85:331–343. Shah, N.M., Marchionni, M.A., Isaacs, I., Stroobant, P. and Anderson, D.J. (1994) Glial growth factor restricts mam-

malian neural crest stem cells to a glial fate. Cell 77:349– 360. Sieber-Blum, M. (2000) Factors controlling lineage specification in the neural crest. Int Rev Cytol 197:1–33. Sieber-Blum, M. and Cohen, A.M. (1980) Clonal analysis of quail neural crest cells: they are pluripotent and differentiate in vitro in the absence of noncrest cells. Dev Biol 80:96–106. Sommer, L. (2001) Context-dependent regulation of fate decisions in multipotent progenitor cells of the peripheral nervous system. Cell Tissue Res 305:211–216. Sommer, L., Shah, N., Rao, M. and Anderson, D.J. (1995) The cellular function of MASH1 in autonomic neurogenesis. Neuron 15:1245–1258. Stemple, D.L. and Anderson, D.J. (1992) Isolation of a stem cell for neurons and glia from the mammalian neural crest. Cell 71:973– 985. Takano, N., Kawakami, T., Kawa, Y., Asano, M., Watabe, H., Ito, M., Soma, Y., Kubota, Y. and Mizoguchi, M. (2002) Fibronectin combined with stem cell factor plays an important role in melanocyte proliferation, differentiation and migration in cultured mouse neural crest cells. Pigment Cell Res 15: 192–200. Trentin, A., Glavieux-Pardanaud, C., Le Douarin, N.M. and Dupin, E. (2004) Self-renewal capacity is a widespread property of various types of neural crest precursor cells. Proc Natl Acad Sci USA 101:4495–4500. Wehrle-Haller, B., Meller, M. and Weston, J.A. (2001) Analysis of melanocyte precursors in Nf1 mutants reveals that MGF/KIT signaling promotes directed cell migration independent of its function in cell survival. Dev Biol 232:471–483. Werling, U. and Schorle, H. (2002) Transcription factor gene AP-2 gamma essential for early murine development. Mol Cell Biol 22:3149–3156. Zhang, J., Hagopian-Donaldson, S., Serbedzija, G., Elsemore, J., Plehn-Dujowich, D., McMahon, A.P., Flavell, R.A. and Williams, T. (1996) Neural tube, skeletal and body wall defects in mice lacking transcription factor AP-2. Nature 381:238–241.